WorldWideScience

Sample records for dna element base

  1. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    Science.gov (United States)

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  2. Transposable Elements: No More 'Junk DNA'

    Directory of Open Access Journals (Sweden)

    Yun-Ji Kim

    2012-12-01

    Full Text Available Since the advent of whole-genome sequencing, transposable elements (TEs, just thought to be 'junk' DNA, have been noticed because of their numerous copies in various eukaryotic genomes. Many studies about TEs have been conducted to discover their functions in their host genomes. Based on the results of those studies, it has been generally accepted that they have a function to cause genomic and genetic variations. However, their infinite functions are not fully elucidated. Through various mechanisms, including de novo TE insertions, TE insertion-mediated deletions, and recombination events, they manipulate their host genomes. In this review, we focus on Alu, L1, human endogenous retrovirus, and short interspersed element/variable number of tandem repeats/Alu (SVA elements and discuss how they have affected primate genomes, especially the human and chimpanzee genomes, since their divergence.

  3. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    Energy Technology Data Exchange (ETDEWEB)

    Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

    2016-10-15

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  4. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    International Nuclear Information System (INIS)

    Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

    2016-01-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  5. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  6. Defining functional DNA elements in the human genome

    Science.gov (United States)

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  7. Radiation-induced changes in DNA methylation of repetitive elements in the mouse heart

    Energy Technology Data Exchange (ETDEWEB)

    Koturbash, Igor, E-mail: ikoturbash@uams.edu [Department of Environmental and Occupational Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Miousse, Isabelle R. [Department of Environmental and Occupational Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Sridharan, Vijayalakshmi [Division of Radiation Health, Department of Pharmaceutical Sciences, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne; Skinner, Charles M. [Department of Environmental and Occupational Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Melnyk, Stepan B.; Pavliv, Oleksandra [Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Surgical Service, Central Arkansas Veterans Healthcare System, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Departments of Basic Sciences and Radiation Medicine, Loma Linda University, Loma Linda, CA 92354 (United States); Boerma, Marjan [Division of Radiation Health, Department of Pharmaceutical Sciences, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2016-05-15

    Highlights: • Radiation-induced dynamic changes in cardiac DNA methylation were detected. • Early LINE-1 hypomethylation was followed by hypermethylation at a later time-point. • Radiation affected one-carbon metabolism in the heart tissue. • Irradiation resulted in accumulation of satellite DNA mRNA transcripts. - Abstract: DNA methylation is a key epigenetic mechanism, needed for proper control over the expression of genetic information and silencing of repetitive elements. Exposure to ionizing radiation, aside from its strong genotoxic potential, may also affect the methylation of DNA, within the repetitive elements, in particular. In this study, we exposed C57BL/6J male mice to low absorbed mean doses of two types of space radiation—proton (0.1 Gy, 150 MeV, dose rate 0.53 ± 0.08 Gy/min), and heavy iron ions ({sup 56}Fe) (0.5 Gy, 600 MeV/n, dose rate 0.38 ± 0.06 Gy/min). Radiation-induced changes in cardiac DNA methylation associated with repetitive elements were detected. Specifically, modest hypomethylation of retrotransposon LINE-1 was observed at day 7 after irradiation with either protons or {sup 56}Fe. This was followed by LINE-1, and other retrotransposons, ERV2 and SINE B1, as well as major satellite DNA hypermethylation at day 90 after irradiation with {sup 56}Fe. These changes in DNA methylation were accompanied by alterations in the expression of DNA methylation machinery and affected the one-carbon metabolism pathway. Furthermore, loss of transposable elements expression was detected in the cardiac tissue at the 90-day time-point, paralleled by substantial accumulation of mRNA transcripts, associated with major satellites. Given that the one-carbon metabolism pathway can be modulated by dietary modifications, these findings suggest a potential strategy for the mitigation and, possibly, prevention of the negative effects exerted by ionizing radiation on the cardiovascular system. Additionally, we show that the methylation status and

  8. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jason A Hilton

    Full Text Available Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision, up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption

  9. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Science.gov (United States)

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  10. DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Thanh Theresa Dinh

    2014-07-01

    Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

  11. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    2017-11-01

    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  12. DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

    OpenAIRE

    Antonio, May A. D.; Hillier, Sharon L.

    2003-01-01

    Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identifie...

  13. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  14. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  15. Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements.

    Science.gov (United States)

    Guérin, Frédéric; Arnaiz, Olivier; Boggetto, Nicole; Denby Wilkes, Cyril; Meyer, Eric; Sperling, Linda; Duharcourt, Sandra

    2017-04-26

    DNA elimination is developmentally programmed in a wide variety of eukaryotes, including unicellular ciliates, and leads to the generation of distinct germline and somatic genomes. The ciliate Paramecium tetraurelia harbors two types of nuclei with different functions and genome structures. The transcriptionally inactive micronucleus contains the complete germline genome, while the somatic macronucleus contains a reduced genome streamlined for gene expression. During development of the somatic macronucleus, the germline genome undergoes massive and reproducible DNA elimination events. Availability of both the somatic and germline genomes is essential to examine the genome changes that occur during programmed DNA elimination and ultimately decipher the mechanisms underlying the specific removal of germline-limited sequences. We developed a novel experimental approach that uses flow cell imaging and flow cytometry to sort subpopulations of nuclei to high purity. We sorted vegetative micronuclei and macronuclei during development of P. tetraurelia. We validated the method by flow cell imaging and by high throughput DNA sequencing. Our work establishes the proof of principle that developing somatic macronuclei can be sorted from a complex biological sample to high purity based on their size, shape and DNA content. This method enabled us to sequence, for the first time, the germline DNA from pure micronuclei and to identify novel transposable elements. Sequencing the germline DNA confirms that the Pgm domesticated transposase is required for the excision of all ~45,000 Internal Eliminated Sequences. Comparison of the germline DNA and unrearranged DNA obtained from PGM-silenced cells reveals that the latter does not provide a faithful representation of the germline genome. We developed a flow cytometry-based method to purify P. tetraurelia nuclei to high purity and provided quality control with flow cell imaging and high throughput DNA sequencing. We identified 61

  16. The contribution of alu elements to mutagenic DNA double-strand break repair.

    Science.gov (United States)

    Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

    2015-03-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  17. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    International Nuclear Information System (INIS)

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng

    2008-01-01

    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage

  18. Genome-wide survey of repetitive DNA elements in the button mushroom Agaricus bisporus

    NARCIS (Netherlands)

    Foulongne-Oriol, M.; Murat, C.; Castanera, R.; Ramírez, L.; Sonnenberg, A.S.M.

    2013-01-01

    Repetitive DNA elements are ubiquitous constituents of eukaryotic genomes. The biological roles of these repetitive elements, supposed to impact genome organization and evolution, are not completely elucidated yet. The availability of whole genome sequence offers the opportunity to draw a picture of

  19. Cell Type-Specific Chromatin Signatures Underline Regulatory DNA Elements in Human Induced Pluripotent Stem Cells and Somatic Cells.

    Science.gov (United States)

    Zhao, Ming-Tao; Shao, Ning-Yi; Hu, Shijun; Ma, Ning; Srinivasan, Rajini; Jahanbani, Fereshteh; Lee, Jaecheol; Zhang, Sophia L; Snyder, Michael P; Wu, Joseph C

    2017-11-10

    Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31 + CD144 + ), cardiac progenitor cells (Sca-1 + ), fibroblasts (DDR2 + ), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was identified with ubiquitous enhancer (H3K4me1) and promoter (H3K4me3) marks in all cell types, whereas class II was enriched with H3K4me1 and H3K4me3 in a cell type-specific manner. Both class I and class II regulatory elements exhibited stimulatory roles in nearby gene expression in a given cell type. However, class I promoters displayed more dominant regulatory effects on transcriptional abundance regardless of distal enhancers. Transcription factor network analysis indicated that human induced pluripotent stem cells and somatic cells from the heart selected their preferential regulatory elements to maintain cell type-specific gene expression. In addition, we validated the function of these enhancer elements in transgenic mouse embryos and human cells and identified a few enhancers that could possibly regulate the cardiac-specific gene expression. Given that a large number of genetic variants associated with human diseases are located in regulatory DNA elements, our study provides valuable resources for deciphering

  20. DNA detection on ultrahigh-density optical fiber-based nanoarrays.

    Science.gov (United States)

    Tam, Jenny M; Song, Linan; Walt, David R

    2009-04-15

    Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

  1. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  2. DNA-based watermarks using the DNA-Crypt algorithm

    Directory of Open Access Journals (Sweden)

    Barnekow Angelika

    2007-05-01

    Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  3. DNA-based watermarks using the DNA-Crypt algorithm.

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-05-29

    The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  4. DNA-based watermarks using the DNA-Crypt algorithm

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-01-01

    Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

  5. An 11bp region with stem formation potential is essential for de novo DNA methylation of the RPS element.

    Directory of Open Access Journals (Sweden)

    Matthew Gentry

    Full Text Available The initiation of DNA methylation in Arabidopsis is controlled by the RNA-directed DNA methylation (RdDM pathway that uses 24nt siRNAs to recruit de novo methyltransferase DRM2 to the target site. We previously described the REPETITIVE PETUNIA SEQUENCE (RPS fragment that acts as a hot spot for de novo methylation, for which it requires the cooperative activity of all three methyltransferases MET1, CMT3 and DRM2, but not the RdDM pathway. RPS contains two identical 11nt elements in inverted orientation, interrupted by a 18nt spacer, which resembles the features of a stemloop structure. The analysis of deletion/substitution derivatives of this region showed that deletion of one 11nt element RPS is sufficient to eliminate de novo methylation of RPS. In addition, deletion of a 10nt region directly adjacent to one of the 11nt elements, significantly reduced de novo methylation. When both 11nt regions were replaced by two 11nt elements with altered DNA sequence but unchanged inverted repeat homology, DNA methylation was not affected, indicating that de novo methylation was not targeted to a specific DNA sequence element. These data suggest that de novo DNA methylation is attracted by a secondary structure to which the two 11nt elements contribute, and that the adjacent 10nt region influences the stability of this structure. This resembles the recognition of structural features by DNA methyltransferases in animals and suggests that similar mechanisms exist in plants.

  6. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  7. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  8. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  9. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element.

    Science.gov (United States)

    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf

    2014-10-01

    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit.

  10. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element

    Science.gov (United States)

    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R.; Jauch, Ralf

    2014-01-01

    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6–DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939

  11. Principles of DNA architectonics: design of DNA-based nanoobjects

    International Nuclear Information System (INIS)

    Vinogradova, O A; Pyshnyi, D V

    2012-01-01

    The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

  12. Design and Test of an Oscillation-based System Architecture for DNA Sensor Arrays

    NARCIS (Netherlands)

    Liu, Hongyuan; Kerkhoff, Hans G.; Richardson, Andrew; Zhang, X.; Nouet, Pascal; Azais, Florence

    2005-01-01

    A DfT strategy for MEMS-based DNA sensors is investigated in this paper. Based on a fault-free and defect model developed for a single sensing element and the VHDL-AMS simulation results, it is implied that an oscillation-based interface might be a potential solution for both testing and read out of

  13. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  14. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    Directory of Open Access Journals (Sweden)

    Thomas Spaller

    Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  15. Feasibility of using DNA-immobilized nanocellulose-based immunoadsorbent for systemic lupus erythematosus plasmapheresis.

    Science.gov (United States)

    Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert

    2016-07-01

    The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.

    Science.gov (United States)

    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando

    2016-10-01

    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    Science.gov (United States)

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  18. Mutations in Cytosine-5 tRNA Methyltransferases Impact Mobile Element Expression and Genome Stability at Specific DNA Repeats

    Directory of Open Access Journals (Sweden)

    Bianca Genenncher

    2018-02-01

    Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.

  19. DNA-Based Applications in Nanobiotechnology

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2010-01-01

    Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

  20. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Metallic Nanostructures Based on DNA Nanoshapes

    Directory of Open Access Journals (Sweden)

    Boxuan Shen

    2016-08-01

    Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.

  2. Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases?

    Science.gov (United States)

    Lee, Andrea J; Wallace, Susan S

    2017-06-01

    The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules.

    Science.gov (United States)

    Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag

    2018-03-05

    The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  4. Processing of free radical damaged DNA bases

    International Nuclear Information System (INIS)

    Wallace, S.

    2003-01-01

    Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant

  5. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  6. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  7. Implementation options for DNA-based identification into ecological status assessment under the European Water Framework Directive.

    Science.gov (United States)

    Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn

    2018-07-01

    Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification

  8. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    International Nuclear Information System (INIS)

    Mahmood, T.; Rehman, M.; Aziz, E.

    2015-01-01

    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  9. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  10. Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

    Science.gov (United States)

    Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

    2018-06-01

    Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

  11. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  12. Ni(II) complexes of arginine Schiff-bases and its interaction with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Sallam, S.A., E-mail: shehabsallam@yahoo.com [Chemistry Department, Faculty of Science, Suez Canal University, Isamilia (Egypt); Abbas, A.M. [Chemistry Department, Faculty of Science, Suez Canal University, Isamilia (Egypt)

    2013-04-15

    Ni(II) complexes with Schiff-bases obtained by condensation of arginine with salicylaldehyde; 2,3-; 2,4-; 2,5-dihydroxybenzaldehyde and o-hydroxynaphthaldehyde have been synthesized using the template method in ethanol or ammonia media. They were characterized by elemental analyses, conductivity measurements, magnetic moment, UV, IR and {sup 1}H NMR spectra as well as thermal analysis (TG, DTG and DTA). The Schiff-bases are dibasic tridentate donors and the complexes have diamagnetic square planar and octahedral structures. The complexes decompose in three steps where kinetic and thermodynamic parameters of the decomposition steps were computed. The interactions of the formed complexes with FM-DNA were monitored by UV and fluorescence spectroscopy. -- Highlights: ► Arginine Schiff-bases and their nickel(II) complexes have been synthesized. ► Magnetic and spectral data show diamagnetic square planar and octahedral complexes. ► The complexes thermally decompose in three stages. Interaction with FM-DNA shows hyperchromism with blue shift.

  13. Ni(II) complexes of arginine Schiff-bases and its interaction with DNA

    International Nuclear Information System (INIS)

    Sallam, S.A.; Abbas, A.M.

    2013-01-01

    Ni(II) complexes with Schiff-bases obtained by condensation of arginine with salicylaldehyde; 2,3-; 2,4-; 2,5-dihydroxybenzaldehyde and o-hydroxynaphthaldehyde have been synthesized using the template method in ethanol or ammonia media. They were characterized by elemental analyses, conductivity measurements, magnetic moment, UV, IR and 1 H NMR spectra as well as thermal analysis (TG, DTG and DTA). The Schiff-bases are dibasic tridentate donors and the complexes have diamagnetic square planar and octahedral structures. The complexes decompose in three steps where kinetic and thermodynamic parameters of the decomposition steps were computed. The interactions of the formed complexes with FM-DNA were monitored by UV and fluorescence spectroscopy. -- Highlights: ► Arginine Schiff-bases and their nickel(II) complexes have been synthesized. ► Magnetic and spectral data show diamagnetic square planar and octahedral complexes. ► The complexes thermally decompose in three stages. Interaction with FM-DNA shows hyperchromism with blue shift

  14. DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

    Science.gov (United States)

    Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

    2017-12-15

    The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

  16. Charge transport through DNA based electronic barriers

    Science.gov (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  17. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  18. Alu Mobile Elements: From Junk DNA to Genomic Gems

    Directory of Open Access Journals (Sweden)

    Sami Dridi

    2012-01-01

    Full Text Available Alus, the short interspersed repeated sequences (SINEs, are retrotransposons that litter the human genomes and have long been considered junk DNA. However, recent findings that these mobile elements are transcribed, both as distinct RNA polymerase III transcripts and as a part of RNA polymerase II transcripts, suggest biological functions and refute the notion that Alus are biologically unimportant. Indeed, Alu RNAs have been shown to control mRNA processing at several levels, to have complex regulatory functions such as transcriptional repression and modulating alternative splicing and to cause a host of human genetic diseases. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity, which further indicates that these mobile retroelements are in fact genomic gems rather than genomic junks.

  19. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  20. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

    2008-01-01

    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  1. A single whole-body low dose X-irradiation does not affect L1, B1 and IAP repeat element DNA methylation longitudinally.

    Directory of Open Access Journals (Sweden)

    Michelle R Newman

    Full Text Available The low dose radioadaptive response has been shown to be protective against high doses of radiation as well as aging-induced genomic instability. We hypothesised that a single whole-body exposure of low dose radiation would induce a radioadaptive response thereby reducing or abrogating aging-related changes in repeat element DNA methylation in mice. Following sham or 10 mGy X-irradiation, serial peripheral blood sampling was performed and differences in Long Interspersed Nucleic Element 1 (L1, B1 and Intracisternal-A-Particle (IAP repeat element methylation between samples were assessed using high resolution melt analysis of PCR amplicons. By 420 days post-irradiation, neither radiation- or aging-related changes in the methylation of peripheral blood, spleen or liver L1, B1 and IAP elements were observed. Analysis of the spleen and liver tissues of cohorts of untreated aging mice showed that the 17-19 month age group exhibited higher repeat element methylation than younger or older mice, with no overall decline in methylation detected with age. This is the first temporal analysis of the effect of low dose radiation on repeat element methylation in mouse peripheral blood and the first to examine the long term effect of this dose on repeat element methylation in a radiosensitive tissue (spleen and a tissue fundamental to the aging process (liver. Our data indicate that the methylation of murine DNA repeat elements can fluctuate with age, but unlike human studies, do not demonstrate an overall aging-related decline. Furthermore, our results indicate that a low dose of ionising radiation does not induce detectable changes to murine repeat element DNA methylation in the tissues and at the time-points examined in this study. This radiation dose is relevant to human diagnostic radiation exposures and suggests that a dose of 10 mGy X-rays, unlike high dose radiation, does not cause significant short or long term changes to repeat element or global DNA

  2. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  3. Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination phenotypes

    International Nuclear Information System (INIS)

    Cole, G.M.; Mortimer, R.K.

    1989-01-01

    The Saccharomyces cerevisiae RAD54 gene is transcriptionally regulated by a broad spectrum of DNA-damaging agents. Induction of RAD54 by DNA-damaging agents is under positive control. Sequences responsible for DNA damage induction (the DRS element) lie within a 29-base-pair region from -99 to -70 from the most proximal transcription start site. This inducible promoter element is functionally separable from a poly(dA-dT) region immediately downstream which is required for constitutive expression. Deletions which eliminate induction of RAD54 transcription by DNA damage but do not affect constitutive expression have no effect on growth or survival of noninducible strains relative to wild-type strains in the presence of DNA-damaging agents. The DRS element is also not required for homothallic mating type switching, transcriptional induction of RAD54 during meiosis, meiotic recombination, or spontaneous or X-ray-induced mitotic recombination. We find no phenotype for a lack of induction of RAD54 message via the damage-inducible DRS, which raises significant questions about the physiology of DNA damage induction in S. cerevisiae

  4. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    International Nuclear Information System (INIS)

    Mao, Grace; Brody, James P.

    2007-01-01

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s -1 . We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase

  5. Interaction of a nodule specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin Ibc(3) 5' upstream region

    DEFF Research Database (Denmark)

    Jensen, Erik Østergaard; Marcker, Kjeld A; Schell, J

    1988-01-01

    Nuclear extracts from soybean nodules, leaves and roots were used to investigate protein-DNA interactions in the 5' upstream (promoter) region of the soybean leghaemoglobin lbc(3) gene. Two distinct regions were identified which strongly bind a nodule specific factor. A Bal31 deletion analysis......, but with different affinities. Elements 1 and 2 share a common motif, although their AT-rich DNA sequences differ. Element 2 is highly conserved at an analogous position in other soybean lb gene 5' upstream regions. Udgivelsesdato: 1988-May...

  6. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  8. Synthesis, structure, DNA/BSA binding and antibacterial studies of NNO tridentate Schiff base metal complexes

    Science.gov (United States)

    Sakthi, Marimuthu; Ramu, Andy

    2017-12-01

    A new salicylaldehyde derived 2,4-diiodo-6-((2-phenylaminoethylimino)methyl)phenol Schiff base(L) and its transition metal complexes of the type MLCl where, M = Cu(II), Ni(II), Co(II), Mn(II) and Zn(II) have been synthesized. The coordination mode of Schiff base holding NNO donor atoms with metal ions was well investigated by elemental analysis, ESI-mass as well as IR, UV-vis, CV and NMR spectral studies. The binding efficiency and mode of these complexes with biological macromolecules viz., herring sperm DNA (HS- DNA) and bovine serum albumin (BSA) have been explored through various spectroscopic techniques. The characteristic changes in absorption, emission and, circular dichroism spectra of the complexes with DNA indicate the noticeable interaction between them. From the all spectral information complexes could interact with DNA via non-intercalation mode of binding. The hyperchromisim in absorption band and hypochromisim in emission intensity of BSA with different complex concentrations shown significant information, and the binding affinity value has been predicted from Stern-Volmer plots. Further, all the complexes could cleave the circular plasmid pUC19 DNA efficiently by using an activator H2O2. The ligand and all metal(II) complexes showed good antibacterial activities. The molecular docking studies of the complexes with DNA were performed in order to make a comparison and conclusion with spectral technic results.

  9. A universal DNA-based protein detection system.

    Science.gov (United States)

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  10. DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.

    Science.gov (United States)

    Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao

    2016-01-13

    Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.

  11. Development of synthetic selfish elements based on modular nucleases in Drosophila melanogaster

    OpenAIRE

    Simoni, A; Siniscalchi, C; Chan, Y-S; Huen, DS; Russell, S; Windbichler, N; Crisanti, A

    2014-01-01

    Selfish genes are DNA elements that increase their rate of genetic transmission at the expense of other genes in the genome and can therefore quickly spread within a population. It has been suggested that selfish elements could be exploited to modify the genome of entire populations for medical and ecological applications. Here we report that transcription activator-like effector nuclease (TALEN) and zinc finger nuclease (ZFN) can be engineered into site-specific synthetic selfish elements (S...

  12. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  13. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)

    2017-10-20

    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  14. Reversible Modulation of DNA-Based Hydrogel Shapes by Internal Stress Interactions.

    Science.gov (United States)

    Hu, Yuwei; Kahn, Jason S; Guo, Weiwei; Huang, Fujian; Fadeev, Michael; Harries, Daniel; Willner, Itamar

    2016-12-14

    We present the assembly of asymmetric two-layer hybrid DNA-based hydrogels revealing stimuli-triggered reversibly modulated shape transitions. Asymmetric, linear hydrogels that include layer-selective switchable stimuli-responsive elements that control the hydrogel stiffness are designed. Trigger-induced stress in one of the layers results in the bending of the linear hybrid structure, thereby minimizing the elastic free energy of the systems. The removal of the stress by a counter-trigger restores the original linear bilayer hydrogel. The stiffness of the DNA hydrogel layers is controlled by thermal, pH (i-motif), K + ion/crown ether (G-quadruplexes), chemical (pH-doped polyaniline), or biocatalytic (glucose oxidase/urease) triggers. A theoretical model relating the experimental bending radius of curvatures of the hydrogels with the Young's moduli and geometrical parameters of the hydrogels is provided. Promising applications of shape-regulated stimuli-responsive asymmetric hydrogels include their use as valves, actuators, sensors, and drug delivery devices.

  15. Effect of DNA type on response of DNA biosensor for carcinogens

    Science.gov (United States)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  16. DNA-Accelerated Copper Catalysis of Friedel-Crafts Conjugate Addition/Enantioselective Protonation Reactions in Water

    NARCIS (Netherlands)

    García-Fernández, Almudena; Megens, Rik P.; Villarino, Lara; Roelfes, Gerard

    2016-01-01

    DNA-induced rate acceleration has been identified as one of the key elements for the success of the DNA-based catalysis concept. Here we report on a novel DNA-based catalytic Friedel-Crafts conjugate addition/enantioselective protonation reaction in water, which represents the first example of a

  17. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  18. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  19. Translation of LINE-1 DNA elements in vitro and in human cells

    International Nuclear Information System (INIS)

    Leibold, D.M.; Swergold, G.D.; Thayer, R.E.; Singer, M.F.; Fanning, T.G.; Dombroski, B.A.

    1990-01-01

    The LINE-1(L1) family of interspread DNA sequences found throughout the human genome (L1 Homo sapiens, L1Hs) includes active transposable elements. Current models for the mechanism of transposition involve reverse transcription of an RNA intermediate and utilization of element-encoded proteins. The authors report that an antiserum against the polypeptide encoded by the L1Hs 5' open reading frame (ORF1) detects, in human cells, an endogenous ORF1 protein as well as the ORG1 product of an appropriate transfecting recombinant vector. The endogenous polypeptide is most abundant in teratocarcinoma and choriocarcinoma cells, among those cell lines tested; it appears to be a single species of ∼38 kDa. In contrast, RNAs synthesized in vitro from cDNAs representing full-length, polyadenylylated cytoplasmic L1Hs RNA yield, upon in vitro translation, ORF1 products of slightly different sizes. This is consistent with the fact that the various cDNAs are different and represent transcription of different genomic L1Hs elements. In vitro studies additionally suggest that translation of ORF1 is initiated at the first AUG codon. Finally, in no case was an ORF1-ORF2 fusion protein detected

  20. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Science.gov (United States)

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  1. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Directory of Open Access Journals (Sweden)

    Md. Mahbubur Rahman

    2015-02-01

    Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  2. Development of synthetic selfish elements based on modular nucleases in Drosophila melanogaster.

    Science.gov (United States)

    Simoni, Alekos; Siniscalchi, Carla; Chan, Yuk-Sang; Huen, David S; Russell, Steven; Windbichler, Nikolai; Crisanti, Andrea

    2014-06-01

    Selfish genes are DNA elements that increase their rate of genetic transmission at the expense of other genes in the genome and can therefore quickly spread within a population. It has been suggested that selfish elements could be exploited to modify the genome of entire populations for medical and ecological applications. Here we report that transcription activator-like effector nuclease (TALEN) and zinc finger nuclease (ZFN) can be engineered into site-specific synthetic selfish elements (SSEs) and demonstrate their transmission of up to 70% in the Drosophila germline. We show here that SSEs can spread via DNA break-induced homologous recombination, a process known as 'homing' similar to that observed for homing endonuclease genes (HEGs), despite their fundamentally different modes of DNA binding and cleavage. We observed that TALEN and ZFN have a reduced capability of secondary homing compared to HEG as their repetitive structure had a negative effect on their genetic stability. The modular architecture of ZFNs and TALENs allows for the rapid design of novel SSEs against specific genomic sequences making them potentially suitable for the genetic engineering of wild-type populations of animals and plants, in applications such as gene replacement or population suppression of pest species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Recent progress on DNA based walkers.

    Science.gov (United States)

    Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun

    2015-08-01

    DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    Science.gov (United States)

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    Science.gov (United States)

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  6. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  7. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  8. Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.

    Science.gov (United States)

    Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K

    2014-11-01

    There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss

  9. DNA-based random number generation in security circuitry.

    Science.gov (United States)

    Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C

    2010-06-01

    DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.

  10. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    International Nuclear Information System (INIS)

    Perçin, Işık; Karakoç, Veyis; Akgöl, Sinan; Aksöz, Erol; Denizli, Adil

    2012-01-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m 2 /g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 μg/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 °C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: ► Magnetic nanoparticles have several advantages over conventional adsorbents. ► MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. ► pDNA adsorption amount was 154 mg/g. ► Fifty-fold capacity increase was obtained when compared to conventional matrices.

  11. A molecular-based fast method to determine the extent of DNA ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-20

    Jul 20, 2009 ... there is also little amount of cell samples required and it is applicable for most eukaryotic cells, ... pounds present in polluted air, soil or water (Gichner and ... head, the nuclear region and a tail which contains DNA ... elements.

  12. Transnuclear retrotransposition of the Tad element of Neurospora.

    OpenAIRE

    Kinsey, J A

    1993-01-01

    Tad is a LINE-like DNA element found in Neutrospora crassa. A Neurospora artificial intron based on the first intron of the am (glutamate dehydrogenase) gene was constructed and introduced, in the correct orientation, into a unique Nru I site in open reading frame 1 of an active Tad element, Tad1-1. Transformants containing the Tad element with the artificial intron were placed in forced heterokaryons with strains lacking Tad elements. Tad was shown to transpose between nuclei in these hetero...

  13. Mapping Base Modifications in DNA by Transverse-Current Sequencing

    Science.gov (United States)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2018-02-01

    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  14. The Foldback-like element Galileo belongs to the P superfamily of DNA transposons and is widespread within the Drosophila genus.

    Science.gov (United States)

    Marzo, Mar; Puig, Marta; Ruiz, Alfredo

    2008-02-26

    Galileo is the only transposable element (TE) known to have generated natural chromosomal inversions in the genus Drosophila. It was discovered in Drosophila buzzatii and classified as a Foldback-like element because of its long, internally repetitive, terminal inverted repeats (TIRs) and lack of coding capacity. Here, we characterized a seemingly complete copy of Galileo from the D. buzzatii genome. It is 5,406 bp long, possesses 1,229-bp TIRs, and encodes a 912-aa transposase similar to those of the Drosophila melanogaster 1360 (Hoppel) and P elements. We also searched the recently available genome sequences of 12 Drosophila species for elements similar to Dbuz\\Galileo by using bioinformatic tools. Galileo was found in six species (ananassae, willistoni, peudoobscura, persimilis, virilis, and mojavensis) from the two main lineages within the Drosophila genus. Our observations place Galileo within the P superfamily of cut-and-paste transposons and extend considerably its phylogenetic distribution. The interspecific distribution of Galileo indicates an ancient presence in the genus, but the phylogenetic tree built with the transposase amino acid sequences contrasts significantly with that of the species, indicating lineage sorting and/or horizontal transfer events. Our results also suggest that Foldback-like elements such as Galileo may evolve from DNA-based transposon ancestors by loss of the transposase gene and disproportionate elongation of TIRs.

  15. Impact of arsenic/phosphorus substitution on the intrinsic conformational properties of the phosphodiester backbone of DNA investigated using ab initio quantum mechanical calculations.

    Science.gov (United States)

    Denning, Elizabeth J; Mackerell, Alexander D

    2011-04-20

    Deoxyribonucleic acid (DNA) is composed of five major elements carbon, hydrogen, nitrogen, oxygen, and phosphorus. The substitution of any of these elements in DNA would be anticipated to have major biological implications. However, recent studies have suggested that the substitution of arsenic into DNA (As-DNA) in bacteria may be possible. To help evaluate this possibility, ab initio quantum mechanical calculations are used to show that arsenodiester and phosphodiester linkages have similar geometric and conformational properties. Based on these results, it is suggested that the As-DNA will have similar conformational properties to phosphorus-based DNA, including the maintenance of base stacking.

  16. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  17. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    Science.gov (United States)

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  18. Oxidative DNA base modifications as factors in carcinogenesis

    International Nuclear Information System (INIS)

    Olinski, R.; Jaruga, P.; Zastawny, T.H.

    1998-01-01

    Reactive oxygen species can cause extensive DNA modifications including modified bases. Some of the DNA base damage has been found to possess premutagenic properties. Therefore, if not repaired, it can contribute to carcinogenesis. We have found elevated amounts of modified bases in cancerous and precancerous tissues as compared with normal tissues. Most of the agents used in anticancer therapy are paradoxically responsible for induction of secondary malignancies and some of them may generate free radicals. The results of our experiments provide evidence that exposure of cancer patients to therapeutic doses of ionizing radiation and anticancer drugs cause base modifications in genomic DNA of lymphocytes. Some of these base damages could lead to mutagenesis in critical genes and ultimately to secondary cancers such as leukemias. This may point to an important role of oxidative base damage in cancer initiation. Alternatively, the increased level of the modified base products may contribute to genetic instability and metastatic potential of tumor cells. (author)

  19. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Fei Chen

    2003-01-01

    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  20. DNA nanotechnology for nanophotonic applications.

    Science.gov (United States)

    Samanta, Anirban; Banerjee, Saswata; Liu, Yan

    2015-02-14

    DNA nanotechnology has touched the epitome of miniaturization by integrating various nanometer size particles with nanometer precision. This enticing bottom-up approach has employed small DNA tiles, large multi-dimensional polymeric structures or more recently DNA origami to organize nanoparticles of different inorganic materials, small organic molecules or macro-biomolecules like proteins, and RNAs into fascinating patterns that are difficult to achieve by other conventional methods. Here, we are especially interested in the self-assembly of nanomaterials that are potentially attractive elements in the burgeoning field of nanophotonics. These materials include plasmonic nanoparticles, quantum dots, fluorescent organic dyes, etc. DNA based self-assembly allows excellent control over distance, orientation and stoichiometry of these nano-elements that helps to engineer intelligent systems that can potentially pave the path for future technology. Many outstanding structures have been fabricated that are capable of fine tuning optical properties, such as fluorescence intensity and lifetime modulation, enhancement of Raman scattering and emergence of circular dichroism responses. Within the limited scope of this review we have tried to give a glimpse of the development of this still nascent but highly promising field to its current status as well as the existing challenges before us.

  1. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  2. A nuclear DNA-based species determination and DNA quantification assay for common poultry species.

    Science.gov (United States)

    Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S

    2014-12-01

    DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.

  3. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    Energy Technology Data Exchange (ETDEWEB)

    Percin, Is Latin-Small-Letter-Dotless-I k [Department of Biology, Hacettepe University, Ankara (Turkey); Karakoc, Veyis [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey); Akgoel, Sinan [Department of Biochemistry, Ege University, Izmir (Turkey); Aksoez, Erol [Department of Biology, Hacettepe University, Ankara (Turkey); Denizli, Adil, E-mail: denizli@hacettepe.edu.tr [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey)

    2012-07-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m{sup 2}/g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 {mu}g/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 Degree-Sign C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: Black-Right-Pointing-Pointer Magnetic nanoparticles have several advantages over conventional adsorbents. Black-Right-Pointing-Pointer MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. Black-Right-Pointing-Pointer pDNA adsorption amount was 154 mg/g. Black-Right-Pointing-Pointer Fifty-fold capacity increase was obtained when compared to conventional matrices.

  4. A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

    Science.gov (United States)

    Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

    2015-01-01

    Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

  5. Ultraviolet enhancement of DNA base release by bleomycin

    International Nuclear Information System (INIS)

    Kakinuma, J.; Tanabe, M.; Orii, H.

    1984-01-01

    The effect of UV irradiation on base-releasing activity of bleomycin was studied on bleomycin A 2 -DNA reaction mixture in the presence of Fe(II) and 2-mercaptoethanol. This effect was measured by the release of free bases from calf thymus DNA with high-performance liquid chromatography. UV irradiation enhanced DNA base-releasing activity of bleomycin and simultaneously caused disappearance of fluorescence emission maximum at 355 nm assigned to bithiazole rings and increase in the intensity of a peak at 400 nm. UV irradiation at 295 nm, the UV absorption maximum of bleomycin, is the most effective in releasing free bases and in changing fluorescence emission patterns. From these results, we suggest that some alterations in the bithiazole group of bleomycin molecule were initiated by UV irradiation and contributed to increased base-releasing activity of bleomycin through a yet unexplained mechanism, presumably through bleomycin dimer formation. (orig.)

  6. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Nucleobase-Based Barbiturates: Their Protective Effect against DNA Damage Induced by Bleomycin-Iron, Antioxidant, and Lymphocyte Transformation Assay

    Directory of Open Access Journals (Sweden)

    Bhaveshkumar D. Dhorajiya

    2014-01-01

    Full Text Available A number of nucleobase-based barbiturates have been synthesized by combination of nucleic acid bases and heterocyclic amines and barbituric acid derivatives through green and efficient multicomponent route and one pot reaction. This approach was accomplished efficiently using aqueous medium to give the corresponding products in high yield. The newly synthesized compounds were characterized by spectral analysis (FT-IR, 1H NMR, 13C NMR, HMBC, and UV spectroscopy and elemental analysis. Representative of all synthesized compounds was tested and evaluated for antioxidant, bleomycin-dependent DNA damage, and Lymphocyte Transformation studies. Compounds TBC > TBA > TBG showed highest lymphocyte transformation assay, TBC > TBA > BG showed inhibitory antioxidant activity using ABTS methods, and TBC > BPA > BAMT > TBA > 1, 3-TBA manifested the best protective effect against DNA damage induced by bleomycin.

  8. Platinum(II Complexes with Tetradentate Schiff Bases as Ligands: Synthesis, Characterization and Detection of DNA Interaction by Differential Pulse Voltammetry

    Directory of Open Access Journals (Sweden)

    Lijun Li

    2012-01-01

    Full Text Available Five sterically hindered platinum(II complexes with tetradentate schiff bases as ligands, [Pt(L] (L= N,N′-bisalicylidene-1,2-ethylenediamine (L1, N,N′-bisalicylidene-1,2-cyclohexanediamine (L2, N,N′-bis(5-hydroxyl-salicylidene-1,2-cyclohexanediamine (L3, N,N′-bisalicylidene-1,2-diphenyl-ethylenediamine (L4 and N,N′-bis(3-tert-butyl-5-methyl-salicylidene-1,2-diphenylethylenediamine (L5 have been synthesized and characterized by IR spectroscopy and elemental analysis. The sterical hindrance of antitumor drug candidates potentially makes them less susceptible to deactivation by sulphur containing proteins and helping to overcome resistance mechanisms. The interaction of these metal complexes with fish sperm single-stranded DNA (ssDNA was studied electrochemically based on the oxidation signals of guanine and adenine. Differential pulse voltammetry was employed to monitor the DNA interaction in solution by using renewable pencil graphite electrode. The results indicate that ligands with different groups can strongly affect the interaction between [Pt(L] complexes and ssDNA due to sterical hindrances and complex [Pt(L1] has the best interaction with DNA among the five complexes.

  9. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  10. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  11. DNA Based Electrochromic and Photovoltaic Cells

    Science.gov (United States)

    2012-01-01

    using deoxyribonucleic acid complex as an electron blocking layer App. Phys. Lett. 88 (2006) 171109. 23. F.H.C. Crick , J.D. Watson . The complementary...9550-09-1-0647 final 01-09-2009 ; 30-11-2011 DNA Based Electrochromic and Photovoltaic Cells FA 9550-09-1-0647 Pawlicka, Agnieszka, J. Instituto de...Available. DNA is an abundant natural product with very good biodegradation properties and can be used to obtain gel polymer electrolytes (GPEs) with high

  12. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

    Science.gov (United States)

    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

    2010-04-01

    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  13. A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs

    International Nuclear Information System (INIS)

    Yang, Mengsi; Jin, Jianhua; Xu, Guiqing; Cui, Fengling; Luo, Hongxia

    2014-01-01

    Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process

  14. A Rewritable, Random-Access DNA-Based Storage System.

    Science.gov (United States)

    Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica

    2015-09-18

    We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.

  15. Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

    Directory of Open Access Journals (Sweden)

    Geoffrey R Bennett

    Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

  16. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element

    International Nuclear Information System (INIS)

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.

    2009-01-01

    Crystals of palindromic SBE DNA-bound Smad1 MH1 domain diffracting to 2.7 Å resolution have been obtained. The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit

  17. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  18. Communication: Electron ionization of DNA bases

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, M. A.; Krishnakumar, E., E-mail: ekkumar@tifr.res.in

    2016-04-28

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.

  19. DNA incision evaluation, binding investigation and biocidal screening of Cu(II), Ni(II) and Co(II) complexes with isoxazole Schiff bases.

    Science.gov (United States)

    Ganji, Nirmala; Chityala, Vijay Kumar; Marri, Pradeep Kumar; Aveli, Rambabu; Narendrula, Vamsikrishna; Daravath, Sreenu; Shivaraj

    2017-10-01

    Two new series of binary metal complexes [M(L 1 ) 2 ] and [M(L 2 ) 2 ] where, M=Cu(II), Ni(II) & Co(II) and L 1 =4-((3,4-dimethylisoxazol-5-ylimino)methyl)benzene-1,3-diol; L 2 =2-((3,4-dimethylisoxazol-5-ylimino)methyl)-5-methoxyphenol were synthesized and characterized by elemental analysis, 1 H NMR, 13 C NMR, FT-IR, ESI mass, UV-Visible, magnetic moment, ESR, SEM and powder XRD studies. Based on these results, a square planar geometry is assigned for all the metal complexes where the Schiff base acts as uninegatively charged bidentate chelating agent via the hydroxyl oxygen and azomethine nitrogen atoms. DNA binding studies of all the complexes with calf thymus DNA have been comprehensively investigated using electronic absorption spectroscopy, fluorescence quenching and viscosity studies. The oxidative and photo cleavage affinity of metal complexes towards supercoiled pBR322 DNA has been ascertained by agarose gel electrophoresis assay. From the results, it is observed that all the metal complexes bind effectively to CT-DNA via an intercalative mode of binding and also cleave pBR322 DNA in a promising manner. Further the Cu(II) complexes have shown better binding and cleavage properties towards DNA. The antimicrobial activities of the Schiff bases and their metal complexes were studied on bacterial and fungal strains and the results denoted that the complexes are more potent than their Schiff base ligands. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  1. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  2. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  3. PCR-based detection of a rare linear DNA in cell culture.

    Science.gov (United States)

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  4. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  5. Improved chaos-based video steganography using DNA alphabets

    Directory of Open Access Journals (Sweden)

    Nirmalya Kar

    2018-03-01

    Full Text Available DNA based steganography plays a vital role in the field of privacy and secure communication. Here, we propose a DNA properties-based mechanism to send data hidden inside a video file. Initially, the video file is converted into image frames. Random frames are then selected and data is hidden in these at random locations by using the Least Significant Bit substitution method. We analyze the proposed architecture in terms of peak signal-to-noise ratio as well as mean squared error measured between the original and steganographic files averaged over all video frames. The results show minimal degradation of the steganographic video file. Keywords: Chaotic map, DNA, Linear congruential generator, Video steganography, Least significant bit

  6. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element

    Science.gov (United States)

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R.

    2009-01-01

    The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 Å resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-­propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit. PMID:19923727

  7. Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

    Directory of Open Access Journals (Sweden)

    Giuseppe Concheri

    Full Text Available BACKGROUND: The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. METHODOLOGY/PRINCIPAL FINDINGS: The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS and optical emission spectrometry (ICP-OES approaches, and b amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA. CONCLUSIONS: Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

  8. DNA hybridization sensor based on pentacene thin film transistor.

    Science.gov (United States)

    Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang

    2011-01-15

    A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Triple-helix molecular switch-based aptasensors and DNA sensors.

    Science.gov (United States)

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. The current state of eukaryotic DNA base damage and repair.

    Science.gov (United States)

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-02

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Modified surface of titanium dioxide nanoparticles-based biosensor for DNA detection

    Science.gov (United States)

    Nadzirah, Sh.; Hashim, U.; Rusop, M.

    2018-05-01

    A new technique was used to develop a simple and selective picoammeter DNA biosensor for identification of E. coli O157:H7. This biosensor was fabricated from titanium dioxide nanoparticles that was synthesized by sol-gel method and spin-coated on silicon dioxide substrate via spinner. 3-Aminopropyl triethoxy silane (APTES) was used to modify the surface of TiO2. Simple surface modification approach has been applied; which is single dropping of APTES onto the TiO2 nanoparticles surface. Carboxyl modified probe DNA has been bind onto the surface of APTES/TiO2 without any amplifier element. Electrical signal has been used as the indicator to differentiate each step (surface modification of TiO2 and probe DNA immobilization). The I-V measurements indicate extremely low current (pico-ampere) flow through the device which is 2.8138E-10 A for pure TiO2 nanoparticles, 2.8124E-10 A after APTES modification and 3.5949E-10 A after probe DNA immobilization.

  12. High-speed DNA-based rolling motors powered by RNase H

    Science.gov (United States)

    Yehl, Kevin; Mugler, Andrew; Vivek, Skanda; Liu, Yang; Zhang, Yun; Fan, Mengzhen; Weeks, Eric R.

    2016-01-01

    DNA-based machines that walk by converting chemical energy into controlled motion could be of use in applications such as next generation sensors, drug delivery platforms, and biological computing. Despite their exquisite programmability, DNA-based walkers are, however, challenging to work with due to their low fidelity and slow rates (~1 nm/min). Here, we report DNA-based machines that roll rather than walk, and consequently have a maximum speed and processivity that is three-orders of magnitude greater than conventional DNA motors. The motors are made from DNA-coated spherical particles that hybridise to a surface modified with complementary RNA; motion is achieved through the addition of RNase H, which selectively hydrolyses hybridised RNA. Spherical motors move in a self-avoiding manner, whereas anisotropic particles, such as dimerised particles or rod-shaped particles travel linearly without a track or external force. Finally, we demonstrate detection of single nucleotide polymorphism by measuring particle displacement using a smartphone camera. PMID:26619152

  13. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  14. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  15. Thermal denaturation of A-DNA

    International Nuclear Information System (INIS)

    Valle-Orero, J; Wildes, A R; Theodorakopoulos, N; Cuesta-López, S; Peyrard, M; Garden, J-L; Danilkin, S

    2014-01-01

    The DNA molecule can take various conformational forms. Investigations focus mainly on the so-called ‘B-form’, schematically drawn in the famous paper by Watson and Crick [1]. This is the usual form of DNA in a biological environment and is the only form that is stable in an aqueous environment. Other forms, however, can teach us much about DNA. They have the same nucleotide base pairs for ‘building blocks’ as B-DNA, but with different relative positions, and studying these forms gives insight into the interactions between elements under conditions far from equilibrium in the B-form. Studying the thermal denaturation is particularly interesting because it provides a direct probe of those interactions which control the growth of the fluctuations when the ‘melting’ temperature is approached. Here we report such a study on the ‘A-form’ using calorimetry and neutron scattering. We show that it can be carried further than a similar study on B-DNA, requiring the improvement of thermodynamic models for DNA. (paper)

  16. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  17. Induced Polarization Influences the Fundamental Forces in DNA Base Flipping

    OpenAIRE

    Lemkul, Justin A.; Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base...

  18. Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

    Science.gov (United States)

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

    2014-02-01

    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

  19. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    Science.gov (United States)

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  20. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  1. A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis

    Science.gov (United States)

    Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan

    2009-01-01

    DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301

  2. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

    1991-01-01

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  3. Elements of Network-Based Assessment

    Science.gov (United States)

    Gibson, David

    2007-01-01

    Elements of network-based assessment systems are envisioned based on recent advances in knowledge and practice in learning theory, assessment design and delivery, and semantic web interoperability. The architecture takes advantage of the meditating role of technology as well as recent models of assessment systems. This overview of the elements…

  4. A comparison of 100 human genes using an alu element-based instability model.

    Science.gov (United States)

    Cook, George W; Konkel, Miriam K; Walker, Jerilyn A; Bourgeois, Matthew G; Fullerton, Mitchell L; Fussell, John T; Herbold, Heath D; Batzer, Mark A

    2013-01-01

    The human retrotransposon with the highest copy number is the Alu element. The human genome contains over one million Alu elements that collectively account for over ten percent of our DNA. Full-length Alu elements are randomly distributed throughout the genome in both forward and reverse orientations. However, full-length widely spaced Alu pairs having two Alus in the same (direct) orientation are statistically more prevalent than Alu pairs having two Alus in the opposite (inverted) orientation. The cause of this phenomenon is unknown. It has been hypothesized that this imbalance is the consequence of anomalous inverted Alu pair interactions. One proposed mechanism suggests that inverted Alu pairs can ectopically interact, exposing both ends of each Alu element making up the pair to a potential double-strand break, or "hit". This hypothesized "two-hit" (two double-strand breaks) potential per Alu element was used to develop a model for comparing the relative instabilities of human genes. The model incorporates both 1) the two-hit double-strand break potential of Alu elements and 2) the probability of exon-damaging deletions extending from these double-strand breaks. This model was used to compare the relative instabilities of 50 deletion-prone cancer genes and 50 randomly selected genes from the human genome. The output of the Alu element-based genomic instability model developed here is shown to coincide with the observed instability of deletion-prone cancer genes. The 50 cancer genes are collectively estimated to be 58% more unstable than the randomly chosen genes using this model. Seven of the deletion-prone cancer genes, ATM, BRCA1, FANCA, FANCD2, MSH2, NCOR1 and PBRM1, were among the most unstable 10% of the 100 genes analyzed. This algorithm may lay the foundation for comparing genetic risks posed by structural variations that are unique to specific individuals, families and people groups.

  5. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  6. Enhanced sensing of dengue virus DNA detection using O_2 plasma treated-silicon nanowire based electrical biosensor

    International Nuclear Information System (INIS)

    Rahman, S.F.A.; Yusof, N.A.; Hashim, U.; Hushiarian, R.; Nuzaihan, M.N.M.; Hamidon, M.N.; Zawawi, R.M.; Fathil, M.F.M.

    2016-01-01

    Dengue Virus (DENV) has become one of the most serious arthropod-borne viral diseases, causing death globally. The existing methods for DENV detection suffer from the late stage treatment due to antibodies-based detection which is feasible only after five days following the onset of the illness. Here, we demonstrated the highly effective molecular electronic based detection utilizing silicon nanowire (SiNW) integrated with standard complementary metal-oxide-semiconductor (CMOS) process as a sensing device for detecting deoxyribonucleic acid (DNA) related to DENV in an early stage diagnosis. To transform the fabricated devices as a functional sensing element, three-step procedure consist of SiNW surface modification, DNA immobilization and DNA hybridization were employed. The detection principle works by detecting the changes in current of SiNW which bridge the source and drain terminal to sense the immobilization of probe DNA and their hybridization with target DNA. The oxygen (O_2) plasma was proposed as an effective strategy for increasing the binding amounts of target DNA by modified the SiNW surface. It was found that the detection limit of the optimized O_2 plasma treated-SiNW device could be reduced to 1.985 × 10"−"1"4 M with a linear detection range of the sequence-specific DNA from 1.0 × 10"−"9 M to 1.0 × 10"−"1"3 M. In addition, the developed biosensor device was able to discriminate between complementary, single mismatch and non-complementary DNA sequences. This highly sensitive assay was then applied to the detection of reverse transcription-polymerase chain reaction (RT-PCR) product of DENV-DNA, making it as a potential method for disease diagnosis through electrical biosensor. - Highlights: • Molecular electronic detection of Dengue Virus (DENV) DNA using SiNW biosensor is presented. • Oxygen plasma surface treatment as an enhancer technique for device sensitivity is highlighted. • The limit of detection (LoD) as low as 1.985

  7. Recognition of base J in duplex DNA by J-binding protein

    NARCIS (Netherlands)

    Sabatini, Robert; Meeuwenoord, Nico; van Boom, Jacques H.; Borst, Piet

    2002-01-01

    beta-d-Glucosylhydroxymethyluracil, also called base J, is an unusual modified DNA base conserved among Kinetoplastida. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes. We have previously found a J-binding

  8. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Science.gov (United States)

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  9. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  10. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  11. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. DNA methylation based biomarkers: Practical considerations and applications

    DEFF Research Database (Denmark)

    Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg

    2012-01-01

    of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...

  13. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  14. Indicator Based and Indicator - Free Electrochemical DNA Biosensors

    National Research Council Canada - National Science Library

    Kerman, Kagan

    2001-01-01

    The utility and advantages of an indicator free and MB based sequence specific DNA hybridization biosensor based on guanine and adenine oxidation signals and MB reduction signals have been demonstrated...

  15. DNA-Based Self-Assembly of Fluorescent Nanodiamonds.

    Science.gov (United States)

    Zhang, Tao; Neumann, Andre; Lindlau, Jessica; Wu, Yuzhou; Pramanik, Goutam; Naydenov, Boris; Jelezko, Fedor; Schüder, Florian; Huber, Sebastian; Huber, Marinus; Stehr, Florian; Högele, Alexander; Weil, Tanja; Liedl, Tim

    2015-08-12

    As a step toward deterministic and scalable assembly of ordered spin arrays we here demonstrate a bottom-up approach to position fluorescent nanodiamonds (NDs) with nanometer precision on DNA origami structures. We have realized a reliable and broadly applicable surface modification strategy that results in DNA-functionalized and perfectly dispersed NDs that were then self-assembled in predefined geometries. With optical studies we show that the fluorescence properties of the nitrogen-vacancy color centers in NDs are preserved during surface modification and DNA assembly. As this method allows the nanoscale arrangement of fluorescent NDs together with other optically active components in complex geometries, applications based on self-assembled spin lattices or plasmon-enhanced spin sensors as well as improved fluorescent labeling for bioimaging could be envisioned.

  16. Electrochemical DNA biosensor based on grafting-to mode of terminal deoxynucleoside transferase-mediated extension.

    Science.gov (United States)

    Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua

    2017-12-15

    Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Slow elimination of injured liver DNA bases of γ-irradiated old mice

    International Nuclear Information System (INIS)

    Gaziev, A.I.; Malakhov, L.V.; Fomenko, L.A.

    1982-01-01

    The paper presents a study of the elimination of injured bases from the liver DNA of old and young mice after their exposure to γ rays. The presented data show that if DNA from the liver of irradiated mice is treated with incision enzymes, its priming activity is increased. In the case of enzymatic treatment of DNA isolated 5 h after irradiation we find a great difference between the priming activity of the liver DNA of old and young mice. The reason for this difference is that the liver DNA of 20-month old mice 5 h after irradiation still has many unrepaired injured bases. These data indicated that the rate of incision of γ-injured DNA bases in the liver of old mice is lower than in the liver of young mice. In the liver of mice of different age the rate of restitution of DNA, single-strand breaks induced by γ rays in doses up to 100 Gy is the same. At the same time, the level of induced reparative synthesis of DNA in cells of an old organism is lower than in cells of a young organism. The obtained data suggest that reduction of the rate of elimination of modified bases from the cell DNA of 20-month old mice is due to reduction of the activity of the DNA repair enzymes or to restrictions in the chromatin in the access of these enzymes to the injured regions of DNA in the cells of old animals

  18. DNA/RNA-based formulations for treatment of breast cancer.

    Science.gov (United States)

    Xie, Zhaolu; Zeng, Xianghui

    2017-12-01

    To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.

  19. DNA binding, cytotoxicity and apoptosis induction activity of a mixed-ligand copper(II) complex with taurine Schiff base and imidazole

    Science.gov (United States)

    Li, Mei; kong, Lin Lin; Gou, Yi; Yang, Feng; Liang, Hong

    2014-07-01

    A novel binuclear copper(II) complex (complex 1) with taurine Schiff base and imidazole has been synthesized and structurally characterized by single crystal X-ray diffraction, elemental analysis, ESI-MS spectrometry, UV-vis and IR spectroscopy. Single-crystal analysis revealed that 1 displays the sulfonate-bridged dinuclear copper(II) centers. Both copper atoms are five-coordinated and exhibit slightly distorted square pyramidal geometries. Each of copper atom is surrounded by three oxygen atoms and one nitrogen atom from different taurine Schiff base ligands, and one nitrogen atom from one imidazole ligand. The interaction between 1 and calf thymus DNA (CT-DNA) was investigated by UV-vis, fluorescence, circular dichroism (CD) spectra and agarose gel electrophoresis. The experimental results indicated that 1 could bind to CT-DNA via an intercalative mode and show efficient cleavage activity. In addition, 1 showed an antitumor effect on cell cycle and apoptosis. Flow cytometric analysis revealed that MGC-803 cells were arrested in the S phase after treatment with 1. Fluorescence microscopic observation indicated that 1 could induce apoptosis of MGC-803 cells.

  20. Centrifugal LabTube platform for fully automated DNA purification and LAMP amplification based on an integrated, low-cost heating system.

    Science.gov (United States)

    Hoehl, Melanie M; Weißert, Michael; Dannenberg, Arne; Nesch, Thomas; Paust, Nils; von Stetten, Felix; Zengerle, Roland; Slocum, Alexander H; Steigert, Juergen

    2014-06-01

    This paper introduces a disposable battery-driven heating system for loop-mediated isothermal DNA amplification (LAMP) inside a centrifugally-driven DNA purification platform (LabTube). We demonstrate LabTube-based fully automated DNA purification of as low as 100 cell-equivalents of verotoxin-producing Escherichia coli (VTEC) in water, milk and apple juice in a laboratory centrifuge, followed by integrated and automated LAMP amplification with a reduction of hands-on time from 45 to 1 min. The heating system consists of two parallel SMD thick film resistors and a NTC as heating and temperature sensing elements. They are driven by a 3 V battery and controlled by a microcontroller. The LAMP reagents are stored in the elution chamber and the amplification starts immediately after the eluate is purged into the chamber. The LabTube, including a microcontroller-based heating system, demonstrates contamination-free and automated sample-to-answer nucleic acid testing within a laboratory centrifuge. The heating system can be easily parallelized within one LabTube and it is deployable for a variety of heating and electrical applications.

  1. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  2. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  3. Transcription factor trapping by RNA in gene regulatory elements.

    Science.gov (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  4. Fractional Order Element Based Impedance Matching

    KAUST Repository

    Radwan, Ahmed Gomaa

    2014-06-24

    Disclosed are various embodiments of methods and systems related to fractional order element based impedance matching. In one embodiment, a method includes aligning a traditional Smith chart (|.alpha.|=1) with a fractional order Smith chart (|.alpha.|.noteq.1). A load impedance is located on the traditional Smith chart and projected onto the fractional order Smith chart. A fractional order matching element is determined by transitioning along a matching circle of the fractional order Smith chart based at least in part upon characteristic line impedance. In another embodiment, a system includes a fractional order impedance matching application executed in a computing device. The fractional order impedance matching application includes logic that obtains a first set of Smith chart coordinates at a first order, determines a second set of Smith chart coordinates at a second order, and determines a fractional order matching element from the second set of Smith chart coordinates.

  5. Synthesis and characterization of azo-guanidine based alcoholic media naked eye DNA sensor

    Science.gov (United States)

    Hashmat, Uzma; Yousaf, Muhammad; Lal, Bhajan; Ullah, Shafiq; Holder, Alvin A.; Badshah, Amin

    2016-01-01

    DNA sensing always has an open meadow of curiosity for biotechnologists and other researchers. Recently, in this field, we have introduced an emerging class of molecules containing azo and guanidine functionalities. In this study, we have synthesized three new compounds (UA1, UA6 and UA7) for potential application in DNA sensing in alcoholic medium. The synthesized materials were characterized by elemental analysis, FTIR, UV-visible, 1H NMR and 13C NMR spectroscopies. Their DNA sensing potential were investigated by UV-visible spectroscopy. The insight of interaction with DNA was further investigated by electrochemical (cyclic voltammetry) and hydrodynamic (viscosity) studies. The results showed that compounds have moderate DNA binding properties, with the binding constants range being 7.2 × 103, 2.4 × 103 and 0.2 × 103 M−1, for UA1, UA6 and UA7, respectively. Upon binding with DNA, there was a change in colour (a blue shift in the λmax value) which was observable with a naked eye. These results indicated the potential of synthesized compounds as DNA sensors with detection limit 1.8, 5.8 and 4.0 ng µl−1 for UA1, UA6 and UA7, respectively. PMID:28018613

  6. DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity

    NARCIS (Netherlands)

    Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard

    2008-01-01

    This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to

  7. Highly sensitive DNA sensors based on cerium oxide nanorods

    Science.gov (United States)

    Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh

    2018-04-01

    In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.

  8. Deep Investigation of Arabidopsis thaliana Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter

    Science.gov (United States)

    Maumus, Florian; Quesneville, Hadi

    2014-01-01

    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant. PMID:24709859

  9. Biosensor for label-free DNA quantification based on functionalized LPGs.

    Science.gov (United States)

    Gonçalves, Helena M R; Moreira, Luis; Pereira, Leonor; Jorge, Pedro; Gouveia, Carlos; Martins-Lopes, Paula; Fernandes, José R A

    2016-10-15

    A label-free fiber optic biosensor based on a long period grating (LPG) and a basic optical interrogation scheme using off the shelf components is used for the detection of in-situ DNA hybridization. A new methodology is proposed for the determination of the spectral position of the LPG mode resonance. The experimental limit of detection obtained for the DNA was 62±2nM and the limit of quantification was 209±7nM. The sample specificity was experimentally demonstrated using DNA targets with different base mismatches relatively to the probe and was found that the system has a single base mismatch selectivity. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. DNA Array-Based Gene Profiling

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario

    2005-01-01

    Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987

  11. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  12. Enhanced sensing of dengue virus DNA detection using O{sub 2} plasma treated-silicon nanowire based electrical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, S.F.A., E-mail: siti_fatimah0410@yahoo.com [Institute of Advanced Technology, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Yusof, N.A., E-mail: azahy@upm.edu.my [Institute of Advanced Technology, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Chemistry Department, Faculty of Science, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Hashim, U. [Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000, Kangar, Perlis (Malaysia); Hushiarian, R. [La Trobe Institute for Molecular Science, La Trobe University, Victoria, 3086 (Australia); Nuzaihan, M.N.M. [Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000, Kangar, Perlis (Malaysia); Hamidon, M.N. [Institute of Advanced Technology, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Zawawi, R.M. [Chemistry Department, Faculty of Science, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Fathil, M.F.M. [Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000, Kangar, Perlis (Malaysia)

    2016-10-26

    Dengue Virus (DENV) has become one of the most serious arthropod-borne viral diseases, causing death globally. The existing methods for DENV detection suffer from the late stage treatment due to antibodies-based detection which is feasible only after five days following the onset of the illness. Here, we demonstrated the highly effective molecular electronic based detection utilizing silicon nanowire (SiNW) integrated with standard complementary metal-oxide-semiconductor (CMOS) process as a sensing device for detecting deoxyribonucleic acid (DNA) related to DENV in an early stage diagnosis. To transform the fabricated devices as a functional sensing element, three-step procedure consist of SiNW surface modification, DNA immobilization and DNA hybridization were employed. The detection principle works by detecting the changes in current of SiNW which bridge the source and drain terminal to sense the immobilization of probe DNA and their hybridization with target DNA. The oxygen (O{sub 2}) plasma was proposed as an effective strategy for increasing the binding amounts of target DNA by modified the SiNW surface. It was found that the detection limit of the optimized O{sub 2} plasma treated-SiNW device could be reduced to 1.985 × 10{sup −14} M with a linear detection range of the sequence-specific DNA from 1.0 × 10{sup −9} M to 1.0 × 10{sup −13} M. In addition, the developed biosensor device was able to discriminate between complementary, single mismatch and non-complementary DNA sequences. This highly sensitive assay was then applied to the detection of reverse transcription-polymerase chain reaction (RT-PCR) product of DENV-DNA, making it as a potential method for disease diagnosis through electrical biosensor. - Highlights: • Molecular electronic detection of Dengue Virus (DENV) DNA using SiNW biosensor is presented. • Oxygen plasma surface treatment as an enhancer technique for device sensitivity is highlighted. • The limit of detection (Lo

  13. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    Science.gov (United States)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  14. Characterization of polymer, DNA-based, and silk thin film resistivities and of DNA-based films prepared for enhanced electrical conductivity

    Science.gov (United States)

    Yaney, Perry P.; Ouchen, Fahima; Grote, James G.

    2009-08-01

    DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.

  15. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    Science.gov (United States)

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  16. Finite-element modelling and preliminary validation of microneedle-based electrodes for enhanced tissue electroporation.

    Science.gov (United States)

    Houlihan, Ruth; Grygoryev, Konstantin; Zhenfei Ning; Williams, John; Moore, Tom; O'Mahony, Conor

    2017-07-01

    This paper investigates the use of microneedle-based electrodes for enhanced testis electroporation, with specific application to the production of transgenic mice. During the design phase, finite-element software has been used to construct a tissue model and to compare the relative performance of electrodes employing a) conventional flat plates, b) microneedle arrays, and c) invasive needles. Results indicate that microneedle-based electrodes can achieve internal tissue field strengths which are an order of magnitude higher than those generated using conventional flat electrodes, and which are comparable to fields produced using invasive needles. Using a double-sided etching process, conductive microneedle arrays were then fabricated and used in prototype electrodes. In a series of mouse model experiments involving injection of a DNA vector expressing Green Fluorescent Protein (GFP), the performance of flat and microneedle electrodes was compared by measuring GFP expression after electroporation. The main finding, supported by experimental and simulated data, is that use of microneedle-based electrodes significantly enhanced electroporation of testis.

  17. One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.

    Science.gov (United States)

    Ensslen, Philipp; Wagenknecht, Hans-Achim

    2015-10-20

    Light-harvesting complexes collect light energy and deliver it by a cascade of energy and electron transfer processes to the reaction center where charge separation leads to storage as chemical energy. The design of artificial light-harvesting assemblies faces enormous challenges because several antenna chromophores need to be kept in close proximity but self-quenching needs to be avoided. Double stranded DNA as a supramolecular scaffold plays a promising role due to its characteristic structural properties. Automated DNA synthesis allows incorporation of artificial chromophore-modified building blocks, and sequence design allows precise control of the distances and orientations between the chromophores. The helical twist between the chromophores, which is induced by the DNA framework, controls energy and electron transfer and thereby reduces the self-quenching that is typically observed in chromophore aggregates. This Account summarizes covalently multichromophore-modified DNA and describes how such multichromophore arrays were achieved by Watson-Crick-specific and DNA-templated self-assembly. The covalent DNA systems were prepared by incorporation of chromophores as DNA base substitutions (either as C-nucleosides or with acyclic linkers as substitutes for the 2'-deoxyribofuranoside) and as DNA base modifications. Studies with DNA base substitutions revealed that distances but more importantly relative orientations of the chromophores govern the energy transfer efficiencies and thereby the light-harvesting properties. With DNA base substitutions, duplex stabilization was faced and could be overcome, for instance, by zipper-like placement of the chromophores in both strands. For both principal structural approaches, DNA-based light-harvesting antenna could be realized. The major disadvantages, however, for covalent multichromophore DNA conjugates are the poor yields of synthesis and the solubility issues for oligonucleotides with more than 5-10 chromophore

  18. A refined element-based Lagrangian shell element for geometrically nonlinear analysis of shell structures

    Directory of Open Access Journals (Sweden)

    Woo-Young Jung

    2015-04-01

    Full Text Available For the solution of geometrically nonlinear analysis of plates and shells, the formulation of a nonlinear nine-node refined first-order shear deformable element-based Lagrangian shell element is presented. Natural co-ordinate-based higher order transverse shear strains are used in present shell element. Using the assumed natural strain method with proper interpolation functions, the present shell element generates neither membrane nor shear locking behavior even when full integration is used in the formulation. Furthermore, a refined first-order shear deformation theory for thin and thick shells, which results in parabolic through-thickness distribution of the transverse shear strains from the formulation based on the third-order shear deformation theory, is proposed. This formulation eliminates the need for shear correction factors in the first-order theory. To avoid difficulties resulting from large increments of the rotations, a scheme of attached reference system is used for the expression of rotations of shell normal. Numerical examples demonstrate that the present element behaves reasonably satisfactorily either for the linear or for geometrically nonlinear analysis of thin and thick plates and shells with large displacement but small strain. Especially, the nonlinear results of slit annular plates with various loads provided the benchmark to test the accuracy of related numerical solutions.

  19. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

    Science.gov (United States)

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-07-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

  20. DNA-based construction at the nanoscale: emerging trends and applications

    Science.gov (United States)

    Lourdu Xavier, P.; Chandrasekaran, Arun Richard

    2018-02-01

    The field of structural DNA nanotechnology has evolved remarkably—from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes—in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.

  1. Oxidatively-induced DNA damage and base excision repair in euthymic patients with bipolar disorder.

    Science.gov (United States)

    Ceylan, Deniz; Tuna, Gamze; Kirkali, Güldal; Tunca, Zeliha; Can, Güneş; Arat, Hidayet Ece; Kant, Melis; Dizdaroglu, Miral; Özerdem, Ayşegül

    2018-05-01

    Oxidatively-induced DNA damage has previously been associated with bipolar disorder. More recently, impairments in DNA repair mechanisms have also been reported. We aimed to investigate oxidatively-induced DNA lesions and expression of DNA glycosylases involved in base excision repair in euthymic patients with bipolar disorder compared to healthy individuals. DNA base lesions including both base and nucleoside modifications were measured using gas chromatography-tandem mass spectrometry and liquid chromatography-tandem mass spectrometry with isotope-dilution in DNA samples isolated from leukocytes of euthymic patients with bipolar disorder (n = 32) and healthy individuals (n = 51). The expression of DNA repair enzymes OGG1 and NEIL1 were measured using quantitative real-time polymerase chain reaction. The levels of malondialdehyde were measured using high performance liquid chromatography. Seven DNA base lesions in DNA of leukocytes of patients and healthy individuals were identified and quantified. Three of them had significantly elevated levels in bipolar patients when compared to healthy individuals. No elevation of lipid peroxidation marker malondialdehyde was observed. The level of OGG1 expression was significantly reduced in bipolar patients compared to healthy individuals, whereas the two groups exhibited similar levels of NEIL1 expression. Our results suggest that oxidatively-induced DNA damage occurs and base excision repair capacity may be decreased in bipolar patients when compared to healthy individuals. Measurement of oxidatively-induced DNA base lesions and the expression of DNA repair enzymes may be of great importance for large scale basic research and clinical studies of bipolar disorder. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  3. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  4. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  5. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  6. Opto-electronic DNA chip-based integrated card for clinical diagnostics.

    Science.gov (United States)

    Marchand, Gilles; Broyer, Patrick; Lanet, Véronique; Delattre, Cyril; Foucault, Frédéric; Menou, Lionel; Calvas, Bernard; Roller, Denis; Ginot, Frédéric; Campagnolo, Raymond; Mallard, Frédéric

    2008-02-01

    Clinical diagnostics is one of the most promising applications for microfluidic lab-on-a-chip or lab-on-card systems. DNA chips, which provide multiparametric data, are privileged tools for genomic analysis. However, automation of molecular biology protocol and use of these DNA chips in fully integrated systems remains a great challenge. Simplicity of chip and/or card/instrument interfaces is amongst the most critical issues to be addressed. Indeed, current detection systems for DNA chip reading are often complex, expensive, bulky and even limited in terms of sensitivity or accuracy. Furthermore, for liquid handling in the lab-on-cards, many devices use complex and bulky systems, either to directly manipulate fluids, or to ensure pneumatic or mechanical control of integrated valves. All these drawbacks prevent or limit the use of DNA-chip-based integrated systems, for point-of-care testing or as a routine diagnostics tool. We present here a DNA-chip-based protocol integration on a plastic card for clinical diagnostics applications including: (1) an opto-electronic DNA-chip, (2) fluid handling using electrically activated embedded pyrotechnic microvalves with closing/opening functions. We demonstrate both fluidic and electric packaging of the optoelectronic DNA chip without major alteration of its electronical and biological functionalities, and fluid control using novel electrically activable pyrotechnic microvalves. Finally, we suggest a complete design of a card dedicated to automation of a complex biological protocol with a fully electrical fluid handling and DNA chip reading.

  7. Long identical multispecies elements in plant and animal genomes.

    Science.gov (United States)

    Reneker, Jeff; Lyons, Eric; Conant, Gavin C; Pires, J Chris; Freeling, Michael; Shyu, Chi-Ren; Korkin, Dmitry

    2012-05-08

    Ultraconserved elements (UCEs) are DNA sequences that are 100% identical (no base substitutions, insertions, or deletions) and located in syntenic positions in at least two genomes. Although hundreds of UCEs have been found in animal genomes, little is known about the incidence of ultraconservation in plant genomes. Using an alignment-free information-retrieval approach, we have comprehensively identified all long identical multispecies elements (LIMEs), which include both syntenic and nonsyntenic regions, of at least 100 identical base pairs shared by at least two genomes. Among six animal genomes, we found the previously known syntenic UCEs as well as previously undescribed nonsyntenic elements. In contrast, among six plant genomes, we only found nonsyntenic LIMEs. LIMEs can also be classified as either simple (repetitive) or complex (nonrepetitive), they may occur in multiple copies in a genome, and they are often spread across multiple chromosomes. Although complex LIMEs were found in both animal and plant genomes, they differed significantly in their composition and copy number. Further analyses of plant LIMEs revealed their functional diversity, encompassing elements found near rRNA and enzyme-coding genes, as well as those found in transposons and noncoding DNA. We conclude that despite the common presence of LIMEs in both animal and plant lineages, the evolutionary processes involved in the creation and maintenance of these elements differ in the two groups and are likely attributable to several mechanisms, including transfer of genetic material from organellar to nuclear genomes, de novo sequence manufacturing, and purifying selection.

  8. Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

    Science.gov (United States)

    Szeverényi, I; Hodel, A; Arber, W; Olasz, F

    1996-09-26

    We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

  9. UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.

    Science.gov (United States)

    Baldock, Brandi L; Hutchison, James E

    2016-12-20

    DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.

  10. Trial watch: Naked and vectored DNA-based anticancer vaccines.

    Science.gov (United States)

    Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

    2015-05-01

    One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

  11. Synthesis, characterization, anti-microbial, DNA binding and cleavage studies of Schiff base metal complexes

    Directory of Open Access Journals (Sweden)

    Poomalai Jayaseelan

    2016-09-01

    Full Text Available A novel Schiff base ligand has been prepared by the condensation between butanedione monoxime with 3,3′-diaminobenzidine. The ligand and metal complexes have been characterized by elemental analysis, UV, IR, 1H NMR, conductivity measurements, EPR and magnetic studies. The molar conductance studies of Cu(II, Ni(II, Co(II and Mn(II complexes showed non-electrolyte in nature. The ligand acts as dibasic with two N4-tetradentate sites and can coordinate with two metal ions to form binuclear complexes. The spectroscopic data of metal complexes indicated that the metal ions are complexed with azomethine nitrogen and oxyimino nitrogen atoms. The binuclear metal complexes exhibit octahedral arrangements. DNA binding properties of copper(II metal complex have been investigated by electronic absorption spectroscopy. Results suggest that the copper(II complex bind to DNA via an intercalation binding mode. The nucleolytic cleavage activities of the ligand and their complexes were assayed on CT-DNA using gel electrophoresis in the presence and absence of H2O2. The ligand showed increased nuclease activity when administered as copper complex and copper(II complex behave as efficient chemical nucleases with hydrogen peroxide activation. The anti-microbial activities and thermal studies have also been studied. In anti-microbial activity all complexes showed good anti-microbial activity higher than ligand against gram positive, gram negative bacteria and fungi.

  12. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  14. A comparison of 100 human genes using an alu element-based instability model.

    Directory of Open Access Journals (Sweden)

    George W Cook

    Full Text Available The human retrotransposon with the highest copy number is the Alu element. The human genome contains over one million Alu elements that collectively account for over ten percent of our DNA. Full-length Alu elements are randomly distributed throughout the genome in both forward and reverse orientations. However, full-length widely spaced Alu pairs having two Alus in the same (direct orientation are statistically more prevalent than Alu pairs having two Alus in the opposite (inverted orientation. The cause of this phenomenon is unknown. It has been hypothesized that this imbalance is the consequence of anomalous inverted Alu pair interactions. One proposed mechanism suggests that inverted Alu pairs can ectopically interact, exposing both ends of each Alu element making up the pair to a potential double-strand break, or "hit". This hypothesized "two-hit" (two double-strand breaks potential per Alu element was used to develop a model for comparing the relative instabilities of human genes. The model incorporates both 1 the two-hit double-strand break potential of Alu elements and 2 the probability of exon-damaging deletions extending from these double-strand breaks. This model was used to compare the relative instabilities of 50 deletion-prone cancer genes and 50 randomly selected genes from the human genome. The output of the Alu element-based genomic instability model developed here is shown to coincide with the observed instability of deletion-prone cancer genes. The 50 cancer genes are collectively estimated to be 58% more unstable than the randomly chosen genes using this model. Seven of the deletion-prone cancer genes, ATM, BRCA1, FANCA, FANCD2, MSH2, NCOR1 and PBRM1, were among the most unstable 10% of the 100 genes analyzed. This algorithm may lay the foundation for comparing genetic risks posed by structural variations that are unique to specific individuals, families and people groups.

  15. Application of DNA-based methods in forensic entomology.

    Science.gov (United States)

    Wells, Jeffrey D; Stevens, Jamie R

    2008-01-01

    A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.

  16. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  17. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  18. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2015-01-01

    Full Text Available Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved.

  19. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  20. A DNA-based semantic fusion model for remote sensing data.

    Directory of Open Access Journals (Sweden)

    Heng Sun

    Full Text Available Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  1. A DNA-based semantic fusion model for remote sensing data.

    Science.gov (United States)

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  2. Radiation chemistry of the base components of DNA and related substances

    International Nuclear Information System (INIS)

    Teoule, R.

    1979-01-01

    The loss of UV absorption may be considered as a useful index to evaluate the extent of base destruction. The variations observed reflect the sum of different phenomena: the modification of base stacking, hydrogen bond rupture between DNA bases and the saturation of conjugated double bonds of heterocycles. Another way to measure the base degradation is by formic acid hydrolysis. Radiation products are very sensitive to the formic acid hydrolysis performed at 180 deg C. In aerated solutions, an important event responsible for the degradation of pyrimidine bases is the formation of hydroperoxide. This review consists of the following subheadings: identification of the DNA base damages; thymine fragment in aerated solutions and in deaerated solutions; adenine fragment; and cytosine fragment. The review concludes with the remarks: one has to be very cautious in the extrapolation of the results obtained by the gamma irradiation of free bases in solution to DNA. Free bases are liberated but no nucleoside during irradiation. (Yamashita, S.)

  3. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas

    2012-06-06

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  4. A new strain based brick element for plate bending

    Directory of Open Access Journals (Sweden)

    L. Belounar

    2014-03-01

    Full Text Available This paper presents the development of a new three-dimensional brick finite element by the use of the strain based approach for the linear analysis of plate bending. The developed element has the three essential external degrees of freedom (U, V and W at each of the eight corner nodes as well as at the centroidal node. The displacement field of the developed element is based on assumed functions for the various strains satisfying the compatibility equations and the static condensation technique is used for the internal node. The performance of this element is evaluated on several problems related to thick and thin plate bending in linear analysis. The obtained results show the good performances and accuracy of the present element.

  5. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    Science.gov (United States)

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Comparison of Subset-Based Local and Finite Element-Based Global Digital Image Correlation

    KAUST Repository

    Pan, Bing; Wang, B.; Lubineau, Gilles; Moussawi, Ali

    2015-01-01

    Digital image correlation (DIC) techniques require an image matching algorithm to register the same physical points represented in different images. Subset-based local DIC and finite element-based (FE-based) global DIC are the two primary image matching methods that have been extensively investigated and regularly used in the field of experimental mechanics. Due to its straightforward implementation and high efficiency, subset-based local DIC has been used in almost all commercial DIC packages. However, it is argued by some researchers that FE-based global DIC offers better accuracy because of the enforced continuity between element nodes. We propose a detailed performance comparison between these different DIC algorithms both in terms of measurement accuracy and computational efficiency. Then, by measuring displacements of the same calculation points using the same calculation algorithms (e.g., correlation criterion, initial guess estimation, subpixel interpolation, optimization algorithm and convergence conditions) and identical calculation parameters (e.g., subset or element size), the performances of subset-based local DIC and two FE-based global DIC approaches are carefully compared in terms of measurement error and computational efficiency using both numerical tests and real experiments. A detailed examination of the experimental results reveals that, when subset (element) size is not very small and the local deformation within a subset (element) can be well approximated by the shape function used, standard subset-based local DIC approach not only provides better results in measured displacements, but also demonstrates much higher computation efficiency. However, several special merits of FE-based global DIC approaches are indicated.

  7. Comparison of Subset-Based Local and Finite Element-Based Global Digital Image Correlation

    KAUST Repository

    Pan, Bing

    2015-02-12

    Digital image correlation (DIC) techniques require an image matching algorithm to register the same physical points represented in different images. Subset-based local DIC and finite element-based (FE-based) global DIC are the two primary image matching methods that have been extensively investigated and regularly used in the field of experimental mechanics. Due to its straightforward implementation and high efficiency, subset-based local DIC has been used in almost all commercial DIC packages. However, it is argued by some researchers that FE-based global DIC offers better accuracy because of the enforced continuity between element nodes. We propose a detailed performance comparison between these different DIC algorithms both in terms of measurement accuracy and computational efficiency. Then, by measuring displacements of the same calculation points using the same calculation algorithms (e.g., correlation criterion, initial guess estimation, subpixel interpolation, optimization algorithm and convergence conditions) and identical calculation parameters (e.g., subset or element size), the performances of subset-based local DIC and two FE-based global DIC approaches are carefully compared in terms of measurement error and computational efficiency using both numerical tests and real experiments. A detailed examination of the experimental results reveals that, when subset (element) size is not very small and the local deformation within a subset (element) can be well approximated by the shape function used, standard subset-based local DIC approach not only provides better results in measured displacements, but also demonstrates much higher computation efficiency. However, several special merits of FE-based global DIC approaches are indicated.

  8. The use of gold nanoparticle aggregation for DNA computing and logic-based biomolecular detection

    International Nuclear Information System (INIS)

    Lee, In-Hee; Yang, Kyung-Ae; Zhang, Byoung-Tak; Lee, Ji-Hoon; Park, Ji-Yoon; Chai, Young Gyu; Lee, Jae-Hoon

    2008-01-01

    The use of DNA molecules as a physical computational material has attracted much interest, especially in the area of DNA computing. DNAs are also useful for logical control and analysis of biological systems if efficient visualization methods are available. Here we present a quick and simple visualization technique that displays the results of the DNA computing process based on a colorimetric change induced by gold nanoparticle aggregation, and we apply it to the logic-based detection of biomolecules. Our results demonstrate its effectiveness in both DNA-based logical computation and logic-based biomolecular detection

  9. Topology optimization for three-dimensional electromagnetic waves using an edge element-based finite-element method.

    Science.gov (United States)

    Deng, Yongbo; Korvink, Jan G

    2016-05-01

    This paper develops a topology optimization procedure for three-dimensional electromagnetic waves with an edge element-based finite-element method. In contrast to the two-dimensional case, three-dimensional electromagnetic waves must include an additional divergence-free condition for the field variables. The edge element-based finite-element method is used to both discretize the wave equations and enforce the divergence-free condition. For wave propagation described in terms of the magnetic field in the widely used class of non-magnetic materials, the divergence-free condition is imposed on the magnetic field. This naturally leads to a nodal topology optimization method. When wave propagation is described using the electric field, the divergence-free condition must be imposed on the electric displacement. In this case, the material in the design domain is assumed to be piecewise homogeneous to impose the divergence-free condition on the electric field. This results in an element-wise topology optimization algorithm. The topology optimization problems are regularized using a Helmholtz filter and a threshold projection method and are analysed using a continuous adjoint method. In order to ensure the applicability of the filter in the element-wise topology optimization version, a regularization method is presented to project the nodal into an element-wise physical density variable.

  10. Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

    Science.gov (United States)

    Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

    2012-02-01

    We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

  11. Optimization of DNA Sensor Model Based Nanostructured Graphene Using Particle Swarm Optimization Technique

    Directory of Open Access Journals (Sweden)

    Hediyeh Karimi

    2013-01-01

    Full Text Available It has been predicted that the nanomaterials of graphene will be among the candidate materials for postsilicon electronics due to their astonishing properties such as high carrier mobility, thermal conductivity, and biocompatibility. Graphene is a semimetal zero gap nanomaterial with demonstrated ability to be employed as an excellent candidate for DNA sensing. Graphene-based DNA sensors have been used to detect the DNA adsorption to examine a DNA concentration in an analyte solution. In particular, there is an essential need for developing the cost-effective DNA sensors holding the fact that it is suitable for the diagnosis of genetic or pathogenic diseases. In this paper, particle swarm optimization technique is employed to optimize the analytical model of a graphene-based DNA sensor which is used for electrical detection of DNA molecules. The results are reported for 5 different concentrations, covering a range from 0.01 nM to 500 nM. The comparison of the optimized model with the experimental data shows an accuracy of more than 95% which verifies that the optimized model is reliable for being used in any application of the graphene-based DNA sensor.

  12. Crystallographic study of one turn of G/C-rich B-DNA.

    Science.gov (United States)

    Heinemann, U; Alings, C

    1989-11-20

    The DNA decamer d(CCAGGCCTGG) has been studied by X-ray crystallography. At a nominal resolution of 1.6 A, the structure was refined to R = 16.9% using stereochemical restraints. The oligodeoxyribonucleotide forms a straight B-DNA double helix with crystallographic dyad symmetry and ten base-pairs per turn. In the crystal lattice, DNA fragments stack end-to-end along the c-axis to form continuous double helices. The overall helical structure and, notably, the groove dimensions of the decamer are more similar to standard, fiber diffraction-determined B-DNA than A-tract DNA. A unique stacking geometry is observed at the CA/TG base-pair step, where an increased rotation about the helix axis and a sliding motion of the base-pairs along their long axes leads to a superposition of the base rings with neighboring carbonyl and amino functions. Three-center (bifurcated) hydrogen bonds are possible at the CC/GG base-pair steps of the decamer. In their common sequence elements, d(CCAGGCCTGG) and the related G.A mismatch decamer d(CCAAGATTGG) show very similar three-dimensional structures, except that d(CCAGGCCTGG) appears to have a less regularly hydrated minor groove. The paucity of minor groove hydration in the center of the decamer may be a general feature of G/C-rich DNA and explain its relative instability in the B-form of DNA.

  13. Identification of a Single Strand Origin of Replication in the Integrative and Conjugative Element ICEBs1 of Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Laurel D Wright

    2015-10-01

    Full Text Available We identified a functional single strand origin of replication (sso in the integrative and conjugative element ICEBs1 of Bacillus subtilis. Integrative and conjugative elements (ICEs, also known as conjugative transposons are DNA elements typically found integrated into a bacterial chromosome where they are transmitted to daughter cells by chromosomal replication and cell division. Under certain conditions, ICEs become activated and excise from the host chromosome and can transfer to neighboring cells via the element-encoded conjugation machinery. Activated ICEBs1 undergoes autonomous rolling circle replication that is needed for the maintenance of the excised element in growing and dividing cells. Rolling circle replication, used by many plasmids and phages, generates single-stranded DNA (ssDNA. In many cases, the presence of an sso enhances the conversion of the ssDNA to double-stranded DNA (dsDNA by enabling priming of synthesis of the second DNA strand. We initially identified sso1 in ICEBs1 based on sequence similarity to the sso of an RCR plasmid. Several functional assays confirmed Sso activity. Genetic analyses indicated that ICEBs1 uses sso1 and at least one other region for second strand DNA synthesis. We found that Sso activity was important for two key aspects of the ICEBs1 lifecycle: 1 maintenance of the plasmid form of ICEBs1 in cells after excision from the chromosome, and 2 stable acquisition of ICEBs1 following transfer to a new host. We identified sequences similar to known plasmid sso's in several other ICEs. Together, our results indicate that many other ICEs contain at least one single strand origin of replication, that these ICEs likely undergo autonomous replication, and that replication contributes to the stability and spread of these elements.

  14. DNA-based asymmetric organometallic catalysis in water

    NARCIS (Netherlands)

    Oelerich, Jens; Roelfes, Gerard

    2013-01-01

    Here, the first examples of DNA-based organometallic catalysis in water that give rise to high enantioselectivities are described. Copper complexes of strongly intercalating ligands were found to enable the asymmetric intramolecular cyclopropanation of alpha-diazo-beta-keto sulfones in water. Up to

  15. Genomic patterns associated with paternal/maternal distribution of transposable elements

    Science.gov (United States)

    Jurka, Jerzy

    2003-03-01

    Transposable elements (TEs) are specialized DNA or RNA fragments capable of surviving in intragenomic niches. They are commonly, perhaps unjustifiably referred to as "selfish" or "parasitic" elements. TEs can be divided in two major classes: retroelements and DNA transposons. The former include non-LTR retrotransposons and retrovirus-like elements, using reverse transriptase for their reproduction prior to integration into host DNA. The latter depend mostly on host DNA replication, with possible exception of rolling-circle transposons recently discovered by our team. I will review basic information on TEs, with emphasis on human Alu and L1 retroelements discussed in the context of genomic organization. TEs are non-randomly distributed in chromosomal DNA. In particular, human Alu elements tend to prefer GC-rich regions, whereas L1 accumulate in AT-rich regions. Current explanations of this phenomenon focus on the so called "target effects" and post-insertional selection. However, the proposed models appear to be unsatisfactory and alternative explanations invoking "channeling" to different chromosomal regions will be a major focus of my presentation. Transposable elements (TEs) can be expressed and integrated into host DNA in the male or female germlines, or both. Different models of expression and integration imply different proportions of TEs on sex chromosomes and autosomes. The density of recently retroposed human Alu elements is around three times higher on chromosome Y than on chromosome X, and over two times higher than the average density for all human autosomes. This implies Alu activity in paternal germlines. Analogous inter-chromosomal proportions for other repeat families should determine their compatibility with one of the three basic models describing the inheritance of TEs. Published evidence indicates that maternally and paternally imprinted genes roughly correspond to GC-rich and AT-rich DNA. This may explain the observed chromosomal distribution of

  16. A DNA methylation-based definition of biologically distinct breast cancer subtypes.

    Science.gov (United States)

    Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel

    2015-03-01

    In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  17. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  18. The essential component in DNA-based information storage system: robust error-tolerating module

    Directory of Open Access Journals (Sweden)

    Aldrin Kay-Yuen eYim

    2014-11-01

    Full Text Available The size of digital data is ever increasing and is expected to grow to 40,000EB by 2020, yet the estimated global information storage capacity in 2011 is less than 300EB, indicating that most of the data are transient. DNA, as a very stable nano-molecule, is an ideal massive storage device for long-term data archive. The two most notable illustrations are from Church et al. and Goldman et al., whose approaches are well-optimized for most sequencing platforms – short synthesized DNA fragments without homopolymer. Here we suggested improvements on error handling methodology that could enable the integration of DNA-based computational process, e.g. algorithms based on self-assembly of DNA. As a proof of concept, a picture of size 438 bytes was encoded to DNA with Low-Density Parity-Check error-correction code. We salvaged a significant portion of sequencing reads with mutations generated during DNA synthesis and sequencing and successfully reconstructed the entire picture. A modular-based programming framework - DNAcodec with a XML-based data format was also introduced. Our experiments demonstrated the practicability of long DNA message recovery with high error-tolerance, which opens the field to biocomputing and synthetic biology.

  19. Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

    Science.gov (United States)

    Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

    2013-12-15

    We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.

    Science.gov (United States)

    Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil

    2017-10-01

    Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.

  1. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  2. Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers

    Directory of Open Access Journals (Sweden)

    MEMEN SURAHMAN

    2010-07-01

    Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.

  3. Fractional Order Element Based Impedance Matching

    KAUST Repository

    Radwan, Ahmed Gomaa; Salama, Khaled N.; Shamim, Atif

    2014-01-01

    Disclosed are various embodiments of methods and systems related to fractional order element based impedance matching. In one embodiment, a method includes aligning a traditional Smith chart (|.alpha.|=1) with a fractional order Smith chart (|.alpha

  4. Droplet-based microscale colorimetric biosensor for multiplexed DNA analysis via a graphene nanoprobe

    International Nuclear Information System (INIS)

    Xiang Xia; Luo Ming; Shi Liyang; Ji Xinghu; He Zhike

    2012-01-01

    Graphical abstract: With a microvalve manipulate technique combined with droplet platform, a microscale fluorescence-based colorimetric sensor for multiplexed DNA analysis is developed via a graphene nanoprobe. Highlights: ► A quantitative detection for multiplexed DNA is first realized on droplet platform. ► The DNA detection is relied on a simple fluorescence-based colorimetric method. ► GO is served as a quencher for two different DNA fluorescent probes. ► This present work provides a rapid, sensitive, visual and convenient detection tool for droplet biosensor. - Abstract: The development of simple and inexpensive DNA detection strategy is very significant for droplet-based microfluidic system. Here, a droplet-based biosensor for multiplexed DNA analysis is developed with a common imaging device by using fluorescence-based colorimetric method and a graphene nanoprobe. With the aid of droplet manipulation technique, droplet size adjustment, droplet fusion and droplet trap are realized accurately and precisely. Due to the high quenching efficiency of graphene oxide (GO), in the absence of target DNAs, the droplet containing two single-stranded DNA probes and GO shows dark color, in which the DNA probes are labeled carboxy fluorescein (FAM) and 6-carboxy-X-rhodamine (ROX), respectively. The droplet changes from dark to bright color when the DNA probes form double helix with the specific target DNAs leading to the dyes far away from GO. This colorimetric droplet biosensor exhibits a quantitative capability for simultaneous detection of two different target DNAs with the detection limits of 9.46 and 9.67 × 10 −8 M, respectively. It is also demonstrated that this biosensor platform can become a promising detection tool in high throughput applications with low consumption of reagents. Moreover, the incorporation of graphene nanoprobe and droplet technique can drive the biosensor field one more step to some extent.

  5. Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

    Science.gov (United States)

    Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

    2015-01-01

    Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

  6. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  7. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  8. DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

    Science.gov (United States)

    Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

    2017-01-11

    DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

  9. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  10. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  11. Transforming bases to bytes: Molecular computing with DNA

    Indian Academy of Sciences (India)

    Despite the popular image of silicon-based computers for computation, an embryonic field of mole- cular computation is emerging, where molecules in solution perform computational ..... [4] Mao C, Sun W, Shen Z and Seeman N C 1999. A nanomechanical device based on the B-Z transition of DNA; Nature 397 144–146.

  12. A Constant Rate of Spontaneous Mutation in DNA-Based Microbes

    Science.gov (United States)

    Drake, John W.

    1991-08-01

    In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.

  13. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  14. Design and specificity of long ssDNA donors for CRISPR-based knock-in

    OpenAIRE

    Leonetti, Manuel; Li, Han; Beckman, Kyle; Pessino, Veronica; Huang, Bo; Weissman, Jonathan

    2017-01-01

    CRISPR/Cas technologies have transformed our ability to manipulate genomes for research and gene-based therapy. In particular, homology-directed repair after genomic cleavage allows for precise modification of genes using exogenous donor sequences as templates. While both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) forms of donors have been used as repair templates, a systematic comparison of the performance and specificity of repair using ssDNA versus dsDNA donors is still la...

  15. DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

    Science.gov (United States)

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

    2014-10-15

    An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

    Science.gov (United States)

    Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

    1997-01-01

    Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis

  17. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification.

    Science.gov (United States)

    Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng

    2014-06-15

    Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  19. All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model

    Science.gov (United States)

    Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978

  20. Non-coding RNAs and epigenome: de novo DNA methylation, allelic exclusion and X-inactivation

    Directory of Open Access Journals (Sweden)

    V. A. Halytskiy

    2013-12-01

    Full Text Available Non-coding RNAs are widespread class of cell RNAs. They participate in many important processes in cells – signaling, posttranscriptional silencing, protein biosynthesis, splicing, maintenance of genome stability, telomere lengthening, X-inactivation. Nevertheless, activity of these RNAs is not restricted to posttranscriptional sphere, but cover also processes that change or maintain the epigenetic information. Non-coding RNAs can directly bind to the DNA targets and cause their repression through recruitment of DNA methyltransferases as well as chromatin modifying enzymes. Such events constitute molecular mechanism of the RNA-dependent DNA methylation. It is possible, that the RNA-DNA interaction is universal mechanism triggering DNA methylation de novo. Allelic exclusion can be also based on described mechanism. This phenomenon takes place, when non-coding RNA, which precursor is transcribed from one allele, triggers DNA methylation in all other alleles present in the cell. Note, that miRNA-mediated transcriptional silencing resembles allelic exclusion, because both miRNA gene and genes, which can be targeted by this miRNA, contain elements with the same sequences. It can be assumed that RNA-dependent DNA methylation and allelic exclusion originated with the purpose of counteracting the activity of mobile genetic elements. Probably, thinning and deregulation of the cellular non-coding RNA pattern allows reactivation of silent mobile genetic elements resulting in genome instability that leads to ageing and carcinogenesis. In the course of X-inactivation, DNA methylation and subsequent hete­rochromatinization of X chromosome can be triggered by direct hybridization of 5′-end of large non-coding RNA Xist with DNA targets in remote regions of the X chromosome.

  1. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  2. Structuring polymers for delivery of DNA-based therapeutics: updated insights.

    Science.gov (United States)

    Gupta, Madhu; Tiwari, Shailja; Vyas, Suresh

    2012-01-01

    Gene therapy offers greater opportunities for treating numerous incurable diseases from genetic disorders, infections, and cancer. However, development of appropriate delivery systems could be one of the most important factors to overcome numerous biological barriers for delivery of various therapeutic molecules. A number of nonviral polymer-mediated vectors have been developed for DNA delivery and offer the potential to surmount the associated problems of their viral counterpart. To address the concerns associated with safety issues, a wide range of polymeric vectors are available and have been utilized successfully to deliver their therapeutics in vivo. Today's research is mainly focused on the various natural or synthetic polymer-based delivery carriers that protect the DNA molecule from degradation, which offer specific targeting to the desired cells after systemic administration, have transfection efficiencies equivalent to virus-mediated gene delivery, and have long-term gene expression through sustained-release mechanisms. This review explores an updated overview of different nonviral polymeric delivery system for delivery of DNA-based therapeutics. These polymeric carriers have been evaluated in vitro and in vivo and are being utilized in various stages of clinical evaluation. Continued research and understanding of the principles of polymer-based gene delivery systems will enable us to develop new and efficient delivery systems for the delivery of DNA-based therapeutics to achieve the goal of efficacious and specific gene therapy for a vast array of clinical disorders as the therapeutic solutions of tomorrow.

  3. Extended HSR/CARD domain mediates AIRE binding to DNA

    Energy Technology Data Exchange (ETDEWEB)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-12-25

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

  4. Extended HSR/CARD domain mediates AIRE binding to DNA

    International Nuclear Information System (INIS)

    Maslovskaja, Julia; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-01-01

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

  5. Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

    Science.gov (United States)

    Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

    2010-03-01

    Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

  6. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    Science.gov (United States)

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

    2012-01-01

    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  7. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  8. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  9. A conserved MCM single-stranded DNA binding element is essential for replication initiation.

    Science.gov (United States)

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-04-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001.

  10. A parallel finite element procedure for contact-impact problems using edge-based smooth triangular element and GPU

    Science.gov (United States)

    Cai, Yong; Cui, Xiangyang; Li, Guangyao; Liu, Wenyang

    2018-04-01

    The edge-smooth finite element method (ES-FEM) can improve the computational accuracy of triangular shell elements and the mesh partition efficiency of complex models. In this paper, an approach is developed to perform explicit finite element simulations of contact-impact problems with a graphical processing unit (GPU) using a special edge-smooth triangular shell element based on ES-FEM. Of critical importance for this problem is achieving finer-grained parallelism to enable efficient data loading and to minimize communication between the device and host. Four kinds of parallel strategies are then developed to efficiently solve these ES-FEM based shell element formulas, and various optimization methods are adopted to ensure aligned memory access. Special focus is dedicated to developing an approach for the parallel construction of edge systems. A parallel hierarchy-territory contact-searching algorithm (HITA) and a parallel penalty function calculation method are embedded in this parallel explicit algorithm. Finally, the program flow is well designed, and a GPU-based simulation system is developed, using Nvidia's CUDA. Several numerical examples are presented to illustrate the high quality of the results obtained with the proposed methods. In addition, the GPU-based parallel computation is shown to significantly reduce the computing time.

  11. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  12. Isothermal amplification of environmental DNA (eDNA for direct field-based monitoring and laboratory confirmation of Dreissena sp.

    Directory of Open Access Journals (Sweden)

    Maggie R Williams

    Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a

  13. Ferrocene-based guanidine derivatives: in vitro antimicrobial, DNA binding and docking supported urease inhibition studies.

    Science.gov (United States)

    Gul, Rukhsana; Rauf, Muhammad Khawar; Badshah, Amin; Azam, Syed Sikander; Tahir, Muhammad Nawaz; Khan, Azim

    2014-10-06

    Some novel ferrocenyl guanidines 1-8 were synthesized and characterized by different spectroscopic methods, elemental analysis and single crystal X-rays diffraction techniques. The crystallographic studies revealed that the existence of the strong non-bonding interactions facilitate these molecules to interact with biological macro-molecules like DNA that described to inherit good biological activities. The DNA interaction studies carried out by cyclic voltammetry (CV) and UV-visible spectroscopy are in close agreement with the binding constants (K) (0.79-5.4) × 10(5) (CV) and (0.72-5.1) × 10(5) (UV-vis). The shift in peak potential, current and absorption maxima of the studied ferrocenyl guanidines in the presence of DNA revealed that CV coupled with UV-vis spectroscopy could provide an opportune to characterize metal-based compounds-DNA interaction mechanism, a prerequisite for the design of new anticancer agents and understanding the molecular basis of their action. The compounds 1-8 have been screened for their antibacterial, antifungal and urease inhibition potency. A concurrent in silico study has also been applied on ferrocene moiety impregnated guanidines 1-8 to identify most active compounds having for inhibiting the activity of urease (pdb id 3LA4). Most of the compounds were found as potent inhibitors of urease and the compound 1 was found to be the most active with an IC50 of 16.83 ± 0.03 μM. The docking scores are in close agreement with the in vitro obtained IC50 values of inhibitors 1-8. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.

    Directory of Open Access Journals (Sweden)

    Michael B Prouse

    Full Text Available Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing. The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators.

  15. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    Directory of Open Access Journals (Sweden)

    Amanda Malvessi Cattani

    Full Text Available Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  16. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    Science.gov (United States)

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  17. International Congress on Transposable elements (ICTE 2016 in Saint Malo: mobile elements under the sun of Brittany

    Directory of Open Access Journals (Sweden)

    Pascale Lesage

    2016-10-01

    Full Text Available Abstract The third international conference on Transposable Elements (ICTE was held 16–19 April 2016 in Saint Malo, France. Organized by the French Transposition Community (Research group of the CNRS: “Mobile genetic elements: from mechanism to populations, an integrative approach” and the French Society of Genetics, the conference’s goal was to bring together researchers who study transposition in diverse organisms, using multiple experimental approaches. The meeting gathered 180 participants from all around the world. Most of them contributed through poster presentations, invited talks and short talks selected from poster abstracts. The talks were organized into six scientific sessions: “Taming mobile DNA: self and non-self recognition”; “Trans-generational inheritance”; “Mobile DNA genome structure and organization, from molecular mechanisms to applications”; “Remembrance of (retrotransposon past: mobile DNA in genome evolution”; and finally “The yin and the yang of mobile DNA in human health”.

  18. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. HLA class I sequence-based typing using DNA recovered from frozen plasma.

    Science.gov (United States)

    Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L

    2012-08-31

    We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. A computational study of nodal-based tetrahedral element behavior.

    Energy Technology Data Exchange (ETDEWEB)

    Gullerud, Arne S.

    2010-09-01

    This report explores the behavior of nodal-based tetrahedral elements on six sample problems, and compares their solution to that of a corresponding hexahedral mesh. The problems demonstrate that while certain aspects of the solution field for the nodal-based tetrahedrons provide good quality results, the pressure field tends to be of poor quality. Results appear to be strongly affected by the connectivity of the tetrahedral elements. Simulations that rely on the pressure field, such as those which use material models that are dependent on the pressure (e.g. equation-of-state models), can generate erroneous results. Remeshing can also be strongly affected by these issues. The nodal-based test elements as they currently stand need to be used with caution to ensure that their numerical deficiencies do not adversely affect critical values of interest.

  2. Comparison of methods for quantification of global DNA methylation in human cells and tissues.

    Directory of Open Access Journals (Sweden)

    Sofia Lisanti

    Full Text Available DNA methylation is a key epigenetic modification which, in mammals, occurs mainly at CpG dinucleotides. Most of the CpG methylation in the genome is found in repetitive regions, rich in dormant transposons and endogenous retroviruses. Global DNA hypomethylation, which is a common feature of several conditions such as ageing and cancer, can cause the undesirable activation of dormant repeat elements and lead to altered expression of associated genes. DNA hypomethylation can cause genomic instability and may contribute to mutations and chromosomal recombinations. Various approaches for quantification of global DNA methylation are widely used. Several of these approaches measure a surrogate for total genomic methyl cytosine and there is uncertainty about the comparability of these methods. Here we have applied 3 different approaches (luminometric methylation assay, pyrosequencing of the methylation status of the Alu repeat element and of the LINE1 repeat element for estimating global DNA methylation in the same human cell and tissue samples and have compared these estimates with the "gold standard" of methyl cytosine quantification by HPLC. Next to HPLC, the LINE1 approach shows the smallest variation between samples, followed by Alu. Pearson correlations and Bland-Altman analyses confirmed that global DNA methylation estimates obtained via the LINE1 approach corresponded best with HPLC-based measurements. Although, we did not find compelling evidence that the gold standard measurement by HPLC could be substituted with confidence by any of the surrogate assays for detecting global DNA methylation investigated here, the LINE1 assay seems likely to be an acceptable surrogate in many cases.

  3. A history of the DNA repair and mutagenesis field: The discovery of base excision repair.

    Science.gov (United States)

    Friedberg, Errol C

    2016-01-01

    This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.

  4. Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

    Science.gov (United States)

    Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

    2017-10-15

    Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  6. Statistical length of DNA based on AFM image measured by a computer

    International Nuclear Information System (INIS)

    Chen Xinqing; Qiu Xijun; Zhang Yi; Hu Jun; Wu Shiying; Huang Yibo; Ai Xiaobai; Li Minqian

    2001-01-01

    Taking advantage of image processing technology, the contour length of DNA molecule was measured automatically by a computer. Based on the AFM image of DNA, the topography of DNA was simulated into a curve. Then the DNA length was measured automatically by inserting mode. It was shown that the experimental length of a naturally deposited DNA (180.4 +- 16.4 nm) was well consistent with the theoretical length (185.0 nm). Comparing to other methods, the present approach had advantages of precision and automatism. The stretched DNA was also measured. It present approach had advantages of precision and automatism. The stretched DNA was also measured. It was shown that the experimental length (343.6 +- 20.7 nm) was much longer than the theoretical length (307.0 nm). This result indicated that the stretching process had a distinct effect on the DNA length. However, the method provided here avoided the DNA-stretching effect

  7. Theory of fractional order elements based impedance matching networks

    KAUST Repository

    Radwan, Ahmed G.

    2011-03-01

    Fractional order circuit elements (inductors and capacitors) based impedance matching networks are introduced for the first time. In comparison to the conventional integer based L-type matching networks, fractional matching networks are much simpler and versatile. Any complex load can be matched utilizing a single series fractional element, which generally requires two elements for matching in the conventional approach. It is shown that all the Smith chart circles (resistance and reactance) are actually pairs of completely identical circles. They appear to be single for the conventional integer order case, where the identical circles completely overlap each other. The concept is supported by design equations and impedance matching examples. © 2010 IEEE.

  8. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Science.gov (United States)

    Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

    2014-03-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  9. DNA-based stable isotope probing: a link between community structure and function

    International Nuclear Information System (INIS)

    Uhlik, Ondrej; Jecna, Katerina; Leigh, Mary Beth; Mackova, Martina; Macek, Tomas

    2009-01-01

    DNA-based molecular techniques permit the comprehensive determination of microbial diversity but generally do not reveal the relationship between the identity and the function of microorganisms. The first direct molecular technique to enable the linkage of phylogeny with function is DNA-based stable isotope probing (DNA-SIP). Applying this method first helped describe the utilization of simple compounds, such as methane, methanol or glucose and has since been used to detect microbial communities active in the utilization of a wide variety of compounds, including various xenobiotics. The principle of the method lies in providing 13C-labeled substrate to a microbial community and subsequent analyses of the 13C-DNA isolated from the community. Isopycnic centrifugation permits separating 13C-labeled DNA of organisms that utilized the substrate from 12C-DNA of the inactive majority. As the whole metagenome of active populations is isolated, its follow-up analysis provides successful taxonomic identification as well as the potential for functional gene analyses. Because of its power, DNA-SIP has become one of the leading techniques of microbial ecology research. But from other point of view, it is a labor-intensive method that requires careful attention to detail during each experimental step in order to avoid misinterpretation of results.

  10. Designing thermal diode and heat pump based on DNA nanowire: Multifractal approach

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@iaurmia.ac.ir; Panahinia, R.

    2017-07-12

    The management of heat flow in DNA nano wire was considered. Thermal diode effect in DNA and the domain of its appearance dependent to system parameters have been detected. The appearance of directed thermal flow in thermodynamic sizes proposes the possibility of designing the macroscopic thermal rectifier. By applying driven force, pumping effect has been also observed. The resonance frequency of DNA and threshold amplitudes of driving force for attaining permanent pumping effect have been detected. Forasmuch as detecting negative differential thermal resistance (NDTR) phenomenon, DNA can act as a thermal transistor. By using an analytical parallel investigation based on Rényi spectrum analysis, threshold values to transition to NDTR and pumping regimes have been detected. - Highlights: • The control and management of heat current in DNA have been investigated. • Directed thermal flow and NDTR in DNA have been identified. • By increasing the system size, the reversed thermal rectification appeared. So, it is proposed the possibility of designing the macroscopic thermal rectifier. • Pumping effect accompanied with detection of resonance frequency of DNA has been observed. • To verify the results, we did a parallel analysis based on multifractal concept to detect threshold values for transition to pumping state and NDTR regime.

  11. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.

  12. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    DEFF Research Database (Denmark)

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong

    2011-01-01

    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...

  13. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Science.gov (United States)

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Cermets based on rhenium and rare earth element oxides

    International Nuclear Information System (INIS)

    Varfolomeev, M.B.; Velichko, A.V.; Zajtseva, L.L.; Shishkov, N.V.

    1977-01-01

    The reduction of perrhenates of rare earth elements and of yttrium by hydrogen and the subsequent sintering have yielded cermets based on rhenium and rare earth element oxides inherent in which are more disperse and homogeneous structures than those of the ''molecular'' rare earth element-Tc cermets. The dispersity of cermets increases in the rare earth elements series from La to Lu. The microhardness of the Re phase in cermets is 490 kgf/mm 2 ; the total microhardness of a cermet is substantially higher

  15. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  16. Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

    KAUST Repository

    Fornander, Louise H

    2013-12-03

    The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

  17. Charge transfer in pi-stacked systems including DNA

    International Nuclear Information System (INIS)

    Siebbeles, L.D.A.

    2003-01-01

    Charge migration in DNA is a subject of intense current study motivated by long-range detection of DNA damage and the potential application of DNA as a molecular wire in nanoscale electronic devices. A key structural element, which makes DNA a medium for long-range charge transfer, is the array of stacked base pairs in the interior of the double helix. The overlapping pi-orbitals of the nucleobases provide a pathway for motion of charge carriers generated on the stack. This 'pi-pathway' resembles the columnarly stacked macrocyclic cores in discotic materials such as triphenylenes. The structure of these pi-stacked systems is highly disordered with dynamic fluctuations occurring on picosecond to nanosecond time scales. Theoretical calculations, concerning the effects of structural disorder and nucleobase sequence in DNA, on the dynamics of charge carriers are presented. Electronic couplings and localization energies of charge carriers were calculated using density functional theory (DFT). Results for columnarly stacked triphenylenes and DNA nucleobases are compared. The results are used to provide insight into the factors that control the mobility of charge carriers. Further, experimental results on the site-selective oxidation of guanine nucleobases in DNA (hot spots for DNA damage) are analyzed on basis of the theoretical results

  18. DENA: A Configurable Microarchitecture and Design Flow for Biomedical DNA-Based Logic Design.

    Science.gov (United States)

    Beiki, Zohre; Jahanian, Ali

    2017-10-01

    DNA is known as the building block for storing the life codes and transferring the genetic features through the generations. However, it is found that DNA strands can be used for a new type of computation that opens fascinating horizons in computational medicine. Significant contributions are addressed on design of DNA-based logic gates for medical and computational applications but there are serious challenges for designing the medium and large-scale DNA circuits. In this paper, a new microarchitecture and corresponding design flow is proposed to facilitate the design of multistage large-scale DNA logic systems. Feasibility and efficiency of the proposed microarchitecture are evaluated by implementing a full adder and, then, its cascadability is determined by implementing a multistage 8-bit adder. Simulation results show the highlight features of the proposed design style and microarchitecture in terms of the scalability, implementation cost, and signal integrity of the DNA-based logic system compared to the traditional approaches.

  19. MIDAS: A Modular DNA Assembly System for Synthetic Biology.

    Science.gov (United States)

    van Dolleweerd, Craig J; Kessans, Sarah A; Van de Bittner, Kyle C; Bustamante, Leyla Y; Bundela, Rudranuj; Scott, Barry; Nicholson, Matthew J; Parker, Emily J

    2018-04-20

    A modular and hierarchical DNA assembly platform for synthetic biology based on Golden Gate (Type IIS restriction enzyme) cloning is described. This enabling technology, termed MIDAS (for Modular Idempotent DNA Assembly System), can be used to precisely assemble multiple DNA fragments in a single reaction using a standardized assembly design. It can be used to build genes from libraries of sequence-verified, reusable parts and to assemble multiple genes in a single vector, with full user control over gene order and orientation, as well as control of the direction of growth (polarity) of the multigene assembly, a feature that allows genes to be nested between other genes or genetic elements. We describe the detailed design and use of MIDAS, exemplified by the reconstruction, in the filamentous fungus Penicillium paxilli, of the metabolic pathway for production of paspaline and paxilline, key intermediates in the biosynthesis of a range of indole diterpenes-a class of secondary metabolites produced by several species of filamentous fungi. MIDAS was used to efficiently assemble a 25.2 kb plasmid from 21 different modules (seven genes, each composed of three basic parts). By using a parts library-based system for construction of complex assemblies, and a unique set of vectors, MIDAS can provide a flexible route to assembling tailored combinations of genes and other genetic elements, thereby supporting synthetic biology applications in a wide range of expression hosts.

  20. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    Science.gov (United States)

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat

    2018-03-01

    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  1. DNA base-calling from a nanopore using a Viterbi algorithm.

    Science.gov (United States)

    Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-05-16

    Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  2. Recent Advancements in DNA Damage-Transcription Crosstalk and High-Resolution Mapping of DNA Breaks.

    Science.gov (United States)

    Vitelli, Valerio; Galbiati, Alessandro; Iannelli, Fabio; Pessina, Fabio; Sharma, Sheetal; d'Adda di Fagagna, Fabrizio

    2017-08-31

    Until recently, DNA damage arising from physiological DNA metabolism was considered a detrimental by-product for cells. However, an increasing amount of evidence has shown that DNA damage could have a positive role in transcription activation. In particular, DNA damage has been detected in transcriptional elements following different stimuli. These physiological DNA breaks are thought to be instrumental for the correct expression of genomic loci through different mechanisms. In this regard, although a plethora of methods are available to precisely map transcribed regions and transcription start sites, commonly used techniques for mapping DNA breaks lack sufficient resolution and sensitivity to draw a robust correlation between DNA damage generation and transcription. Recently, however, several methods have been developed to map DNA damage at single-nucleotide resolution, thus providing a new set of tools to correlate DNA damage and transcription. Here, we review how DNA damage can positively regulate transcription initiation, the current techniques for mapping DNA breaks at high resolution, and how these techniques can benefit future studies of DNA damage and transcription.

  3. Slow elimination of DNA damaged bases in the liver of old gamma-irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Gaziev, A I; Malakhova, L V; Fomenko, L A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki

    1981-01-01

    Elimination of the DNA damaged bases in the liver of old and young mice after their gamma-irradiation is studied. It is established that the incision rate of DNA gamma-damaged bases in the liver of old mice is lower than in the liver of the young ones. It is supposed to be connected with the decrease of the activity of DNA reparation ferments or with the presence of limitations in chromatin for the access of these ferments to the damaged parts of DNA in the cells of old animals.

  4. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de

    2006-01-01

    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....

  5. Fundamental study of the radiation monitoring system based on evaluation of DNA lesions

    International Nuclear Information System (INIS)

    Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.

    2011-01-01

    The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)

  6. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  7. Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

    Science.gov (United States)

    Ishii, Satoshi; Sadowsky, Michael J

    2009-04-01

    A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

  8. A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

    Science.gov (United States)

    Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

    2015-07-01

    In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  10. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  11. Microheaters based on ultrasonic actuation of piezoceramic elements

    Science.gov (United States)

    Visvanathan, Karthik; Gianchandani, Yogesh B.

    2011-08-01

    This paper describes the use of micromachined lead zirconate titanate (PZT) piezoceramic elements for heat generation by ultrasonic energy dissipated within the elements and surrounding media. Simulations based on three-dimensional finite-element models suggest that circular disk-shaped elements provide superior steady-state temperature rise for a given cross-sectional area, volume of the PZT element and drive voltage. Experimental validation is performed using PZT-5A heaters of 3.2 mm diameter and 0.191 mm thickness. Single-element heaters and dual-element stacks are evaluated. Although the steady-state temperature generated by these heaters reaches the maximum value at the frequency of maximum electromechanical conductance, the heating effectiveness is maximized at the frequency of maximum electromechanical impedance. Stacked PZT heaters provide 3.5 times the temperature rise and 3 times greater heating effectiveness than single elements. Furthermore, the heaters attain the maximum heating effectiveness when bonded to highly damping and non-conducting substrates. A maximum temperature of 120 °C is achieved at 160 mW input power. Experiments are performed using porcine tissue samples to show the feasibility of using PZT heaters in tissue cauterization. A PZT heater probe brands a porcine tissue in 2-3 s with 10 VRMS drive voltage. The interface temperature is ≈150 °C.

  12. DNA-Based Nanobiosensors as an Emerging Platform for Detection of Disease

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2015-06-01

    Full Text Available Detection of disease at an early stage is one of the biggest challenges in medicine. Different disciplines of science are working together in this regard. The goal of nanodiagnostics is to provide more accurate tools for earlier diagnosis, to reduce cost and to simplify healthcare delivery of effective and personalized medicine, especially with regard to chronic diseases (e.g., diabetes and cardiovascular diseases that have high healthcare costs. Up-to-date results suggest that DNA-based nanobiosensors could be used effectively to provide simple, fast, cost-effective, sensitive and specific detection of some genetic, cancer, and infectious diseases. In addition, they could potentially be used as a platform to detect immunodeficiency, and neurological and other diseases. This review examines different types of DNA-based nanobiosensors, the basic principles upon which they are based and their advantages and potential in diagnosis of acute and chronic diseases. We discuss recent trends and applications of new strategies for DNA-based nanobiosensors, and emphasize the challenges in translating basic research to the clinical laboratory.

  13. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2012-01-01

    Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  14. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier

    2014-01-01

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL −1 and 50 μg mL −1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  15. Excited state dynamics of DNA bases

    Czech Academy of Sciences Publication Activity Database

    Kleinermanns, K.; Nachtigallová, Dana; de Vries, M. S.

    2013-01-01

    Roč. 32, č. 2 (2013), s. 308-342 ISSN 0144-235X R&D Projects: GA ČR GAP208/12/1318 Grant - others:National Science Foundation(US) CHE-0911564; NASA (US) NNX12AG77G; Deutsche Forschungsgemeinschaft(DE) SFB 663; Deutsche Forschungsgemeinschaft(DE) KI 531-29 Institutional support: RVO:61388963 Keywords : DNA bases * nucleobases * excited state * dynamics * computations * gas phase * conical intersections Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.920, year: 2013

  16. Feasibility study of molecular memory device based on DNA using methylation to store information

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

    2016-07-14

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  17. Feasibility study of molecular memory device based on DNA using methylation to store information

    International Nuclear Information System (INIS)

    Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

    2016-01-01

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  18. DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis

    Science.gov (United States)

    Lucena-Aguilar, Gema; Sánchez-López, Ana María; Barberán-Aceituno, Cristina; Carrillo-Ávila, José Antonio; López-Guerrero, José Antonio

    2016-01-01

    High-quality human DNA samples and associated information of individuals are necessary for biomedical research. Biobanks act as a support infrastructure for the scientific community by providing a large number of high-quality biological samples for specific downstream applications. For this purpose, biobank methods for sample preparation must ensure the usefulness and long-term functionality of the products obtained. Quality indicators are the tool to measure these parameters, the purity and integrity determination being those specifically used for DNA. This study analyzes the quality indicators in DNA samples derived from 118 frozen human tissues in optimal cutting temperature (OCT) reactive, 68 formalin-fixed paraffin-embedded (FFPE) tissues, 119 frozen blood samples, and 26 saliva samples. The results obtained for DNA quality are discussed in association with the usefulness for downstream applications and availability of the DNA source in the target study. In brief, if any material is valid, blood is the most approachable option of prospective collection of samples providing high-quality DNA. However, if diseased tissue is a requisite or samples are available, the recommended source of DNA would be frozen tissue. These conclusions will determine the best source of DNA, according to the planned downstream application. Furthermore our results support the conclusion that a complete procedure of DNA quantification and qualification is necessary to guarantee the appropriate management of the samples, avoiding low confidence results, high costs, and a waste of samples. PMID:27158753

  19. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  20. A new model for ancient DNA decay based on paleogenomic meta-analysis.

    Science.gov (United States)

    Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G

    2017-06-20

    The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer

    Science.gov (United States)

    2006-08-01

    cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish

  2. Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

    Science.gov (United States)

    Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

    2003-09-01

    Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

  3. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  4. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  5. Electroporation-based DNA delivery technology

    DEFF Research Database (Denmark)

    Gothelf, A; Gehl, Julie

    2014-01-01

    DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....

  6. The biology and potential for genetic research of transposable elements in filamentous fungi

    OpenAIRE

    Fávaro,Léia Cecilia de Lima; Araújo,Welington Luiz de; Azevedo,João Lúcio de; Paccola-Meirelles,Luzia Doretto

    2005-01-01

    Recently many transposable elements have been identified and characterized in filamentous fungi, especially in species of agricultural, biotechnological and medical interest. Similar to the elements found in other eukaryotes, fungal transposons can be classified as class I elements (retrotransposons) that use RNA and reverse transcriptase and class II elements (DNA transposons) that use DNA. The changes (transposition and recombination) caused by transposons can supply wide-ranging genetic va...

  7. Computational modeling of a carbon nanotube-based DNA nanosensor

    Energy Technology Data Exchange (ETDEWEB)

    Kalantari-Nejad, R; Bahrami, M [Mechanical Engineering Department, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Rafii-Tabar, H [Department of Medical Physics and Biomedical Engineering and Research Centre for Medical Nanotechnology and Tissue Engineering, Shahid Beheshti University of Medical Sciences, Evin, Tehran (Iran, Islamic Republic of); Rungger, I; Sanvito, S, E-mail: mbahrami@aut.ac.ir [School of Physics and CRANN, Trinity College, Dublin 2 (Ireland)

    2010-11-05

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  8. Computational modeling of a carbon nanotube-based DNA nanosensor

    International Nuclear Information System (INIS)

    Kalantari-Nejad, R; Bahrami, M; Rafii-Tabar, H; Rungger, I; Sanvito, S

    2010-01-01

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  9. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Eiko E Kuramae

    Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.

  10. DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects

    Energy Technology Data Exchange (ETDEWEB)

    Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)

    2014-02-01

    The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular

  11. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Ivan Liachko

    2014-03-01

    Full Text Available The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  12. DNA based random key generation and management for OTP encryption.

    Science.gov (United States)

    Zhang, Yunpeng; Liu, Xin; Sun, Manhui

    2017-09-01

    One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

  13. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  14. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  15. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. MitBASE : a comprehensive and integrated mitochondrial DNA database. The present status

    NARCIS (Netherlands)

    Attimonelli, M.; Altamura, N.; Benne, R.; Brennicke, A.; Cooper, J. M.; D'Elia, D.; Montalvo, A.; Pinto, B.; de Robertis, M.; Golik, P.; Knoop, V.; Lanave, C.; Lazowska, J.; Licciulli, F.; Malladi, B. S.; Memeo, F.; Monnerot, M.; Pasimeni, R.; Pilbout, S.; Schapira, A. H.; Sloof, P.; Saccone, C.

    2000-01-01

    MitBASE is an integrated and comprehensive database of mitochondrial DNA data which collects, under a single interface, databases for Plant, Vertebrate, Invertebrate, Human, Protist and Fungal mtDNA and a Pilot database on nuclear genes involved in mitochondrial biogenesis in Saccharomyces

  17. DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging

    Directory of Open Access Journals (Sweden)

    Ricardo Gredilla

    2011-01-01

    Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.

  18. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    Science.gov (United States)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  19. Magnetophoresis of flexible DNA-based dumbbell structures

    Science.gov (United States)

    Babić, B.; Ghai, R.; Dimitrov, K.

    2008-02-01

    Controlled movement and manipulation of magnetic micro- and nanostructures using magnetic forces can give rise to important applications in biomedecine, diagnostics, and immunology. We report controlled magnetophoresis and stretching, in aqueous solution, of a DNA-based dumbbell structure containing magnetic and diamagnetic microspheres. The velocity and stretching of the dumbbell were experimentally measured and correlated with a theoretical model based on the forces acting on individual magnetic beads or the entire dumbbell structures. The results show that precise and predictable manipulation of dumbbell structures is achievable and can potentially be applied to immunomagnetic cell separators.

  20. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  1. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

    Science.gov (United States)

    Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

    2017-02-21

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

  2. Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

    Directory of Open Access Journals (Sweden)

    Nynne Sharma

    2013-01-01

    Full Text Available DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system.

  3. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  4. Effect of proton transfer on the electronic coupling in DNA

    International Nuclear Information System (INIS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-01-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, V da , in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate V da for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the V da matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the V da matrix elements are also analyzed

  5. Analysis of phage Mu DNA transposition by whole-genome Escherichia coli tiling arrays reveals a complex relationship to distribution of target selection protein B, transcription and chromosome architectural elements.

    Science.gov (United States)

    Ge, Jun; Lou, Zheng; Cui, Hong; Shang, Lei; Harshey, Rasika M

    2011-09-01

    Of all known transposable elements, phage Mu exhibits the highest transposition efficiency and the lowest target specificity. In vitro, MuB protein is responsible for target choice. In this work, we provide a comprehensive assessment of the genome-wide distribution of MuB and its relationship to Mu target selection using high-resolution Escherichia coli tiling DNA arrays. We have also assessed how MuB binding and Mu transposition are influenced by chromosome-organizing elements such as AT-rich DNA signatures, or the binding of the nucleoid-associated protein Fis, or processes such as transcription. The results confirm and extend previous biochemical and lower resolution in vivo data. Despite the generally random nature of Mu transposition and MuB binding, there were hot and cold insertion sites and MuB binding sites in the genome, and differences between the hottest and coldest sites were large. The new data also suggest that MuB distribution and subsequent Mu integration is responsive to DNA sequences that contribute to the structural organization of the chromosome.

  6. Self-Assembling Molecular Logic Gates Based on DNA Crossover Tiles.

    Science.gov (United States)

    Campbell, Eleanor A; Peterson, Evan; Kolpashchikov, Dmitry M

    2017-07-05

    DNA-based computational hardware has attracted ever-growing attention due to its potential to be useful in the analysis of complex mixtures of biological markers. Here we report the design of self-assembling logic gates that recognize DNA inputs and assemble into crossover tiles when the output signal is high; the crossover structures disassemble to form separate DNA stands when the output is low. The output signal can be conveniently detected by fluorescence using a molecular beacon probe as a reporter. AND, NOT, and OR logic gates were designed. We demonstrate that the gates can connect to each other to produce other logic functions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Science.gov (United States)

    Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E

    2014-01-01

    Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  8. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Directory of Open Access Journals (Sweden)

    Katja Limmer

    Full Text Available Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA, parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  9. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  10. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  11. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  12. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  13. Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.

    Science.gov (United States)

    Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei

    2016-11-01

    Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.

  14. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  15. Hydrogen peroxide biosensor based on DNA-Hb modified gold electrode

    International Nuclear Information System (INIS)

    Kafi, A.K.M.; Fan Yin; Shin, Hoon-Kyu; Kwon, Young-Soo

    2006-01-01

    A hydrogen peroxide (H 2 O 2 ) biosensor based on DNA-hemoglobin (Hb) modified electrode is described in this paper. The sensor was designed by DNA and hemoglobin dropletting onto gold electrode surface layer by layer. The sensor based on the direct electron transfer of iron of hemoglobin showed a well electrocatalytic response to the reduction of the H 2 O 2 . This sensor offered an excellent electrochemical response for H 2 O 2 concentration below micromole level with high sensitivity and selectivity and short response time. Experimental conditions influencing the biosensor performance such as, pH, potential were optimized and assessed. The levels of the RSD's ( 2 O 2 was observed from 10 to 120 μM with the detection limit of 0.4 μM (based on the S/N = 3)

  16. Pros and cons of methylation-based enrichment methods for ancient DNA

    Science.gov (United States)

    Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

    2015-01-01

    The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828

  17. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    International Nuclear Information System (INIS)

    Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.

    2015-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor

  18. Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

    Science.gov (United States)

    Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

    2013-01-01

    To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

  19. Synthesis, characterization, DNA binding and cleavage studies of mixed-ligand copper (II complexes

    Directory of Open Access Journals (Sweden)

    M. Sunita

    2017-05-01

    Full Text Available New two copper complexes of type [Cu(Bzimpy(LH2O]SO4 (where L = 2,2′ bipyridine (bpy, and ethylene diamine (en, Bzimpy = 2,6-bis(benzimidazole-2ylpyridine have been synthesized and characterized by elemental analyses, molar conductance measurements, magnetic susceptibility measurements, mass, IR, electronic and EPR spectral studies. Based on elemental and spectral studies six coordinated geometries were assigned to the two complexes. DNA-binding properties of these metal complexes were investigated using absorption spectroscopy, fluorescence spectroscopy, viscosity measurements and thermal denaturation methods. Experimental studies suggest that the complexes bind to DNA through intercalation. These complexes also promote the cleavage of plasmid pBR322, in the presence of H2O2.

  20. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  1. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  2. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  3. Synthesis, Characterization, DNA Interaction, and Antitumor Activities of La (III) Complex with Schiff Base Ligand Derived from Kaempferol and Diethylenetriamine.

    Science.gov (United States)

    Wang, Qin; Huang, Yu; Zhang, Jin-Sheng; Yang, Xin-Bin

    2014-01-01

    A novel La (III) complex, [LaL(H2O)3]NO3 ·3H2O, with Schiff base ligand L derived from kaempferol and diethylenetriamine, has been synthesized and characterized by elemental analysis, IR, UV-visible, (1)H NMR, thermogravimetric analysis, and molar conductance measurements. The fluorescence spectra, circular dichroism spectra, and viscosity measurements and gel electrophoresis experiments indicated that the ligand L and La (III) complex could bind to CT-DNA presumably via intercalative mode and the La (III) complex showed a stronger ability to bind and cleave DNA than the ligand L alone. The binding constants (K b ) were evaluated from fluorescence data and the values ranged from 0.454 to 0.659 × 10(5) L mol(-1) and 1.71 to 17.3 × 10(5) L mol(-1) for the ligand L and La (III) complex, respectively, in the temperature range of 298-310 K. It was also found that the fluorescence quenching mechanism of EB-DNA by ligand L and La (III) complex was a static quenching process. In comparison to free ligand L, La (III) complex exhibited enhanced cytotoxic activities against tested tumor cell lines HL-60 and HepG-2, which may correlate with the enhanced DNA binding and cleaving abilities of the La (III) complex.

  4. Physically transient photonics: random versus distributed feedback lasing based on nanoimprinted DNA.

    Science.gov (United States)

    Camposeo, Andrea; Del Carro, Pompilio; Persano, Luana; Cyprych, Konrad; Szukalski, Adam; Sznitko, Lech; Mysliwiec, Jaroslaw; Pisignano, Dario

    2014-10-28

    Room-temperature nanoimprinted, DNA-based distributed feedback (DFB) laser operation at 605 nm is reported. The laser is made of a pure DNA host matrix doped with gain dyes. At high excitation densities, the emission of the untextured dye-doped DNA films is characterized by a broad emission peak with an overall line width of 12 nm and superimposed narrow peaks, characteristic of random lasing. Moreover, direct patterning of the DNA films is demonstrated with a resolution down to 100 nm, enabling the realization of both surface-emitting and edge-emitting DFB lasers with a typical line width of <0.3 nm. The resulting emission is polarized, with a ratio between the TE- and TM-polarized intensities exceeding 30. In addition, the nanopatterned devices dissolve in water within less than 2 min. These results demonstrate the possibility of realizing various physically transient nanophotonics and laser architectures, including random lasing and nanoimprinted devices, based on natural biopolymers.

  5. A one-step miniprep for the isolation of plasmid DNA and lambda phage particles.

    Directory of Open Access Journals (Sweden)

    George Lezin

    Full Text Available Plasmid DNA minipreps are fundamental techniques in molecular biology. Current plasmid DNA minipreps use alkali and the anionic detergent SDS in a three-solution format. In addition, alkali minipreps usually require additional column-based purification steps and cannot isolate other extra-chromosomal elements, such as bacteriophages. Non-ionic detergents (NIDs have been used occasionally as components of multiple-solution plasmid DNA minipreps, but a one-step approach has not been developed. Here, we have established a one-tube, one-solution NID plasmid DNA miniprep, and we show that this approach also isolates bacteriophage lambda particles. NID minipreps are more time-efficient than alkali minipreps, and NID plasmid DNA performs better than alkali DNA in many downstream applications. In fact, NID crude lysate DNA is sufficiently pure to be used in digestion and sequencing reactions. Microscopic analysis showed that the NID procedure fragments E. coli cells into small protoplast-like components, which may, at least in part, explain the effectiveness of this approach. This work demonstrates that one-step NID minipreps are a robust method to generate high quality plasmid DNA, and NID approaches can also isolate bacteriophage lambda particles, outperforming current standard alkali-based minipreps.

  6. The radiation chemistry of the purine bases within DNA and related model compounds

    International Nuclear Information System (INIS)

    Cadet, J.; Berger, M.; Shaw, A.

    1986-01-01

    Both the direct and indirect effects of ionizing radiations are believed to contribute to the chemical changes induced in cellular DNA. Relevant information on the possible degradation pathways has been provided by studies using DNA model compounds, the major proportion of which have focused on pyrimidine components and sugar derivatives. With the development of powerful analytical tools such as high performance liquid chromatography and soft ionization mass spectrometry techniques, progress has recently been made in the elucidation of the nature of the radiation-induced chemical modifications of purine bases in DNA and related nucleosides and nucleotides. This short review details recent aspects of the radiation-induced degradation of adenine and guanine bases in DNA and its model compounds as the result of both direct and indirect effects. 11 refs., 2 figs., 1 tab

  7. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage

    Science.gov (United States)

    Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.

    1999-01-01

    DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315

  8. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  9. Electrochemical DNA biosensor based on avidin-biotin conjugation for influenza virus (type A) detection

    Science.gov (United States)

    Chung, Da-Jung; Kim, Ki-Chul; Choi, Seong-Ho

    2011-09-01

    An electrochemical DNA biosensor (E-DNA biosensor) was fabricated by avidin-biotin conjugation of a biotinylated probe DNA, 5'-biotin-ATG AGT CTT CTA ACC GAG GTC GAA-3', and an avidin-modified glassy carbon electrode (GCE) to detect the influenza virus (type A). An avidin-modified GCE was prepared by the reaction of avidin and a carboxylic acid-modified GCE, which was synthesized by the electrochemical reduction of 4-carboxyphenyl diazonium salt. The current value of the E-DNA biosensor was evaluated after hybridization of the probe DNA and target DNA using cyclic voltammetry (CV). The current value decreased after the hybridization of the probe DNA and target DNA. The DNA that was used follows: complementary target DNA, 5'-TTC GAC CTC GGT TAG AAG ACT CAT-3' and two-base mismatched DNA, 5'-TTC GAC AGC GGT TAT AAG ACT CAT-3'.

  10. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  11. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  12. The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy

    Directory of Open Access Journals (Sweden)

    Suneetha Amara

    2017-03-01

    Full Text Available DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer.

  13. A dynamic bead-based microarray for parallel DNA detection

    International Nuclear Information System (INIS)

    Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P

    2011-01-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

  14. Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.

    Science.gov (United States)

    Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine

    2012-02-01

    Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.

  15. One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.

    Science.gov (United States)

    Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E

    2014-06-01

    The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.

  16. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  17. Satellite DNA-based artificial chromosomes for use in gene therapy.

    Science.gov (United States)

    Hadlaczky, G

    2001-04-01

    Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.

  18. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features.

    Science.gov (United States)

    Zaman, Rianon; Chowdhury, Shahana Yasmin; Rashid, Mahmood A; Sharma, Alok; Dehzangi, Abdollah; Shatabda, Swakkhar

    2017-01-01

    DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM) as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  19. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features

    Directory of Open Access Journals (Sweden)

    Rianon Zaman

    2017-01-01

    Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  20. The evolution of ultraconserved elements with different phylogenetic origins

    KAUST Repository

    Ryu, Tae Woo; Seridi, Loqmane; Ravasi, Timothy

    2012-01-01

    Background: Ultraconserved elements of DNA have been identified in vertebrate and invertebrate genomes. These elements have been found to have diverse functions, including enhancer activities in developmental processes. The evolutionary origins

  1. Highly Sensitive DNA Sensor Based on Upconversion Nanoparticles and Graphene Oxide.

    Science.gov (United States)

    Alonso-Cristobal, P; Vilela, P; El-Sagheer, A; Lopez-Cabarcos, E; Brown, T; Muskens, O L; Rubio-Retama, J; Kanaras, A G

    2015-06-17

    In this work we demonstrate a DNA biosensor based on fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er nanoparticles and graphene oxide (GO). Monodisperse NaYF4:Yb,Er nanoparticles with a mean diameter of 29.1 ± 2.2 nm were synthesized and coated with a SiO2 shell of 11 nm, which allowed the attachment of single strands of DNA. When these DNA-functionalized NaYF4:Yb,Er@SiO2 nanoparticles were in the proximity of the GO surface, the π-π stacking interaction between the nucleobases of the DNA and the sp(2) carbons of the GO induced a FRET fluorescence quenching due to the overlap of the fluorescence emission of the NaYF4:Yb,Er@SiO2 and the absorption spectrum of GO. By contrast, in the presence of the complementary DNA strands, the hybridization leads to double-stranded DNA that does not interact with the GO surface, and thus the NaYF4:Yb,Er@SiO2 nanoparticles remain unquenched and fluorescent. The high sensitivity and specificity of this sensor introduces a new method for the detection of DNA with a detection limit of 5 pM.

  2. Research Report Non-invasive DNA-based species and sex ...

    Indian Academy of Sciences (India)

    shrushti modi

    Non-invasive DNA-based species and sex identification of Asiatic wild dog (Cuon alpinus) .... We did not find any cross-gender amplification with any of the reference or field-collected samples. Success rate for sex discrimination for all field-.

  3. Developing a biological dosimeter based on mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

    1996-12-31

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.

  4. Developing a biological dosimeter based on mitochondrial DNA

    International Nuclear Information System (INIS)

    Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.

    1995-01-01

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs

  5. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  6. Identification of DNA-binding protein target sequences by physical effective energy functions: free energy analysis of lambda repressor-DNA complexes.

    Directory of Open Access Journals (Sweden)

    Caselle Michele

    2007-09-01

    Full Text Available Abstract Background Specific binding of proteins to DNA is one of the most common ways gene expression is controlled. Although general rules for the DNA-protein recognition can be derived, the ambiguous and complex nature of this mechanism precludes a simple recognition code, therefore the prediction of DNA target sequences is not straightforward. DNA-protein interactions can be studied using computational methods which can complement the current experimental methods and offer some advantages. In the present work we use physical effective potentials to evaluate the DNA-protein binding affinities for the λ repressor-DNA complex for which structural and thermodynamic experimental data are available. Results The binding free energy of two molecules can be expressed as the sum of an intermolecular energy (evaluated using a molecular mechanics forcefield, a solvation free energy term and an entropic term. Different solvation models are used including distance dependent dielectric constants, solvent accessible surface tension models and the Generalized Born model. The effect of conformational sampling by Molecular Dynamics simulations on the computed binding energy is assessed; results show that this effect is in general negative and the reproducibility of the experimental values decreases with the increase of simulation time considered. The free energy of binding for non-specific complexes, estimated using the best energetic model, agrees with earlier theoretical suggestions. As a results of these analyses, we propose a protocol for the prediction of DNA-binding target sequences. The possibility of searching regulatory elements within the bacteriophage λ genome using this protocol is explored. Our analysis shows good prediction capabilities, even in absence of any thermodynamic data and information on the naturally recognized sequence. Conclusion This study supports the conclusion that physics-based methods can offer a completely complementary

  7. Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

    Science.gov (United States)

    Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

    2012-08-01

    The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.

  8. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  9. A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

    Science.gov (United States)

    Yamamoto, F; Yamamoto, M

    2004-07-01

    We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

  10. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  11. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  12. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  13. Google matrix analysis of DNA sequences.

    Science.gov (United States)

    Kandiah, Vivek; Shepelyansky, Dima L

    2013-01-01

    For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW). At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  14. Google matrix analysis of DNA sequences.

    Directory of Open Access Journals (Sweden)

    Vivek Kandiah

    Full Text Available For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW. At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  15. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    Science.gov (United States)

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  16. A damage mechanics based general purpose interface/contact element

    Science.gov (United States)

    Yan, Chengyong

    Most of the microelectronics packaging structures consist of layered substrates connected with bonding materials, such as solder or epoxy. Predicting the thermomechanical behavior of these multilayered structures is a challenging task in electronic packaging engineering. In a layered structure the most complex part is always the interfaces between the strates. Simulating the thermo-mechanical behavior of such interfaces, is the main theme of this dissertation. The most commonly used solder material, Pb-Sn alloy, has a very low melting temperature 180sp°C, so that the material demonstrates a highly viscous behavior. And, creep usually dominates the failure mechanism. Hence, the theory of viscoplasticity is adapted to describe the constitutive behavior. In a multilayered assembly each layer has a different coefficient of thermal expansion. Under thermal cycling, due to heat dissipated from circuits, interfaces and interconnects experience low cycle fatigue. Presently, the state-of-the art damage mechanics model used for fatigue life predictions is based on Kachanov (1986) continuum damage model. This model uses plastic strain as a damage criterion. Since plastic strain is a stress path dependent value, the criterion does not yield unique damage values for the same state of stress. In this dissertation a new damage evolution equation based on the second law of thermodynamic is proposed. The new criterion is based on the entropy of the system and it yields unique damage values for all stress paths to the final state of stress. In the electronics industry, there is a strong desire to develop fatigue free interconnections. The proposed interface/contact element can also simulate the behavior of the fatigue free Z-direction thin film interconnections as well as traditional layered interconnects. The proposed interface element can simulate behavior of a bonded interface or unbonded sliding interface, also called contact element. The proposed element was verified against

  17. The regulation of transactivator of transcription on the activity of DNA-PKcs promoter

    International Nuclear Information System (INIS)

    Yang Tianyi; Zhang Shimeng; Qin Xia; Li Bing; Liu Xiaodan; Zhou Pingkun

    2012-01-01

    Objective: To explore the influence of human immunodeficiency virus transactivator of transcription (TAT) on the promoter activity of DNA dependent protein kinase catalytic subunit (DNA-PKcs). Methods: The truncated promoters of DNA-PKcs were cloned by PCR from the template DNA from HeLa genomic DNA, and the pGL3-basic-DNA-PKcs promoter reporter plasmids were constructed. The activity of DNA-PKcs promoters was detected by dual-luciferase reporter assay system. A Lac-repressor and Lacoperator based green fluorescent protein imaging system was used to assay the chromatin remodeling activity. Results: A series of reporter plasmids harboring the truncated promoters of DNA-PKcs from -939 bp to -1 bp were constructed. The sequence of -64 bp to-1 bp was identified as a critical element for the activity of DNA-PKes promoter. TAT can suppress the activity of DNA-PKcs promoter. TAT participates in the regulation of the large scale chromatin relaxation. Ionizing radiation attenuates the activity of TAT played in the chromatin remodeling. Conclusion: TAT represses the promoter activity of DNA repair protein DNA-PKcs, and also play a role of large scale chromatin remodeling which can te attenuated by ionizing radiation. (authors)

  18. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre

    2006-01-01

    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  19. Altruistic functions for selfish DNA.

    Science.gov (United States)

    Faulkner, Geoffrey J; Carninci, Piero

    2009-09-15

    Mammalian genomes are comprised of 30-50% transposed elements (TEs). The vast majority of these TEs are truncated and mutated fragments of retrotransposons that are no longer capable of transposition. Although initially regarded as important factors in the evolution of gene regulatory networks, TEs are now commonly perceived as neutrally evolving and non-functional genomic elements. In a major development, recent works have strongly contradicted this "selfish DNA" or "junk DNA" dogma by demonstrating that TEs use a host of novel promoters to generate RNA on a massive scale across most eukaryotic cells. This transcription frequently functions to control the expression of protein-coding genes via alternative promoters, cis regulatory non protein-coding RNAs and the formation of double stranded short RNAs. If considered in sum, these findings challenge the designation of TEs as selfish and neutrally evolving genomic elements. Here, we will expand upon these themes and discuss challenges in establishing novel TE functions in vivo.

  20. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite

    2010-08-01

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  1. ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.

    Science.gov (United States)

    Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia

    2017-12-01

    Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.

  2. Ionically conducting Er3+-doped DNA-based biomembranes for electrochromic devices

    International Nuclear Information System (INIS)

    Leones, R.; Fernandes, M.; Sentanin, F.; Cesarino, I.; Lima, J.F.; Zea Bermudez, V. de; Pawlicka, A.; Magon, C.J.; Donoso, J.P.; Silva, M.M.

    2014-01-01

    Biopolymer-based membranes have particular interest due to their biocompatibility, Biodegradability, easy extraction from natural resources and low cost. The incorporation of Er 3+ ions into natural macromolecule hosts with the purpose of producing highly efficient emitting phosphors is of widespread interest in materials science, due to their important roles in display devices. Thus, biomembranes may be viewed as innovative materials for the area of optics. This paper describes studies of luminescent material DNA-based membranes doped with erbium triflate and demonstrates that their potential technological applications may be expanded to electrochromic devices. The sample that exhibits the highest ionic conductivity is DNA 10 Er, (1.17 × 10 −5 and 7.76 × 10 −4 S.cm −1 at 30 and 100 °C, respectively). DSC, XRD and POM showed that the inclusion of the guest salt into DNA does not change significantly its amorphous nature. The overall redox stability was ca. 2.0 V indicating that these materials have an acceptable stability window for applications in solid state electrochemical devices. The EPR analysis suggested that the Er 3+ ions are distributed in various environments. A small ECD comprising a Er 3+ -doped DNA-based membrane was assembled and tested by cyclic voltammetry and chronoamperometry. These electrochemical analyses revealed a pale blue color to transparent color change and a decrease of the charge density from -4.0 to -1.2 mC.cm −2 during 4000 color/bleaching cycles

  3. Exploring repetitive DNA landscapes using REPCLASS, a tool that automates the classification of transposable elements in eukaryotic genomes.

    Science.gov (United States)

    Feschotte, Cédric; Keswani, Umeshkumar; Ranganathan, Nirmal; Guibotsy, Marcel L; Levine, David

    2009-07-23

    Eukaryotic genomes contain large amount of repetitive DNA, most of which is derived from transposable elements (TEs). Progress has been made to develop computational tools for ab initio identification of repeat families, but there is an urgent need to develop tools to automate the annotation of TEs in genome sequences. Here we introduce REPCLASS, a tool that automates the classification of TE sequences. Using control repeat libraries, we show that the program can classify accurately virtually any known TE types. Combining REPCLASS to ab initio repeat finding in the genomes of Caenorhabditis elegans and Drosophila melanogaster allowed us to recover the contrasting TE landscape characteristic of these species. Unexpectedly, REPCLASS also uncovered several novel TE families in both genomes, augmenting the TE repertoire of these model species. When applied to the genomes of distant Caenorhabditis and Drosophila species, the approach revealed a remarkable conservation of TE composition profile within each genus, despite substantial interspecific covariations in genome size and in the number of TEs and TE families. Lastly, we applied REPCLASS to analyze 10 fungal genomes from a wide taxonomic range, most of which have not been analyzed for TE content previously. The results showed that TE diversity varies widely across the fungi "kingdom" and appears to positively correlate with genome size, in particular for DNA transposons. Together, these data validate REPCLASS as a powerful tool to explore the repetitive DNA landscapes of eukaryotes and to shed light onto the evolutionary forces shaping TE diversity and genome architecture.

  4. Adding Social Elements to Game-Based Learning

    OpenAIRE

    Chien-Hung Lai; Yu-Chang Lin; Bin-Shyan Jong; Yen-Teh Hsia

    2014-01-01

    Game-based learning is to present the instruction by games in learning, with the main purpose of triggering learners’ motives instead of instructing the courses. Thus, increasing learning motive by game-based learning becomes a common instructional strategy to enhance learning achievement. However, it is not easy to design interesting games combined with courses. In 2011, Echeverria proposed a design to combine characteristics of games with elements of courses by matching the virtual scenario...

  5. Towards DNA-Based Programmable Matter

    Science.gov (United States)

    2012-02-28

    thiolated   ssDNA  was  first  immobilized  onto  the  gold...surface.  The  surface  was  then  passivated  with   mercaptohexanol.  Subsequently,  another  complementary   thiolated ...right).       Approach  3:  DNA-­‐mediated  interaction  between   polymer -­‐coated  surfaces   We  also  tried

  6. DNA based methods used for characterization and detection of food ...

    African Journals Online (AJOL)

    Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

  7. Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.

    Science.gov (United States)

    Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan

    2017-09-26

    Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.

  8. DNA-based catalytic enantioselective intermolecular oxa-Michael addition reactions

    NARCIS (Netherlands)

    Megens, Rik P.; Roelfes, Gerard

    2012-01-01

    Using the DNA-based catalysis concept, a novel Cu(II) catalyzed enantioselective oxa-Michael addition of alcohols to enones is reported. Enantioselectivities of up to 86% were obtained. The presence of water is important for the reactivity, possibly by reverting unwanted side reactions such as

  9. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  10. Ultrasensitive Electrochemical Detection of Clostridium perfringens DNA Based Morphology-Dependent DNA Adsorption Properties of CeO2 Nanorods in Dairy Products

    Directory of Open Access Journals (Sweden)

    Xingcan Qian

    2018-06-01

    Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.

  11. DMPD: Activation of lymphokine genes in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available thatrespond to T cell activation signals. Arai N, Naito Y, Watanabe M, Masuda ES, Yamaguchi-Iwai Y, Tsuboi A, Heike T,Matsud... in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. Authors Arai N, Naito Y, Watanabe M, Masud...a ES, Yamaguchi-Iwai Y, Tsuboi A, Heike T,Matsuda I, Yokota

  12. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  13. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  14. High-Throughput Array Instrument for DNA-Based Breast Cancer Diagnostics

    National Research Council Canada - National Science Library

    Swerdlow, Harold

    2000-01-01

    ...) for breast-cancer diagnostics. These methods are based upon large numbers of discrete DNA spots placed on glass microscope slides typically, and hybridized to a probe derived from a tIssue or blood sample...

  15. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    Science.gov (United States)

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

    2018-02-12

    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

    Science.gov (United States)

    El-Diasty, Fouad; Abdel-Wahab, Fathy

    2015-10-01

    The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.

  17. Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae

    Directory of Open Access Journals (Sweden)

    E. Coluccia

    2011-05-01

    Full Text Available Muraenidae is a species-rich family, with relationships among genera and species and taxonomy that have not been completely clarified. Few cytogenetic studies have been conducted on this family, and all of them showed the same diploid chromosome number (2n=42 but with conspicuous karyotypic variation among species. The Mediterranean moray eel Gymnothorax unicolor was previously cytogenetically studied using classical techniques that allowed the characterization of its karyotype structure and the constitutive heterochromatin and argyrophilic nucleolar organizer regions (Ag-NORs distribution pattern. In the present study, we describe two new repetitive elements (called GuMboI and GuDdeI obtained from restricted genomic DNA of G. unicolor that were characterized by Southern blot and physically localized by in situ hybridization on metaphase chromosomes. As they are highly repetitive DNA sequences, they map in heterochromatic regions. However, while GuDdeI was localized in the centromeric regions, the GuMboI fraction was distributed on some centromeres and was co-localized with the nucleolus organizer region (NOR. Comparative analysis with other Mediterranean species such as Muraena helena pointed out that these DNA fractions are species-specific and could potentially be used for species discrimination. As a new contribution to the karyotype of this species, we found that the major ribosomal genes are localized on acrocentric chromosome 9 and that the telomeres of each chromosome are composed of a tandem repeat derived from a poly-TTAGGG DNA sequence, as it occurs in most vertebrate species. The results obtained add new information useful in comparative genomics at the chromosomal level and contribute to the cytogenetic knowledge regarding this fish family, which has not been extensively studied.

  18. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Isolation and characterization of repeat elements of the oak genome and their application in population analysis

    International Nuclear Information System (INIS)

    Fluch, S.; Burg, K.

    1998-01-01

    Four minisatellite sequence elements have been identified and isolated from the genome of the oak species Quercus petraea and Quercus robur. Minisatellites 1 and 2 are putative members of repeat families, while minisatellites 3 and 4 show repeat length variation among individuals of test populations. A 590 base pair (bp) long element has also been identified which reveals individual-specific autoradiographic patterns when used as probe in Southern hybridisations of genomic oak DNA. (author)

  20. Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

    International Nuclear Information System (INIS)

    Shamim, S.; Murtaza, S.; Nazar, M.F.

    2016-01-01

    A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

  1. DNA aptamer selection and aptamer-based fluorometric displacement assay for the hepatotoxin microcystin-RR

    International Nuclear Information System (INIS)

    Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile

    2016-01-01

    Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)

  2. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-01

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  3. Development of polygon elements based on the scaled boundary finite element method

    International Nuclear Information System (INIS)

    Chiong, Irene; Song Chongmin

    2010-01-01

    We aim to extend the scaled boundary finite element method to construct conforming polygon elements. The development of the polygonal finite element is highly anticipated in computational mechanics as greater flexibility and accuracy can be achieved using these elements. The scaled boundary polygonal finite element will enable new developments in mesh generation, better accuracy from a higher order approximation and better transition elements in finite element meshes. Polygon elements of arbitrary number of edges and order have been developed successfully. The edges of an element are discretised with line elements. The displacement solution of the scaled boundary finite element method is used in the development of shape functions. They are shown to be smooth and continuous within the element, and satisfy compatibility and completeness requirements. Furthermore, eigenvalue decomposition has been used to depict element modes and outcomes indicate the ability of the scaled boundary polygonal element to express rigid body and constant strain modes. Numerical tests are presented; the patch test is passed and constant strain modes verified. Accuracy and convergence of the method are also presented and the performance of the scaled boundary polygonal finite element is verified on Cook's swept panel problem. Results show that the scaled boundary polygonal finite element method outperforms a traditional mesh and accuracy and convergence are achieved from fewer nodes. The proposed method is also shown to be truly flexible, and applies to arbitrary n-gons formed of irregular and non-convex polygons.

  4. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  5. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  6. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  7. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  8. Age Estimation with DNA: From Forensic DNA Fingerprinting to Forensic (Epi)Genomics: A Mini-Review.

    Science.gov (United States)

    Parson, Walther

    2018-01-23

    Forensic genetics developed from protein-based techniques a quarter of a century ago and became famous as "DNA fingerprinting," this being based on restriction fragment length polymorphisms (RFLPs) of high-molecular-weight DNA. The amplification of much smaller short tandem repeat (STR) sequences using the polymerase chain reaction soon replaced RFLP analysis and advanced to become the gold standard in genetic identification. Meanwhile, STR multiplexes have been developed and made commercially available which simultaneously amplify up to 30 STR loci from as little as 15 cells or fewer. The enormous information content that comes with the large variety of observed STR genotypes allows for genetic individualisation (with the exception of identical twins). Carefully selected core STR loci form the basis of intelligence-led DNA databases that provide investigative leads by linking unsolved crime scenes and criminals through their matched STR profiles. Nevertheless, the success of modern DNA fingerprinting depends on the availability of reference material from suspects. In order to provide new investigative leads in cases where such reference samples are absent, forensic scientists started to explore the prediction of phenotypic traits from the DNA of the evidentiary sample. This paradigm change now uses DNA and epigenetic markers to forecast characteristics that are useful to triage further investigative work. So far, the best investigated externally visible characteristics are eye, hair and skin colour, as well as geographic ancestry and age. Information on the chronological age of a stain donor (or any sample donor) is elemental for forensic investigations in a number of aspects and has, therefore, been explored by researchers in some detail. Among different methodological approaches tested to date, the methylation-sensitive analysis of carefully selected DNA markers (CpG sites) has brought the most promising results by providing prediction accuracies of ±3-4 years

  9. The biology and potential for genetic research of transposable elements in filamentous fungi

    Directory of Open Access Journals (Sweden)

    Léia Cecilia de Lima Fávaro

    2005-12-01

    Full Text Available Recently many transposable elements have been identified and characterized in filamentous fungi, especially in species of agricultural, biotechnological and medical interest. Similar to the elements found in other eukaryotes, fungal transposons can be classified as class I elements (retrotransposons that use RNA and reverse transcriptase and class II elements (DNA transposons that use DNA. The changes (transposition and recombination caused by transposons can supply wide-ranging genetic variation, especially for species that do not have a sexual phase. The application of transposable elements to gene isolation and population analysis is an important tool for molecular biology and studies of fungal evolution.

  10. Cloud-based adaptive exon prediction for DNA analysis.

    Science.gov (United States)

    Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen

    2018-02-01

    Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.

  11. Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe

    Science.gov (United States)

    He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing

    2011-11-01

    The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.

  12. Adding Social Elements to Game-Based Learning

    Directory of Open Access Journals (Sweden)

    Chien-Hung Lai

    2014-05-01

    Full Text Available Game-based learning is to present the instruction by games in learning, with the main purpose of triggering learners’ motives instead of instructing the courses. Thus, increasing learning motive by game-based learning becomes a common instructional strategy to enhance learning achievement. However, it is not easy to design interesting games combined with courses. In 2011, Echeverria proposed a design to combine characteristics of games with elements of courses by matching the virtual scenarios in games with proper courses. However, in the past game-based learning, students were gathered in regular places for several times of game-based learning. Students’ learning was limited by time and space. Therefore, for students’ game-based learning at any time and in any places, based on theories of design elements of online community game Aki Järvinen, this study treats Facebook as the platform of games. The development by online community game is easier, faster and cheaper than traditional video games. In 2006, Facebook allowed API program of the third party. Therefore, by Facebook, this study provides the platform for students to learn in social lives to explore students’ activities in online community games. Questionnaire survey is conducted to find out if the design of non-single user game is attractive for students to participate in game-based learning. In order to make sure that the questionnaires can be the criteria to investigate students’ intention to play games, by statistical program of social science; this study validates reliability and validity of items of questionnaire to effectively control the effect of online community games on students’ learning intention.

  13. Detection of anthrax lef with DNA-based photonic crystal sensors

    Science.gov (United States)

    Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong

    2011-12-01

    Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

  14. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Integrating DNA-based data into bioassessments improves our understanding of species distributions and species habitat relationships

    Science.gov (United States)

    The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or inv...

  16. Comparative DNA isolation behaviours of silica and polymer based sorbents in batch fashion: monodisperse silica microspheres with bimodal pore size distribution as a new sorbent for DNA isolation.

    Science.gov (United States)

    Günal, Gülçin; Kip, Çiğdem; Eda Öğüt, S; İlhan, Hasan; Kibar, Güneş; Tuncel, Ali

    2018-02-01

    Monodisperse silica microspheres with bimodal pore-size distribution were proposed as a high performance sorbent for DNA isolation in batch fashion under equilibrium conditions. The proposed sorbent including both macroporous and mesoporous compartments was synthesized 5.1 μm in-size, by a "staged shape templated hydrolysis and condensation method". Hydrophilic polymer based sorbents were also obtained in the form of monodisperse-macroporous microspheres ca 5.5 μm in size, with different functionalities, by a developed "multi-stage microsuspension copolymerization" technique. The batch DNA isolation performance of proposed material was comparatively investigated using polymer based sorbents with similar morphologies. Among all sorbents tried, the best DNA isolation performance was achieved with the monodisperse silica microspheres with bimodal pore size distribution. The collocation of interconnected mesoporous and macroporous compartments within the monodisperse silica microspheres provided a high surface area and reduced the intraparticular mass transfer resistance and made easier both the adsorption and desorption of DNA. Among the polymer based sorbents, higher DNA isolation yields were achieved with the monodisperse-macroporous polymer microspheres carrying trimethoxysilyl and quaternary ammonium functionalities. However, batch DNA isolation performances of polymer based sorbents were significantly lower with respect to the silica microspheres.

  17. A three-dimensional cell-based smoothed finite element method for elasto-plasticity

    International Nuclear Information System (INIS)

    Lee, Kye Hyung; Im, Se Yong; Lim, Jae Hyuk; Sohn, Dong Woo

    2015-01-01

    This work is concerned with a three-dimensional cell-based smoothed finite element method for application to elastic-plastic analysis. The formulation of smoothed finite elements is extended to cover elastic-plastic deformations beyond the classical linear theory of elasticity, which has been the major application domain of smoothed finite elements. The finite strain deformations are treated with the aid of the formulation based on the hyperelastic constitutive equation. The volumetric locking originating from the nearly incompressible behavior of elastic-plastic deformations is remedied by relaxing the volumetric strain through the mean value. The comparison with the conventional finite elements demonstrates the effectiveness and accuracy of the present approach.

  18. A three-dimensional cell-based smoothed finite element method for elasto-plasticity

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kye Hyung; Im, Se Yong [KAIST, Daejeon (Korea, Republic of); Lim, Jae Hyuk [KARI, Daejeon (Korea, Republic of); Sohn, Dong Woo [Korea Maritime and Ocean University, Busan (Korea, Republic of)

    2015-02-15

    This work is concerned with a three-dimensional cell-based smoothed finite element method for application to elastic-plastic analysis. The formulation of smoothed finite elements is extended to cover elastic-plastic deformations beyond the classical linear theory of elasticity, which has been the major application domain of smoothed finite elements. The finite strain deformations are treated with the aid of the formulation based on the hyperelastic constitutive equation. The volumetric locking originating from the nearly incompressible behavior of elastic-plastic deformations is remedied by relaxing the volumetric strain through the mean value. The comparison with the conventional finite elements demonstrates the effectiveness and accuracy of the present approach.

  19. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  20. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  1. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    -regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

  2. TFIIIC bound DNA elements in nuclear organization and insulation.

    Science.gov (United States)

    Kirkland, Jacob G; Raab, Jesse R; Kamakaka, Rohinton T

    2013-01-01

    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short interspersed nuclear elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer - blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vice versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. This article is part of a Special Issue entitled: Transcription by Odd Pols. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. One-step synthesis of DNA functionalized cadmium-free quantum dots and its application in FRET-based protein sensing

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)

    2017-03-08

    DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.

  4. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  5. Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor

    Science.gov (United States)

    Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh

    2017-09-01

    The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.

  6. The evolution of ultraconserved elements with different phylogenetic origins

    KAUST Repository

    Ryu, Tae Woo

    2012-12-05

    Background: Ultraconserved elements of DNA have been identified in vertebrate and invertebrate genomes. These elements have been found to have diverse functions, including enhancer activities in developmental processes. The evolutionary origins and functional roles of these elements in cellular systems, however, have not yet been determined. Results: Here, we identified a wide range of ultraconserved elements common to distant species, from primitive aquatic organisms to terrestrial species with complicated body systems, including some novel elements conserved in fruit fly and human. In addition to a well-known association with developmental genes, these DNA elements have a strong association with genes implicated in essential cell functions, such as epigenetic regulation, apoptosis, detoxification, innate immunity, and sensory reception. Interestingly, we observed that ultraconserved elements clustered by sequence similarity. Furthermore, species composition and flanking genes of clusters showed lineage-specific patterns. Ultraconserved elements are highly enriched with binding sites to developmental transcription factors regardless of how they cluster. Conclusion: We identified large numbers of ultraconserved elements across distant species. Specific classes of these conserved elements seem to have been generated before the divergence of taxa and fixed during the process of evolution. Our findings indicate that these ultraconserved elements are not the exclusive property of higher modern eukaryotes, but rather transmitted from their metazoan ancestors. 2012 Ryu et al.; licensee BioMed Central Ltd.

  7. Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.

    Science.gov (United States)

    Xiao, Lu; Xiang, Yu

    2016-06-01

    The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. As solid as a rock-comparison of CE- and MPS-based analyses of the petrosal bone as a source of DNA for forensic identification of challenging cranial bones.

    Science.gov (United States)

    Kulstein, Galina; Hadrys, Thorsten; Wiegand, Peter

    2018-01-01

    Short tandem repeat (STR) typing from skeletal remains can be a difficult task. Dependent on the environmental conditions of the provenance of the bones, DNA can be degraded and STR typing inhibited. Generally, dense and compact bones are known to preserve DNA better. Several studies already proved that femora and teeth have high DNA typing success rates. Unfortunately, these elements are not present in all cases involving skeletal remains. Processing partial or singular skeletal elements, it is favorable to select bone areas where DNA preservation is comparably higher. Especially, cranial bones are often accidentally discovered during criminal investigations. The cranial bone is composed of multiple parts. In this examination, we evaluated the potential of the petrous bone for human identification of skeletal remains in forensic case work. Material from different sections of eight unknown cranial bones and-where available-additionally other skeletal elements, collected at the DNA department of the Institute of Legal Medicine in Ulm, Germany, from 2010 to 2017, were processed with an optimized DNA extraction and STR typing strategy. The results highlight that STR typing from the petrous bones leads to reportable profiles in all individuals, even in cases where the analysis of the parietal bone failed. Moreover, the comparison of capillary electrophorese (CE) typing to massively parallel sequencing (MPS) analysis shows that MPS has the potential to analyze degraded human remains and is even capable to provide additional information about phenotype and ancestry of unknown individuals.

  9. Dihydropyridines decrease X-ray-induced DNA base damage in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Wojewodzka, M., E-mail: marylaw@ichtj.waw.pl [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Gradzka, I.; Buraczewska, I.; Brzoska, K.; Sochanowicz, B. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Goncharova, R.; Kuzhir, T. [Institute of Genetics and Cytology, Belarussian National Academy of Sciences, Minsk (Belarus); Szumiel, I. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland)

    2009-12-01

    Compounds with the structural motif of 1,4-dihydropyridine display a broad spectrum of biological activities, often defined as bioprotective. Among them are L-type calcium channel blockers, however, also derivatives which do not block calcium channels exert various effects at the cellular and organismal levels. We examined the effect of sodium 3,5-bis-ethoxycarbonyl-2,6-dimethyl-1,4-dihydropyridine-4-carboxylate (denoted here as DHP and previously also as AV-153) on X-ray-induced DNA damage and mutation frequency at the HGPRT (hypoxanthine-guanine phosphoribosyl transferase) locus in Chinese hamster ovary CHO-K1 cells. Using formamido-pyrimidine glycosylase (FPG) comet assay, we found that 1-h DHP (10 nM) treatment before X-irradiation considerably reduced the initial level of FPG-recognized DNA base damage, which was consistent with decreased 8-oxo-7,8-dihydro-2'-deoxyguanosine content and mutation frequency lowered by about 40%. No effect on single strand break rejoining or on cell survival was observed. Similar base damage-protective effect was observed for two calcium channel blockers: nifedipine (structurally similar to DHP) or verapamil (structurally unrelated). So far, the specificity of the DHP-caused reduction in DNA damage - practically limited to base damage - has no satisfactory explanation.

  10. A parity checker circuit based on microelectromechanical resonator logic elements

    Energy Technology Data Exchange (ETDEWEB)

    Hafiz, Md Abdullah Al, E-mail: abdullah.hafiz@kaust.edu.sa [CEMSE Division, King Abdullah University of Science and Technology, Thuwal (Saudi Arabia); Li, Ren [CEMSE Division, King Abdullah University of Science and Technology, Thuwal (Saudi Arabia); Younis, Mohammad I. [PSE Division, King Abdullah University of Science and Technology, Thuwal (Saudi Arabia); Fariborzi, Hossein [CEMSE Division, King Abdullah University of Science and Technology, Thuwal (Saudi Arabia)

    2017-03-03

    Micro/nano-electromechanical resonator based logic computation has attracted significant attention in recent years due to its dynamic mode of operation, ultra-low power consumption, and potential for reprogrammable and reversible computing. Here we demonstrate a 4-bit parity checker circuit by utilizing recently developed logic gates based on MEMS resonators. Toward this, resonance frequencies of shallow arch shaped micro-resonators are electrothermally tuned by the logic inputs to constitute the required logic gates for the proposed parity checker circuit. This study demonstrates that by utilizing MEMS resonator based logic elements, complex digital circuits can be realized. - Highlights: • A 4-bit parity checker circuit is proposed and demonstrated based on MEMS resonator based logic elements. • Multiple copies of MEMS resonator based XOR logic gates are used to construct a complex logic circuit. • Functionality and feasibility of micro-resonator based logic platform is demonstrated.

  11. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    Science.gov (United States)

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Cytoplasmic transfer of heritable elements other than mtDNA from SAMP1 mice into mouse tumor cells suppresses their ability to form tumors in C57BL6 mice.

    Science.gov (United States)

    Shimizu, Akinori; Tani, Haruna; Takibuchi, Gaku; Ishikawa, Kaori; Sakurazawa, Ryota; Inoue, Takafumi; Hashimoto, Tetsuo; Nakada, Kazuto; Takenaga, Keizo; Hayashi, Jun-Ichi

    2017-11-04

    In a previous study, we generated transmitochondrial P29mtSAMP1 cybrids, which had nuclear DNA from the C57BL6 (referred to as B6) mouse strain-derived P29 tumor cells and mitochondrial DNA (mtDNA) exogenously-transferred from the allogeneic strain SAMP1. Because P29mtSAMP1 cybrids did not form tumors in syngeneic B6 mice, we proposed that allogeneic SAMP1 mtDNA suppressed tumor formation of P29mtSAMP1 cybrids. To test this hypothesis, current study generated P29mt(sp)B6 cybrids carrying all genomes (nuclear DNA and mtDNA) from syngeneic B6 mice by eliminating SAMP1 mtDNA from P29mtSAMP1 cybrids and reintroducing B6 mtDNA. However, the P29mt(sp)B6 cybrids did not form tumors in B6 mice, even though they had no SAMP1 mtDNA, suggesting that SAMP1 mtDNA is not involved in tumor suppression. Then, we examined another possibility of whether SAMP1 mtDNA fragments potentially integrated into the nuclear DNA of P29mtSAMP1 cybrids are responsible for tumor suppression. We generated P29 H (sp)B6 cybrids by eliminating nuclear DNA from P29mt(sp)B6 cybrids and reintroducing nuclear DNA with no integrated SAMP1 mtDNA fragment from mtDNA-less P29 cells resistant to hygromycin in selection medium containing hygromycin. However, the P29 H (sp)B6 cybrids did not form tumors in B6 mice, even though they carried neither SAMP1 mtDNA nor nuclear DNA with integrated SAMP1 mtDNA fragments. Moreover, overproduction of reactive oxygen species (ROS) and bacterial infection were not involved in tumor suppression. These observations suggest that tumor suppression was caused not by mtDNA with polymorphic mutations or infection of cytozoic bacteria but by hypothetical heritable cytoplasmic elements other than mtDNA from SAMP1 mice. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Science.gov (United States)

    Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

    2013-01-01

    Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  14. Application of capillary gas chromatography-mass spectrometry to chemical characterization of radiation-induced base damage of DNA: implications for assessing DNA repair processes

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    The application of capillary gas chromatography-mass spectrometry (GC-MS) to the chemical characterization of radiation-induced base products of calf thymus DNA is presented. Samples of calf thymus DNA irradiated in N 2 O-saturated aqueous solution were hydrolyzed with HCOOH, trimethylsilylated, and subjected to GC-MS analysis using a fused-silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC properties and easily interpretable mass spectra; an intense molecular ion (M+.) and a characteristic (M-CH 3 )+ ion were observed. The complementary use of t-butyldimethylsilyl derivatives was also demonstrated. These derivatives provided an intense characteristic (M-57)+ ion, which appeared as either the base peak or the second most intense ion in the spectra. All mass spectra obtained are discussed

  15. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  16. Synthesis, Characterization and DNA Binding Activity of a Potential DNA Intercalator

    International Nuclear Information System (INIS)

    Siti Norain Harun; Yaakob Razak; Haslina Ahmad

    2016-01-01

    A novel complex, (Ru(dppz) 2 (p-MOPIP)) 2+ (dppz = dipyrido-(3,2-a:20,30-c]phenazine, p-MOPIP = 2-(4-methoxyphenyl) imidazo(4,5-f)(1,10]phenanthroline) has been synthesized and characterized by elemental analysis, 1 H Nuclear Magnetic Resonance spectroscopy, mass spectrometry, Fourier Transform Infrared analysis, Ultra Violet visible and fluorescence spectroscopy. Herein, the complex was designed by adding p-MOPIP as an intercalating ligand and dppz as the ancillary ligand. The DNA binding properties of the complex with Calf Thymus DNA (CT-DNA) were investigated using spectroscopic methods. The UV-visible absorption band observed at 460 nm corresponded to the metal-to-ligand charge transfer (MLCT) while bands at 358 and 281 nm corresponded to intra-ligand (IL) π-π * transitions of the ligand scaffold in p-MOPIP and dppz. The intrinsic binding constant, K b for this complex was 1.67x10 6 M -1 and this suggested that this complex, (Ru(dppz) 2 (p-MOPIP)) 2+ bound to DNA via the intercalative mode. Interestingly, the interaction of this complex with CT-DNA also had a molecular light switch effect. (author)

  17. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  18. A silicon-based electrochemical sensor for highly sensitive, specific, label-free and real-time DNA detection

    International Nuclear Information System (INIS)

    Guo, Yuanyuan; Su, Shao; Wei, Xinpan; Zhong, Yiling; Su, Yuanyuan; He, Yao; Huang, Qing; Fan, Chunhai

    2013-01-01

    We herein present a new kind of silicon-based electrochemical sensor using a gold nanoparticles-decorated silicon wafer (AuNPs@Si) as a high-performance electrode, which is facilely prepared via in situ AuNPs growth on a silicon wafer. Particularly significantly, the resultant electrochemical sensor is efficacious for label-free DNA detection with high sensitivity due to the unique merits of the prepared silicon-based electrode. Typically, DNA at remarkably low concentrations (1–10 fM) could be readily detected without requiring additional signal-amplification procedures, which is better than or comparable to the lowest DNA concentration ever detected via well-studied signal-amplification-assisted electrochemical sensors. Moreover, the silicon-based sensor features high specificity, allowing unambiguous discrimination of single-based mismatches. We further show that real-time DNA assembly is readily monitored via recording the intensity changes of current signals due to the robust thermal stability of the silicon-based electrode. The unprecedented advantages of the silicon-based electrochemical sensor would offer new opportunities for myriad sensing applications. (paper)

  19. Microelectromechanical resonator based digital logic elements

    KAUST Repository

    Hafiz, Md Abdullah Al

    2016-10-20

    Micro/nano-electromechanical resonator based mechanical computing has recently attracted significant attention. However, its full realization has been hindered by the difficulty in realizing complex combinational logics, in which the logic function is constructed by cascading multiple smaller logic blocks. In this work we report an alternative approach for implementation of digital logic core elements, multiplexer and demultiplexer, which can be used to realize combinational logic circuits by suitable concatenation. Toward this, shallow arch shaped microresonators are electrically connected and their resonance frequencies are tuned based on an electrothermal frequency modulation scheme. This study demonstrates that by reconfiguring the same basic building block, the arch microresonator, complex logic circuits can be realized.

  20. Microelectromechanical resonator based digital logic elements

    KAUST Repository

    Hafiz, Md Abdullah Al; Kosuru, Lakshmoji; Younis, Mohammad I.; Fariborzi, Hossein

    2016-01-01

    Micro/nano-electromechanical resonator based mechanical computing has recently attracted significant attention. However, its full realization has been hindered by the difficulty in realizing complex combinational logics, in which the logic function is constructed by cascading multiple smaller logic blocks. In this work we report an alternative approach for implementation of digital logic core elements, multiplexer and demultiplexer, which can be used to realize combinational logic circuits by suitable concatenation. Toward this, shallow arch shaped microresonators are electrically connected and their resonance frequencies are tuned based on an electrothermal frequency modulation scheme. This study demonstrates that by reconfiguring the same basic building block, the arch microresonator, complex logic circuits can be realized.

  1. Finite Element Based Lagrangian Vortex Dynamics Model for Wind Turbine Aerodynamics

    International Nuclear Information System (INIS)

    McWilliam, Michael K; Crawford, Curran

    2014-01-01

    This paper presents a novel aerodynamic model based on Lagrangian Vortex Dynamics (LVD) formulated using a Finite Element (FE) approach. The advantage of LVD is improved fidelity over Blade Element Momentum Theory (BEMT) while being faster than Numerical Navier-Stokes Models (NNSM) in either primitive or velocity-vorticity formulations. The model improves on conventional LVD in three ways. First, the model is based on an error minimization formulation that can be solved with fast root finding algorithms. In addition to improving accuracy, this eliminates the intrinsic numerical instability of conventional relaxed wake simulations. The method has further advantages in optimization and aero-elastic simulations for two reasons. The root finding algorithm can solve the aerodynamic and structural equations simultaneously, avoiding Gauss-Seidel iteration for compatibility constraints. The second is that the formulation allows for an analytical definition for sensitivity calculations. The second improvement comes from a new discretization scheme based on an FE formulation and numerical quadrature that decouples the spatial, influencing and temporal meshes. The shape for each trailing filament uses basis functions (interpolating splines) that allow for both local polynomial order and element size refinement. A completely independent scheme distributes the influencing (vorticity) elements along the basis functions. This allows for concentrated elements in the near wake for accuracy and progressively less in the far-wake for efficiency. Finally the third improvement is the use of a far-wake model based on semi-infinite vortex cylinders where the radius and strength are related to the wake state. The error-based FE formulation allows the transition to the far wake to occur across a fixed plane

  2. A treatise on benzimidazole based Schiff base metal(II) complexes accentuating their biological efficacy: Spectroscopic evaluation of DNA interactions, DNA cleavage and antimicrobial screening

    Energy Technology Data Exchange (ETDEWEB)

    Kumaravel, Ganesan; Raman, Natarajan, E-mail: ramchem1964@gmail.com

    2017-01-01

    Two novel imidazole derived Schiff bases, (Z)-1-(1H-benzo[d]imidazol-2-yl)-N-benzylidenemethanamine (L{sup 1}) and 1-(1H-benzo[d]imidazol-2-yl)-N-(4-nitrobenzylidene) methanamine, and a series of their transition metal complexes of the types [M(L{sup 1}){sub 2}]Cl{sub 2} and [M(L{sup 2}){sub 2}]Cl{sub 2} where, M = Cu(II), Ni(II), Co(II) and Zn(II) have been designed and synthesized. These compounds were characterized by various spectral and physicochemical data. UV–Vis, magnetic susceptibility and molar conductivity data indicate that all the complexes adopt square planar geometry. The EPR spectral data of the Cu(II) complexes have provided supportive evidence to the conclusion derived on the basis of electronic absorption and magnetic moment values. Moreover, the interaction of complexes with DNA via intercalation has been explored by absorption, fluorescence spectroscopy, cyclic voltammetry, viscosity and circular dichroism. Agarose gel electrophoresis technique reveals that the complexes are good metallonucleases. All the compounds have relatively high antibacterial and antifungal potencies. Among the metal complexes, Cu(II) complexes exhibit higher efficacy against all the pathogens. - Highlights: • Synthesis of new and efficient benzimidazole based DNA targeting complexes • Synthesis of efficient metallointercalators • Excellent DNA exploiting ability of Cu(II) complexes • Efficient antimicrobial agents against various pathogens.

  3. Constructing large scale SCI-based processing systems by switch elements

    International Nuclear Information System (INIS)

    Wu, B.; Kristiansen, E.; Skaali, B.; Bogaerts, A.; Divia, R.; Mueller, H.

    1993-05-01

    The goal of this paper is to study some of the design criteria for the switch elements to form the interconnection of large scale SCI-based processing systems. The approved IEEE standard 1596 makes it possible to couple up to 64K nodes together. In order to connect thousands of nodes to construct large scale SCI-based processing systems, one has to interconnect these nodes by switch elements to form different topologies. A summary of the requirements and key points of interconnection networks and switches is presented. Two models of the SCI switch elements are proposed. The authors investigate several examples of systems constructed for 4-switches with simulations and the results are analyzed. Some issues and enhancements are discussed to provide the ideas behind the switch design that can improve performance and reduce latency. 29 refs., 11 figs., 3 tabs

  4. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  5. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Science.gov (United States)

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  6. Reliability-Based Optimization of Structural Elements

    DEFF Research Database (Denmark)

    Sørensen, John Dalsgaard

    In this paper structural elements from an optimization point of view are considered, i.e. only the geometry of a structural element is optimized. Reliability modelling of the structural element is discussed both from an element point of view and from a system point of view. The optimization...

  7. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  8. Extension to linear dynamics for hybrid stress finite element formulation based on additional displacements

    Science.gov (United States)

    Sumihara, K.

    Based upon legitimate variational principles, one microscopic-macroscopic finite element formulation for linear dynamics is presented by Hybrid Stress Finite Element Method. The microscopic application of Geometric Perturbation introduced by Pian and the introduction of infinitesimal limit core element (Baby Element) have been consistently combined according to the flexible and inherent interpretation of the legitimate variational principles initially originated by Pian and Tong. The conceptual development based upon Hybrid Finite Element Method is extended to linear dynamics with the introduction of physically meaningful higher modes.

  9. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  10. Endogenous viral elements in animal genomes.

    Directory of Open Access Journals (Sweden)

    Aris Katzourakis

    2010-11-01

    Full Text Available Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized.

  11. Diverse fates of uracilated HIV-1 DNA during infection of myeloid lineage cells.

    Science.gov (United States)

    Hansen, Erik C; Ransom, Monica; Hesselberth, Jay R; Hosmane, Nina N; Capoferri, Adam A; Bruner, Katherine M; Pollack, Ross A; Zhang, Hao; Drummond, Michael Bradley; Siliciano, Janet M; Siliciano, Robert; Stivers, James T

    2016-09-20

    We report that a major subpopulation of monocyte-derived macrophages (MDMs) contains high levels of dUTP, which is incorporated into HIV-1 DNA during reverse transcription (U/A pairs), resulting in pre-integration restriction and post-integration mutagenesis. After entering the nucleus, uracilated viral DNA products are degraded by the uracil base excision repair (UBER) machinery with less than 1% of the uracilated DNA successfully integrating. Although uracilated proviral DNA showed few mutations, the viral genomic RNA was highly mutated, suggesting that errors occur during transcription. Viral DNA isolated from blood monocytes and alveolar macrophages (but not T cells) of drug-suppressed HIV-infected individuals also contained abundant uracils. The presence of viral uracils in short-lived monocytes suggests their recent infection through contact with virus producing cells in a tissue reservoir. These findings reveal new elements of a viral defense mechanism involving host UBER that may be relevant to the establishment and persistence of HIV-1 infection.

  12. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  13. Insulin increases transcription of rat gene 33 through cis-acting elements in 5[prime]-flanking DNA

    Energy Technology Data Exchange (ETDEWEB)

    Cadilla, C.; Isham, K.R.; Lee, K.L.; Ch' ang, L.Y.; Kenney, F.T. (Oak Ridge National Lab., TN (United States)); Johnson, A.C. (National Cancer Institute, Bethesda, MD (United States). Lab. of Molecular Biology)

    1992-01-01

    Gene 33 is a multihormonally-regulated rat gene whose transcription is rapidly and markedly enhanced by insulin in liver and cultured hepatoma cells. To examine the mechanism by which insulin regulates transcription, the authors have constructed chimeric plasmids in which expression of the bacterial cat gene, encoding chloramphenicol acetyltransferase (CAT), is governed by gene 33 promoter elements and contiguous sequence in DNA flanking the transcription start point (tsp). When transfected into H4IIE hepatoma cells, these constructs gave rise to stably transformed cell lines producing the bacterial CAT enzyme. This expression was increased by insulin treatment in a fashion resembling the effect of this hormone on transcription of the native gene. In vitro transcription assays in nuclear extracts also revealed increased transcription of the chimeric plasmids when the extracts were prepared from insulin-treated rat hepatoma cells. The results demonstrate that induction by insulin is mediated by cis-acting nucleotide sequences located between bp [minus]480 to +27 relative to the tsp.

  14. Hexahedral connection element based on hybrid-stress theory for solid structures

    International Nuclear Information System (INIS)

    Wu, D; Sze, K Y; Lo, S H

    2010-01-01

    For building structures, high-performance hybrid-stress hexahedral solid elements are excellent choices for modelling joints, beams/columns walls and thick slabs if the exact geometrical representation is required. While it is straight-forward to model beam-column structures of uniform member size with solid hexahedral elements, joining up beams and columns of various cross-sections at a common point proves to be a challenge for structural modelling using hexahedral elements with specified dimensions. In general, the joint has to be decomposed into 27 smaller solid elements to cater for the necessary connection requirements. This will inevitably increase the computational cost and introduce element distortions when elements of different sizes have to be used at the joint. Hexahedral connection elements with arbitrary specified connection interfaces will be an ideal setup to connect structural members of different sizes without increasing the number of elements or introducing highly distorted elements. In this paper, based on the hybrid-stress element theory, a general way to construct hexahedral connection element with various interfaces is introduced. Following this way, a 24-node connection element is presented and discussed in detail. Performance of the 24-node connection element equipped with different number of stress modes will be assessed with worked examples.

  15. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  16. Electrochemical DNA biosensor based on the BDD nanograss array electrode.

    Science.gov (United States)

    Jin, Huali; Wei, Min; Wang, Jinshui

    2013-04-10

    The development of DNA biosensor has attracted considerable attention due to their potential applications, including gene analysis, clinical diagnostics, forensic study and more medical applications. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry in this study. Electrochemical DNA biosensor was developed based on the BDD film electrode (fBDD) and BDD nanograss array electrode (nBDD). In comparison with fBDD and AuNPs/CA/fBDD electrode, the lower semicircle diameter of electrochemical impedance spectroscopy obtained on nBDD and AuNPs/CA/nBDD electrode indicated that the presence of nanograss array improved the reactive site, reduced the interfacial resistance, and made the electron transfer easier. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry. The experimental results demonstrated that the prepared AuNPs/CA/nBDD electrode was suitable for DNA hybridization with favorable performance of faster response, higher sensitivity, lower detection limit and satisfactory selectivity, reproducibility and stability.

  17. DNA barcode goes two-dimensions: DNA QR code web server.

    Science.gov (United States)

    Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  18. DNA barcode goes two-dimensions: DNA QR code web server.

    Directory of Open Access Journals (Sweden)

    Chang Liu

    Full Text Available The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  19. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  20. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Quantification of transcription factor-DNA binding affinity in a living cell.

    Science.gov (United States)

    Belikov, Sergey; Berg, Otto G; Wrange, Örjan

    2016-04-20

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [(3)H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Profiling the miRNAs for Early Cancer Detection using DNA-based Logic Gates

    Directory of Open Access Journals (Sweden)

    Tahereh Yahya

    2017-12-01

    Full Text Available Abstract Background: DNA-based computing is an emerging research aspect that enables the in-vivo computation and decision making with significant correctness. Recent papers show that the expression level of miRNAs are related to the progress status of some diseases such as cancers and DNA computing is introduced as a low cost and concise technique for detection of these biomarkers. In this paper, DNA-based logic gates are implemented in the laboratory to detect the level of miR-21 as the biomarker of cancer. Materials and Methods: At the first, required strands for designing DNA gates are synthesized. Then, double stranded gate is generated in laboratory using a temperature gradient that followed by electrophoresis process. This double strand is the computation engine for detecting the miR-21 biomarker. miR-21 is as input in designed gate. At the end, the expression level of miR-21 is identified by measuring the generated fluorescent. Results: at the first stage, the proposed DNA-based logic gate is evaluated by using the synthesized input strands and then it is experimented on a tumor tissue. Experimental results on synthesized strands show that its detection quality/correctness is 2.5x better than conventional methods. Conclusion: Experimental results on the tumor tissues are successful and are matched with those are extracted from real time PCR results. Also, the results show that this method is significantly more suitable than real time PCR in view of time and cost.

  3. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  4. Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

    Science.gov (United States)

    Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

    2018-09-15

    Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  6. SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.

    Science.gov (United States)

    Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra

    2016-03-01

    Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.

  7. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting

    Science.gov (United States)

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai

    2009-01-01

    SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241

  8. Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta.

    Science.gov (United States)

    Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N

    2004-07-16

    A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

  9. DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils.

    Science.gov (United States)

    Schonhoft, Joseph D; Stivers, James T

    2013-04-16

    Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

  10. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  11. Distance-based relative orbital elements determination for formation flying system

    Science.gov (United States)

    He, Yanchao; Xu, Ming; Chen, Xi

    2016-01-01

    The present paper deals with determination of relative orbital elements based only on distance between satellites in the formation flying system, which has potential application in engineering, especially suited for rapid orbit determination required missions. A geometric simplification is performed to reduce the formation configuration in three-dimensional space to a plane. Then the equivalent actual configuration deviating from its nominal design is introduced to derive a group of autonomous linear equations on the mapping between the relative orbital elements differences and distance errors. The primary linear equations-based algorithm is initially proposed to conduct the rapid and precise determination of the relative orbital elements without the complex computation, which is further improved by least-squares method with more distance measurements taken into consideration. Numerical simulations and comparisons with traditional approaches are presented to validate the effectiveness of the proposed methods. To assess the performance of the two proposed algorithms, accuracy validation and Monte Carlo simulations are implemented in the presence of noises of distance measurements and the leader's absolute orbital elements. It is demonstrated that the relative orbital elements determination accuracy of two approaches reaches more than 90% and even close to the actual values for the least-squares improved one. The proposed approaches can be alternates for relative orbit determination without assistance of additional facilities in engineering for their fairly high efficiency with accuracy and autonomy.

  12. Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases

    International Nuclear Information System (INIS)

    Ahmed, Towfiq; Haraldsen, Jason T; Balatsky, Alexander V; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan

    2014-01-01

    Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology. (paper)

  13. Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases

    Science.gov (United States)

    Ahmed, Towfiq; Haraldsen, Jason T.; Rehr, John J.; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V.

    2014-03-01

    Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.

  14. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  15. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  16. Oxidative DNA damage in lung tissue from patients with COPD is clustered in functionally significant sequences

    Directory of Open Access Journals (Sweden)

    Viktor M Pastukh

    2011-03-01

    Full Text Available Viktor M Pastukh1, Li Zhang2, Mykhaylo V Ruchko1, Olena Gorodnya1, Gina C Bardwell1, Rubin M Tuder2, Mark N Gillespie11Department of Pharmacology and Center for Lung Biology, University of South Alabama College of Medicine, Mobile, AL, USA; 2Program in Translational Lung Research, Division of Pulmonary Sciences and Critical Care Medicine, Department of Medicine, University of Colorado at Denver, Aurora, CO, USAAbstract: Lung tissue from COPD patients displays oxidative DNA damage. The present study determined whether oxidative DNA damage was randomly distributed or whether it was localized in specific sequences in either the nuclear or mitochondrial genomes. The DNA damage-specific histone, gamma-H2AX, was detected immunohistochemically in alveolar wall cells in lung tissue from COPD patients but not control subjects. A PCR-based method was used to search for oxidized purine base products in selected 200 bp sequences in promoters and coding regions of the VEGF, TGF-β1, HO-1, Egr1, and β-actin genes while quantitative Southern blot analysis was used to detect oxidative damage to the mitochondrial genome in lung tissue from control subjects and COPD patients. Among the nuclear genes examined, oxidative damage was detected in only 1 sequence in lung tissue from COPD patients: the hypoxic response element (HRE of the VEGF promoter. The content of VEGF mRNA also was reduced in COPD lung tissue. Mitochondrial DNA content was unaltered in COPD lung tissue, but there was a substantial increase in mitochondrial DNA strand breaks and/or abasic sites. These findings show that oxidative DNA damage in COPD lungs is prominent in the HRE of the VEGF promoter and in the mitochondrial genome and raise the intriguing possibility that genome and sequence-specific oxidative DNA damage could contribute to transcriptional dysregulation and cell fate decisions in COPD.Keywords: DNA damage, VEGF hypoxic response element, mtDNA, COPD

  17. Duplex Alu Screening for Degraded DNA of Skeletal Human Remains

    Directory of Open Access Journals (Sweden)

    Fabian Haß

    2017-10-01

    Full Text Available The human-specific Alu elements, belonging to the class of Short INterspersed Elements (SINEs, have been shown to be a powerful tool for population genetic studies. An earlier study in this department showed that it was possible to analyze Alu presence/absence in 3000-year-old skeletal human remains from the Bronze Age Lichtenstein cave in Lower Saxony, Germany. We developed duplex Alu screening PCRs with flanking primers for two Alu elements, each combined with a single internal Alu primer. By adding an internal primer, the approximately 400–500 bp presence signals of Alu elements can be detected within a range of less than 200 bp. Thus, our PCR approach is suited for highly fragmented ancient DNA samples, whereas NGS analyses frequently are unable to handle repetitive elements. With this analysis system, we examined remains of 12 individuals from the Lichtenstein cave with different degrees of DNA degradation. The duplex PCRs showed fully informative amplification results for all of the chosen Alu loci in eight of the 12 samples. Our analysis system showed that Alu presence/absence analysis is possible in samples with different degrees of DNA degradation and it reduces the amount of valuable skeletal material needed by a factor of four, as compared with a singleplex approach.

  18. Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization

    International Nuclear Information System (INIS)

    Liu, P.; Hun, X.; Qing, H.

    2011-01-01

    We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)

  19. Development of swine-specific DNA markers for biosensor-based halal authentication.

    Science.gov (United States)

    Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

    2012-06-29

    The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

  20. Solving probability reasoning based on DNA strand displacement and probability modules.

    Science.gov (United States)

    Zhang, Qiang; Wang, Xiaobiao; Wang, Xiaojun; Zhou, Changjun

    2017-12-01

    In computation biology, DNA strand displacement technology is used to simulate the computation process and has shown strong computing ability. Most researchers use it to solve logic problems, but it is only rarely used in probabilistic reasoning. To process probabilistic reasoning, a conditional probability derivation model and total probability model based on DNA strand displacement were established in this paper. The models were assessed through the game "read your mind." It has been shown to enable the application of probabilistic reasoning in genetic diagnosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand.

    Science.gov (United States)

    Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes

    2012-01-01

    Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.

  2. Dielectrophoretic trapping of DNA-coated gold nanoparticles on silicon based vertical nanogap devices.

    Science.gov (United States)

    Strobel, Sebastian; Sperling, Ralph A; Fenk, Bernhard; Parak, Wolfgang J; Tornow, Marc

    2011-06-07

    We report on the successful dielectrophoretic trapping and electrical characterization of DNA-coated gold nanoparticles on vertical nanogap devices (VNDs). The nanogap devices with an electrode distance of 13 nm were fabricated from Silicon-on-Insulator (SOI) material using a combination of anisotropic reactive ion etching (RIE), selective wet chemical etching and metal thin-film deposition. Au nanoparticles (diameter 40 nm) coated with a monolayer of dithiolated 8 base pairs double stranded DNA were dielectrophoretically trapped into the nanogap from electrolyte buffer solution at MHz frequencies as verified by scanning and transmission electron microscopy (SEM/TEM) analysis. First electrical transport measurements through the formed DNA-Au-DNA junctions partially revealed an approximately linear current-voltage characteristic with resistance in the range of 2-4 GΩ when measured in solution. Our findings point to the importance of strong covalent bonding to the electrodes in order to observe DNA conductance, both in solution and in the dry state. We propose our setup for novel applications in biosensing, addressing the direct interaction of biomolecular species with DNA in aqueous electrolyte media.

  3. Amplification of the Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 lytic origin of DNA replication is dependent upon a cis-acting AT-rich region and an ORF50 response element and the trans-acting factors ORF50 (K-Rta) and K8 (K-bZIP)

    International Nuclear Information System (INIS)

    AuCoin, David P.; Colletti, Kelly S.; Cei, Sylvia A.; Papouskova, Iva; Tarrant, Margaret; Pari, Gregory S.

    2004-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV8), has significant sequence homology to Epstein-Barr virus (EBV). In cell culture, HHV8 is primarily latent, and viral genes associated with lytic replication are not expressed. Two lytic origins of DNA replication (oriLyt) are present within the HHV8 genome and are composed of an AT-rich region adjacent to GC-rich DNA sequences. We have now identified essential cis- and trans-acting elements required for oriLyt-dependent DNA replication. The transient replication assay was used to show that two AT-rich elements, three consensus AP1 transcription factor-binding sites, an ORF50 response element (RE), and a consensus TATA box motif are essential for efficient origin-dependent DNA replication. Transient transfection of luciferase reporter constructs indicated that the downstream region of the HHV8 oriLyt responds to ORF50 and suggests that part of the oriLyt may be an enhancer/promoter. In addition, a transient cotransfection-replication assay elucidated the set of trans-acting factors required for lytic DNA replication. These factors consist of homologues to the core replication proteins: ORF6 (ssDNA binding protein), ORF9 (DNA polymerase), ORF40-41 (primase-associated factor), ORF44 (helicase), ORF56 (primase), and ORF59 (polymerase processivity factor) common to all herpesviruses along with ORF50 (K-Rta) and K8 (K-bZIP)

  4. Molecular analysis of diverse elements mediating VanA glycopeptide resistance in enterococci

    DEFF Research Database (Denmark)

    Palepou, M.F.I.; Adebiyi, A.M.A.; Tremlett, C.H.

    1998-01-01

    Differences were examined among 24 distinct elements mediating VanA-type glycopeptide resistance in enterococci isolated from hospital patients and non-human sources in the UK. The methods used included long-PCR restriction fragment length polymorphism (L-PCR RFLP) analysis and DNA hybridization...... characterized by the presence of an IS1216V/IS3-like/orf1 complex and a point mutation in vanX, both of which were absent from the other 23 groups of VanA elements. This finding is consistent with the dissemination of a stable resistance element. We conclude that L-PCR RFLP analysis, combined with DNA...

  5. Detection of DNA hybridization based on SnO2 nanomaterial enhanced fluorescence

    International Nuclear Information System (INIS)

    Gu Cuiping; Huang Jiarui; Ni Ning; Li Minqiang; Liu Jinhuai

    2008-01-01

    In this paper, enhanced fluorescence emissions were firstly investigated based on SnO 2 nanomaterial, and its application in the detection of DNA hybridization was also demonstrated. The microarray of SnO 2 nanomaterial was fabricated by the vapour phase transport method catalyzed by patterned Au nanoparticles on a silicon substrate. A probe DNA was immobilized on the substrate with patterned SnO 2 nanomaterial, respectively, by covalent and non-covalent linking schemes. When a fluorophore labelled target DNA was hybridized with a probe DNA on the substrate, fluorescence emissions were only observed on the surface of SnO 2 nanomaterial, which indicated the property of enhancing fluorescence signals from the SnO 2 nanomaterial. By comparing the different fluorescence images from covalent and non-covalent linking schemes, the covalent method was confirmed to be more effective for immobilizing a probe DNA. With the combined use of SnO 2 nanomaterial and the covalent linking scheme, the target DNA could be detected at a very low concentration of 10 fM. And the stability of SnO 2 nanomaterial under the experimental conditions was also compared with silicon nanowires. The findings strongly suggested that SnO 2 nanomaterial could be extensively applied in detections of biological samples with enhancing fluorescence property and high stability

  6. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    International Nuclear Information System (INIS)

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong

    2013-01-01

    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  7. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  8. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  9. Synthesis and DNA interaction of a Sm(III) complex of a Schiff base ...

    African Journals Online (AJOL)

    The interaction between the Sm(III) complex of an ionic Schiff base [HL]-, derived from vanillin and L-tryptophan, and herring sperm DNA at physiological pH (7.40) has been studied by UV-Vis absorption, fluorescence and viscosity methods. The binding ratios nSm(III) : nK[HL] = 1:1 and nSm(III)L: nDNA =5:1 were confirmed ...

  10. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    Science.gov (United States)

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  11. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    Science.gov (United States)

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  12. Detection of Avian Influenza Virus by Fluorescent DNA Barcode-based Immunoassay with Sensitivity Comparable to PCR

    DEFF Research Database (Denmark)

    Cao, Cuong; Dhumpa, Raghuram; Bang, Dang Duong

    2010-01-01

    involves the sandwiching of the target AIV between magnetic immunoprobes and barcode-carrying immunoprobes. Because each barcode-carrying immunoprobe is functionalized with a multitude of fluorophore-DNA barcode strands, many DNA barcodes are released for each positive binding event resulting......In this paper, a coupling of fluorophore-DNA barcode and bead-based immunoassay for detecting avian influenza virus (AIV) with PCR-like sensitivity is reported. The assay is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representative barcodes. The detection...

  13. Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.

    Science.gov (United States)

    Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P

    2017-09-01

    Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  16. An ultrasensitive electrochemical DNA biosensor based on a copper oxide nanowires/single-walled carbon nanotubes nanocomposite

    International Nuclear Information System (INIS)

    Chen, Mei; Hou, Changjun; Huo, Danqun; Yang, Mei; Fa, Huanbao

    2016-01-01

    Graphical abstract: A novel and sensitive electrochemical biosensor based on hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH) was first developed for the detection of the specific-sequence target DNA. This schematic represents the fabrication procedure of our DNA biosensor. - Highlights: • An ultrasensitive DNA electrochemical biosensor was developed. • CuO NWs entangled with the SWCNTs formed a mesh structure with good conductivity. • It is the first time use of CuONWs-SWCNTs hybrid nanocomposite for DNA detection. • The biosensor is simple, selective, stable, and sensitive. • The biosensor has great potential for use in analysis of real samples. - Abstract: Here, we developed a novel and sensitive electrochemical biosensor to detect specific-sequence target DNA. The biosensor was based on a hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH). The resulting CuO NWs/SWCNTs layers exhibited a good differential pulse voltammetry (DPV) current response for the target DNA sequences, which we attributed to the properties of CuO NWs and SWCNTs. CuO NWs and SWCNTs hybrid composites with highly conductive and biocompatible nanostructure were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), and cyclic voltammetry (CV). Immobilization of the probe DNA on the electrode surface was largely improved due to the unique synergetic effect of CuO NWs and SWCNTs. DPV was applied to monitor the DNA hybridization event, using adriamycin as an electrochemical indicator. Under optimal conditions, the peak currents of adriamycin were linear with the logarithm of target DNA concentrations (ranging from 1.0 × 10"−"1"4 to 1.0 × 10"−"8 M), with a detection limit of 3.5 × 10"−"1"5 M (signal/noise ratio of 3). The biosensor also showed high selectivity to

  17. An ultrasensitive electrochemical DNA biosensor based on a copper oxide nanowires/single-walled carbon nanotubes nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mei [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Hou, Changjun, E-mail: houcj@cqu.edu.cn [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); National Key Laboratory of Fundamental Science of Micro/Nano-Device and System Technology, Chongqing University, Chongqing 400044 (China); Huo, Danqun [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); National Key Laboratory of Fundamental Science of Micro/Nano-Device and System Technology, Chongqing University, Chongqing 400044 (China); Yang, Mei [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Fa, Huanbao [College of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China)

    2016-02-28

    Graphical abstract: A novel and sensitive electrochemical biosensor based on hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH) was first developed for the detection of the specific-sequence target DNA. This schematic represents the fabrication procedure of our DNA biosensor. - Highlights: • An ultrasensitive DNA electrochemical biosensor was developed. • CuO NWs entangled with the SWCNTs formed a mesh structure with good conductivity. • It is the first time use of CuONWs-SWCNTs hybrid nanocomposite for DNA detection. • The biosensor is simple, selective, stable, and sensitive. • The biosensor has great potential for use in analysis of real samples. - Abstract: Here, we developed a novel and sensitive electrochemical biosensor to detect specific-sequence target DNA. The biosensor was based on a hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH). The resulting CuO NWs/SWCNTs layers exhibited a good differential pulse voltammetry (DPV) current response for the target DNA sequences, which we attributed to the properties of CuO NWs and SWCNTs. CuO NWs and SWCNTs hybrid composites with highly conductive and biocompatible nanostructure were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), and cyclic voltammetry (CV). Immobilization of the probe DNA on the electrode surface was largely improved due to the unique synergetic effect of CuO NWs and SWCNTs. DPV was applied to monitor the DNA hybridization event, using adriamycin as an electrochemical indicator. Under optimal conditions, the peak currents of adriamycin were linear with the logarithm of target DNA concentrations (ranging from 1.0 × 10{sup −14} to 1.0 × 10{sup −8} M), with a detection limit of 3.5 × 10{sup −15} M (signal/noise ratio of 3). The biosensor also showed high

  18. MD study of pyrimidine base damage on DNA and its recognition by repair enzyme

    International Nuclear Information System (INIS)

    Pinak, M.

    2000-01-01

    The molecular dynamics (MD) simulation was used on the study of two specific damages of pyrimidine bases of DNA. Pyrimidine bases are major targets either of free radicals induced by ionizing radiation in DNA surrounding environment or UV radiation. Thymine dimer (TD) is UV induced damage, in which two neighboring thymines in one strand are joined by covalent bonds of C(5)-C(5) and C(6)-C(6) atoms of thymines. Thymine glycol (TG) is ionizing radiation induced damage in which the free water radical adds to unsaturated bond C(5)-C(6) of thymine. Both damages are experimentally suggested to be mutagenetic and carcinogenic unless properly repaired by repair enzymes. In the case of MD of TD, there is detected strong kink around the TD site that is not observed in native DNA. In addition there is observed the different value of electrostatic energy at the TD site - negative '-10 kcal/mol', in contrary to nearly neutral value of native thymine site. Structural changes and specific electrostatic energy - seems to be important for proper recognition of TD damaged site, formation of DNA-enzyme complex and thus for subsequent repair of DNA. In the case of TG damaged DNA there is major structural distortion at the TG site, mainly the increased distance between TG and the C5' of adjacent nucleotide. This enlarged gap between the neighboring nucleotides may prevent the insertion of complementary base during replication causing the replication process to stop. In which extend this structural feature together with energy properties of TG contributes to the proper recognition of TG by repair enzyme Endonuclease III is subject of further computational MD study. (author)

  19. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  20. Electrokinetic transport of rigid macroions in the thin double layer limit: a boundary element approach.

    Science.gov (United States)

    Allison, Stuart A; Xin, Yao

    2005-08-15

    A boundary element (BE) procedure is developed to numerically calculate the electrophoretic mobility of highly charged, rigid model macroions in the thin double layer regime based on the continuum primitive model. The procedure is based on that of O'Brien (R.W. O'Brien, J. Colloid Interface Sci. 92 (1983) 204). The advantage of the present procedure over existing BE methodologies that are applicable to rigid model macroions in general (S. Allison, Macromolecules 29 (1996) 7391) is that computationally time consuming integrations over a large number of volume elements that surround the model particle are completely avoided. The procedure is tested by comparing the mobilities derived from it with independent theory of the mobility of spheres of radius a in a salt solution with Debye-Huckel screening parameter, kappa. The procedure is shown to yield accurate mobilities provided (kappa)a exceeds approximately 50. The methodology is most relevant to model macroions of mean linear dimension, L, with 1000>(kappa)L>100 and reduced absolute zeta potential (q|zeta|/k(B)T) greater than 1.0. The procedure is then applied to the compact form of high molecular weight, duplex DNA that is formed in the presence of the trivalent counterion, spermidine, under low salt conditions. For T4 DNA (166,000 base pairs), the compact form is modeled as a sphere (diameter=600 nm) and as a toroid (largest linear dimension=600 nm). In order to reconcile experimental and model mobilities, approximately 95% of the DNA phosphates must be neutralized by bound counterions. This interpretation, based on electrokinetics, is consistent with independent studies.