Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Indian Academy of Sciences (India)
First page Back Continue Last page Graphics. µE: Electrophoretic mobility. µE: Electrophoretic mobility. E: Intensity of electric field. H: Total height. h: Distance from the top surface of bottom chamber (slug height). N: Cell concentration × Volume of the chamber.
The electrophoretic mobility shift assay (EMSA)
sprotocols
2015-01-01
The electrophoretic mobility shift assay (EMSA), also known as “gel shift assay”, is used to examine the binding parameters and relative affinities of protein and DNA interactions. We produced recombinant CCA1 protein and tested its binding affinity for the promoter fragments that contain CBS (AAAAATCT) or evening element (EE, AAAATATCT) (1) using a modified procedure adopted from published protocols (2,3).
Matyášek, Roman; Fulneček, Jaroslav; Kovařík, Aleš
2013-09-01
DNA containing a sequence that generates a local curvature exhibits a pronounced retardation in electrophoretic mobility. Various theoretical models have been proposed to explain relationship between DNA structural features and migration anomaly. Here, we studied the capacity of 15 static wedge-bending models to predict electrophoretic behavior of 69 satellite monomers derived from four divergent families. All monomers exhibited retarded mobility in PAGE corresponding to retardation factors ranging 1.02-1.54. The curvature varied both within and across the groups and correlated with the number, position, and lengths of A-tracts. Two dinucleotide models provided strong correlation between gel mobility and curvature prediction; two trinucleotide models were satisfactory while remaining dinucleotide models provided intermediate results with reliable prediction for subsets of sequences only. In some cases, similarly shaped molecules exhibited relatively large differences in mobility and vice versa. Generally less accurate predictions were obtained in groups containing less homogeneous sequences possessing distinct structural features. In conclusion, relatively universal theoretical models were identified suitable for the analysis of natural sequences known to harbor relatively moderate curvature. These models could be potentially applied to genome wide studies. However, in silico predictions should be viewed in context of experimental measurement of intrinsic DNA curvature. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F
2012-01-01
An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology. Copyright © 2012 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Lau, Kok-Tee; Sorrell, C.C.
2011-01-01
Coarse (≤20 μm) titanium particles were deposited on low-carbon steel substrates by cathodic electrophoretic deposition (EPD) with ethanol as suspension medium and poly(diallyldimethylammonium chloride) (PDADMAC) as polymeric charging agent. Preliminary data on the electrophoretic mobilities and electrical conductivities on the suspensions of these soft particles as well as the solutions themselves as a function of PDADMAC level were used as the basis for the investigation of the EPD parameters in terms of the deposition yield as a function of five experimental parameters: (a) PDADMAC addition level, (b) solids loading, (c) deposition time, (d) applied voltage, and (e) electrode separation. These data were supported by particle sizing by laser diffraction and deposit surface morphology by scanning electron microscopy (SEM). The preceding data demonstrated that Ti particles of ∼1-12 μm size, electrosterically modified by the PDADMAC charging agent, acted effectively as colloidal particles during EPD. Owing to the non-colloidal nature of the particles and the stabilization of the Ti particles by electrosteric forces, the relevance of the zeta potential is questionable, so the more fundamental parameter of electrophoretic mobility was used. A key finding from the present work is the importance of assessing the electrophoretic mobilities of both the suspensions and solutions since the latter, which normally is overlooked, plays a critical role in the ability to interpret the results meaningfully. Further, algebraic uncoupling of these data plus determination of the deposit yield as a function of charging agent addition allow discrimination between the three main mechanistic stages of the electrokinetics of the process, which are: (1) surface saturation; (2) compression of the diffuse layer, growth of polymer-rich layer, and/or competition between the mobility of Ti and PDADMAC; and (3) little or no decrease in electrophoretic mobility of Ti, establishment of
Energy Technology Data Exchange (ETDEWEB)
Lau, Kok-Tee [School of Materials Science and Engineering, University of New South Wales, Sydney, NSW 2052 (Australia); Faculty of Manufacturing Engineering, Universiti Teknikal Malaysia Melaka, 76109 Durian Tunggal, Melaka (Malaysia); Sorrell, C.C., E-mail: C.Sorrell@unsw.edu.au [School of Materials Science and Engineering, University of New South Wales, Sydney, NSW 2052 (Australia)
2011-03-25
Coarse ({<=}20 {mu}m) titanium particles were deposited on low-carbon steel substrates by cathodic electrophoretic deposition (EPD) with ethanol as suspension medium and poly(diallyldimethylammonium chloride) (PDADMAC) as polymeric charging agent. Preliminary data on the electrophoretic mobilities and electrical conductivities on the suspensions of these soft particles as well as the solutions themselves as a function of PDADMAC level were used as the basis for the investigation of the EPD parameters in terms of the deposition yield as a function of five experimental parameters: (a) PDADMAC addition level, (b) solids loading, (c) deposition time, (d) applied voltage, and (e) electrode separation. These data were supported by particle sizing by laser diffraction and deposit surface morphology by scanning electron microscopy (SEM). The preceding data demonstrated that Ti particles of {approx}1-12 {mu}m size, electrosterically modified by the PDADMAC charging agent, acted effectively as colloidal particles during EPD. Owing to the non-colloidal nature of the particles and the stabilization of the Ti particles by electrosteric forces, the relevance of the zeta potential is questionable, so the more fundamental parameter of electrophoretic mobility was used. A key finding from the present work is the importance of assessing the electrophoretic mobilities of both the suspensions and solutions since the latter, which normally is overlooked, plays a critical role in the ability to interpret the results meaningfully. Further, algebraic uncoupling of these data plus determination of the deposit yield as a function of charging agent addition allow discrimination between the three main mechanistic stages of the electrokinetics of the process, which are: (1) surface saturation; (2) compression of the diffuse layer, growth of polymer-rich layer, and/or competition between the mobility of Ti and PDADMAC; and (3) little or no decrease in electrophoretic mobility of Ti
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...
Shaparenko, N. O.; Beketova, D. I.; Demidova, M. G.; Bulavchenko, A. I.
2018-05-01
The hydrodynamic diameter and electrophoretic mobility of titania nanoparticles in AOT microemulsions are studied depending on their water content (from 0 to 1.5 vol %), chloroform content in n-decane-chloroform mixture (from 0 to 30 vol %) and temperature (from 0 to 60°C). Considerable changes in diameter (from 20 to 400 nm) are detected upon adding water to the microemulsion. The electrophoretic mobility grows by 2-3 times upon adding chloroform, or as the temperature falls. The observed features allow us to halve the time of electrophoretic concentration for 140 nm TiO2 nanoparticles, and to concentrate 14 nm nanoparticles that do not exhibit electrophoretic mobility in the absence of chloroform.
International Nuclear Information System (INIS)
Kryukova, L.M.; Medvedkova, V.V.
1981-01-01
Effect of the exogenous gibberellin on the DNA of plants irradiated with high doses of γ-radiation is studied. Repair of the molecular weight of DNA can be judged on according to electrophoretic mobility in 1% agar sludge of DNA samples denaturated in alkaline. Investigation results reaffirm that exogenous gibberellin promotes to the repair of the DNA of plants damaged with high doses of radiation. The mechanism of the effect of the hormone is not yet studied, but it is supposed that physiological action of the phytohormone is realized through the ferment systems of plants [ru
Cobalt ferrite nanoparticles with improved aqueous colloidal stability and electrophoretic mobility
International Nuclear Information System (INIS)
Munjal, Sandeep; Khare, Neeraj
2016-01-01
We have synthesized CoFe 2 O 4 (CFO) nanoparticles of size ∼ 12.2 nm by hydrothermal synthesis method. To control the size of these CFO nanoparticles, oleic acid was used as a surfactant. The inverse spinel phase of the synthesized nanoparticles was confirmed by X-ray diffraction method. As synthesized oleic acid coated CFO (OA@CFO) nanoparticles has very less electrophoretic mobility in the water and are not water dispersible. These OA@CFO nanoparticles were successfully turned into water soluble phase with a better colloidal aqueous stability, through a chemical treatment using citric acid. The modified citric acid coated CFO (CA@CFO) nanoparticles were dispersible in water and form a stable aqueous solution with high electrophoretic mobility.
NMR studies of electrophoretic mobility in surfactant systems
International Nuclear Information System (INIS)
Conveney, F.M.; Strange, J.H.; Smith, A.L.; Smith, E.G.
1989-01-01
An experimental technique is described in which the flow of electrically charged micelles is measured in the presence of an applied electric field using an NMR technique. The method is used to determine the electrophoretic mobility at ambient temperature of a 5% aqueous solution of sodium dodecyl sulphate and is shown to provide a new technique for the study of electrophoresis in surfactant solutions. (author). 8 refs.; 4 figs
International Nuclear Information System (INIS)
Hoffmann, W.
1982-01-01
The new developed Laser Doppler Cytopherometer (Lazypher) allows the exact and objective measurement of the electrophoretic mobility of particles. Comparative experiments with the Free Flow Cell Electrophoresis instrument of Hannig showed identical results. The impression that the electrophoretic Mobility Test (EMT) is not valid for cancer diagnosis has been substantiated. But in its present form with the new instrument (Lazypher) possible improvements, e.g. isolation of lymphocytes, purification of antigens or indicator particles, can be estimated objectively for their value for the test system. (orig.) [de
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Energy Technology Data Exchange (ETDEWEB)
Lau, Kok-Tee, E-mail: ktlau@utem.edu.my [Faculty of Manufacturing Engineering, Universiti Teknikal Malaysia Melaka, Hang Tuah Jaya, 76100, Durian Tunggal, Melaka (Malaysia); Anand, T. Joseph Sahaya [Faculty of Manufacturing Engineering, Universiti Teknikal Malaysia Melaka, Hang Tuah Jaya, 76100, Durian Tunggal, Melaka (Malaysia); Sorrell, Charles C. [School of Materials Science and Engineering, UNSW Australia, Sydney, NSW 2052 (Australia)
2016-10-01
Proton activities of suspensions of Ti particles with added cationic polyelectrolyte as a function of acid additions have been investigated and compared in terms of the electrophoretic mobility and deposition yield. The proton activity in ethanol medium decreased with the addition of PEI polyelectrolyte and reduced further in the presence of Ti particles. The decrease in proton activity in the suspension indicates that protonation occurred on both the PEI molecules and Ti particles. It is proposed that the protonation of the amine groups of PEI and hydroxyl sites of Ti particle led to the formation of hydrogen bonding between the Ti particle and PEI molecules. Increase in the PEI and Ti with increasing acid addition translated to higher electrophoretic mobilities and deposition yield at low ranges of acetic acid addition (<0.75 vol%). - Highlights: • Protonation characteristics of polyelectrolytes and suspension particles are reported. • The protonation characteristics explained the electrophoretic mobility and yield results. • Adsorption mechanisms of protonated polyelectrolytes on the titanium particle is proposed. • Hydroxyl sites on the particles link the oxide particle and the polyelectrolyte molecules.
International Nuclear Information System (INIS)
Lau, Kok-Tee; Anand, T. Joseph Sahaya; Sorrell, Charles C.
2016-01-01
Proton activities of suspensions of Ti particles with added cationic polyelectrolyte as a function of acid additions have been investigated and compared in terms of the electrophoretic mobility and deposition yield. The proton activity in ethanol medium decreased with the addition of PEI polyelectrolyte and reduced further in the presence of Ti particles. The decrease in proton activity in the suspension indicates that protonation occurred on both the PEI molecules and Ti particles. It is proposed that the protonation of the amine groups of PEI and hydroxyl sites of Ti particle led to the formation of hydrogen bonding between the Ti particle and PEI molecules. Increase in the PEI and Ti with increasing acid addition translated to higher electrophoretic mobilities and deposition yield at low ranges of acetic acid addition (<0.75 vol%). - Highlights: • Protonation characteristics of polyelectrolytes and suspension particles are reported. • The protonation characteristics explained the electrophoretic mobility and yield results. • Adsorption mechanisms of protonated polyelectrolytes on the titanium particle is proposed. • Hydroxyl sites on the particles link the oxide particle and the polyelectrolyte molecules.
Electrophoretic transport of biomolecules across liquid-liquid interfaces
Energy Technology Data Exchange (ETDEWEB)
Hahn, Thomas; Hardt, Steffen [Center of Smart Interfaces, TU Darmstadt, Petersenstrasse 32, D-64287 Darmstadt (Germany); Muenchow, Goetz, E-mail: hardt@csi.tu-darmstadt.de [Institut fuer Mikrotechnik Mainz GmbH, Carl-Zeiss-Strasse 18-20, D-55129 Mainz (Germany)
2011-05-11
The mass transfer resistance of a liquid-liquid interface in an aqueous two-phase system composed of poly(ethylene glycol) and dextran is investigated. Different types of proteins and DNA stained with fluorescent dyes serve as probes to study the transport processes close to the interface. A microfluidic device is employed to enable the electrophoretic transport of biomolecules from one phase to another. The results obtained for proteins can be explained solely via the different electrophoretic mobilities and different affinities of the molecules to the two phases, without any indications of a significant mass transfer resistance of the liquid-liquid interface. By contrast, DNA molecules adsorb to the interface and only desorb under an increased electric field strength. The desorption process carries the signature of a thermally activated escape from a metastable state, as reflected in the exponential decay of the fluorescence intensity at the interface as a function of time.
A substrate-optimized electrophoretic mobility shift assay for ADAM12
DEFF Research Database (Denmark)
Kotzsch, Alexander; Skovgaard, Tine; Buus, Uwe
2014-01-01
long been investigated as pharmaceutical drug targets; however, due to lack of potency and in vivo side effects, none of the small-molecule inhibitors discovered so far has made it beyond clinical testing. Ongoing research on novel selective inhibitors of ADAMs requires reliable biochemical assays...... to validate molecular probes from large-scale screening efforts. Here we describe an electrophoretic mobility shift assay for ADAM12 based on the identification of an optimized peptide substrate that is characterized by excellent performance and reproducibility....
ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS
The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...
Weiss, Victor U.; Kerul, Lukas; Kallinger, Peter; Szymanski, Wladyslaw W.; Marchetti-Deschmann, Martina; Allmaier, Günter
2014-01-01
Nanoparticle characterization is gaining importance in food technology, biotechnology, medicine, and pharmaceutical industry. An instrument to determine particle electrophoretic mobility (EM) diameters in the single-digit to double-digit nanometer range receiving increased attention is the gas-phase electrophoretic mobility molecular analyzer (GEMMA) separating electrophoretically single charged analytes in the gas-phase at ambient pressure. A fused-silica capillary is used for analyte transfer to the gas-phase by means of a nano electrospray (ES) unit. The potential of this capillary to separate analytes electrophoretically in the liquid phase due to different mobilities is, at measurement conditions recommended by the manufacturer, eliminated due to elevated pressure applied for sample introduction. Measurements are carried out upon constant feeding of analytes to the system. Under these conditions, aggregate formation is observed for samples including high amounts of non-volatile components or complex samples. This makes the EM determination of individual species sometimes difficult, if not impossible. With the current study we demonstrate that liquid phase electrophoretic separation of proteins (as exemplary analytes) occurs in the capillary (capillary zone electrophoresis, CE) of the nano ES unit of the GEMMA. This finding was consecutively applied for on-line desalting allowing EM diameter determination of analytes despite a high salt concentration within samples. The present study is to our knowledge the first report on the use of the GEMMA to determine EM diameters of analytes solubilized in the ES incompatible electrolyte solutions by the intended use of electrophoresis (in the liquid phase) during sample delivery. Results demonstrate the proof of concept of such an approach and additionally illustrate the high potential of a future on-line coupling of a capillary electrophoresis to a GEMMA instrument. PMID:25109866
Electrophoretic detection of protein p53 in human leukocytes
International Nuclear Information System (INIS)
Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.
1986-01-01
The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients
Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J
2016-01-01
Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and
Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M
2015-02-01
In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.
DNA-magnetic Particle Binding Analysis by Dynamic and Electrophoretic Light Scattering.
Haddad, Yazan; Dostalova, Simona; Kudr, Jiri; Zitka, Ondrej; Heger, Zbynek; Adam, Vojtech
2017-11-09
Isolation of DNA using magnetic particles is a field of high importance in biotechnology and molecular biology research. This protocol describes the evaluation of DNA-magnetic particles binding via dynamic light scattering (DLS) and electrophoretic light scattering (ELS). Analysis by DLS provides valuable information on the physicochemical properties of particles including particle size, polydispersity, and zeta potential. The latter describes the surface charge of the particle which plays major role in electrostatic binding of materials such as DNA. Here, a comparative analysis exploits three chemical modifications of nanoparticles and microparticles and their effects on DNA binding and elution. Chemical modifications by branched polyethylenimine, tetraethyl orthosilicate and (3-aminopropyl)triethoxysilane are investigated. Since DNA exhibits a negative charge, it is expected that zeta potential of particle surface will decrease upon binding of DNA. Forming of clusters should also affect particle size. In order to investigate the efficiency of these particles in isolation and elution of DNA, the particles are mixed with DNA in low pH (~6), high ionic strength and dehydration environment. Particles are washed on magnet and then DNA is eluted by Tris-HCl buffer (pH = 8). DNA copy number is estimated using quantitative polymerase chain reaction (PCR). Zeta potential, particle size, polydispersity and quantitative PCR data are evaluated and compared. DLS is an insightful and supporting method of analysis that adds a new perspective to the process of screening of particles for DNA isolation.
Electrophoretic mobility patterns of collagen following laser welding
Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.
1991-06-01
Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.
Electrophoretic Retardation of Colloidal Particles in Nonpolar Liquids
Directory of Open Access Journals (Sweden)
Filip Strubbe
2013-04-01
Full Text Available We have measured the electrophoretic mobility of single, optically trapped colloidal particles, while gradually depleting the co-ions and counterions in the liquid around the particle by applying a dc voltage. This is achieved in a nonpolar liquid, where charged reverse micelles act as co-ions and counterions. By increasing the dc voltage, the mobility first increases when the concentrations of co-ions and counterions near the particle start to decrease. At sufficiently high dc voltage (around 2 V, the mobility reaches a saturation value when the co-ions and counterions are fully separated. The increase in mobility is larger when the equilibrium ionic strength is higher. The dependence of the experimental data on the equilibrium ionic strength and on the applied voltage is in good agreement with the standard theory of electrophoretic retardation, assuming that the bare particle charge remains constant. This method is useful for studying the electrophoretic retardation effect and charging mechanisms for nonpolar colloids, and it sheds light on previously unexplained particle acceleration in electronic ink devices.
Huhn, Carolin; Pyell, Ute
2008-07-11
It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.
On the mobility of partially denatured DNA in gel electrophoresis: a theoretical investigation
Sean, David
There are technologies which exploit a rapid reduction of the gel electrophoretic mobility of DNA arising from partial denaturation. The underlying phenomenon behind these experiments---the mechanisms which reduce the mobility---are not very well understood. Such is the purpose of my thesis. The first chapter provides a brief introduction to the field of polymer physics. The subjects covered are carefully chosen to directly relate to the forthcoming research. There is a published semi-empirical formula used to model the rapid decrease of mobility which is largely considered to be consistent with experimental data. The second chapter of this thesis demonstrates that there is a fundamental confusion in the literature regarding the fitting parameter Lr, in the said formula. By going back to the original derivation, a physical interpretation can be given to L r. This interpretation yields theoretical values which are consistent with what has been published. However, we find that an underlying assumption---that the effect of the denaturation does not depend on its position along the DNA fragment---may systematically overestimate experimental observations of Lr. To measure the impact of this assumption, a simulation model of DNA is presented. The article presented in the third chapter reveals that indeed, the position of the denatured region affects the migration of the DNA fragment. A refined version of the formula which takes these factors into account is proposed. The simulations also reveal that, for certain fields, an unexpected conformation completely dominates during migration of the fragment. This surprising result: a squid-like conformation, is explored in chapter four.
2017-10-01
ELISA or... ELISA or quantitative immunofluorescence microscopy Ø Planned activity duration in SOW: 2017 Q1 – 2017 Q3 Ø Proportion of subtask completed: 0% Ø...Subtask 3A: i) validate mouse cell findings using chemiluminescent electrophoretic mobility shift assays (or DNA-binding ELISA technique in
International Nuclear Information System (INIS)
Yamamoto, Osamu; Ogawa, Masaaki; Hoshi, Masaharu
1982-01-01
Application of electrophoresis to the analysis of DNA strand breaks was studied comparing with the sedimentation analysis. A BRL gel electrophoresis system (Type V16) was used for this study. Calf thymus DNA (1 mg/ml) irradiated with 60 Co gamma-rays in SSC solution was applied to both the electrophoretic analysis and the sedimentation analysis. Lamda phage DNA and its fragments were employed as the standard size molecules. In a range from 1 k base pairs to 6 k base pairs in length for double stranded DNA or from 2 k bases to 12 k bases for single stranded DNA, the calculated average molecular weight from the electrophoresis coincided with that from the sedimentation. Number of single strand breaks and double strand breaks were 1.34 x 10 11 breaks/mg/rad (G = 0.215) and 0.48 x 10 5 breaks/mg/rad 2 , respectively. (author)
Electrophoretic properties of BSA-coated quantum dots.
Bücking, Wendelin; Massadeh, Salam; Merkulov, Alexei; Xu, Shu; Nann, Thomas
2010-02-01
Low toxic InP/ZnS quantum dots (QDs), ZnS:Mn(2+)/ZnS nanocrystals and CdSe/ZnS nanoparticles were rendered water-dispersible by different ligand-exchange methods. Eventually, they were coated with bovine serum albumin (BSA) as a model protein. All particles were characterised by isotachophoresis (ITP), laser Doppler velocimetry (LDV) and agarose gel electrophoresis. It was found that the electrophoretic mobility and colloidal stability of ZnS:Mn(2+)/ZnS and CdSe/ZnS nanoparticles, which bore short-chain surface ligands, was primarily governed by charges on the nanoparticles, whereas InP/ZnS nanocrystals were not charged per se. BSA-coated nanoparticles showed lower electrophoretic mobility, which was attributed to their larger size and smaller overall charge. However, these particles were colloidally stable. This stability was probably caused by steric stabilisation of the BSA coating.
Origin of the electrophoretic force on DNA in solid-state nanopores
van Dorp, Stijn; Keyser, Ulrich F.; Dekker, Nynke H.; Dekker, Cees; Lemay, Serge G.
2009-05-01
Despite gel electrophoresis being one of the main workhorses of molecular biology, the physics of polyelectrolyte electrophoresis in a strongly confined environment remains poorly understood. Theory indicates that forces in electrophoresis result from interplay between ionic screening and hydrodynamics, but these ideas could so far be addressed only indirectly by experiments based on macroscopic porous gels. Here, we provide a first direct experimental test by measuring the electrophoretic force on a single DNA molecule threading through a solid-state nanopore as a function of pore size. The stall force gradually decreases on increasing the nanopore diameter from 6 to 90nm, inconsistent with expectations from simple electrostatics and strikingly demonstrating the influence of the hydrodynamic environment. We model this process by applying the coupled Poisson-Boltzmann and Stokes equations in the nanopore geometry and find good agreement with the experimental results.
Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat
2016-02-01
In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
Development of the resolution theory for electrophoretic exclusion.
Kenyon, Stacy M; Keebaugh, Michael W; Hayes, Mark A
2014-09-01
Electrophoretic exclusion, a technique that differentiates species in bulk solution near a channel entrance, has been demonstrated on benchtop and microdevice designs. In these systems, separation occurs when the electrophoretic velocity of one species is greater than the opposing hydrodynamic flow, while the velocity of the other species is less than that flow. Although exclusion has been demonstrated in multiple systems for a range of analytes, a theoretical assessment of resolution has not been addressed. To compare the results of these calculations to traditional techniques, the performance is expressed in terms of smallest difference in electrophoretic mobilities that can be completely separated (R = 1.5). The calculations indicate that closest resolvable species (Δμmin ) differ by approximately 10(-13) m(2) /Vs and peak capacity (nc ) is 1000. Published experimental data were compared to these calculated results. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Stanislawska-Sachadyn, Anna; Paszko, Zygmunt; Kluska, Anna; Skasko, Elzibieta; Sromek, Maria; Balabas, Aneta; Janiec-Jankowska, Aneta; Wisniewska, Alicja; Kur, Jozef; Sachadyn, Pawel
2005-01-01
MutS ability to bind DNA mismatches was applied to the detection of point mutations in PCR products. MutS recognized mismatches from single up to five nucleotides and retarded the electrophoretic migration of mismatched DNA. The electrophoretic detection of insertions/deletions above three nucleotides is also possible without MutS, thanks to the DNA mobility shift caused by the presence of large insertion/deletion loops in the heteroduplex DNA. Thus, the method enables the search for a broad range of mutations: from single up to several nucleotides. The mobility shift assays were carried out in polyacrylamide gels stained with SYBR-Gold. One assay required 50-200 ng of PCR product and 1-3 μg of Thermus thermophilus his 6 -MutS protein. The advantages of this approach are: the small amounts of DNA required for the examination, simple and fast staining, no demand for PCR product purification, no labelling and radioisotopes required. The method was tested in the detection of cancer predisposing mutations in RET, hMSH2, hMLH1, BRCA1, BRCA2 and NBS1 genes. The approach appears to be promising in screening for unknown point mutations
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
Energy Technology Data Exchange (ETDEWEB)
Snyder, C.E. (Oak Ridge National Lab., TN); Schmoyer, R.L.; Bates, R.C.; Mitra, S.
1982-01-01
Vertical slab gel electrophoresis of DNA with CH/sub 3/HgOH-containing agarose produces sharp bands whose mobilities are suitable for size estimation of single-stranded DNA containing 600 to 20,000 bases. The relationship of electrophoretic mobility to size of DNA over this range is a smooth, S-shaped function, and an empirical model was developed to express the relationship. The model involves terms in squared and reciprocal mobilities, and produced excellent fit of known standard markers to measured mobilities. It was used to estimate the sizes of six parvovirus DNAs: Kilham rat virus (KRV), H-1, LuIII, and minute virus of mice (MVM) DNAs had molecular weights of 1.66 to 1.70 x 10/sup 6/, while the molecular weight of bovine parvovirus (BPV) DNA was 1.84 x 10/sup 6/ and that of adenoassociated virus (AAV) DNA was 1.52 x 10/sup 6/.
International Nuclear Information System (INIS)
Thielmann, H.W.; Hecht, R.
1980-01-01
Superhelical DNA of the Pseudomonas phage PM2 was irradiated with UV-light or reacted with covalently binding carcinogens, such as 7-bromomethyl-benz[a]anthracene, (Ac) 2 ONFln, K-region epoxides, and alkylating agents. Migration velocity of the DNA products was determined using agarose gel electrophoresis. In gels of more than 1.3%-1.9% agarose, modified PM2 DNA exhibited a dose-(concentration-)dependent decrease of migration velocity. This phenomenon is probably due to a decrease in superhelix density which caused the compact DNA coil to assume eventually an open-circular conformation. Comparison of the extent of DNA modification with the decrease of migration velocity revealed that the superhelical structure sensitively reflected the chemical DNA alterations. DNA species exhibiting in 1.6% agarose gels, a migration velocity of up to 30% of that of control DNA showed an increase of velocity in 0.4% agarose. Therefore, in 1.3%-1.9% agarose gels, the decrease of superhelix density is accompanied by an increase of the frictional coefficient, whereas in 0.4%-0.9% agarose gels the same decrease of superhelix density apparently led to a higher degree of flexibility of the macromolecule and/or exposure of additional electric charges. (orig.) [de
The Electrophoretic Mobility of Proteins near Surfaces
Ramasamy, Perumal; Singh, Avtar; Rafailovich, Miriam; Sokolov, Jonathan
2004-03-01
We have attempted to apply the methods developed for surface DNA electrophoresis (1) for proteomics. Droplets of FITC stained Abumin, Poly- L-Lysine, or Casein purchased from Sigma were deposited on glass cover slips. The droplets were then place in contact with a TBE buffer solution contained in a cell molded from PDMS. Pt electrodes were inserted into the cell and a voltage was a applied. The motion of the protein was then imaged with a Leica Confocal microscope as a function of buffer concentration, distance from the surface, and applied voltage. The mobilities were then compared with those of uncharged one micron florescent Polystyrene beads. References: 1)Henzel WJ, Watanabe C, Stults JT., !0 Protein Identification: The Origins of Peptide Mass Fingerprinting. !1 J. American Society for Mass Spectrometry. 14 (September 2003): 931-942 2)Mathesius U, Imin N, Natera SH, Rolfe BG., !0 Proteomics as a functional genomics tool. !1 Methods of Molecular Biology 236: 395-414. *Work supported in part by the NSF-MRSEC program
Optimization of the southern electrophoretic transfer method
International Nuclear Information System (INIS)
Allison, M.A.; Fujimura, R.K.
1987-01-01
The technique of separating DNA fragments using agarose gel electrophoresis is essential in the analysis of nucleic acids. Further, after the method of transferring specific DNA fragments from those agarose gels to cellulose nitrate membranes was developed in 1975, a method was developed to transfer DNA, RNA, protein and ribonucleoprotein particles from various gels onto diazobenzyloxymethyl (DBM) paper using electrophoresis as well. This paper describes the optimum conditions for quantitative electrophoretic transfer of DNA onto nylon membranes. This method exemplifies the ability to hybridize the membrane more than once with specific RNA probes by providing sufficient retention of the DNA. Furthermore, the intrinsic properties of the nylon membrane allow for an increase in the efficiency and resolution of transfer while using somewhat harsh alkaline conditions. The use of alkaline conditions is of critical importance since we can now denature the DNA during transfer and thus only a short pre-treatment in acid is required for depurination. 9 refs., 7 figs
LNA effects on DNA binding and conformation
DEFF Research Database (Denmark)
Pabon-Martinez, Y Vladimir; Xu, You; Villa, Alessandra
2017-01-01
-substitution in the duplex pyrimidine strand alters the double helix structure, affecting x-displacement, slide and twist favoring triplex formation through enhanced TFO major groove accommodation. Collectively, these findings should facilitate the design of potent anti-gene ONs.......The anti-gene strategy is based on sequence-specific recognition of double-strand DNA by triplex forming (TFOs) or DNA strand invading oligonucleotides to modulate gene expression. To be efficient, the oligonucleotides (ONs) should target DNA selectively, with high affinity. Here we combined...... hybridization analysis and electrophoretic mobility shift assay with molecular dynamics (MD) simulations to better understand the underlying structural features of modified ONs in stabilizing duplex- and triplex structures. Particularly, we investigated the role played by the position and number of locked...
Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics
Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar
2018-02-01
In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
Survival rate of eukaryotic cells following electrophoretic nanoinjection
Simonis, Matthias; H?bner, Wolfgang; Wilking, Alice; Huser, Thomas; Hennig, Simon
2017-01-01
Insertion of foreign molecules such as functionalized fluorescent probes, antibodies, or plasmid DNA to living cells requires overcoming the plasma membrane barrier without harming the cell during the staining process. Many techniques such as electroporation, lipofection or microinjection have been developed to overcome the cellular plasma membrane, but they all result in reduced cell viability. A novel approach is the injection of cells with a nanopipette and using electrophoretic forces for...
Mpountoukas, Panagiotis; Pantazaki, Anastasia; Kostareli, Efterpi; Christodoulou, Pantelitsa; Kareli, Dimitra; Poliliou, Stamatia; Mourelatos, Costas; Lambropoulou, Vasso; Lialiaris, Theodore
2010-10-01
Food coloring agents, amaranth, erythrosine and tartrazine have been tested at 0.02-8mM in human peripheral blood cells in vitro, in order to investigate their genotoxic, cytotoxic and cytostatic potential. Amaranth at the highest concentration (8mM) demonstrates high genotoxicity, cytostaticity and cytotoxicity. The frequency of SCEs/cell was increased 1.7 times over the control level. Additionally, erythrosine at 8, 4 and 2mM shows a high cytotoxicity and cytostaticity. Finally, tartrazine seems to be toxic at 8 and 4mM. No signs of genotoxicity were observed. Reversely, tartrazine showed cytotoxicity at 1 and 2mM. Furthermore, spectroscopic titration studies for the interaction of these food additives with DNA showed that these dyes bind to calf thymus DNA and distinct isosbestic points are observed clearly suggesting binding of the dyes to DNA. Additionally DNA electrophoretic mobility experiments showed that these colorants are obviously capable for strong binding to linear dsDNA causing its degradation. PCR amplification of all DNA fragments (which previously were pre-treated with three different concentrations of the colorants, extracted from agarose gel after separation and then purified), seems to be attenuated with a manner dye concentration-dependent reflecting in a delayed electrophoretic mobility due to the possible binding of some molecules of the dyes. Evaluation of the data and curves were obtained after quantitative and qualitative analysis of the lanes of the gel by an analyzer computer program. Our results indicate that these food colorants had a toxic potential to human lymphocytes in vitro and it seems that they bind directly to DNA. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
DNA Extraction by Isotachophoresis in a Microfluidic Channel
Energy Technology Data Exchange (ETDEWEB)
Stephenson, S J
2011-08-10
Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing
Weiss, Victor U; Golesne, Monika; Friedbacher, Gernot; Alban, Susanne; Szymanski, Wladyslaw W; Marchetti-Deschmann, Martina; Allmaier, Günter
2018-02-21
Size, size distribution and molecular weight (MW) determination of nanoparticles and that are for example large polymers, are of great interest and pose an analytical challenge. In this context, nano electrospray gas-phase electrophoretic mobility molecular analysis (nES GEMMA) is a valuable tool with growing impact. Separation of single-charged analytes according to their electrophoretic mobility diameter (EMD) starting from single-digit EMDs up to several hundred nm diameters is possible. In case of spherical analytes, the EMD corresponds to the dry nanoparticle size. Additionally, the instrument is capable of number-based, single-particle detection following the recommendation of the European Commission for nanoparticle characterization (2011/696/EU). In case an EMD/MW correlation for a particular compound class (based on availability of well-defined standards) exists, a nanoparticle's MW can be determined from its EMD. In the present study, we focused on nES GEMMA of linear and branched, water-soluble polysaccharides forming nanoparticles and were able to obtain spectra for both analyte classes regarding single-charged species. Based on EMDs for corresponding analytes, an excellent EMD/MW correlation could be obtained in case of the branched natural polymer (dextran). This enables the determination of dextran MWs from nES GEMMA spectra despite high analyte polydispersity and in a size/MW range, where classical mass spectrometry is limited. EMD/MW correlations based on linear (pullulans, oat-ß-glucans) polymers were significantly different, possibly indicating challenges in the exact MW determination of these compounds by, for example, chromatographic and light scattering means. Despite these observations, nES GEMMA of linear, monosaccharide-based polymers enabled the determination of size and size-distribution of such dry bionanoparticles. © 2018 The Authors. Electrophoresis published by Wiley-VCH Verlag GmbH & Co. KGaA.
The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...
DNA-binding specificity and molecular functions of NAC transcription factors
DEFF Research Database (Denmark)
Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila
2005-01-01
The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding....... The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...
Psoralens cleave pBR322 DNA under ultraviolet radiation
International Nuclear Information System (INIS)
Kagan, J.; Xinsheng Chen; Wang, T.P.
1992-01-01
Supercoiled (SC) pBR322 was used to probe the recent claim that 5-geranoxylpsoralen (5-GOP) did not photoreact with DNA. Contrary to expectations, 5-GOP was found to damage DNA in the presence of UV-A through two competing pathways; (a) single strand breaks, identified by the conversion of supercoiled into open circular and linear DNA, and (b) cross-linking, revealed by the fluence-dependent decrease in the extent of denaturation of the double stranded supercoiled DNA to single stranded circular DNA. In addition, a fluence-dependent modification reduced the ability of the restriction enzyme EcoR I to linearize the photosensitized DNA, and alkali-labile lesions were generated. Psoralen, 5-methoxypsoralen, and 8-methoxypsoralen, which are well-known to undergo cycloaddition to DNA, had a more pronounced effect on supercoiled DNA. Single strand breaks occurred more readily than with 5-GOP, and the surviving SC form remaining had reduced electrophoretic mobility in agarose gels. In all cases, the DNA damage was more prominent when oxygen was absent. (author)
Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng
2017-01-01
DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372
Noel, Amélie; Mirbel, Déborah; Cloutet, Eric; Fleury, Guillaume; Schatz, Christophe; Navarro, Christophe; Hadziioannou, Georges; CyrilBrochon
2018-01-01
In order to obtain efficient electrophoretic inks, Tridodecylamine (Dod3N), has been studied as charge control agent (CCA) in a non-polar paraffin solvent (Isopar G) for various inorganic pigments (TiO2 and Fe2O3). All hydrophobic mineral oxides, i.e. treated with octyltrimethoxysilane (C8) or dodecyltrimethoxysilane (C12), were found to be negatively charged in presence of Dod3N. The electrophoretic mobilities of inorganic pigments seemed to be strongly dependent of their isoelectric point (IEP) and also of the concentration of dod3N with an optimum range between 10 and 20 mM depending on the pigments. Finally, an electrophoretic ink constituted of hydrophobic mineral oxides in presence of Dod3N was tested in a device. Its efficiency as charge control agent to negatively charge hydrophobic particles was confirmed through good optical properties and fast response time (220 ms at 200 kV m-1).
Probing DNA with micro- and nanocapillaries and optical tweezers
International Nuclear Information System (INIS)
Steinbock, L J; Otto, O; Skarstam, D R; Jahn, S; Chimerel, C; Gornall, J L; Keyser, U F
2010-01-01
We combine for the first time optical tweezer experiments with the resistive pulse technique based on capillaries. Quartz glass capillaries are pulled into a conical shape with tip diameters as small as 27 nm. Here, we discuss the translocation of λ-phage DNA which is driven by an electrophoretic force through the nanocapillary. The resulting change in ionic current indicates the folding state of single λ-phage DNA molecules. Our flow cell design allows for the straightforward incorporation of optical tweezers. We show that a DNA molecule attached to an optically trapped colloid is pulled into a capillary by electrophoretic forces. The detected electrophoretic force is in good agreement with measurements in solid-state nanopores.
Survival rate of eukaryotic cells following electrophoretic nanoinjection.
Simonis, Matthias; Hübner, Wolfgang; Wilking, Alice; Huser, Thomas; Hennig, Simon
2017-01-25
Insertion of foreign molecules such as functionalized fluorescent probes, antibodies, or plasmid DNA to living cells requires overcoming the plasma membrane barrier without harming the cell during the staining process. Many techniques such as electroporation, lipofection or microinjection have been developed to overcome the cellular plasma membrane, but they all result in reduced cell viability. A novel approach is the injection of cells with a nanopipette and using electrophoretic forces for the delivery of molecules. The tip size of these pipettes is approximately ten times smaller than typical microinjection pipettes and rather than pressure pulses as delivery method, moderate DC electric fields are used to drive charged molecules out of the tip. Here, we show that this approach leads to a significantly higher survival rate of nanoinjected cells and that injection with nanopipettes has a significantly lower impact on the proliferation behavior of injected cells. Thus, we propose that injection with nanopipettes using electrophoretic delivery is an excellent alternative when working with valuable and rare living cells, such as primary cells or stem cells.
Survival rate of eukaryotic cells following electrophoretic nanoinjection
Simonis, Matthias; Hübner, Wolfgang; Wilking, Alice; Huser, Thomas; Hennig, Simon
2017-01-01
Insertion of foreign molecules such as functionalized fluorescent probes, antibodies, or plasmid DNA to living cells requires overcoming the plasma membrane barrier without harming the cell during the staining process. Many techniques such as electroporation, lipofection or microinjection have been developed to overcome the cellular plasma membrane, but they all result in reduced cell viability. A novel approach is the injection of cells with a nanopipette and using electrophoretic forces for the delivery of molecules. The tip size of these pipettes is approximately ten times smaller than typical microinjection pipettes and rather than pressure pulses as delivery method, moderate DC electric fields are used to drive charged molecules out of the tip. Here, we show that this approach leads to a significantly higher survival rate of nanoinjected cells and that injection with nanopipettes has a significantly lower impact on the proliferation behavior of injected cells. Thus, we propose that injection with nanopipettes using electrophoretic delivery is an excellent alternative when working with valuable and rare living cells, such as primary cells or stem cells. PMID:28120926
Interaction of a non-histone chromatin protein (high-mobility group protein 2) with DNA
International Nuclear Information System (INIS)
Goodwin, G.H.; Shooter, K.V.; Johns, E.W.
1975-01-01
The interaction with DNA of the calf thymus chromatin non-histone protein termed the high-mobility group protein 2 has been studied by sedimentation analysis in the ultracentrifuge and by measuring the binding of the 125 I-labelled protein to DNA. The results have been compared with those obtained previously by us [Eur. J. Biochem. (1974) 47, 263-270] for the interaction of high-mobility group protein 1 with DNA. Although the binding parameters are similar for these two proteins, high-mobility group protein 2 differs from high-mobility group protein 1 in that the former appears to change the shape of the DNA to a more compact form. The molecular weight of high-mobility group protein 2 has been determined by equilibrium sedimentation and a mean value of 26,000 was obtained. A low level of nuclease activity detected in one preparation of high-mobility group protein 2 has been investigated. (orig.) [de
Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A
2014-06-01
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.
Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B
2014-03-01
Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Meeting report for mobile DNA 2010.
Chaconas, George; Craig, Nancy; Curcio, M Joan; Deininger, Prescott; Feschotte, Cedric; Levin, Henry; Rice, Phoebe A; Voytas, Daniel F
2010-08-24
An international conference on mobile DNA was held 24-28 April 2010 in Montreal, Canada. Sponsored by the American Society for Microbiology, the conference's goal was to bring together researchers from around the world who study transposition in diverse organisms using multiple experimental approaches. The meeting drew over 190 attendees and most contributed through poster presentations, invited talks and short talks selected from poster abstracts. The talks were organized into eight scientific sessions, which ranged in topic from the evolutionary dynamics of mobile genetic elements to transposition reaction mechanisms. Here we present highlights from the platform sessions with a focus on talks presented by the invited speakers.
Meeting Report for Mobile DNA 2010
Directory of Open Access Journals (Sweden)
Chaconas George
2010-08-01
Full Text Available Abstract An international conference on mobile DNA was held 24-28 April 2010 in Montreal, Canada. Sponsored by the American Society for Microbiology, the conference's goal was to bring together researchers from around the world who study transposition in diverse organisms using multiple experimental approaches. The meeting drew over 190 attendees and most contributed through poster presentations, invited talks and short talks selected from poster abstracts. The talks were organized into eight scientific sessions, which ranged in topic from the evolutionary dynamics of mobile genetic elements to transposition reaction mechanisms. Here we present highlights from the platform sessions with a focus on talks presented by the invited speakers.
Intrinsic bent DNA sites in the chromosomal replication origin of Xylella fastidiosa 9a5c
Directory of Open Access Journals (Sweden)
F. Gimenes
2008-04-01
Full Text Available The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3 located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.
Single DNA imaging and length quantification through a mobile phone microscope
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2016-03-01
The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.
Preparation and surface encapsulation of hollow TiO nanoparticles for electrophoretic displays
International Nuclear Information System (INIS)
Zhao Qian; Tan Tingfeng; Qi Peng; Wang Shirong; Bian Shuguang; Li Xianggao; An Yong; Liu Zhaojun
2011-01-01
Hollow black TiO nanosparticles were obtained via deposition of inorganic coating on the surface of hollow core-shell polymer latex with Ti(OBu) 4 as precursor and subsequent calcination in ammonia gas. Hollow TiO particles were characterized by scanning electron microscope, transmission electronic microscopy, X-ray diffraction, and thermogravimetric analysis. Encapsulation of TiO via dispersion polymerization was promoved by pretreating the pigments with 3-(trimethoxysilyl) propyl methacrylate, making it possible to prepare hollow TiO-polymer particles. When St and DVB were used as polymerization monomer, hollow TiO-polymer core-shell particles came into being via dispersion polymerization, and the lipophilic degree is 28.57%. Glutin-arabic gum microcapsules containing TiO-polymer particles electrophoretic liquid were prepared using via complex coacervation. It was founded that hollow TiO-polymer particles had enough electrophoretic mobility after coating with polymer.
Pedersen-Bjergaard, S; Rasmussen, K E; Sannes, E
1998-01-01
While the hallucinogenic mushrooms Psilocybe semilanceata have previously been analyzed for the indole alkaloids psilocybin and baeocystin by capillary zone electrophoresis (CZE) at pH 11.5, the present work focused on the development of an alternative and complementary capillary electrophoretic method for their identification. Owing to their structural similarity and zwitterionic nature, the compounds were difficult to resolve based on different interactions with cationic or anionic micelles. However, while the attempts with micellar electrokinetic chromatography (MEKC) were unsuccessful, rapid derivatization with propyl chloroformate and reanalysis by CZE at pH 11.5 was effective to support identification of the two indole alkaloids. Psilocin was difficult to analyze by CZE at pH 11.5 owing to comigration with the electroosmotic flow. For this compound, the pH of the running buffer was reduced to 7.2 to effectively enhance the electrophoretic mobility.
Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R
2012-04-01
It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.
A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks
Shaw, Harry
2012-01-01
Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.
DEFF Research Database (Denmark)
Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris
2016-01-01
Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA......-binding proteins have previously been found to be phosphorylated on tyrosine and arginine residues. While tyrosine phosphorylation was shown to enhance the DNA-binding properties of SsbA, arginine phosphorylation was not functionally characterized.Materials and methods: We used mass spectrometry analysis to detect...... phosphorylation of SsbA purified from B. subtilis cells. The detected phosphorylation site was assessed for its influence on DNA-binding in vitro, using electrophoretic mobility shift assays. The ability of B. subtilis serine/threonine kinases to phosphorylate SsbA was assessed using in vitro phosphorylation...
Ascher, Judith; Ceccherini, Maria Teresa; Agnelli, Alberto; Corti, Guiseppe; Pietramellara, Giacomo
2010-05-01
The soil genome consists of an intracellular and an extracellular fraction. Recently, soil extracellular DNA (eDNA) has been shown to be quantitatively relevant, with a high survival capacity and mobility, playing a crucial role in the gene transfer by transformation, in the formation of bacterial biofilm and as a source of nutrients for soil microorganisms. The eDNA fraction can be discriminated and classified by its interaction with clay minerals, humic acids and Al/Fe oxihydroxides, resulting in differently mobile components. The eDNA extractable in water, classified as DNA free in the extracellular soil environment or adsorbed on soil colloids (eDNAfree/adsorbed), is hypothesized to be the most mobile DNA in soil. Challenging to assess the information stored in this DNA fraction, eDNAfree/adsorbed was recovered from fine earth (gel electrophoresis), and qualitative analysis in terms of the composition and distribution of fungal and bacterial communities (Denaturing Gradient Gel Electrophoresis- fingerprinting). The mobile soil eDNA, extracted from each horizon, was characterised by low molecular weight (result of the movement of eDNA along the soil profile and from fine earth to skeleton. The molecular characterization provided information about the autochthonous microflora inhabiting skeleton and fine earth as well as information about the fate of soil DNA in terms of presence, persistence and movement of eDNA and the stored genetic information.
Mobile DNA and evolution in the 21st century
Directory of Open Access Journals (Sweden)
Shapiro James A
2010-01-01
Full Text Available Abstract Scientific history has had a profound effect on the theories of evolution. At the beginning of the 21st century, molecular cell biology has revealed a dense structure of information-processing networks that use the genome as an interactive read-write (RW memory system rather than an organism blueprint. Genome sequencing has documented the importance of mobile DNA activities and major genome restructuring events at key junctures in evolution: exon shuffling, changes in cis-regulatory sites, horizontal transfer, cell fusions and whole genome doublings (WGDs. The natural genetic engineering functions that mediate genome restructuring are activated by multiple stimuli, in particular by events similar to those found in the DNA record: microbial infection and interspecific hybridization leading to the formation of allotetraploids. These molecular genetic discoveries, plus a consideration of how mobile DNA rearrangements increase the efficiency of generating functional genomic novelties, make it possible to formulate a 21st century view of interactive evolutionary processes. This view integrates contemporary knowledge of the molecular basis of genetic change, major genome events in evolution, and stimuli that activate DNA restructuring with classical cytogenetic understanding about the role of hybridization in species diversification.
International Nuclear Information System (INIS)
Lalwani, N.D.; Chaubal, K.A.
1980-01-01
Suspensions of human amnion cells were 60 Co γ-irradiated in the presence of phenobarbital or thiobarbital (50 μg/ml). The barbiturates protected the cells against the dose-dependent reduction in electrophoretic mobility (EPM) observed 4 hours after irradiation of untreated cells, although there was an initial decrease in the EPM of treated cells followed by recovery. Treated irradiated cells exhibited greater colony-forming ability than the untreated cells. Pentobarbital and phenobarbital had similar effects, but thiobarbital was not so effective. 3 H-TdR uptake increased within 4 hours of irradiation for the treated cells. The reproductive capacity of the cells was retained at doses as high as 500 rad. The results are discussed with reference to the effects of anaesthetics on cell membranes. (U.K.)
Association of electrophoretic karyotype of Candida stellatoidea with virulence for mice
International Nuclear Information System (INIS)
Kwon-Chung, K.J.; Wickes, B.L.; Merz, W.G.
1988-01-01
Seven isolates of Candida stellatoidea were studied for their electrophoretic karyotype, virulence for mice, sensitivity to UV radiation, growth rate in vitro, reaction on cycloheximide-indicator medium, and proteinase activity. The isolates exhibited one of two distinct electrophoretic karyotypes as determined by orthogonal field alternating gel electrophoresis (OFAGE). Four isolates, including the type culture of C. stellatoidea, belonged to electrophoretic karyotype type I by OFAGE, showing eight to nine bands of which at least two bands were less than 1,000 kilobases in size as estimated by comparison with the DNA bands of Saccharomyces cerevisiae. These isolates failed to produce fatal infection in mice within 20 days when 5 X 10(5) cells were injected intravenously. The yeasts were cleared from the kidneys of two of three mice tested by day 30. Type I showed proteinase activity on bovine serum albumin agar at pH 3.8 and produced a negative reaction on cycloheximide-bromcresol green medium within 48 h. The three grouped in type II by OFAGE showed banding patterns similar to those of a well-characterized isolate of Candida albicans. The isolates of type II had an electrophoretic karyotype of six to seven bands approximately 1,200 kilobases or greater in size. All three type II isolates were highly virulent for mice, producing fatality curves similar to those of a previously studied C. albicans isolate. From 80 to 90% of the mice injected with 5 X 10(5) cells intravenously died within 20 days. The type II isolates produced a positive reaction on cycloheximide-bromcresol green agar and showed no proteinase activity on bovine serum albumin agar at the low pH. In addition, the type II isolates grew faster and were significantly more resistant to UV irradiation than the type I isolates
Tilted hexagonal post arrays: DNA electrophoresis in anisotropic media.
Chen, Zhen; Dorfman, Kevin D
2014-02-01
Using Brownian dynamics simulations, we show that DNA electrophoresis in a hexagonal array of micron-sized posts changes qualitatively when the applied electric field vector is not coincident with the lattice vectors of the array. DNA electrophoresis in such "tilted" post arrays is superior to the standard "un-tilted" approach; while the time required to achieve a resolution of unity in a tilted post array is similar to an un-tilted array at a low-electric field strengths, this time (i) decreases exponentially with electric field strength in a tilted array and (ii) increases exponentially with electric field strength in an un-tilted array. Although the DNA dynamics in a post array are complicated, the electrophoretic mobility results indicate that the "free path," i.e. the average distance of ballistic trajectories of point-sized particles launched from random positions in the unit cell until they intersect the next post, is a useful proxy for the detailed DNA trajectories. The analysis of the free path reveals a fundamental connection between anisotropy of the medium and DNA transport therein that goes beyond simply improving the separation device. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.
2014-01-01
The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281
DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain
International Nuclear Information System (INIS)
Canuto, K S; Sergio, L P S; Marciano, R S; Guimarães, O R; Polignano, G A C; Geller, M; Fonseca, A S; Paoli, F
2013-01-01
Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)
Epigenetic control of mobile DNA as an interface between experience and genome change
Directory of Open Access Journals (Sweden)
James A. Shapiro
2014-04-01
Full Text Available Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration.
International Nuclear Information System (INIS)
Iliakis, G.E.; Cicilioni, O.; Metzger, L.
1991-01-01
Experiments were performed to calibrate a recently developed pulsed field gel electrophoresis assay, the asymmetric field inversion gel electrophoresis (AFIGE), for the measurement of double-strand breaks (dsb) in the DNA of mammalian cells. Calibration was carried out by means of 125 I decay accumulation, under conditions preventing repair, based on the observation that each 125 I decay in the DNA produces approximately one dsb. Results suggest that that observed fluctuations in the fraction of DNA activity released (FAR) per Gy throughout the cycle reflect cell-cycle-associated differences in the physicochemical properties of the DNA molecules that alter their electrophoretic mobility, rather than variations in the induction of dsb per Gy, i.e. the sensitivity of the assay fluctuates throughout the cycle. (author)
Akdag, Mehmet; Dasdag, Suleyman; Canturk, Fazile; Akdag, Mehmet Zulkuf
2018-01-01
The aim of this study was to investigate effect of radiofrequency radiation (RFR) emitted from mobile phones on DNA damage in follicle cells of hair in the ear canal. The study was carried out on 56 men (age range: 30-60 years old)in four treatment groups with n = 14 in each group. The groups were defined as follows: people who did not use a mobile phone (Control), people use mobile phones for 0-30 min/day (second group), people use mobile phones for 30-60 min/day (third group) and people use mobile phones for more than 60 min/day (fourth group). Ear canal hair follicle cells taken from the subjects were analyzed by the Comet Assay to determine DNA damages. The Comet Assay parameters measured were head length, tail length, comet length, percentage of head DNA, tail DNA percentage, tail moment, and Olive tail moment. Results of the study showed that DNA damage indicators were higher in the RFR exposure groups than in the control subjects. In addition, DNA damage increased with the daily duration of exposure. In conclusion, RFR emitted from mobile phones has a potential to produce DNA damage in follicle cells of hair in the ear canal. Therefore, mobile phone users have to pay more attention when using wireless phones.
Directory of Open Access Journals (Sweden)
Modesto Redrejo-Rodríguez
2017-11-01
Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.
Electrophoretic pattern of blood serum proteins of some of the vertebrates of Pakistan
International Nuclear Information System (INIS)
Shakoori, Abdul Rauf; Zaheer, Saleem Akhtar; Ahmad, Muhammad Salih.
1976-01-01
The electrophoretic pattern of blood serum proteins of some of the common fishes e.g. Catla catla, Cirrhina mrigala, Channa punctatus, Channa marulius, Wallago attu, Heterop-neustes fossilis; amphibia e.g., Rana tigrina, Rana cyanophlyctis, Bufo melanostictus; reptiles e.g. Varanus bengalensis, Uromastix hardwickii; birds e.g. Columba livia, Gallus domesticus, Passer domestica, Anas platyrhynchos; and mammals e.g. Homo sapiens, Mus musculus, Lepus cuniculus have been described. The mobility of proteins of blood sera has been studied over cellulose acetate paper and then a comparative pattern analysed
Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.
Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio
2011-08-01
Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.
Combined electrophoretic-separation and electrospray method and system
Smith, R.D.; Olivares, J.A.
1989-06-27
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.
Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.
Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L
1997-01-01
Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis
Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida
2010-11-01
The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.
DEFF Research Database (Denmark)
Jungwirth, Britta; Sala, Claudia; Kohl, Thomas A
2013-01-01
of the 6C non-coding RNA gene and to non-canonical DNA binding sites within protein-coding regions. The present study underlines the dynamics within the GlxR regulon by identifying in vivo targets during growth on glucose and contributes to the expansion of knowledge of this important transcriptional......The transcriptional regulator GlxR has been characterized as a global hub within the gene-regulatory network of Corynebacterium glutamicum. Chromatin immunoprecipitation with a specific anti-GlxR antibody and subsequent high-throughput sequencing (ChIP-seq) was applied to C. glutamicum to get new...... mapping of these data on the genome sequence of C. glutamicum, 107 enriched DNA fragments were detected from cells grown with glucose as carbon source. GlxR binding sites were identified in the sequence of 79 enriched DNA fragments, of which 21 sites were not previously reported. Electrophoretic mobility...
Yu, W; Sanders, B G; Kline, K
1997-01-01
RRR-alpha-tocopheryl succinate (vitamin E succinate, VES) treatment of murine EL4 T lymphoma cells induced the cells to undergo apoptosis. After 48 hours of VES treatment at 20 micrograms/ml, 95% of cells were apoptotic. Evidence for the induction of apoptosis by VES treatments is based on staining of DNA for detection of chromatin condensation/fragmentation, two-color flow-cytometric analyses of DNA content, and end-labeled DNA and electrophoretic analyses for detection of DNA ladder formation. VES-treated EL4 cells were blocked in the G1 cell cycle phase; however, apoptotic cells came from all cell cycle phases. Analyses of mRNA expression of genes involved in apoptosis revealed decreased c-myc and increased bcl-2, c-fos, and c-jun mRNAs within three to six hours after treatment. Western analyses showed increased c-Jun, c-Fos, and Bcl-2 protein levels. Electrophoretic mobility shift assays showed increased AP-1 binding at 6, 12, and 24 hours after treatment and decreased c-Myc binding after 12 and 24 hours of VES treatment. Treatments of EL4 cells with VES+RRR-alpha-to-copherol reduced apoptosis without effecting DNA synthesis arrest. Treatments of EL4 cells with VES+rac-6-hydroxyl-2, 5,7,8-tetramethyl-chroman-2-carboxylic acid, butylated hydroxytoluene, or butylated hydroxyanisole had no effect on apoptosis or DNA synthesis arrest caused by VES treatments. Analyses of bcl-2, c-myc, c-jun, and c-fos mRNA levels in cells receiving VES + RRR-alpha-tocopherol treatments showed no change from cells receiving VES treatments alone, implying that these changes are correlated with VES treatments but are not causal for apoptosis. However, treatments with VES + RRR-alpha-tocopherol decreased AP-1 binding to consensus DNA oligomer, suggesting AP-1 involvement in apoptosis induced by VES treatments.
Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F
1997-07-01
The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.
Lee, Myung W.; Song, C.K.
2012-01-01
In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).
Tumor transfection after systemic injection of DNA lipid nanocapsules.
Morille, Marie; Passirani, Catherine; Dufort, Sandrine; Bastiat, Guillaume; Pitard, Bruno; Coll, Jean-Luc; Benoit, Jean-Pierre
2011-03-01
With the goal of generating an efficient vector for systemic gene delivery, a new kind of nanocarrier consisting of lipid nanocapsules encapsulating DOTAP/DOPE lipoplexes (DNA LNCs) was pegylated by the post-insertion of amphiphilic and flexible polymers. The aim of this surface modification was to create a long-circulating vector, able to circulate in the blood stream and efficient in transfecting tumoral cells after passive targeting by enhanced permeability and retention effect (EPR effect). PEG conformation, electrostatic features, and hydrophylicity are known to be important factors able to influence the pharmacokinetic behaviour of vectors. In this context, the surface structure characteristics of the newly pegylated DNA LNCs were studied by measuring electrophoretic mobility as a function of ionic strength in order to establish a correlation between surface properties and in vivo performance of the vector. Finally, thanks to this PEGylation, gene expression was measured up to 84-fold higher in tumor compared to other tested organs after intravenous injection. The present results indicate that PEGylated DNA LNCs are promising carriers for an efficient cancer gene therapy. Copyright © 2010 Elsevier Ltd. All rights reserved.
Preferential binding of yeast Rad4-Rad23 complex to damaged DNA
International Nuclear Information System (INIS)
Jansen, L.E.T.; Verhage, R.A.; Brouwer, J.
1998-01-01
The yeast Rad4 and Rad23 proteins form a complex that is involved in nucleotide excision repair (NER). Their function in this process is not known yet, but genetic data suggest that they act in an early step in NER. We have purified an epitope-tagged Rad4.Rad23 (tRad4. Rad23) complex from yeast cells, using a clone overproducing Rad4 with a hemagglutinin-tag at its C terminus. tRad4.Rad23 complex purified by both conventional and immuno-affinity chromatography complements the in vitro repair defect of rad4 and rad23 mutant extracts, demonstrating that these proteins are functional in NER. Using electrophoretic mobility shift assays, we show preferential binding of the tRad4.Rad23 complex to damaged DNA in vitro. UV-irradiated, as well as N-acetoxy-2-(acetylamino)fluorene-treated DNA, is efficiently bound by the protein complex. These data suggest that Rad4.Rad23 interacts with DNA damage during NER and may play a role in recognition of the damage
Electrophoretic studies on corrosion products from secondary side on nuclear steam generator
International Nuclear Information System (INIS)
Das, P.C.; Velmurugan, S.; Sinha, P.K.; Mathur, P.K.
1988-01-01
Electrophoretic mobilities of aqueous suspensions of the steam generator crud samples were determined at 25degC and the zeta potentials were calculated using Smoluchowski equation assuming k. a>>1. The determined (pH) pzc values for different crud samples were compared with the available literature data for magnetite (the major constituent of S.G. crud). The observed shift in the (δ) zeta potentials and crud suspensions towards more negative values in the presence of anions such as Cl - , NO 3 - and SO 4 2- , used for maintaining constant ionic strengths, suggested probable adsorption of these anions on the oxide solution interface. (author). 10 refs
Energy Technology Data Exchange (ETDEWEB)
Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of); Chung, Jeong Min [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of); Yun, Hyung Joong; Won, Jonghan [Advanced Nano Surface Research Group, Korea Basic Science Institute, 169-148 Gwahak-ro, Daejeon, 305-333 (Korea, Republic of); Jung, Hyun Suk, E-mail: hsjung@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of)
2016-01-22
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.
International Nuclear Information System (INIS)
Lee, Sangmin; Chung, Jeong Min; Yun, Hyung Joong; Won, Jonghan; Jung, Hyun Suk
2016-01-01
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.
On some surprising statistical properties of a DNA fingerprinting technique called AFLP
Gort, G.
2010-01-01
AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary
DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.
Rieben, W Kurt; Coulombe, Roger A
2004-12-01
Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.
Sadek, Samir H; Pimenta, Francisco; Pinho, Fernando T; Alves, Manuel A
2017-04-01
In this work, we explore two methods to simultaneously measure the electroosmotic mobility in microchannels and the electrophoretic mobility of micron-sized tracer particles. The first method is based on imposing a pulsed electric field, which allows to isolate electrophoresis and electroosmosis at the startup and shutdown of the pulse, respectively. In the second method, a sinusoidal electric field is generated and the mobilities are found by minimizing the difference between the measured velocity of tracer particles and the velocity computed from an analytical expression. Both methods produced consistent results using polydimethylsiloxane microchannels and polystyrene micro-particles, provided that the temporal resolution of the particle tracking velocimetry technique used to compute the velocity of the tracer particles is fast enough to resolve the diffusion time-scale based on the characteristic channel length scale. Additionally, we present results with the pulse method for viscoelastic fluids, which show a more complex transient response with significant velocity overshoots and undershoots after the start and the end of the applied electric pulse, respectively. © 2016 The Authors. Electrophoresis published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Alu Mobile Elements: From Junk DNA to Genomic Gems
Directory of Open Access Journals (Sweden)
Sami Dridi
2012-01-01
Full Text Available Alus, the short interspersed repeated sequences (SINEs, are retrotransposons that litter the human genomes and have long been considered junk DNA. However, recent findings that these mobile elements are transcribed, both as distinct RNA polymerase III transcripts and as a part of RNA polymerase II transcripts, suggest biological functions and refute the notion that Alus are biologically unimportant. Indeed, Alu RNAs have been shown to control mRNA processing at several levels, to have complex regulatory functions such as transcriptional repression and modulating alternative splicing and to cause a host of human genetic diseases. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity, which further indicates that these mobile retroelements are in fact genomic gems rather than genomic junks.
Concentration polarization in nanochannel DNA electrophoresis
Dubsky, P.; Das, Siddhartha; van den Berg, Albert; Eijkel, Jan C.T.
2011-01-01
We demonstrate that the large field electrophoresis of a single DNA molecule in nanofluidic systems is accompanied by concentration polarization. We illustrate this phenomena by utilizing our electrophoretic simulation tool SIMUL. First we in-vestigate a simple system with univalent strong
Crystal structure and DNA binding of the homeodomain of the stem cell transcription factor Nanog.
Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C; Kolatkar, Prasanna R
2008-02-22
The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.
Crystal Structure and DNA Binding of the Homeodomain of the Stem Cell Transcription Factor Nanog
Energy Technology Data Exchange (ETDEWEB)
Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C.; Kolatkar, Prasanna R. (GI-Singapore); (Scripps)
2010-02-08
The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.
DEFF Research Database (Denmark)
Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate
2009-01-01
within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......The PA promoter in the human uracil-DNA glycosylase gene (UNG) directs expression of the nuclear form (UNG2) of UNG proteins. Using a combination of promoter deletion and mutation analyses, and transient transfection of HeLa cells, we show that repressor and derepressor activities are contained......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...
Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei
2006-01-01
A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592
Electrophoretic deposition of sol-gel-derived ceramic coatings
International Nuclear Information System (INIS)
Zhang, Y.; Crooks, R.M.
1992-01-01
In this paper the physical, optical, and chemical characteristics of electrophoretically and dip-coated sol-gel ceramic films are compared. The results indicate that electrophoresis may allow a higher level of control over the chemistry and structure of ceramic coatings than dip-coating techniques. For example, controlled-thickness sol-gel coatings can be prepared by adjusting the deposition time or voltage. Additionally, electrophoretic coatings can be prepared in a four-component alumino-borosilicate sol display interesting optical characteristics. For example, the ellipsometrically-measured refractive indices of electrophoretic coatings are higher than the refractive indices of dip-coated films cast from identical sols, and they are also higher than any of the individual sol components. This result suggests that there are physical and/or chemical differences between films prepared by dip-coating and electrophoresis
Liu, Chuan; Gao, Peng; Xu, Shang-Cheng; Wang, Yuan; Chen, Chun-Hai; He, Min-Di; Yu, Zheng-Ping; Zhang, Lei; Zhou, Zhou
2013-11-01
To evaluate whether exposure to mobile phone radiation (MPR) can induce DNA damage in male germ cells. A mouse spermatocyte-derived GC-2 cell line was exposed to a commercial mobile phone handset once every 20 min in standby, listen, dialed or dialing modes for 24 h. DNA damage was determined using an alkaline comet assay. The levels of DNA damage were significantly increased following exposure to MPR in the listen, dialed and dialing modes. Moreover, there were significantly higher increases in the dialed and dialing modes than in the listen mode. Interestingly, these results were consistent with the radiation intensities of these modes. However, the DNA damage effects of MPR in the dialing mode were efficiently attenuated by melatonin pretreatment. These results regarding mode-dependent DNA damage have important implications for the safety of inappropriate mobile phone use by males of reproductive age and also suggest a simple preventive measure: Keeping mobile phones as far away from our body as possible, not only during conversations but during 'dialed' and 'dialing' operation modes. Since the 'dialed' mode is actually part of the standby mode, mobile phones should be kept at a safe distance from our body even during standby operation. Furthermore, the protective role of melatonin suggests that it may be a promising pharmacological candidate for preventing mobile phone use-related reproductive impairments.
Preparation of guinea pig macrophage for electrophoretic experiments in space
1979-01-01
Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.
Investigation of the free flow electrophoretic process. Volume 2: Technical analysis
Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.
1979-01-01
The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.
International Nuclear Information System (INIS)
Nielsen, P.E.; Zhen, W.; Henriksen, U.; Buchardt, O.
1988-01-01
The authors have found that di-, tri-, tetra-, and hexa-9-acridinylamines are so efficiently associated with DNA during electrophoresis in polyacrylamide or agarose gels that they retard its migration. The retardation is roughly proportional to the reagent to base pair ratio, and the magnitude of the retardation indicates that a combined charge neutralization/helix extension mechanism is mainly responsible for the effect. Furthermore, DNA sequence dependent differences are observed. Thus, the pUC 19 restriction fragments (HaeIII or AluI), which in the native state comigrate upon gel electrophoretic analysis, could be separated in the presence of a diacridine, and specific DNA fragments responded differently to different diacridines. These results suggest that the effect also is due to a contribution from the DNA conformation and that the DNA conformation dynamics are influenced differently upon binding of different diacridines. They foresee three applications of this observation: (1) in analytical gel electrophoretic separation of otherwise comigrating DNA molecules, (2) in studies of polyintercalator-DNA interaction, and (3) in measurements of polyintercalator-induced DNA unwinding
Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina
2017-07-01
The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.
Directory of Open Access Journals (Sweden)
Bianca Genenncher
2018-02-01
Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.
Quantitative analysis of TALE-DNA interactions suggests polarity effects.
Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P
2013-04-01
Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.
Silva, Marcilene Rezende; Sendin, Shimene Mascarenhas; Araujo, Isabela Couto de Oliveira; Pimentel, Fernanda Silva; Viana, Marcos Borato
2013-01-01
To characterize alpha-chain variant hemoglobins with electric mobility similar to that of hemoglobin S in a newborn screening program. β(S) allele and alpha-thalassemia deletions were investigated in 14 children who had undefined hemoglobin at birth and an electrophoretic profile similar to that of hemoglobin S when they were six months old. Gene sequencing and restriction enzymes (DdeI, BsaJI, NlaIV, Bsu36I and TaqI) were used to identify hemoglobins. Clinical and hematological data were obtained from children who attended scheduled medical visits. THE FOLLOWING ALPHA CHAIN VARIANTS WERE FOUND: seven children with hemoglobin Hasharon [alpha2 47(CE5) Asp>His, HbA2:c.142G>C], all associated with alpha-thalassemia, five with hemoglobin Ottawa [alpha1 15(A13) Gly>Arg, HBA1:c.46G>C], one with hemoglobin St Luke's [alpha1 95(G2) Pro>Arg, HBA1:c.287C>G] and another one with hemoglobin Etobicoke [alpha212 84(F5) Ser>Arg, HBA212:c.255C>G]. Two associations with hemoglobin S were found: one with hemoglobin Ottawa and one with hemoglobin St Luke's. The mutation underlying hemoglobin Etobicoke was located in a hybrid α212 allele in one child. There was no evidence of clinically relevant hemoglobins detected in this study. Apparently these are the first cases of hemoglobin Ottawa, St Luke's, Etobicoke and the α212 gene described in Brazil. The hemoglobins detected in this study may lead to false diagnosis of sickle cell trait or sickle cell disease when only isoelectric focusing is used in neonatal screening. Additional tests are necessary for the correct identification of hemoglobin variants.
Hydrodynamic caracterization and molecular weight stimation of ultrasonically sheared DNA
International Nuclear Information System (INIS)
Garces, F.; Casal, J.I.; Garcia, A.
1981-01-01
The sedimentation coefficients and intrinsec viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight stimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of lambds-DNA. (author) [es
Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA
International Nuclear Information System (INIS)
Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana
2014-01-01
Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode
Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA
Energy Technology Data Exchange (ETDEWEB)
Verebová, Valéria [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia); Adamcik, Jozef [Food and Soft Materials Science, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 9, CH-8092 Zürich (Switzerland); Danko, Patrik; Podhradský, Dušan [Department of Biochemistry, Institute of Chemistry, Faculty of Sciences, P.J. Šafárik University, Moyzesova 11, 041 54 Košice (Slovakia); Miškovský, Pavol [Department of Biophysics, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Center for Interdisciplinary Biosciences, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Staničová, Jana, E-mail: jana.stanicova@uvlf.sk [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia)
2014-01-31
Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.
Sequence Dependent Electrophoretic Separations of DNA in Pluronic F127 Gels
You, Seungyong; van Winkle, David H.
2010-03-01
Two-dimensional (2-D) electrophoresis has successfully been used to visualize the separation of DNA fragments of the same length. We electrophorese a double-stranded DNA ladder in an Agarose gel for the first dimension and in gels of Pluronic F127 for the second dimension at room temperature. The 1000 bp band that travels together as a single band in an Agarose gel is split into two bands in Pluronic gels. The slower band follows the exponential decay trend that the other ladder constituents do. After sequencing the DNA fragments, the faster band has an apparently random sequence, while the slower band and the others have two A-tracts in each 250 bp segment. The A-tracts consist of a series of at least five adenine bases pairing with thymine bases. This result leads to the conclusion that the migration of the DNA molecules bent with A-tracts is more retarded in Pluronic gels than the wild-type of DNA molecules.
Directory of Open Access Journals (Sweden)
Geoffry N De Iuliis
Full Text Available BACKGROUND: In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. PRINCIPAL FINDINGS: Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR tuned to 1.8 GHz and covering a range of specific absorption rates (SAR from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001. Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. CONCLUSIONS: RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications
Polyacrylamide medium for the electrophoretic separation of biomolecules
Madabhushi, Ramakrishna S.; Gammon, Stuart A.
2003-11-11
A polyacryalmide medium for the electrophoretic separation of biomolecules. The polyacryalmide medium comprises high molecular weight polyacrylamides (PAAm) having a viscosity average molecular weight (M.sub.v) of about 675-725 kDa were synthesized by conventional red-ox polymerization technique. Using this separation medium, capillary electrophoresis of BigDye DNA sequencing standard was performed. A single base resolution of .about.725 bases was achieved in .about.60 minute in a non-covalently coated capillary of 50 .mu.m i.d., 40 cm effective length, and a filed of 160 V/cm at 40.degree. C. The resolution achieved with this formulation to separate DNA under identical conditions is much superior (725 bases vs. 625 bases) and faster (60 min. vs. 75 min.) to the commercially available PAAm, such as supplied by Amersham. The formulation method employed here to synthesize PAAm is straight-forward, simple and does not require cumbersome methods such as emulsion polymerizaiton in order to achieve very high molecular weights. Also, the formulation here does not require separation of PAAm from the reaction mixture prior to reconstituting the polymer to a final concentration. Furthermore, the formulation here is prepared from a single average mol. wt. PAAm as opposed to the mixture of two different average mo. wt. PAAm previously required to achieve high resolution.
Electrophoretic transfer protein zymography.
Pan, Daniel; Hill, Adam P; Kashou, Anthony; Wilson, Karl A; Tan-Wilson, Anna
2011-04-15
Zymography detects and characterizes proteolytic enzymes by electrophoresis of protease-containing samples into a nonreducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel containing a copolymerized protein substrate. The usefulness of zymography for molecular weight determination and proteomic analysis is hampered by the fact that some proteases exhibit slower migration through a gel that contains substrate protein. This article introduces electrophoretic transfer protein zymography as one solution to this problem. In this technique, samples containing proteolytic enzymes are first resolved in nonreducing SDS-PAGE on a gel without protein substrate. The proteins in the resolving gel are then electrophoretically transferred to a receiving gel previously prepared with a copolymerized protein substrate. The receiving gel is then developed as a zymogram to visualize clear or lightly stained bands in a dark background. Band intensities are linearly related to the amount of protease, extending the usefulness of the technique so long as conditions for transfer and development of the zymogram are kept constant. Conditions of transfer, such as the pore sizes of resolving and receiving gels and the transfer time relative to the molecular weight of the protease, are explored. Copyright © 2011 Elsevier Inc. All rights reserved.
Diamond electrophoretic microchips-Joule heating effects
International Nuclear Information System (INIS)
Karczemska, Anna T.; Witkowski, Dariusz; Ralchenko, Victor; Bolshakov, Andrey; Sovyk, Dmitry; Lysko, Jan M.; Fijalkowski, Mateusz; Bodzenta, Jerzy; Hassard, John
2011-01-01
Microchip electrophoresis (MCE) has become a mature separation technique in the recent years. In the presented research, a polycrystalline diamond electrophoretic microchip was manufactured with a microwave plasma chemical vapour deposition (MPCVD) method. A replica technique (mould method) was used to manufacture microstructures in diamond. A numerical analysis with CoventorWare TM was used to compare thermal properties during chip electrophoresis of diamond and glass microchips of the same geometries. Temperature distributions in microchips were demonstrated. Thermal, electrical, optical, chemical and mechanical parameters of the polycrystalline diamond layers are advantageous over traditionally used materials for microfluidic devices. Especially, a very high thermal conductivity coefficient gives a possibility of very efficient dissipation of Joule heat from the diamond electrophoretic microchip. This enables manufacturing of a new generation of microdevices.
Diamond electrophoretic microchips-Joule heating effects
Energy Technology Data Exchange (ETDEWEB)
Karczemska, Anna T., E-mail: anna.karczemska@p.lodz.pl [Technical University of Lodz, Institute of Turbomachinery, 219/223 Wolczanska str., Lodz (Poland); Witkowski, Dariusz [Technical University of Lodz, Institute of Turbomachinery, 219/223 Wolczanska str., Lodz (Poland); Ralchenko, Victor, E-mail: ralchenko@nsc.gpi.ru [General Physics Institute, Russian Academy of Science, 38 Vavilov str., Moscow (Russian Federation); Bolshakov, Andrey; Sovyk, Dmitry [General Physics Institute, Russian Academy of Science, 38 Vavilov str., Moscow (Russian Federation); Lysko, Jan M., E-mail: jmlysko@ite.waw.pl [Institute of Electron Technology, Al. Lotnikow 32/46, 02-668 Warsaw (Poland); Fijalkowski, Mateusz, E-mail: petr.louda@vslib.cz [Technical University of Liberec, Faculty of Mechanical Engineering (Czech Republic); Bodzenta, Jerzy, E-mail: jerzy.bodzenta@polsl.pl [Silesian University of Technology, Institute of Physics, 2 Krzywoustego str., 44-100 Gliwice (Poland); Hassard, John, E-mail: j.hassard@imperial.ac.uk [Imperial College of Science, Technology and Medicine, London (United Kingdom)
2011-03-15
Microchip electrophoresis (MCE) has become a mature separation technique in the recent years. In the presented research, a polycrystalline diamond electrophoretic microchip was manufactured with a microwave plasma chemical vapour deposition (MPCVD) method. A replica technique (mould method) was used to manufacture microstructures in diamond. A numerical analysis with CoventorWare{sup TM} was used to compare thermal properties during chip electrophoresis of diamond and glass microchips of the same geometries. Temperature distributions in microchips were demonstrated. Thermal, electrical, optical, chemical and mechanical parameters of the polycrystalline diamond layers are advantageous over traditionally used materials for microfluidic devices. Especially, a very high thermal conductivity coefficient gives a possibility of very efficient dissipation of Joule heat from the diamond electrophoretic microchip. This enables manufacturing of a new generation of microdevices.
Shamim, Uzma; Hanif, Sarmad; Ullah, M F; Azmi, Asfar S; Bhat, Showket H; Hadi, S M
2008-08-01
It was earlier proposed that an important anti-cancer mechanism of plant polyphenols may involve mobilization of endogenous copper ions, possibly chromatin-bound copper and the consequent pro-oxidant action. This paper shows that plant polyphenols are able to mobilize nuclear copper in human lymphocytes, leading to degradation of cellular DNA. A cellular system of lymphocytes isolated from human peripheral blood and comet assay was used for this purpose. Incubation of lymphocytes with neocuproine (a cell membrane permeable copper chelator) inhibited DNA degradation in intact lymphocytes. Bathocuproine, which is unable to permeate through the cell membrane, did not cause such inhibition. This study has further shown that polyphenols are able to degrade DNA in cell nuclei and that such DNA degradation is inhibited by neocuproine as well as bathocuproine (both of which are able to permeate the nuclear pore complex), suggesting that nuclear copper is mobilized in this reaction. Pre-incubation of lymphocyte nuclei with polyphenols indicates that it is capable of traversing the nuclear membrane. This study has also shown that polyphenols generate oxidative stress in lymphocyte nuclei which is inhibited by scavengers of reactive oxygen species (ROS) and neocuproine. These results indicate that the generation of ROS occurs through mobilization of nuclear copper resulting in oxidatively generated DNA breakage.
Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T
2015-08-01
Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel
Directory of Open Access Journals (Sweden)
Marcilene Rezende Silva
2013-01-01
Full Text Available OBJECTIVE: To characterize alpha-chain variant hemoglobins with electric mobility similar to that of hemoglobin S in a newborn screening program. METHODS: βS allele and alpha-thalassemia deletions were investigated in 14 children who had undefined hemoglobin at birth and an electrophoretic profile similar to that of hemoglobin S when they were six months old. Gene sequencing and restriction enzymes (DdeI, BsaJI, NlaIV, Bsu36I and TaqI were used to identify hemoglobins. Clinical and hematological data were obtained from children who attended scheduled medical visits. RESULTS: The following alpha chain variants were found: seven children with hemoglobin Hasharon [alpha2 47(CE5 Asp>His, HbA2:c.142G>C], all associated with alpha-thalassemia, five with hemoglobin Ottawa [alpha1 15(A13 Gly>Arg, HBA1:c.46G>C], one with hemoglobin St Luke's [alpha1 95(G2 Pro>Arg, HBA1:c.287C>G] and another one with hemoglobin Etobicoke [alpha212 84(F5 Ser>Arg, HBA212:c.255C>G]. Two associations with hemoglobin S were found: one with hemoglobin Ottawa and one with hemoglobin St Luke's. The mutation underlying hemoglobin Etobicoke was located in a hybrid α212 allele in one child. There was no evidence of clinically relevant hemoglobins detected in this study. CONCLUSION: Apparently these are the first cases of hemoglobin Ottawa, St Luke's, Etobicoke and the α212 gene described in Brazil. The hemoglobins detected in this study may lead to false diagnosis of sickle cell trait or sickle cell disease when only isoelectric focusing is used in neonatal screening. Additional tests are necessary for the correct identification of hemoglobin variants.
Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B
2018-04-01
Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.
Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin
2015-10-01
Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues
Two high-mobility group box domains act together to underwind and kink DNA
Energy Technology Data Exchange (ETDEWEB)
Sánchez-Giraldo, R.; Acosta-Reyes, F. J. [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain); Malarkey, C. S. [University of Colorado School of Medicine, Aurora, CO 80045 (United States); Saperas, N. [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain); Churchill, M. E. A., E-mail: mair.churchill@ucdenver.edu [University of Colorado School of Medicine, Aurora, CO 80045 (United States); Campos, J. L., E-mail: mair.churchill@ucdenver.edu [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain)
2015-06-30
The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.
Two high-mobility group box domains act together to underwind and kink DNA
International Nuclear Information System (INIS)
Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.
2015-01-01
The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA
A new insight into the interaction of ZnO with calf thymus DNA through surface defects.
Das, Sumita; Chatterjee, Sabyasachi; Pramanik, Srikrishna; Devi, Parukuttyamma Sujatha; Kumar, Gopinatha Suresh
2018-01-01
Experimental evidences on the binding interaction of ZnO and Calf Thymus (CT) DNA using several biophysical techniques are the centre of interest of the present study. The interaction of ZnO with CT DNA has been investigated in detail by absorption spectral study, fluorescence titration, Raman analysis, zeta potential measurement, viscometric experiment along with thermal melting study and microscopic analysis. Steady-state fluorescence study revealed the quenching (48%) of the surface defect related peak intensity of ZnO on interaction with DNA. The optimized concentration of ZnO and DNA to obtain this level of quenching has been found to be 0.049mM and 1.027μM, respectively. Additional fluorescence study with 8-hydroxy-5-quinoline (HQ) as a fluorescence probe for Zn 2+ ruled out the dissolution effect of ZnO under the experimental conditions. DNA conjugation on the surface of ZnO was also supported by Raman study. The quantitative variation in conductivity as well as electrophoretic mobility indicated significant interaction of ZnO with the DNA molecule. Circular dichroism (CD) and viscometry titrations provided clear evidence in support of the conformational retention of the DNA on interaction with ZnO. The binding interaction was found to be predominantly entropy driven in nature. The bio-physical studies presented in this paper exploring ZnO-CT DNA interaction could add a new horizon to understand the interaction between metal oxide and DNA. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Yu-Ming Chang
Full Text Available The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG. Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA. Here we show by electrophoretic mobility shift assay (EMSA, electron microscopy (EM, circular dichroism (CD, and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA, thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.
Effects of cooking methods on electrophoretic patterns of rainbow trout
Directory of Open Access Journals (Sweden)
Yasemen Yanar
2011-07-01
Full Text Available The aim of this study was to determine the effects of different cooking methods on the electrophoretic patterns of rainbow trout (Oncorhynchus mykiss fillets using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE. Raw rainbow trout were deep-fried, microwaved, grilled, and baked and then monitored for changes in the electrophoretic pattern. All cooking methods resulted in significant moisture loss when compared to the raw sample (P
Three-dimensional fluorescence analysis of chernozem humic acids and their electrophoretic fractions
Trubetskoi, O. A.; Trubetskaya, O. E.
2017-09-01
Polyacrylamide gel electrophoresis in combination with size-exclusion chromatography (SEC-PAGE) has been used to obtain stable electrophoretic fractions of different molecular size (MS) from chernozem humic acids (HAs). Three-dimensional fluorescence charts of chernozem HAs and their fractions have been obtained for the first time, and all fluorescence excitation-emission maxima have been identified in the excitation wavelength range of 250-500 nm. It has been found that fractionation by the SEC-PAGE method results in a nonuniform distribution of protein- and humin-like fluorescence of the original HA preparation among the electrophoretic fractions. The electrophoretic fractions of the highest and medium MSs have only the main protein-like fluorescence maximum and traces of humin-like fluorescence. In the electrophoretic fraction of the lowest MS, the intensity of protein-like fluorescence is low, but the major part of humin-like fluorescence is localized there. Relationships between the intensity of protein-like fluorescence and the weight distribution of amino acids have been revealed, as well as between the degree of aromaticity and the intensity of humin-like fluorescence in electrophoretic fractions of different MSs. The obtained relationships can be useful in the interpretation of the spatial structural organization and ecological functions of soil HAs.
International Nuclear Information System (INIS)
Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.
1990-01-01
Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins
International Nuclear Information System (INIS)
Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala
2016-01-01
This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli ( E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10 -7 to 10 -12 M with a detection limit of 1×10 -12 M. (paper)
A method for UV-bonding in the fabrication of glass electrophoretic microchips.
Huang, Z; Sanders, J C; Dunsmor, C; Ahmadzadeh, H; Landers, J P
2001-10-01
This paper presents an approach for the development of methodologies amenable to simple and inexpensive microchip fabrication, potentially applicable to dissimilar materials bonding and chip integration. The method involves a UV-curable glue that can be used for glass microchip fabrication bonding at room temperature. This involves nothing more than fabrication of glue "guide channels" into the microchip architecture that upon exposure to the appropriate UV light source, bonds the etched plate and cover plate together. The microchip performance was verified by capillary zone electrophoresis (CZE) of small fluorescent molecules with no microchannel surface modification carried out, as well as with a DNA fragment separation following surface modification. The performance of these UV-bonded electrophoretic microchips indicates that this method may provide an alternative to high temperature bonding.
Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays
Delwart, E. L.; Sheppard, H. W.; Walker, B. D.; Goudsmit, J.; Mullins, J. I.
1994-01-01
High mutation rates and strong selective pressures imposed on human immunodeficiency viruses in vivo result in the formation of pools of genetic variants known as quasispecies. DNA heteroduplex mobility and tracking analyses were used to monitor the generation of HIV sequence diversity, to estimate
Directory of Open Access Journals (Sweden)
MA Ghatee
2013-06-01
Full Text Available Background: Leishmania tropica is a genetically divergent species. Amplification of entire internal transcribed spacer (ITS region of L. tropica isolates obtained from Bam district, one of the well known focus of anthroponotic cutaneous leishmaniasis ACL( in Iran, revealed a double-band pattern in agarose gel electrophoresis. This study explains how this pattern occurs.Methods: Twenty seven L. tropica smear preparations were collected from Bam district, south east Iran, and eight L. major and one L. infantum smear preparations were gathered from Shiraz, south west Iran. Furthermore one L. major and one L. infantum cultured standard strains were tested using entire ITS-PCR to survey their electrophoretic pattern. The ITS sequences of L. tropica, L. major, and L. infantum already deposited in GenBank were analyzed. Analysis of GenBank sequences of L. tropica revealed two groups of sequences based on length size, one group having a 100 bp gap. Therefore, a new reverse primer namely LITS-MG was designed to exclude this gap in PCR products.Results: Whole ITS fragment amplification resulted in a double-band pattern in all L. tropica cases, while a sharp single band was observed for L. infantum and L. major isolates. This result was corresponding to the result obtained from in silico analysis of GenBank sequences. Use of LITS-MG primer was expectedly resulted in a single band including ITS1, 5.8s and partial ITS2 product for L. tropica which is appropriate for following molecular studies such as sequencing or restriction analysis.Conclusion: Sequences analysis of GenBank L. tropica sequences and following practical laboratory tests revealed at least two alleles in L. tropica which were confirmed in Bam isolates. This especial double-band pattern is because of a 100 bp fragment difference within ITS-rDNA alleles
International Nuclear Information System (INIS)
Yamamoto, Osamu; Fuji, Izumi
1984-01-01
Lambda DNA solution was prepared at a concentration of 125μg/ml of 10mM Tris-HCl-5mM NaCl-1mM Na 2 EDTA (pH 7.4). Solutions were irradiated with 60 Co gamma-rays and 3 H beta-rays ( 3 HHO addition), respectively. After irradiation of DNA solutions, single-strand breaks and double-strand breaks were detected by a vertical gel electrophoretic system (BRL Model V16). In both strand breaks higher oxygen enhancement ratios were obtained with 60 Co erradiation. (J.P.N.)
Czech Academy of Sciences Publication Activity Database
Matyášek, Roman; Fulneček, Jaroslav; Kovařík, Aleš
2013-01-01
Roč. 34, č. 17 (2013), s. 2511-2521 ISSN 0173-0835 R&D Projects: GA ČR(CZ) GA206/09/1751; GA ČR(CZ) GAP501/10/0208; GA ČR(CZ) GA13-10057S Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : HIGHLY REPETITIVE DNA * DOUBLE-HELICAL DNA * CURVED DNA Subject RIV: AC - Archeology, Anthropology, Ethnology Impact factor: 3.161, year: 2013
Electrophoretic Porosimetry of Sol-Gels
Snow, L. A.; Smith, D. D.; Sibille, L.; Hunt, A. J.; Ng, J.; Rose, M. Franklin (Technical Monitor)
2000-01-01
It has been hypothesized that gravity has an effect on the formation and resulting microstructure of sol-gels. In order to more clearly resolve the effect of gravity, pores may be non-destructively analyzed in the wet gel, circumventing the shrinkage and coarsening associated with the drying procedure. We discuss the development of an electrophoretic technique, analogous to affinity chromatography, for the determination of pore size distribution and its application to silica gels. Specifically a monodisperse charged dye is monitored by an optical densitometer as it moves through the wet gel under the influence of an electric field. The transmittance data (output) represents the convolution of the dye concentration profile at the beginning of the run (input) with the pore size distribution (transfer function), i.e. linear systems theory applies. Because of the practical difficulty in producing a delta function input dye profile we prefer instead to use a step function. Average pore size is then related to the velocity of this dye front, while the pore size distribution is related to the spreading of the front. Preliminary results of this electrophoretic porosimetry and its application to ground and space-grown samples will be discussed.
Electrophoretic separations on paper: Past, present, and future-A review.
Nanthasurasak, Pavisara; Cabot, Joan Marc; See, Hong Heng; Guijt, Rosanne M; Breadmore, Michael C
2017-09-08
Point-of-collection (POC) devices aim for a fast, on-site detection for medical and environmental purposes. In this area, microfluidic Paper-based Analytical Devices (μPADs) have recently gained popularity because these are potentially cheap and environmentally friendly to produce, and easy to use. From an analytical perspective, paper is well known for its use as a substrate for chromatography, but less known for its use in electrophoretic separations. With the recent interest in μPADs, most applications are based on rather simple assays with relatively few applications incorporating an analytical separation. The focus of this review is on paper-based electrophoresis, originating with the key developments in the 1940s and 1950s as well as the recent developments of electrophoretic μPADs, and concluding with a critical discussion of the opportunities and challenges for electrophoretic μPADS in the future. Copyright © 2017. Published by Elsevier B.V.
Walz, M; Kück, U
1995-12-01
The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.
Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D
2000-01-01
Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift
International Nuclear Information System (INIS)
Hanif, Sarmad; Shamim, Uzma; Ullah, M.F.; Azmi, Asfar S.; Bhat, Showket H.; Hadi, S.M.
2008-01-01
Epidemiological and experimental evidence exists to suggest that pomegranate and its juice possess chemopreventive and anticancer properties. The anthocyanidin delphinidin is a major polyphenol present in pomegranates and has been shown to be responsible for these effects. Plant polyphenols are recognized as naturally occurring antioxidants but also catalyze oxidative DNA degradation of cellular DNA either alone or in the presence of transition metal ions such as copper. In this paper we show that similar to various other classes of polyphenols, delphinidin is also capable of causing oxidative degradation of cellular DNA. Lymphocytes were exposed to various concentrations of delphinidin (10, 20, 50 μM) for 1 h and the DNA breakage was assessed using single cell alkaline gel electrophoresis (Comet assay). Inhibition of DNA breakage by several scavengers of reactive oxygen species (ROS) indicated that it is caused by the formation of ROS. Incubation of lymphocytes with neocuproine (a cell membrane permeable Cu(I) chelator) inhibited DNA degradation in intact lymphocytes in a dose dependent manner. Bathocuproine, which is unable to permeate through the cell membrane, did not cause such inhibition. We have further shown that delphinidin is able to degrade DNA in cell nuclei and that such DNA degradation is also inhibited by neocuproine suggesting that nuclear copper is mobilized in this reaction. These results indicate that the generation of ROS possibly occurs through mobilization of endogenous copper ions. The results are in support of our hypothesis that the prooxidant activity of plant polyphenols may be an important mechanism for their anticancer properties
Sialic acid accelerates the electrophoretic velocity of injured dorsal root ganglion neurons
Directory of Open Access Journals (Sweden)
Chen-xu Li
2015-01-01
Full Text Available Peripheral nerve injury has been shown to result in ectopic spontaneous discharges on soma and injured sites of sensory neurons, thereby inducing neuropathic pain. With the increase of membrane proteins on soma and injured site neurons, the negatively charged sialic acids bind to the external domains of membrane proteins, resulting in an increase of this charge. We therefore speculate that the electrophoretic velocity of injured neurons may be faster than non-injured neurons. The present study established rat models of neuropathic pain via chronic constriction injury. Results of the cell electrophoresis test revealed that the electrophoretic velocity of injured neuronal cells was faster than that of non-injured (control cells. We then treated cells with divalent cations of Ca 2+ and organic compounds with positive charges, polylysine to counteract the negatively charged sialic acids, or neuraminidase to specifically remove sialic acids from the membrane surface of injured neurons. All three treatments significantly reduced the electrophoretic velocity of injured neuronal cells. These findings suggest that enhanced sialic acids on injured neurons may accelerate the electrophoretic velocity of injured neurons.
DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...
African Journals Online (AJOL)
We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...
DEFF Research Database (Denmark)
Bureau, M F; Gehl, J; Deleuze, V
2000-01-01
is largely open. We have evaluated the effects of various combinations of square wave electric pulses of variable field strength and duration, on cell permeabilization and on DNA transfection in the skeletal muscle in vivo. One high voltage pulse of 800 V/cm, 0.1 ms duration (short high pulse) or a series......Gene transfer using electrical pulses is a rapidly expanding field. Many studies have been performed in vitro to elucidate the mechanism of DNA electrotransfer. In vivo, the use of efficient procedures for DNA electrotransfer in tissues is recent, and the question of the implied mechanisms...
Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components
Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik
2015-03-01
We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.
DNA binding specificity of the basic-helix-loop-helix protein MASH-1.
Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K
1995-09-05
Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.
International Nuclear Information System (INIS)
Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio
1995-01-01
The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)
Yasukawa, Takehiro; Reyes, Aurelio; Cluett, Tricia J; Yang, Ming-Yao; Bowmaker, Mark; Jacobs, Howard T; Holt, Ian J
2006-11-15
Using two-dimensional agarose gel electrophoresis, we show that mitochondrial DNA (mtDNA) replication of birds and mammals frequently entails ribonucleotide incorporation throughout the lagging strand (RITOLS). Based on a combination of two-dimensional agarose gel electrophoretic analysis and mapping of 5' ends of DNA, initiation of RITOLS replication occurs in the major non-coding region of vertebrate mtDNA and is effectively unidirectional. In some cases, conversion of nascent RNA strands to DNA starts at defined loci, the most prominent of which maps, in mammalian mtDNA, in the vicinity of the site known as the light-strand origin.
Energy Technology Data Exchange (ETDEWEB)
Casal, J I; Garces, F; Garcia-Sacristan, A
1981-07-01
The sedimentation coefficients and intrinsic viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight estimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of X-ENA. (Author) 35 refs.
DNA migration mechanism analyses for applications in capillary and microchip electrophoresis
Forster, Ryan E.; Hert, Daniel G.; Chiesl, Thomas N.; Fredlake, Christopher P.; Barron, Annelise E.
2009-01-01
In 2009, electrophoretically driven DNA separations in slab gels and capillaries have the sepia tones of an old-fashioned technology in the eyes of many, even while they remain ubiquitously used, fill a unique niche, and arguably have yet to reach their full potential. For comic relief, what is old becomes new again: agarose slab gel separations are used to prepare DNA samples for “next-gen” sequencing platforms (e.g., the Illumina and 454 machines)—dsDNA molecules within a certain size range are “cut out” of a gel and recovered for subsequent “massively parallel” pyrosequencing. In this review, we give a Barron lab perspective on how our comprehension of DNA migration mechanisms in electrophoresis has evolved, since the first reports of DNA separations by CE (∼1989) until now, 20 years later. Fused silica capillaries, and borosilicate glass and plastic microchips, quietly offer increasing capacities for fast (and even “ultra-fast”), efficient DNA separations. While the channel-by-channel scaling of both old and new electrophoresis platforms provides key flexibility, it requires each unique DNA sample to be prepared in its own micro- or nanovolume. This Achille's heel of electrophoresis technologies left an opening through which pooled-sample, next-gen DNA sequencing technologies rushed. We shall see, over time, whether sharpening understanding of transitions in DNA migration modes in crosslinked gels, nanogel solutions, and uncrosslinked polymer solutions will allow electrophoretic DNA analysis technologies to flower again. Microchannel electrophoresis, after a quiet period of metamorphosis, may emerge sleeker and more powerful, to claim its own important niche applications. PMID:19582705
DEFF Research Database (Denmark)
Peeper, D S; Keblusek, P; Helin, K
1995-01-01
of the retinoblastoma gene (pRB). We find that E2F-1 proteins are heterogeneously phosphorylated in insect cells, as a result of which they migrate as a doublet on SDS-polyacrylamide gels. This electrophoretic shift is shown to be dependent upon specific phosphorylation of E2F-1 on serine-375 (S375), near the p...
A laser scanner for imaging fluorophore labeled molecules in electrophoretic gels
Energy Technology Data Exchange (ETDEWEB)
Fisk, D.J.; Sutherland, J.C. [Brookhaven National Lab., Upton, NY (United States). Biology Dept.
1995-08-01
A laser scanner for imaging electrophoretic gels was constructed and tested. The scanner incorporates a green helium-neon (HeNe) laser (543.5nm wavelength) and can achieve a spatial resolution of 19{micro}m. The instrument can function in two modes : snap-shot and finish-line. In snapshot mode, all samples are electrophoresed for the same time and the gel is scanned after completion of electrophoresis, while in finish-line mode, fluorophore labeled samples are electrophoresed for a constant distance and the image is formed as the samples pass under the detector. The resolving power of the finish-line mode of imaging is found to be greater than that of the snapshot mode of imaging. This laser scanner is also compared with a Charge Coupled Device (CCD) camera and in terms of resolving power is found to be superior. Sensitivity of the instrument is presented in terms of the minimum amount of DNA that can be detected verses its molecular length.
Electrophoretic deposition of composite hydroxyapatite-chitosan coatings
International Nuclear Information System (INIS)
Pang Xin; Zhitomirsky, Igor
2007-01-01
Cathodic electrophoretic deposition has been utilized for the fabrication of composite hydroxyapatite-chitosan coatings on 316L stainless steel substrates. The addition of chitosan to the hydroxyapatite suspensions promoted the electrophoretic deposition of the hydroxyapatite nanoparticles and resulted in the formation of composite coatings. The obtained coatings were investigated by X-ray diffraction, thermogravimetric and differential thermal analysis, scanning and transmission electron microscopy, potentiodynamic polarization measurements, and electrochemical impedance spectroscopy. It was shown that the deposit composition can be changed by a variation of the chitosan or hydroxyapatite concentration in the solutions. Experimental conditions were developed for the fabrication of hydroxyapatite-chitosan nanocomposites containing 40.9-89.8 wt.% hydroxyapatite. The method enabled the formation of adherent and uniform coatings of thicknesses up to 60 μm. X-ray studies revealed that the preferred orientation of the hydroxyapatite nanoparticles in the chitosan matrix increases with decreasing hydroxyapatite content in the composite coatings. The obtained coatings provided the corrosion protection for the 316L stainless steel substrates
Cho, Sang-Yun; Cho, Won Kyong; Sohn, Seong-Han; Kim, Kook-Hyung
2012-01-06
Plant viruses must interact with host cellular components to replicate and move from cell to cell. In the case of Potato virus X (PVX), it carries stem-loop 1 (SL1) RNA essential for viral replication and movement. Using two-dimensional electrophoresis northwestern blot analysis, we previously identified several host proteins that bind to SL1 RNA. Of those, we further characterized a DnaJ-like protein from Nicotiana benthamiana named NbDnaJ. An electrophoretic mobility shift assay confirmed that NbDnaJ binds only to SL1 minus-strand RNA, and bimolecular fluorescence complementation (BiFC) indicated that NbDnaJ interacts with PVX capsid protein (CP). Using a series of deletion mutants, the C-terminal region of NbDnaJ was found to be essential for the interaction with PVX CP. The expression of NbDnaJ significantly changed upon infection with different plant viruses such as PVX, Tobacco mosaic virus, and Cucumber mosaic virus, but varied depending on the viral species. In transient experiments, both PVX replication and movement were inhibited in plants that over-expressed NbDnaJ but accelerated in plants in which NbDnaJ was silenced. In summary, we suggest that the newly identified NbDnaJ plays a role in PVX replication and movement by interacting with SL1(-) RNA and PVX CP. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Swenberg, C.E.; Vaishnav, Y.N.; Li, Bin; Tsao, Hong; Mao, Bing; Geacintov, N.E.
1997-01-01
The technique of high-resolution gel electrophoresis using oligodeoxyribonucleotides of known composition as model systems, offers a simple quantitative estimate of DNA damage in aqueous solution induced by ionizing radiation. The fraction of damaged DNA can be quantitatively defined in terms of the increased electrophoretic mobilities of the damaged oligonucleotides, relative to the mobility of the unirradiated and intact oligonucleotides. The usual direct strand breaks can be observed at γ-ray dosages of 200 Gy. However, at a γ-ray dosage of 400 Gy, only a broad background, attributed to heterogeneously and multiply damaged oligonucleotide fragments with overlapping and varying electrophoretic mobilities, can be distinguished. On the other hand, individual bands due to resolvable DNA fragments are evident even at dosages as high as 400 Gy for fission neutrons. When double-stranded oligonucleotides are exposed to γ-ray dosages of 200 Gy, the fraction of damaged DNA approaches 30-40%. This damage can be almost completely suppressed (>99%) if the irradiations are conducted in aqueous solutions in the presence of 0.5-1.0 mM concentrations of the thiols cysteamine or 3-(3-methylaminopropylamino)propanethiol (WR-151326). The rate constant of reaction of OH·radicals with small double stranded oligonucleotides 16 base pairs long, K DNA , is found to be closer to the diffusion-controlled value (>3 x 10 9 M -1 s -1 ) than the magnitudes of K DNA for the higher molecular weight, native DNA reported in the literature. These observations suggest that oligonucleotides represent more simple model systems than native DNA in solutions for studying the mechanisms of radioprotection exerted by thiols of different structures. (author)
We investigated DNA sequencing information from alleles (DNA amplified fragments) of two previously reported SSR markers (CIR316 and MUCS088) linked to root-knot nematode (RKN) resistance genes. Markers based on electrophoretic differences, including RFLPs, AFLPs and SSRs can sometimes mask underlyi...
Hydrodynamic characterization and molecular weight estimation of ultrasonically sheared DNA
International Nuclear Information System (INIS)
Casal, J. I.; Garces, F.; Garcia-Sacristan, A.
1981-01-01
The sedimentation coefficients and intrinsic viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight estimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of X-ENA. (Author) 35 refs
Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow
Hatlo, Marius M.; Panja, Debabrata; van Roij, René
2011-08-01
Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.
A novel method for the preparation of electrophoretic display microcapsules
Energy Technology Data Exchange (ETDEWEB)
Liu, Xiao-Meng; He, Jing; Liu, Sheng-Yun [State Key Laboratory of Organic-Inorganic Composites, Beijing University of Chemical Technology, Beijing 100029 (China); Chen, Jian-Feng [State Key Laboratory of Organic-Inorganic Composites, Beijing University of Chemical Technology, Beijing 100029 (China); Research Center of the Ministry of Education for High Gravity Engineering and Technology, Beijing University of Chemical Technology, Beijing 100029 (China); Le, Yuan, E-mail: leyuan@mail.buct.edu.cn [State Key Laboratory of Organic-Inorganic Composites, Beijing University of Chemical Technology, Beijing 100029 (China)
2014-07-01
Highlights: • The electrophoretic display microcapsules were prepared by coaxial jet method aided by gas spray. • The positions of inner tube, liquid and gas flow rate of the process were investigated. • The size and shell thickness of the prepared microcapsules were controllable. • The prepared microcapsules had high coating ratio and exhibit reversible response to DC field. - Abstract: The narrow distributed electrophoretic display microcapsules containing electrophoretic ink were prepared using coaxial jet method aided by gas spray. Experimental results showed the size and shell thickness of the microcapsules could be controlled by adjusting flow rates of core and shell fluids as well as gas. The as-prepared white and red microcapsules, with average size of 100 and 200 μm respectively, had high coating ratio (above 90%) and exhibited reversible response to DC electric field. Compared with the approach of other microencapsulation methods, the new technique not only has a simple procedure but also provides a more effective way of size control. This novel method is expected to prepare microcapsules with potential application in the fields of electronic paper and other material science.
Improved DNA electrophoresis in conditions favoring polyborates and lewis acid complexation.
Directory of Open Access Journals (Sweden)
Hari Singhal
2010-06-01
Full Text Available Spatial compression among the longer DNA fragments occurs during DNA electrophoresis in agarose and non-agarose gels when using certain ions in the conductive buffer, impairing the range of fragment sizes resolved well in a single gel. Substitutions using various polyhydroxyl anions supported the underlying phenomenon as the complexation of Lewis acids to DNA. We saw significant improvements using conditions (lithium borate 10 mM cations, pH 6.5 favoring the formation of borate polyanions and having lower conductance and Joule heating, delayed electrolyte exhaustion, faster electrophoretic run-speed, and sharper separation of DNA bands from 100 bp to 12 kb in a single run.
Henke, Sarah K; Cronan, John E
2016-11-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.
Chiral ionic liquids in chromatographic and electrophoretic separations.
Kapnissi-Christodoulou, Constantina P; Stavrou, Ioannis J; Mavroudi, Maria C
2014-10-10
This report provides an overview of the application of chiral ionic liquids (CILs) in separation technology, and particularly in capillary electrophoresis and both gas and liquid chromatography. There is a large number of CILs that have been synthesized and designed as chiral agents. However, only a few have successfully been applied in separation technology. Even though this application of CILs is still in its early stages, the scientific interest is increasing dramatically. This article is focused on the use of CILs as chiral selectors, background electrolyte additives, chiral ligands and chiral stationary phases in electrophoretic and chromatographic techniques. Different examples of CILs, which contain either a chiral cation, a chiral anion or both, are presented in this review article, and their major advantages along with their potential applications in chiral electrophoretic and chromatographic recognition are discussed. Copyright © 2014 Elsevier B.V. All rights reserved.
Single Molecule Screening of Disease DNA Without Amplification
Energy Technology Data Exchange (ETDEWEB)
Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)
2006-01-01
The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA
International Nuclear Information System (INIS)
Oliveira Sampa, M.H. de; Vinhas, L.A.; Pino, E.S.
1991-05-01
In this work we present an introduction of the electrophoretic process followed by a detailed experimental treatment of the technique used in the determination and optimization of the ζ-potential, mainly as a function of the electrolyte concentration, in a high purity boron electrophoretics deposition on aluminium substrates used as electrodes in neutron detectors. (author)
Predicting tensorial electrophoretic effects in asymmetric colloids
Mowitz, Aaron J.; Witten, T. A.
2017-12-01
We formulate a numerical method for predicting the tensorial linear response of a rigid, asymmetrically charged body to an applied electric field. This prediction requires calculating the response of the fluid to the Stokes drag forces on the moving body and on the countercharges near its surface. To determine the fluid's motion, we represent both the body and the countercharges using many point sources of drag known as Stokeslets. Finding the correct flow field amounts to finding the set of drag forces on the Stokeslets that is consistent with the relative velocities experienced by each Stokeslet. The method rigorously satisfies the condition that the object moves with no transfer of momentum to the fluid. We demonstrate that a sphere represented by 1999 well-separated Stokeslets on its surface produces flow and drag force like a solid sphere to 1% accuracy. We show that a uniformly charged sphere with 3998 body and countercharge Stokeslets obeys the Smoluchowski prediction [F. Morrison, J. Colloid Interface Sci. 34, 210 (1970), 10.1016/0021-9797(70)90171-2] for electrophoretic mobility when the countercharges lie close to the sphere. Spheres with dipolar and quadrupolar charge distributions rotate and translate as predicted analytically to 4% accuracy or better. We describe how the method can treat general asymmetric shapes and charge distributions. This method offers promise as a way to characterize and manipulate asymmetrically charged colloid-scale objects from biology (e.g., viruses) and technology (e.g., self-assembled clusters).
International Nuclear Information System (INIS)
Heilmann, J.; Taucher-Scholz, G.; Kraft, G.
1994-11-01
A fast assay for the detection of DNA double-strand breaks was developed involving constant field gel electrophoresis (Taucher-Scholz et al., 1994) and densitometric scanning of agarose gels stained with ethidium bromide. With this technique, DSB induction was investigated after irradiation of CHO cells with carbon ions with LET values between 14 keV/μm and 400 keV/μm. In parallel, a computer code was developed to simulate both the principle of the electrophoretic detection of DNA double-strand breaks and the action of radiations of different ionization density. The results of the experiments and the calculations are presented here and compared with each other. (orig./HSI)
Validation for chromatographic and electrophoretic methods
Ribani, Marcelo; Bottoli, Carla Beatriz Grespan; Collins, Carol H.; Jardim, Isabel Cristina Sales Fontes; Melo, Lúcio Flávio Costa
2004-01-01
The validation of an analytical method is fundamental to implementing a quality control system in any analytical laboratory. As the separation techniques, GC, HPLC and CE, are often the principal tools used in such determinations, procedure validation is a necessity. The objective of this review is to describe the main aspects of validation in chromatographic and electrophoretic analysis, showing, in a general way, the similarities and differences between the guidelines established by the dif...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864...
Roberta Troia; Massimo Giunti; Stefano Calipa; Robert Goggs
2018-01-01
Canine gastric dilatation–volvulus (GDV) is a life-threatening disease characterized by extensive tissue ischemia, tissue hypoperfusion, and systemic inflammation. Biomarkers that better reflect the severity of gastric necrosis and systemic inflammation would aid clinicians in the management of these patients. This study aimed to investigate the prognostic significance of cell-free DNA (cfDNA), high-mobility group box-1 (HMGB1), and procalcitonin (PCT) in dogs with GDV. Concentrations of cfDN...
Template-based electrophoretic deposition of perovskite PZT nanotubes
Energy Technology Data Exchange (ETDEWEB)
Nourmohammadi, A. [Solid Surfaces Analysis and Electron Microscopy Group, Institute of Physics, Chemnitz University of Technology, D-09126 Chemnitz (Germany); Semiconductors Department, Materials and Energy Research Center (MERC), 31779-83634 Karaj (Iran, Islamic Republic of); Bahrevar, M.A. [Semiconductors Department, Materials and Energy Research Center (MERC), 31779-83634 Karaj (Iran, Islamic Republic of)], E-mail: ma.bahrevar@yahoo.com; Hietschold, M. [Solid Surfaces Analysis and Electron Microscopy Group, Institute of Physics, Chemnitz University of Technology, D-09126 Chemnitz (Germany)
2009-04-03
Template-based electrophoretic deposition of perovskite lead zirconate titanate (PZT) nanotubes was achieved using anodic alumina (AA) membranes and sols, containing lead, zirconium and titanium precursors. The effect of various anodizing voltages on the size of the channels in the anodic alumina template was investigated. The prepared sol was driven into the channels under the influence of various electric fields and subsequently sintered at about 700 deg. C. The effects of the initial heating rates and the burn-out temperature on the phase evolution of the samples were studied and a modified firing process was employed. The effects of the electrophoretic voltage and the deposition time on the average wall thickness of the tubes were investigated. Scanning and transmission electron microscopy (SEM and TEM) revealed the efficiency of electrophoresis in the growth of lead zirconate titanate nanotubes in a close-packed array. The X-ray diffraction analyses indicated the presence of perovskite as the principal phase after a modified firing schedule.
Application of design of experiment on electrophoretic deposition of ...
Indian Academy of Sciences (India)
Unknown
Keywords. Coating; electrophoretic deposition; glass-ceramic; design of experiment. 1. Introduction ... other chemicals used were of laboratory reagent grade. ... changes from 7⋅0 to 9⋅5 that adversely affects the deposi- tion efficiency and ...
International Nuclear Information System (INIS)
Baulch, Janet E.; Li, M.-W.; Raabe, Otto G.
2007-01-01
The ataxia telangiectasia mutated (ATM) gene product maintains genome integrity and initiates cellular DNA repair pathways following exposures to genotoxic agents. ATM also plays a significant role in meiotic recombination during spermatogenesis. Fertilization with sperm carrying damaged DNA could lead to adverse effects in offspring including developmental defects or increased cancer susceptibility. Currently, there is little information regarding the effect of ATM heterozygosity on germline DNA repair and heritable effects of paternal germline-ionizing irradiation. We used neutral pH comet assays to evaluate spermatozoa 45 days after acute whole-body irradiation of male mice (0.1 Gy, attenuated 137 Cs γ rays) to determine the effect of ATM heterozygosity on delayed DNA damage effects of Type A/B spermatogonial irradiation. Using the neutral pH sperm comet assay, significant irradiation-related differences were found in comet tail length, percent tail DNA and tail extent moment, but there were no observed differences in effect between wild-type and ATM +/- mice. However, evaluation of spermatozoa from third generation descendants of irradiated male mice for heritable chromatin effects revealed significant differences in DNA electrophoretic mobility in the F 3 descendants that were based upon the irradiated F 0 sire's genotype. In this study, radiation-induced chromatin alterations to Type A/B spermatogonia, detected in mature sperm 45 days post-irradiation, led to chromatin effects in mature sperm three generations later. The early cellular response to and repair of DNA damage is critical and appears to be affected by ATM zygosity. Our results indicate that there is potential for heritable genetic or epigenetic changes following Type A/B spermatogonial irradiation and that ATM heterozygosity increases this effect
Sun, Daekyu; Hurley, Laurence H
2010-01-01
The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.
Properties of electrophoretically deposited single wall carbon nanotube films
International Nuclear Information System (INIS)
Lim, Junyoung; Jalali, Maryam; Campbell, Stephen A.
2015-01-01
This paper describes techniques for rapidly producing a carbon nanotube thin film by electrophoretic deposition at room temperature and determines the film mass density and electrical/mechanical properties of such films. The mechanism of electrophoretic deposition of thin layers is explained with experimental data. Also, film thickness is measured as a function of time, electrical field and suspension concentration. We use Rutherford backscattering spectroscopy to determine the film mass density. Films created in this manner have a resistivity of 2.14 × 10 −3 Ω·cm, a mass density that varies with thickness from 0.12 to 0.54 g/cm 3 , and a Young's modulus between 4.72 and 5.67 GPa. The latter was found to be independent of thickness from 77 to 134 nm. We also report on fabricating free-standing films by removing the metal seed layer under the CNT film, and selectively etching a sacrificial layer. This method could be extended to flexible photovoltaic devices or high frequency RF MEMS devices. - Highlights: • We explain the electrophoretic deposition process and mechanism of thin SWCNT film deposition. • Characterization of the SWCNT film properties including density, resistivity, transmittance, and Young's modulus. • The film density and resistivity are found to be a function of the film thickness. • Techniques developed to create free standing layers of SW-CNTs for flexible electronics and mechanical actuators
Pachkowski, Brian; Nakamura, Jun
2013-01-01
Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.
UV-induced DNA-binding proteins in human cells
International Nuclear Information System (INIS)
Glazer, P.M.; Greggio, N.A.; Metherall, J.E.; Summers, W.C.
1989-01-01
To investigate the response of human cells to DNA-damaging agents such as UV irradiation, the authors examined nuclear protein extracts of UV-irradiated HeLa cells for the presence of DNA-binding proteins. Electrophoretically separated proteins were transferred to a nitrocellulose filter that was subsequently immersed in a binding solution containing radioactively labeled DNA probes. Several DNA-binding proteins were induced in HeLa cells after UV irradiation. These included proteins that bind predominantly double-stranded DNA and proteins that bind both double-stranded and single-stranded DNA. The binding proteins were induced in a dose-dependent manner by UV light. Following a dose of 12 J/m 2 , the binding proteins in the nuclear extracts increased over time to a peak in the range of 18 hr after irradiation. Experiments with metabolic inhibitors (cycloheximide and actinomycin D) revealed that de novo synthesis of these proteins is not required for induction of the binding activities, suggesting that the induction is mediated by protein modification
Directory of Open Access Journals (Sweden)
Akira Kitamura
2018-07-01
Full Text Available Normal function and abnormal aggregation of transactivation response (TAR DNA/RNA-binding protein 43 kDa (TDP-43 are directly associated with the lethal genetic diseases: cystic fibrosis, amyotrophic lateral sclerosis (ALS, and frontotemporal lobar degeneration (FTLD. The binding of TDP-43 to single-stranded DNA (ssDNA or RNA is involved in transcriptional repression, regulation of RNA splicing, and RNA stabilization. Equilibrium dissociation constants (Kd of TDP-43 and ssDNA or RNA have been determined using various methods; however, methods that can measure Kd with high sensitivity in a short time using a small amount of TDP-43 in solution would be advantageous. Here, in order to determine the Kd of TDP-43 and fluorescence-labeled ssDNA as well as the binding stoichiometry, we use fluorescence correlation spectroscopy (FCS, which detects the slowed diffusion of molecular interactions in solution with single-molecule sensitivity, in addition to electrophoretic mobility shift assay (EMSA. Using tandem affinity chromatography of TDP-43 dually tagged with glutathione-S-transferase and poly-histidine tags, highly purified protein was obtained. FCS successfully detected specific interaction between purified TDP-43 and TG ssDNA repeats, with a Kd in the nanomolar range. The Kd of the TDP-43 mutant was not different from the wild type, although mutant oligomers, which did not bind ssDNA, were observed. Analysis of the fluorescence brightness per dimerized TDP-43/ssDNA complex was used to evaluate their binding stoichiometry. The results suggest that an assay combining FCS and EMSA can precisely analyze ssDNA recognition mechanisms, and that FCS may be applied for the rapid and quantitative determination of the interaction strength between TDP-43 and ssDNA or RNA. These methods will aid in the elucidation of the substrate recognition mechanism of ALS- and FTLD-associated variants of TDP-43.
African Journals Online (AJOL)
2012-03-26
Mar 26, 2012 ... 2), in LPS-stimulated BV2 microglial cells. The level of NO production was analyzed using Griess reaction. The release of PGE2 was determined using sandwich enzyme-linked immunosorbent assay. The DNA-binding activity of nuclear factor-κB (NF-κB) was measured by electrophoretic mobility shift assay ...
Electrophoretic deposition of zinc-substituted hydroxyapatite coatings.
Sun, Guangfei; Ma, Jun; Zhang, Shengmin
2014-06-01
Zinc-substituted hydroxyapatite nanoparticles synthesized by the co-precipitation method were used to coat stainless steel plates by electrophoretic deposition in n-butanol with triethanolamine as a dispersant. The effect of zinc concentration in the synthesis on the morphology and microstructure of coatings was investigated. It is found that the deposition current densities significantly increase with the increasing zinc concentration. The zinc-substituted hydroxyapatite coatings were analyzed by X-ray diffraction, scanning electron microscopy and Fourier transform infrared spectroscopy. It is inferred that hydroxyapatite and triethanolamine predominate in the chemical composition of coatings. With the increasing Zn/Ca ratios, the contents of triethanolamine decrease in the final products. The triethanolamine can be burnt out by heat treatment. The tests of adhesive strength have confirmed good adhesion between the coatings and substrates. The formation of new apatite layer on the coatings has been observed after 7days of immersion in a simulated body fluid. In summary, the results show that dense, uniform zinc-substituted hydroxyapatite coatings are obtained by electrophoretic deposition when the Zn/Ca ratio reaches 5%. Copyright © 2014 Elsevier B.V. All rights reserved.
Ten helical twist angles of B-DNA
Energy Technology Data Exchange (ETDEWEB)
Kabsch, W; Sander, C; Trifonov, E N
1982-01-01
On the assumption that the twist angles between adjacent base-pairs in the DNA molecule are additive a linear system of 40 equations was derived from experimental measurements of the total twist angles for different pieces of DNA of known sequences. This system of equations is found to be statistically consistent providing a solution for all ten possible twist angles of B-DNA by a least squares fitting procedure. Four of the calculated twist angles were not known before. The other six twist angles calculated are very close to the experimentally measured ones. The data used were obtained by the electrophoretic band-shift method, crystallography and nuclease digestion of DNA adsorbed to mica or Ca-phosphate surface. The validity of the principle of additivity of the twist angles implies that the angle between any particular two base-pairs is a function of only these base-pairs, independent of nearest neighbors.
International Nuclear Information System (INIS)
Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.
1986-01-01
In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells
Mitochondrial DNA in wildlife forensic science: Species identification of tissues
Cronin, Matthew A.; Palmisciano, Daniel A.; Vyse, Ernest R.; Cameron, David G.
1991-01-01
A common problem in wildlife law enforcement is identifying the species of origin of carcasses, meat, or blood when morphological characters such as hair or bones are not available. Immunological and protein electrophoretic (allozyme or general protein) procedures have been used in species identification with considerable success (Bunch et al. 1976, McClymont et al. 1982, Wolfe 1983, Mardini 1984, Pex and Wolfe 1985, Dratch 1986), However, immunological tests often are not sensitive enough to distinguish closely related species. Furthermore, electrophoretically detectable protein polymorphisms may be lacking in certain populations or species and may not be species-specific.Analysis of DNA in human and wildlife forensics has been shown to be a potentially powerful tool for identification of individuals (Jeffreys et al. 1985, Vassartet al. 1987, Thommasen et al. 1989). Differences in copy number and nucleotide sequence of repetitive sequences in the nuclear (chromosomal) DNA result in hypervariability and individual-specific patterns which have been termed DNA "fingerprints." However, these patterns may be too variable for species identification necessitating analyses of more conservative parts of the genome.Mitochondrial DNA (mtDNA) is haploid, maternally inherited, similar in nucleotide sequence among conspecifics from the same geographic region, and more suitable for species identification, in contrast to hypervariable DNA fingerprints. MtDNA has several characteristics which make it useful as a species-specific marker. In mammals, individuals have a single mtDNA genotype shared by all tissues. Because mtDNA is haploid and reflects only maternal ancestry, the mtDNA gene number in a population is 4 times less than the nuclear gene number (Birky et al. 1983). This can result in relatively rapid loss or fixation of mtDNA genotypes so that all individuals in a population may be descended from a single ancestral female in as few as 4N (N = population size) generations
Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao
2008-07-02
Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.
Yeh, Li-Hsien; Fang, Kuo-Ying; Hsu, Jyh-Ping; Tseng, Shiojenn
2011-12-01
The electrophoresis of a soft particle comprising a rigid core and a charged porous membrane layer in a narrow space is modeled. This simulates, for example, the capillary electrophoresis of biocolloids such as cells and microorganisms, and biosensor types of device. We show that, in addition to the boundary effect, the effects of double-layer polarization (DLP) and the electroosmotic retardation flow can be significant, yielding interesting electrophoretic behaviors. For example, if the friction coefficient of the membrane layer and/or the boundary is large, then the DLP effect can be offset by the electroosmotic retardation flow, making the particle mobility to decrease with increasing double layer thickness, which is qualitatively consistent with many experimental observations in the literature, but has not been explained clearly in previous analyses. In addition, depending upon the thickness of double layer, the friction of the membrane layer of a particle can either retard or accelerate its movement, an interesting result which has not been reported previously. This work is the first attempt to show solid evidence for the influence of a boundary on the effect of DLP and the electrophoretic behavior of soft particles. The model proposed is verified by the experimental data in the literature. The results of numerical simulation provide valuable information for the design of bio-analytical apparatus such as nanopore-based sensing applications and for the interpretation of relevant experimental data. Copyright © 2011 Elsevier B.V. All rights reserved.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Directory of Open Access Journals (Sweden)
Jason D Thompson
Full Text Available Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA
International Nuclear Information System (INIS)
Roos, C; Santos, J N; Guimarães, O R; Geller, M; Fonseca, A S; Paoli, F
2013-01-01
Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm −2 ) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms. (paper)
Holtkamp, Hannah; Grabmann, Gerlinde; Hartinger, Christian G
2016-04-01
Electrophoretic methods have been widely applied in research on the roles of metal complexes in biological systems. In particular, CE, often hyphenated to a sensitive MS detector, has provided valuable information on the modes of action of metal-based pharmaceuticals, and more recently new methods have been added to the electrophoretic toolbox. The range of applications continues to expand as a result of enhanced CE-to-MS interfacing, with sensitivity often at picomolar level, and evolved separation modes allowing for innovative sample analysis. This article is a followup to previous reviews about CE methods in metallodrug research (Electrophoresis, 2003, 24, 2023-2037; Electrophoresis, 2007, 28, 3436-3446; Electrophoresis, 2012, 33, 622-634), also providing a comprehensive overview of metal species studied by electrophoretic methods hyphenated to MS. It highlights the latest CE developments, takes a sneak peek into gel electrophoresis, traces biomolecule labeling, and focuses on the importance of early-stage drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Morales-Cid, Gabriel; Simonet, Bartolomé M; Cárdenas, Soledad; Valcárcel, Miguel
2007-05-01
On many occasions, sample treatment is a critical step in electrophoretic analysis. As an alternative to batch procedures, in this work, a new strategy is presented with a view to develop an on-capillary sample cleanup method. This strategy is based on the partial filling of the capillary with carboxylated single-walled carbon nanotube (c-SWNT). The nanoparticles retain interferences from the matrix allowing the determination and quantification of carbohydrates (viz glucose, maltose and fructose). The precision of the method for the analysis of real samples ranged from 5.3 to 6.4%. The proposed method was compared with a method based on a batch filtration of the juice sample through diatomaceous earth and further electrophoretic determination. This method was also validated in this work. The RSD for this other method ranged from 5.1 to 6%. The results obtained by both methods were statistically comparable demonstrating the accuracy of the proposed methods and their effectiveness. Electrophoretic separation of carbohydrates was achieved using 200 mM borate solution as a buffer at pH 9.5 and applying 15 kV. During separation, the capillary temperature was kept constant at 40 degrees C. For the on-capillary cleanup method, a solution containing 50 mg/L of c-SWNTs prepared in 300 mM borate solution at pH 9.5 was introduced for 60 s into the capillary just before sample introduction. For the electrophoretic analysis of samples cleaned in batch with diatomaceous earth, it is also recommended to introduce into the capillary, just before the sample, a 300 mM borate solution as it enhances the sensitivity and electrophoretic resolution.
Smith, Ryan J; Beck, Rachel W; Prevette, Lisa E
2015-01-01
Poly(ethylene glycol) (PEG) is often conjugated to polyethylenimine (PEI) to provide colloidal stability to PEI-DNA polyplexes and shield charge leading to toxicity. Here, a library of nine cationic copolymers was synthesized by grafting three molecular weights (750, 2000, 5000Da) of PEG to linear PEI at three conjugation ratios. Using isothermal titration calorimetry, we have quantified the thermodynamics of the associations between the copolymers and DNA and determined the extent to which binding is hindered as a function of PEG molecular weight and conjugation ratio. Low conjugation ratios of 750Da PEG to PEI resulted in little decrease in DNA affinity, but a significant decrease-up to two orders of magnitude-was found for the other copolymers. We identified limitations in determination of affinity using indirect assays (electrophoretic mobility shift and ethidium bromide exclusion) commonly used in the field. Dynamic light scattering of the DNA complexes at physiological ionic strength showed that PEI modifications that did not reduce DNA affinity also did not confer significant colloidal stability, a finding that was supported by calorimetric data on the aggregation process. These results quantify the DNA interaction thermodynamics of PEGylated polycations for the first time and indicate that there is an optimum PEG chain length and degree of substitution in the design of agents that have desirable properties for effective in vivo gene delivery. Copyright © 2015 Elsevier B.V. All rights reserved.
Stabilization of green bodies via sacrificial gelling agent during electrophoretic deposition
Energy Technology Data Exchange (ETDEWEB)
Worsley, Marcus A.; Kuntz, Joshua D.; Rose, Klint A.
2016-03-22
In one embodiment, a method for electrophoretic deposition of a three-dimensionally patterned green body includes suspending a first material in a gelling agent above a patterned electrode of an electrophoretic deposition (EPD) chamber, and gelling the suspension while applying a first electric field to the suspension to cause desired patterning of the first material in a resulting gelation. In another embodiment, a ceramic, metal, or cermet includes a plurality of layers, wherein each layer includes a gradient in composition, microstructure, and/or density in an x-y plane oriented parallel to a plane of deposition of the plurality of layers along a predetermined distance in a z-direction perpendicular to the plane of deposition.
Mapping of 34 minisatellite loci resolved by two-dimensional DNA typing
DEFF Research Database (Denmark)
Børglum, Anders; Nyegaard, Mette; Kvistgaard, AB
1997-01-01
Two-dimensional (2-D) DNA typing is based on electrophoretic separation of genomic DNA fragments in two dimensions according to independent criteria (size and base-pair sequence), followed by hybridization analysis using multilocus probes. The technique allows simultaneous visualization of several...... could be deduced, showing no evidence of clustering. In the analysis of spot patterns, use was made of a computerized image analysis system specifically designed for 2-D DNA typing. Since experimental variations between different separation patterns were automatically corrected for with this program......, rapid and reliable scorings could be obtained. The results presented demonstrate the availability of reliable genetic information throughout the 2-D separation pattern. Adding the use of semiautomated computerized pattern analysis, this study further substantiates the applicability of 2-D DNA typing...
Ribosomal DNA-binding proteins in the nucleolus of Physarum polycephalum
International Nuclear Information System (INIS)
Graham-Lorence, S.E.
1987-01-01
In Physarum polycephalum, the nucleoli are extra chromosomal structures containing 200 to 400 copies of a linear 60 kilobase palindromic rDNA molecule. These rDNA molecules are organized into minichromosomes which apparently are held within a nucleolar protein matrix. To obtained evidence for attachment of the rDNA to such a matrix, both intact and lithium diiodosalicylate/NaCl-extracted nucleoli were digested for various lengths of time with micrococcal nuclease, so that portions of the rDNA molecules not attached within the nucleolar structure would be released. Nucleolar DNA-binding proteins were determined by blotting electrophoretically separated proteins from SDS-polyacrylamide gels onto nitrocellulose paper and probing them with radiolabeled DNA. In addition to the histones and lexosome proteins, eight DNA-binding proteins were identified having molecular weights of 25, 38, 47, 53, 55, 67, and 70 kD, with the 47, 53, 67, and 70 kD proteins requiring Ca 2+ for binding
Fukai, Nao; Kitagawa, Shinya; Ohtani, Hajime
2017-07-01
We have recently demonstrated the separation of neutral and water-insoluble linear synthetic polymers in nonaqueous capillary zone electrophoresis (NACZE) using a cationic surfactant of cetyltrimethylammonium chloride (CTAC). In this study, eight ionic surfactants were investigated for the separation of four synthetic polymers (polystyrene, polymethylmethacrylates, polybutadiene, and polycarbonate); only three surfactants (CTAC, dimethyldioctadecylammonium bromide, and sodium dodecylsulfate) caused their separation. The order of the interaction between the polymers and the surfactants depended on both the surfactant species and the composition of the electrophoretic medium. Their investigation revealed that the separation is majorly affected by the hydrophobic interactions between the polymers and the ionic surfactants. In addition, the electrophoretic behavior of polycarbonate suggested that electrostatic interaction also affects the selectivity of the polymers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L
2017-06-27
The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.
Olson, Daniel W.; Dutta, Sarit; Laachi, Nabil; Tian, Mingwei; Dorfman, Kevin D.
2011-01-01
Using the two-state, continuous-time random walk model, we develop expressions for the mobility and the plate height during DNA electrophoresis in an ordered post array that delineate the contributions due to (i) the random distance between collisions and (ii) the random duration of a collision. These contributions are expressed in terms of the means and variances of the underlying stochastic processes, which we evaluate from a large ensemble of Brownian dynamics simulations performed using different electric fields and molecular weights in a hexagonal array of 1 μm posts with a 3 μm center-to-center distance. If we fix the molecular weight, we find that the collision frequency governs the mobility. In contrast, the average collision duration is the most important factor for predicting the mobility as a function of DNA size at constant Péclet number. The plate height is reasonably well-described by a single post rope-over-pulley model, provided that the extension of the molecule is small. Our results only account for dispersion inside the post array and thus represent a theoretical lower bound on the plate height in an actual device. PMID:21290387
Directory of Open Access Journals (Sweden)
Victor M Aguilera
2015-09-01
Full Text Available Recent field and experimental evidence collected in the southern upwelling region off Concepción (36°5'S, 73°3'W showed an abrupt reduction (<72 h in the egg production rates (EPR of copepods when they were fed steadily and solely with the local bloom-forming diatom Thalassiosira rotula. Because diatoms were biochemically similar to dinoflagellate Prorocentrum minimum, a diet which supported higher reproductive outcomes, the fecundity reduction observed in copepod females fed with the diatom may have obeyed to post-ingestive processes, giving rise to resources reallocation. This hypothesis was tested by comparing feeding (clearance and ingestion rates, reproduction (EPR and hatching success and the structure of protein profiles (i.e., number and intensity of electrophoretic bands of copepods (adults and eggs incubated during 96 h with the two food conditions. The structure of protein profiles included molecular sizes that were calculated from the relative mobility of protein standards against the logarithm of their molecular sizes. After assessing the experimental conditions, feeding decreased over time for those females fed with T. rotula, while reproduction was higher in females fed with P. minimum. Electrophoretic profiles resulted similar mostly at a banding region of 100 to 89-kDa, while they showed partial differences around the region of 56-kDa band, especially in those females fed and eggs produced with T. rotula. Due to reproductive volume was impacted while larvae viability, a physiological processes with specific and high nutritional requirements, was independent on food type; post-ingestive processes, such as expression of stress-related proteins deviating resources to metabolic processes others than reproduction, are discussed under framework of nutritional-toxic mechanisms mediating copepod-diatoms relationships in productive upwelling areas.
NMR studies of bent DNA using {sup 13}C-enriched samples
Energy Technology Data Exchange (ETDEWEB)
Zimmer, D.P.; Crothers, D.M. [Yale Univ., New Haven, CT (United States)
1994-12-01
Bending of the DNA double helix can be brought about by introducing runs of adenines (A-tracts) in phase with the helical repeat of the DNA. The requirements for bending of DNA by A-tracts are that the length of the A-tract be greater than 3 base pairs and that the A-tracts must be in phase with the helical repeat (every 10 or 11 bp). Other factors, such as the number of adenines in the run, flanking sequences, and whether the A-tracts are phased with respect to the 5{prime}A or the 3{prime}A, have effects upon the degree of bending as assayed by electrophoretic mobility on native polyacrylamide gels. There are a number of models for bending A-tract DNA. The junction-bending model postulates that the structure of A-tracts is similar to the fiber diffraction structure of poly A, in which there is a significant degree of base pair tilt with respect to the helix axis. In this model, bending occurs at the junction between the A-tract and the B-form helix to allow favorable stacking interactions to occur. The bend of the helix could arise as a result of some other perturbation of B-form DNA by A-tracts, such as propeller twist; bending also could be due to a combination of factors. Our goal is to find the structural features of A-tracts responsible for bending of the helix by performing NMR on oligonucleotides containing A-tracts to obtain higher resolution structural data. One of the problems encountered in NMR structure determination of nucleic acids and other macromolecules is the assignment of resonances to nuclei. This procedure can be greatly facilitated through the use of {sup 13}C-enriched nucleic acid samples. We are developing a technique for the enzymatic synthesis of labeled DNA for NMR. The technique we are developing is similar to RNA labeling techniques already in use. The technique involves growth of methylotrophic bacteria on {sup 13}CH{sub 3}OH.
Directory of Open Access Journals (Sweden)
Minwoo Lee
Full Text Available One of the primary transcriptional regulators of fatty acid homeostasis in many prokaryotes is the protein FadR. To better understand its biological function in the extreme thermophile Thermus thermophilus HB8, we sought to first determine its preferred DNA-binding sequences in vitro using the combinatorial selection method Restriction Endonuclease Protection, Selection, and Amplification (REPSA and then use this information to bioinformatically identify potential regulated genes. REPSA determined a consensus FadR-binding sequence 5´-TTRNACYNRGTNYAA-3´, which was further characterized using quantitative electrophoretic mobility shift assays. With this information, a search of the T. thermophilus HB8 genome found multiple operons potentially regulated by FadR. Several of these were identified as encoding proteins involved in fatty acid biosynthesis and degradation; however, others were novel and not previously identified as targets of FadR. The role of FadR in regulating these genes was validated by physical and functional methods, as well as comparative genomic approaches to further characterize regulons in related organisms. Taken together, our study demonstrates that a systematic approach involving REPSA, biophysical characterization of protein-DNA binding, and bioinformatics can be used to postulate biological roles for potential transcriptional regulators.
An electrophoretical and immunological study of Pycnogonida, with phylogenetic considerations
Munilla, Tomás; Haro, de Andrés
1981-01-01
An electrophoretical and immunological study is made of nine species of pycnogonids, representing seven families, from the Catalan coast. An electrophoretogram of each species is given and the antigenic properties of its protein bands are determined. Taking as comparative basis the serological
Positively charged TiO2 particles in non-polar system for electrophoretic display
International Nuclear Information System (INIS)
Chang, Young Seon
2005-02-01
Electrophoretic display uses a technique called electrophoresis to represent images and letters electronically with electronic ink. Although it has good characteristics such as wide viewing angle, high contrast ratio and extremely low power consumption, there are still several issues to be resolved to improve its performances. Higher mobility and stability of the ink particles are the most important issues among them. In this study, TiO 2 particles coated with acrylamide were found to be effective ink particles that satisfy higher mobility and stability. The TiO 2 particles coated with 5∼40% acrylamide were prepared by dispersion polymerization using monomers of methyl methacrylate (MMA) and acrylamide. The TiO 2 particles coated with acrylamide were dispersed in isopar-G with sorbitan esters such as span 20, span 80 and span 85. The size of the TiO 2 particles were changed from 200±150 nm to 350∼500 nm by the coating process. The morphology of coated particles was observed using a transmission electron microscope (TEM) and thermogravimetric analysis (TGA). From the TGA results, the weight fraction of TiO 2 and polymer in coated particle were calculated. From the zeta potential measurement, it was shown that as acrylamide concentration was increased from 5% to 30%, zeta potential of the coated TiO 2 particles was increased from 50mV to about 230mV. The zeta potential of the coated TiO 2 particles with 40% acrylamide was decreased to 50mV. As a stabilizer, span 85 was the most effective surfactant to improve stability of the TiO 2 particles coated with acrylamide among used surfactants in this study. Span 85 showed best stability in the storage test with TiO 2 particles coated with 10% acrylamide. The mobility of TiO 2 particles coated with acrylamide with span 85 in dye solution (Oil Blue-N dissolved in isopar-G) were measured by ITO cell test. The mobility of TiO 2 particles coated with 10∼30% acrylamide was over 600μm 2 /Vs while the mobility of TiO 2
Hall, Gordon H; Glerum, D Moira; Backhouse, Christopher J
2016-02-01
Electrophoretic separation of fluorescently end-labeled DNA after a PCR serves as a gold standard in genetic diagnostics. Because of their size and cost, instruments for this type of analysis have had limited market uptake, particularly for point-of-care applications. This might be changed through a higher level of system integration and lower instrument costs that can be realized through the use of LEDs for excitation and photodiodes for detection--if they provide sufficient sensitivity. Here, we demonstrate an optimized microchip electrophoresis instrument using polymeric fluidic chips with fluorescence detection of end-labeled DNA with a LOD of 0.15 nM of Alexa Fluor 532. This represents orders of magnitude improvement over previously reported instruments of this type. We demonstrate the system with an electrophoretic separation of two PCR products and their respective primers. We believe that this is the first LED-induced fluorescence microchip electrophoresis system with photodiode-based detection that could be used for standard applications of PCR and electrophoresis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Huang, Ying; Sarkar, D.K., E-mail: dsarkar@uqac.ca; Chen, X-Grant
2015-02-01
Graphical abstract: - Highlights: • Fabrication of superhydrophobic ZnO thin films surfaces by electrophoretic deposition process on aluminum substrates. • Effect of bath temperature on the physical and superhydrophobic properties of thin films. • The water contact angle of 155° ± 3 with roll off property has been observed on the film that was grown at bath temperatures of 50 °C. • The activation energy for electrophoretic deposition of SA-functionalized ZnO nanoparticle is calculated to be 0.50 eV. - Abstract: Superhydrophobic thin films have been fabricated on aluminum alloy substrates by electrophoretic deposition (EPD) process using stearic acid (SA) functionalized zinc oxide (ZnO) nanoparticles suspension in alcohols at varying bath temperatures. The deposited thin films have been characterized using both X-ray diffraction (XRD) and infrared (IR) spectroscopy and it is found that the films contain low surface energy zinc stearate and ZnO nanoparticles. It is also observed that the atomic percentage of Zn and O, roughness and water contact angle of the thin films increase with the increase of the deposited bath temperature. Furthermore, the thin film deposited at 50 °C, having a roughness of 4.54 ± 0.23 μm, shows superhydrophobic properties providing a water contact angle of 155 ± 3° with rolling off properties. Also, the activation energy of electrophoretic deposition of stearic-acid-functionalized ZnO nanoparticles is calculated to be 0.5 eV.
Lambert, Cherie; Li, Jimei; Jonscher, Karen; Yang, Teng-Chieh; Reigan, Philip; Quintana, Megan; Harvey, Jean; Freed, Brian M
2007-07-06
Cigarette smoke is a potent inhibitor of pulmonary T cell responses, resulting in decreased immune surveillance and an increased incidence of respiratory tract infections. The alpha,beta-unsaturated aldehydes in cigarette smoke (acrolein and crotonaldehyde) inhibited production of interleukin-2 (IL-2), IL-10, granulocyte-macrophage colony-stimulating factor, interferon-gamma, and tumor necrosis factor-alpha by human T cells but did not inhibit production of IL-8. The saturated aldehydes (acetaldehyde, propionaldehyde, and butyraldehyde) in cigarette smoke were inactive. Acrolein inhibited induction of NF-kappaB DNA binding activity after mitogenic stimulation of T cells but had no effect on induction of NFAT or AP-1. Acrolein inhibited NF-kappaB1 (p50) binding to the IL-2 promoter in a chromatin immunoprecipitation assay by >99%. Using purified recombinant p50 in an electrophoretic mobility shift assay, we demonstrated that acrolein was 2000-fold more potent than crotonaldehyde in blocking DNA binding to an NF-kappaB consensus sequence. Matrix-assisted laser desorption/ionization time-of-flight and tandem mass spectrometry demonstrated that acrolein alkylated two amino acids (Cys-61 and Arg-307) in the DNA binding domain. Crotonaldehyde reacted with Cys-61, but not Arg-307, whereas the saturated aldehydes in cigarette smoke did not react with p50. These experiments demonstrate that aldehydes in cigarette smoke can regulate gene expression by direct modification of a transcription factor.
Layered ceramic composites via control of electrophoretic deposition kinetics
Czech Academy of Sciences Publication Activity Database
Hadraba, Hynek; Drdlík, D.; Chlup, Zdeněk; Maca, K.; Dlouhý, Ivo; Cihlář, J.
2013-01-01
Roč. 33, č. 12 (2013), s. 2305-2312 ISSN 0955-2219 R&D Projects: GA ČR(CZ) GAP108/11/1644; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081723 Keywords : Alumina * Zirconia * Laminates * Electrophoretic deposition Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 2.307, year: 2013
Electrophoretic deposition of composite halloysite nanotube–hydroxyapatite–hyaluronic acid films
Energy Technology Data Exchange (ETDEWEB)
Deen, I. [Department of Materials Science and Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Zhitomirsky, I., E-mail: zhitom@mcmaster.ca [Department of Materials Science and Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)
2014-02-15
Highlights: ► Composite halloysite nanotubes–hydroxyapatite–hyaluronic acid films were prepared. ► Electrophoretic deposition method was used for deposition. ► Natural hyaluronic acid was used as a dispersing, charging and film forming agent. ► Film composition and deposition yield can be varied. ► The films can be used for biomedical implants with controlled release of drugs. -- Abstract: Electrophoretic deposition method has been developed for the deposition of biocomposite films containing halloysite nanotubes (HNTs), hydroxyapatite (HA) and hyaluronic acid. The method is based on the use of natural hyaluronate biopolymer as a dispersing and charging agent for HNT and HA and film forming agent for the fabrication of the composite films. The deposition kinetics was studied by the quartz crystal microbalance method. The composite films were studied by X-ray diffraction, thermogravimetric analysis, differential thermal analysis and electron microscopy. The composite films are promising materials for the fabrication of biomedical implants with advanced functional properties.
Electrophoretic deposition of composite halloysite nanotube–hydroxyapatite–hyaluronic acid films
International Nuclear Information System (INIS)
Deen, I.; Zhitomirsky, I.
2014-01-01
Highlights: ► Composite halloysite nanotubes–hydroxyapatite–hyaluronic acid films were prepared. ► Electrophoretic deposition method was used for deposition. ► Natural hyaluronic acid was used as a dispersing, charging and film forming agent. ► Film composition and deposition yield can be varied. ► The films can be used for biomedical implants with controlled release of drugs. -- Abstract: Electrophoretic deposition method has been developed for the deposition of biocomposite films containing halloysite nanotubes (HNTs), hydroxyapatite (HA) and hyaluronic acid. The method is based on the use of natural hyaluronate biopolymer as a dispersing and charging agent for HNT and HA and film forming agent for the fabrication of the composite films. The deposition kinetics was studied by the quartz crystal microbalance method. The composite films were studied by X-ray diffraction, thermogravimetric analysis, differential thermal analysis and electron microscopy. The composite films are promising materials for the fabrication of biomedical implants with advanced functional properties
Hidalgo, María A; Romero, Alex; Figueroa, Jaime; Cortés, Patricia; Concha, Ilona I; Hancke, Juan L; Burgos, Rafael A
2005-01-01
Andrographolide, the major active component from Andrographis paniculata, has shown to possess anti-inflammatory activity. Andrographolide inhibits the expression of several proinflammatory proteins that exhibit a nuclear factor kappa B (NF-κB) binding site in their gene. In the present study, we analyzed the effect of andrographolide on the activation of NF-κB induced by platelet-activating factor (PAF) and N-formyl-methionyl-leucyl-phenylalanine (fMLP) in HL-60 cells differentiated to neutrophils. PAF (100 nM) and fMLP (100 nM) induced activation of NF-κB as determined by degradation of inhibitory factor B α (IκBα) using Western blotting in cytosolic extracts and by binding to DNA using electrophoretic mobility shift assay (EMSA) in nuclear extracts. Andrographolide (5 and 50 μM) inhibited the NF-κB-luciferase activity induced by PAF. However, andrographolide did not reduce phosphorylation of p38 MAPK or ERK1/2 and did not change IκBα degradation induced by PAF and fMLP. Andrographolide reduced the DNA binding of NF-κB in whole cells and in nuclear extracts induced by PAF and fMLP. Andrographolide reduced cyclooxygenase-2 (COX-2) expression induced by PAF and fMLP in HL-60/neutrophils. It is concluded that andrographolide exerts its anti-inflammatory effects by inhibiting NF-κB binding to DNA, and thus reducing the expression of proinflammatory proteins, such as COX-2. PMID:15678086
Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.
Directory of Open Access Journals (Sweden)
Michael Allevato
Full Text Available The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX bind Enhancer box (E-box DNA elements (CANNTG and have the greatest affinity for the canonical MYC E-box (CME CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87% of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.
Two-dimensional electrophoretic analysis of nuclear matrix proteins in human colon adenocarcinoma.
Toumpanaki, A; Baltatzis, G E; Gaitanarou, E; Seretis, E; Toumpanakis, C; Aroni, K; Kittas, Christos; Voloudakis-Baltatzis, I E
2009-01-01
The aim of the present study was to observe possible qualitative and quantitative expression differences between nuclear matrix proteins (NMPs) of human colon adenocarcinoma and their mirror biopsies, using the technique of two-dimensional gel electrophoresis, in order to identify the existence of specific NMP fingerprints for colon cancer. Colon tissues were examined ultrastructurally and NMPs were isolated biochemically, by serial extraction of lipids, soluble proteins, DNA, RNA, and intermediate filaments and were separated according to their isoelectric point (pI) and their molecular weight (MW) by high-resolution two-dimensional electrophoresis (2D). By comparing the 2D electropherograms of colon cancer tissues and mirror biopsy tissues we observed qualitative and quantitative expression differences between their NMPs but also a differentiation of NMP composition between the stages of malignancy. Moreover, despite the similarities between mirror biopsy samples, a highlight percentage of exception was observed. Electrophoretic results provided in this study demonstrated that the examined NMPs could be further investigated as potential markers for detection of colorectal cancer in an early stage, for the assessment of the disease progression, as well as useful tools for individual therapy and for preventing a possible recurrence of cancer and metastasis.
1998-06-29
Curcumin DFX Desferrioxamine DNA Deoxyribonucleic Acid DPI Diphenyliodinium DPPD Diphenylphenylenediamine DTH Dithionite EMSA Electrophoretic mobility shift... neuroprotective effects (Fern et al., 1996, Morishita et al., 1 1997). The identification of a hypoxia inducible transcription factor known as HIF-1 (Semenza...derived EPO in the eNS neuroprotective response to hypoxia. Cloning of the human and murine EPO gene, the availability of a convenient EPa producing
International Nuclear Information System (INIS)
Ra, Woo Youn; Woo, Won Hyung
1971-01-01
During the period from June. 1969 to Dec. 1970, the serum protein electrophoretic patterns of 44 cases of various cancer patients have been studied to determine the alterations in serum protein fractions in patients who were responding to irradiation or those failing. The serum electrophoretic pattern could be observed as an indicator of prognosis or radiosensitivity. A blood sample was obtained prior to any treatment and the follow up sampling was performed 2 times during radiation therapy. Serum total protein was determined by the method of Wolfson and serum electrophoresis was carried out by using Spinoco Model R B electrophoresis system. The results were following: Seven cases out of cases of cervical cancer responding favorably to radiotherapy showed decreased in Alpha-2 globulin fraction were increased. A case whose third time serum electrophoretic pattern showed multiple myeloma type died 5 months after radiotherapy with bone metastasis. Four cases out of 9 cases of favorably responded breast cancer patients showed decreased in Alpha-2 globulin foraction compared with 2 cases of unfavorable response showed increased in Alpha-2 globulin fraction
Energy Technology Data Exchange (ETDEWEB)
Ra, Woo Youn; Woo, Won Hyung [Kyungpook National University School of Medicine, Taegu (Korea, Republic of)
1971-10-15
During the period from June. 1969 to Dec. 1970, the serum protein electrophoretic patterns of 44 cases of various cancer patients have been studied to determine the alterations in serum protein fractions in patients who were responding to irradiation or those failing. The serum electrophoretic pattern could be observed as an indicator of prognosis or radiosensitivity. A blood sample was obtained prior to any treatment and the follow up sampling was performed 2 times during radiation therapy. Serum total protein was determined by the method of Wolfson and serum electrophoresis was carried out by using Spinoco Model R B electrophoresis system. The results were following: Seven cases out of cases of cervical cancer responding favorably to radiotherapy showed decreased in Alpha-2 globulin fraction were increased. A case whose third time serum electrophoretic pattern showed multiple myeloma type died 5 months after radiotherapy with bone metastasis. Four cases out of 9 cases of favorably responded breast cancer patients showed decreased in Alpha-2 globulin foraction compared with 2 cases of unfavorable response showed increased in Alpha-2 globulin fraction.
Vries, de R.
2011-01-01
A large literature exists on modeling the influence of sequence-specific DNA-binding proteins on the shape of the DNA double helix in terms of one or a few fixed constraints. This approach is inadequate for the many proteins that bind DNA sequence independently, and that are present in very large
Effect of acids and bases on electrophoretic deposition of
Czech Academy of Sciences Publication Activity Database
Cihlář, J.; Drdlík, D.; Cihlářová, Z.; Hadraba, Hynek
2013-01-01
Roč. 33, č. 10 (2013), s. 1885-1892 ISSN 0955-2219 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0068; GA ČR GD106/09/H035 Institutional support: RVO:68081723 Keywords : Electrophoretic deposition * Zirconia * Alumina * 2-Propanol * Electrosteric stabilization Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 2.307, year: 2013
Positively charged TiO{sub 2} particles in non-polar system for electrophoretic display
Energy Technology Data Exchange (ETDEWEB)
Chang, Young Seon
2005-02-15
Electrophoretic display uses a technique called electrophoresis to represent images and letters electronically with electronic ink. Although it has good characteristics such as wide viewing angle, high contrast ratio and extremely low power consumption, there are still several issues to be resolved to improve its performances. Higher mobility and stability of the ink particles are the most important issues among them. In this study, TiO{sub 2} particles coated with acrylamide were found to be effective ink particles that satisfy higher mobility and stability. The TiO{sub 2} particles coated with 5∼40% acrylamide were prepared by dispersion polymerization using monomers of methyl methacrylate (MMA) and acrylamide. The TiO{sub 2} particles coated with acrylamide were dispersed in isopar-G with sorbitan esters such as span 20, span 80 and span 85. The size of the TiO{sub 2} particles were changed from 200±150 nm to 350∼500 nm by the coating process. The morphology of coated particles was observed using a transmission electron microscope (TEM) and thermogravimetric analysis (TGA). From the TGA results, the weight fraction of TiO{sub 2} and polymer in coated particle were calculated. From the zeta potential measurement, it was shown that as acrylamide concentration was increased from 5% to 30%, zeta potential of the coated TiO{sub 2} particles was increased from 50mV to about 230mV. The zeta potential of the coated TiO{sub 2} particles with 40% acrylamide was decreased to 50mV. As a stabilizer, span 85 was the most effective surfactant to improve stability of the TiO{sub 2} particles coated with acrylamide among used surfactants in this study. Span 85 showed best stability in the storage test with TiO{sub 2} particles coated with 10% acrylamide. The mobility of TiO{sub 2} particles coated with acrylamide with span 85 in dye solution (Oil Blue-N dissolved in isopar-G) were measured by ITO cell test. The mobility of TiO{sub 2} particles coated with 10∼30
International Nuclear Information System (INIS)
Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.
1996-01-01
Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in
Electrophoretic deposits of boron on duralumin plates used for measuring neutron flux
International Nuclear Information System (INIS)
Lang, F.M.; Magnier, P.; Finck, C.
1956-01-01
Preparation of boron thin film deposits of around 1 mg per cm 2 on duralumin plates with a diameter of 8 cm. The boron coated plates for ionization chambers were originally prepared at the CEA by pulverization of boron carbides on sodium silicates. This method is not controlling precisely enough the quantity of boron deposit. Thus, an electrophoretic method is considered for a better control of the quantity of boron deposit in the scope of using in the future boron 10 which is costly and rare. The method described by O. Flint is not satisfying enough and a similar electrophoretic process has been developed. Full description of the method is given as well as explanation of the use of dried methanol as solvent, tannin as electrolyte and magnesium chloride to avoid alumina formation. (M.P.)
Engineering of magnetic DNA nanoparticles for tumor-targeted therapy
International Nuclear Information System (INIS)
Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.
2013-01-01
This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.
Engineering of magnetic DNA nanoparticles for tumor-targeted therapy
Energy Technology Data Exchange (ETDEWEB)
Hosseinkhani, Hossein, E-mail: hosseinkhani@yahoo.com [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)
2013-01-15
This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.
Electrophoretic deposition of PEEK-TiO 2 composite coatings on stainless steel
Seuß , Sigrid; Subhani, Tayyab; Yi Kang, Min; Okudaira, Kenji; Ventura, Isaac Aguilar; Boccaccini, Aldo R.
2012-01-01
Electrophoretic deposition (EPD) has been successfully used to deposit composite coatings composed of polyetheretherketone (PEEK) and titanium dioxide (TiO 2) nanoparticles on 316L stainless steel substrates. The suspensions of TiO2 nanoparticles
Electrophoretic preparation and characterization of porous electrodes from diamond nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Riveros, Lyda La Torre; Soto, Keyla; Tryk, Donald A; Cabrera, Carlos R [Department of Chemistry and Center of Nanoscale Materials, University of Puerto Rico, Rio Piedras, PO Box 23346 San Juan, PR 00931-3346 (Puerto Rico)
2007-04-15
We carried out chemical purification of commercially available diamond nanoparticles by refluxing in aqueous HNO{sub 3} and characterized the samples by spectroscopic and surface techniques before and after purification. As a first step in the preparation of electrodes for electrochemistry, we have electrophoretically deposited thin, highly uniform films of controlled thickness (1-8 {mu}m) on silicon substrates using the purified diamond nanoparticles. These have been characterized by scanning electron microscopy (SEM). All films obtained were homogeneous in thickness and without macroscopic holes or cracks. Such structures could also be used in many other applications such as fuel cells or lithium batteries. We have performed cyclic voltammetry experiments with these electrodes. The voltammograms of diamond nanoparticles electrophoretically deposited on silicon indicate hydrogen evolution. This demonstrates that the material is useful as electrocatalitic support. This conclusion is supported by the cyclic voltammograms obtained using ferrycyanide (III) chloride and hexaamineruthenium (III) chloride complexes as redox probes. However, these redox probes showed very small peak currents. This behavior could be improved by doping the diamond nanoparticles with an impurity such as boron.
Electrophoretic preparation and characterization of porous electrodes from diamond nanoparticles
International Nuclear Information System (INIS)
Riveros, Lyda La Torre; Soto, Keyla; Tryk, Donald A; Cabrera, Carlos R
2007-01-01
We carried out chemical purification of commercially available diamond nanoparticles by refluxing in aqueous HNO 3 and characterized the samples by spectroscopic and surface techniques before and after purification. As a first step in the preparation of electrodes for electrochemistry, we have electrophoretically deposited thin, highly uniform films of controlled thickness (1-8 μm) on silicon substrates using the purified diamond nanoparticles. These have been characterized by scanning electron microscopy (SEM). All films obtained were homogeneous in thickness and without macroscopic holes or cracks. Such structures could also be used in many other applications such as fuel cells or lithium batteries. We have performed cyclic voltammetry experiments with these electrodes. The voltammograms of diamond nanoparticles electrophoretically deposited on silicon indicate hydrogen evolution. This demonstrates that the material is useful as electrocatalitic support. This conclusion is supported by the cyclic voltammograms obtained using ferrycyanide (III) chloride and hexaamineruthenium (III) chloride complexes as redox probes. However, these redox probes showed very small peak currents. This behavior could be improved by doping the diamond nanoparticles with an impurity such as boron
Qin, Yangzhong; Yang, Yi; Zhang, Luyuan; Fowler, Jason D.; Qiu, Weihong; Wang, Lijuan; Suo, Zucai; Zhong, Dongping
2013-01-01
Water plays essential structural and dynamical roles in protein-DNA recognition through contributing to enthalpic or entropic stabilization of binding complex and by mediating intermolecular interactions and fluctuations for biological function. These interfacial water molecules are confined by the binding partners in nanospace but in many cases they are highly mobile and exchange with outside bulk solution. Here, we report our studies of the interfacial water dynamics in the binary and terna...
Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z
1994-01-01
The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.
The PS1 hairpin of Mcm3 is essential for viability and for DNA unwinding in vitro.
Directory of Open Access Journals (Sweden)
Simon K W Lam
Full Text Available The pre-sensor 1 (PS1 hairpin is found in ring-shaped helicases of the AAA+ family (ATPases associated with a variety of cellular activities of proteins and is implicated in DNA translocation during DNA unwinding of archaeal mini-chromosome maintenance (MCM and superfamily 3 viral replicative helicases. To determine whether the PS1 hairpin is required for the function of the eukaryotic replicative helicase, Mcm2-7 (also comprised of AAA+ proteins, we mutated the conserved lysine residue in the putative PS1 hairpin motif in each of the Saccharomyces cerevisiae Mcm2-7 subunits to alanine. Interestingly, only the PS1 hairpin of Mcm3 was essential for viability. While mutation of the PS1 hairpin in the remaining MCM subunits resulted in minimal phenotypes, with the exception of Mcm7 which showed slow growth under all conditions examined, the viable alleles were synthetic lethal with each other. Reconstituted Mcm2-7 containing Mcm3 with the PS1 mutation (Mcm3(K499A had severely decreased helicase activity. The lack of helicase activity provides a probable explanation for the inviability of the mcm3(K499A strain. The ATPase activity of Mcm2-7(3K499A was similar to the wild type complex, but its interaction with single-stranded DNA in an electrophoretic mobility shift assay and its associations in cells were subtly altered. Together, these findings indicate that the PS1 hairpins in the Mcm2-7 subunits have important and distinct functions, most evident by the essential nature of the Mcm3 PS1 hairpin in DNA unwinding.
Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing
2010-01-01
DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research addresses how the...Acid dsDNA double stranded DNA MOSAIC Mobile Stream Processing Cluster PCR Polymerase Chain Reaction RAM Random Access Memory ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ...are 5′→3′ and strands with strikethrough are 3′→5′. A dsDNA duplex formed between a strand and its reverse complement is called a
International Nuclear Information System (INIS)
Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G.; Paoli, F.
2015-01-01
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T 4 endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T 4 endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T 4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)
Energy Technology Data Exchange (ETDEWEB)
Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G., E-mail: adnfonseca@ig.com.br [Instituto de Biologia Roberto Alcantara Gomes, Rio de Janeiro, RJ (Brazil). Departamento de Biofisica e Biometria. Lab. de Ciencias Radiologicas; Paoli, F. [Universidade Federal de Juiz de Fora (UFJF), Juiz de Fora, MG (Brazil). Instituto de Ciencias Biologicas. Departamento de Morfologia
2015-10-15
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T{sub 4} endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T{sub 4} endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T{sub 4} endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.
Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J
2018-04-06
In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.
Rojaee, Ramin; Fathi, Mohammadhossein; Raeissi, Keyvan
2014-12-01
Magnesium is one of the most critical elements in hard tissues regeneration and therefore causes speeding up the restoration of harmed bones, while high deterioration rate of magnesium in body fluid restricts it to be used as biodegradable implants. Alloying magnesium with some relatively nobler metals such as aluminium, zinc, rare earth elements, magnesium-bioceramics composites, and surface modification techniques are some of the routes to control magnesium corrosion rate. In this study AZ91 magnesium alloy had been coated by nanostructured hydroxyapatite via sol-gel dip coating and electrophoretical methods to survey the final barricade properties of the obtained coatings. In order to perform electrophoretic coating, powders were prepared by sol-gel method, and then the powders deposited on substrates utilizing direct current electricity. Zeta potentials of the electrophoresis suspensions were measured to determine a best mode for good quality coatings. Transmission Electron Microscopy (TEM), and Scanning Electron Microscopy (SEM) were used to confirm nanoscale dimension, and the uniformity of the nanostructured hydroxyapatite coating, respectively. Fourier Transform-Infrared and X-ray diffraction analysis were utilized for functional group and phase structure evaluation of the prepared coatings, correspondingly. Electrochemical corrosion tests were performed in SBF at 37±1 (°)C which revealed considerable increase in corrosion protection resistivity and corrosion current density for electrophoretic coated specimens versus sol-gel coated specimens. Results showed that both sol-gel and electrophoretical techniques seem to be suitable to coat magnesium alloys for biomedical applications but electrophoretic coating technique is a better choice due to the more homogeneity and more crystalline structure of the coating.
International Nuclear Information System (INIS)
Maekawa, Hideaki; Tsuchida, Kozo; Hashido, Kazuo; Takada, Naoko; Kameoka, Yosuke; Hirata, Makoto
2004-01-01
Centromere of human chromosome was recognized easily and certainly by fluorescence in situ hybridization (FISH) process. The DNA in plasmid were extracted right after irradiation of 137 Cs before repairs of the damaged DNA. Genes of the damaged DNA were detected by polymerase cycle restoration (PCR) process. Cut off frequency for two chains in the DNA were detected in real time. The cut off frequency in the damaged plasmid DNA detected by the PCR process was compared with simulation calculation. The difference between these cut off frequency values was within the value expected by electrophoretic mobility. It was cleared that the PCR amplification was difficult for the close structure of plasmid, but carried immediately on the nicked plasmid. (M. Suetake)
Comparison of serum protein electrophoretic pattern in cows and small ruminants
Directory of Open Access Journals (Sweden)
Oskar Nagy
2015-01-01
Full Text Available Determination of the physiological electrophoretic patterns in animals is very useful for clinicians in diagnosing healthy and sick animals. The objective of this study was to investigate the serum protein electrophoretic pattern in cows, sheep, and goats in order to evaluate the differences in the size and number of protein fractions between the evaluated ruminant species. Ten adult multiparous high-yielding dairy cows, 10 adult female sheep and 10 adult female goats were included in this study. All the evaluated animals were clinically healthy. Serum was analyzed for total serum protein concentrations, and for the relative and absolute values of protein fractions with calculation of albumin/globulin ratios. Serum protein fractions were separated by zone electrophoresis on buffered agarose gel. Serum protein electrophoresis identified 6 distinct bands, comprising albumin, alpha1- (α1, alpha2- (α2, beta1- (β1, beta2- (β2, and gamma- (γ globulins in cows. In sheep, serum proteins exhibited 6 fractions: albumin, α1-, α2-, β-, γ1- and γ2-globulins. In goats, serum proteins were separated into 5 fractions: albumin, α1-, α2-, β- and γ-globulins. Significant differences in the relative as well as absolute means were found for the albumin/globulin ratio and most of the protein fractions, except γ-globulins. No significant differences were found in the concentration of total proteins. These results describe the marked species differences in most of serum protein fractions between the evaluated groups of animals, and contribute to the current knowledge about the physiological electrophoretic pattern of serum proteins in ruminants, which can be used for diagnostic purposes.
Nano-structured yttria-stabilized zirconia coating by electrophoretic deposition
Energy Technology Data Exchange (ETDEWEB)
Maleki-Ghaleh, H., E-mail: H_Maleki@sut.ac.ir [Faculty of Materials Engineering, Sahand University of Technology, Tabriz (Iran, Islamic Republic of); Rekabeslami, M. [Faculty of Mechanical Engineering, Materials Science and Engineering Division, K. N. Toosi University of Technology, Tehran (Iran, Islamic Republic of); Shakeri, M.S. [Materials and Energy Research Center, Karaj (Iran, Islamic Republic of); Siadati, M.H. [Faculty of Mechanical Engineering, Materials Science and Engineering Division, K. N. Toosi University of Technology, Tehran (Iran, Islamic Republic of); Javidi, M. [Department of Materials Science and Engineering, School of Engineering, Shiraz University, Shiraz (Iran, Islamic Republic of); Talebian, S.H. [Faculty of Petroleum Engineering, Universiti Technologi Petronas, Perak (Malaysia); Aghajani, H. [Department of Materials Engineering, University of Tabriz, Tabriz (Iran, Islamic Republic of)
2013-09-01
The most important role of thermal barrier coatings is to reduce the temperature of the substrate in high temperature applications. Nanoparticle zirconia might be a suitable choice for improving the efficiency of thermal barrier coatings. Nanostructured coatings have lower thermal conduction, higher thermal expansion and lower dimensional variations at higher temperatures in comparison with the microstructured coatings. Electrophoretic deposition has been preferred for thermal barrier coatings due to its simplicity, controllability and low cost. In the present study, three different suspensions of ZrO{sub 2}–8 wt%Y{sub 2}O{sub 3} (40 nm) made with ethanol, acetone and acetyl acetone were used. Electrophoretic deposition was conducted at a fixed voltage of 60 V for 120 s on aluminized Inconel 738-LC, and then heat treated at 1100{sup o}C for 4 h in air atmosphere. The coating morphology and elemental distribution were studied using scanning electron microscopy. It was observed that suspension media have an important effect on the quality of the final product. Acetyl acetone showed better dispersion of particles than the other two media. Consequently, deposition from acetyl acetone resulted in uniform and crack-free layers while those from ethanol and acetone were completely non-uniform due to agglomeration and low viscosity, respectively.
Cationic Polybutyl Cyanoacrylate Nanoparticles for DNA Delivery
Directory of Open Access Journals (Sweden)
Jinghua Duan
2009-01-01
Full Text Available To enhance the intracellular delivery potential of plasmid DNA using nonviral vectors, we used polybutyl cyanoacrylate (PBCA and chitosan to prepare PBCA nanoparticles (NPs by emulsion polymerization and prepared NP/DNA complexes through the complex coacervation of nanoparticles with the DNA. The object of our work is to evaluate the characterization and transfection efficiency of PBCA-NPs. The NPs have a zeta potential of 25.53 mV at pH 7.4 and size about 200 nm. Electrophoretic analysis suggested that the NPs with positive charges could protect the DNA from nuclease degradation and cell viability assay showed that the NPs exhibit a low cytotoxicity to human hepatocellular carcinoma (HepG2 cells. Qualitative and quantitative analysis of transfection in HepG2 cells by the nanoparticles carrying plasmid DNA encoding for enhanced green fluorescent protein (EGFP-N1 was done by digital fluorescence imaging microscopy system and fluorescence-activated cell sorting (FACS. Qualitative results showed highly efficient expression of GFP that remained stable for up to 96 hours. Quantitative results from FACS showed that PBCA-NPs were significantly more effective in transfecting HepG2 cells after 72 hours postincubation. The results of this study suggested that PBCA-NPs have favorable properties for nonviral delivery.
Influence of amino acids Shiff bases on irradiated DNA stability in vivo.
Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G
2013-01-01
To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.
Nisha, C K; Manorama, Sunkara V; Ganguli, Munia; Maiti, Souvik; Kizhakkedathu, Jayachandran N
2004-03-16
Complete biophysical characterization of complexes (polyplexes) of cationic polymers and DNA is needed to understand the mechanism underlying nonviral therapeutic gene transfer. In this article, we propose a new series of synthesized random cationic polymers (RCPs) from methoxy poly(ethylene glycol) monomethacrylate (MePEGMA) and (3-(methacryloylamino)propyl)trimethylammonium chloride with different mole ratios (32:68, 11:89, and 6:94) which could be used as a model system to address and answer the basic questions relating to the mechanism of the interaction of calf thymus DNA (CT-DNA) and cationic polymers. The solubility of the complexes of CT-DNA and RCP was followed by turbidity measurements. It has been observed that complexes of RCP with 68 mol % MePEGMA precipitate near the charge neutralization point, whereas complexes of the other two polymers are water-soluble and stable at all compositions. Dnase 1 digestion experiments show that DNA is inaccessible when it forms complexes with RCP. Ethidium bromide exclusion and gel electrophoretic mobility show that both polymers are capable of binding with CT-DNA. Atomic force microscopy images in conjunction with light scattering experiments showed that the complexes are spherical in nature and 75-100 nm in diameter. Circular dichroism spectroscopy studies indicated that the secondary structure of DNA in the complexes is not perturbed due to the presence of poly(ethylene glycol) segments in the polymer. Furthermore, we used a combination of spectroscopic and calorimetric techniques to determine complete thermodynamic profiles accompanying the helix-coil transition of CT-DNA in the complexes. UV and differential scanning calorimetry melting experiments revealed that DNA in the complexes is more stable than in the free state and the extent of stability depends on the polymer composition. Isothermal titration calorimetry experiments showed that the binding of these RCPs to CT-DNA is associated with small exothermic
International Nuclear Information System (INIS)
Garcia, P.; Hermoso, J.M.; Garcia, J.A.; Garcia, E.; Lopez, R.; Salas, M.
1986-01-01
Incubation of extracts of Cp-1-infected Streptococcus pneumoniae with [α- 32 P]dATP produced a labeled protein with the electrophoretic mobility of the Cp-1 terminal protein. The reaction product was resistant to treatment with micrococcal nuclease and sensitive to treatment with proteinase K. Incubation of the 32 P-labeled protein with 5 M piperidine for 4 h at 50 0 C released 5'-dAMP, indicating that a covalent complex between the terminal protein and 5'-dAMP was formed in vitro. When the four deoxynucleoside triphosphates were included in the reaction mixture, a labeled complex of slower electrophoretic mobility in sodium dodecyl sulfate-polyacrylamide gels than the terminal protein-dAMP complex was also found, indicating that the Cp-1 terminal protein-dAMP complex can be elongated and, therefore, that it is an initiation complex. Treatment of the 32 P-labeled terminal protein-dAMP complex with 5.8 M HCl at 110 0 C for 2 h yielded phosphothreonine. These results, together with the resistance of the terminal protein-DNA linkage to hydroxylamine, suggest that the Cp-1 terminal protein is covalently linked to the DNA through a phosphoester bond between L-threonine and 5'-dAMP, namely, a O-5'-deoxyadenylyl-L-threonine bond
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
Aranda, Xavier G; Racho, Ronald G; Pacheco-Rodríguez, Gustavo; Alvarez-González, Rafael
2014-01-01
Nucleic acid metabolism is biochemically compartmentalized to the nucleus. Thus, it is necessary to define the proteome of the various macromolecular structures within this organelle. We isolated the nuclear matrix (NM) fraction from rat liver by sequential centrifugation steps at 13,000 rpm, staggered between endogenous nuclease treatment for 2 h at 37°C, followed by high-salt (H.S.; 2.0 M NaCl) and non-ionic detergent extractions (0.1%- or 1.0% Triton X-100) to eliminate the bulk of chromosomal DNA/RNA, histone proteins and the nuclear envelope (NE). Integrity of the NM and NE structures was confirmed by electron microscopy. Next, we analyzed the NM proteome on a 20% polyacrylamide gel using the PhastSystem. We observed the absence of histone proteins and the characteristic presence of the lamins by Coomassie blue staining. By contrast, upon silver staining, following electrophoretic separation with a Tris-Borate-EDTA buffer, we observed the NM-associated nucleic RNA and protein-free ADP-ribose polymers. While polymers are found in much lower concentration than RNA in NM, they were purified by affinity chromatography on boronate resin prior to electrophoresis. We observed the electrophoretic resolution of free ADP-ribose chains (5-25 units) by silver staining. The significance of our observations to cancer studies and carcinogenesis is discussed. Copyright© 2014, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.
Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids
Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.
2015-04-01
Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
A rollable, organic electrophoretic QVGA display with field-shielded pixel architecture
Gelinck, G.H.; Huitema, H.E.A.; Mil, M. van; Veenendaal, E. van; Lieshout, P.J.G. van; Touwslager, F.; Patry, S.F.; Sohn, S.; Whitesides, T.; McCreary, M.D.
2006-01-01
A 100-um thin QVGA display was made by combining a 25-um thin organic transistor active-matrix backplane with an electrophoretic display film. High contrast and low crosstalk was achieved by the addition of a field shield to the backplane. The display can be bent repeatedly to a radius of 2 mm
International Nuclear Information System (INIS)
Gao Li; Sun Chong; Qiu Hongling; Liu Hui; Shao Huanjie; Wang Jun; Li Wenxin
2004-01-01
To investigate the zinc finger genes involved in human embryonic development, we constructed a C 2 H 2 -ZNF enriched human embryonic cDNA library, from which a novel human gene named hKid3 was identified. The hKid3 cDNA encodes a 554 amino acid protein with an amino-terminal KRAB domain and 11 carboxyl-terminal C 2 H 2 zinc finger motifs. Northern blot analysis indicates that two hKid3 transcripts of 6 and 8.5 kb express in human fetal brain and kidney. The 6 kb transcript can also be detected in human adult brain, heart, and skeletal muscle while the 8.5 kb transcript appears to be embryo-specific. GFP-fused hKid3 protein is localized to nuclei and the ZF domain is necessary and sufficient for nuclear localization. To explore the DNA-binding specificity of hKid3, an oligonucleotide library was selected by GST fusion protein of hKid3 ZF domain, and the consensus core sequence 5'-CCAC-3' was evaluated by competitive electrophoretic mobility shift assay. Moreover, The KRAB domain of hKid3 exhibits transcription repressor activity when tested in GAL4 fusion protein assay. These results indicate that hKid3 may function as a transcription repressor with regulated expression pattern during human development of brain and kidney
Electrophoretic Ink Display Prepared by Jelly Fig Pectin/Gelatin Microspheres
Directory of Open Access Journals (Sweden)
Wing-Ming Chou
2015-05-01
Full Text Available A brand new Bio-Electronic ink (Bio-E ink display device was prepared and characterized in this study. Semiconductor material, copper phthalocyanine (CuPc was modified by cationic surfactants, cetylpyridinium chloride (CPC, as the core material, and the shell of capsule was prepared by jelly fig pectin, gelatin and sodium dodecyl sulphate (SDS. Here, jelly fig pectin was provided as the shell material for the first time. Chemical structure of the modified CuPc was characterized by Fourier Transform Infrared Spectrometer (FTIR. The core-shell microcapsules were achieved by coacervation method in an oil/water (O/W emulsion system. The particle size and morphology of microcapsules were affected by the concentrations of SDS and pH values of the O/W emulsion system. A new microcapsule-based electrophoretic display device was presented. Its image display ability of the microcapsules electrophoretic device was presented as appropriated electric power was applied, and the response time was 0.06 sec under 0.1 V/mm of electric field. Moreover, we found that its image contrast ratio of display device was influenced by the particle sizes of the microcapsules.
Numerical simulation of stress-strain state of electrophoretic shell molds
Sviridov, A. V.; Odinokov, V. I.; Dmitriev, E. A.; Evstigneev, A. I.; Bashkov, O. V.
2017-10-01
In the foundry engineering, castings obtained in one-piece non-gas-generating high-refractory electrophoretic shell molds (ShM) by investment patterns (IP) have an increased rejects percentage associated with low deformation resistance and crack resistance of the SM at different stages of their formation and manufacturing. Crack resistance of the ShM based on IP depends mainly on their stress-strain state (SSS) at various stages of mold forming. SSS decrease significantly improves their crack resistance and decreases their rejects percentage of castings occurring due to clogging and surface defects. In addition, the known methods of decreasing the SSS are still poorly understood. Thus, current research trends are to determine SSS at each stage of ShM forming and develop the ways to decrease it. Theoretical predicting of crack formation in multiple-layer axisymmetric shell molds is given in the work [1], and SSS of multiple-layer axisymmetric shell molds is given in the work [2]. Monolayer electrophoretic ShM had a lack of concern in this field, thus it became an argument for the present workMathematical Model of ShM SSS
International Nuclear Information System (INIS)
Adámik, Matej; Bažantová, Pavla; Navrátilová, Lucie; Polášková, Alena; Pečinka, Petr; Holaňová, Lucie; Tichý, Vlastimil; Brázdová, Marie
2015-01-01
Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed
Energy Technology Data Exchange (ETDEWEB)
Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)
2015-01-02
Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.
Energy Technology Data Exchange (ETDEWEB)
Khan, Nazir M; Sandur, Santosh K; Checker, Rahul; Sharma, Deepak; Poduval, T.B., E-mail: nazirbiotech@rediffmail.com [Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai (India)
2012-07-01
1,4-Naphthoquinone (NQ) is the parent molecule of many clinically approved anticancer, anti-infective, and antiparasitic drugs such as anthracycline, mitomycin, daunorubicin, doxorubicin, diospyrin, and malarone. Presence of NQ during a-irradiation (4Gy) significantly reduced the death of irradiated murine splenic lymphocytes in a dose dependent manner (0.05-liM), with complete protection at liM as assessed by PI staining. Radioprotection by NQ was further confirmed by inhibition of caspase activation, decrease in cell size, DNA-fragmentation, nuclear-blebbing and clonogenic assay. All trans retinoic acid which is inhibitor of Nrf-2 pathway, completely abrogated the radioprotective effect of NQ, suggesting that radioprotective activity of NQ may be due to activation of Nrf-2 signaling pathways. Further, addition of NQ to lymphocytes activated Nrf-2 in time dependent manner as shown by confocal microscopy, electrophoretic mobility shift assay and quantitative real time PCR. It also increased the expression of Nrf-2 dependent cytoprotective genes like hemeoxygenase-1, MnSOD, catalse as demonstrated by real time PCR and flowcytometry. NQ protected lymphocytes significantly against radiation-induced cell death even when added after irradiation. Complete protection was observed by addition of NQ up to 2 h after irradiation. However, percentage protection decreased with increasing time interval. These results suggested that NQ may offer protection to lymphocytes activating repair pathways. Repair of radiation induced DNA strand breaks was studied by comet assay. Pretreatment of lymphocytes with NQ induced single strand breaks up to 6h but not double strand breaks in DNA. However, NQ mediated single strand breaks were repaired completely at longer time intervals. Addition of NQ to lymphocytes prior to 4 Gy a-radiation exposure showed decrease in the yield of DNA double strand breaks. The observed time-dependent decrease in the DNA strand breaks could be attributed to
Lanthanides separation by counter - current electrophoretic using α - hydroxyisobutyric acid
International Nuclear Information System (INIS)
Alleluia, I.B.
1975-01-01
Studies about counter-current electrophoretic separation of rare earth metal ions using α-hydroxyisobutyric acid as complexing electrolyte are discussed. La, Pr, Nd, Sm and Eu were separated and fractions with purities better than 99,9% were obtained, using neutron activation analysis. A relation between the first stability constant of the α-hydroxyisobutyrate/lanthanide complexes and their migration velocities were observed. (M.J.C.) [pt
Zirconium phosphate coating on aluminium foams by electrophoretic deposition for acidic catalysis
Ordomskiy, V.; Schouten, J.C.; Schaaf, van der J.; Nijhuis, T.A.
2012-01-01
The electrophoretic deposition method has been applied for the formation of an amorphous zirconium phosphate layer on the surface of open-cell aluminum foam. The aluminum foam was fully and uniformly covered by the zirconium phosphate layer with a good mechanical adherence to the support. The
Kostal, Vratislav; Arriaga, Edgar A.
2011-01-01
Interactions between the cytoskeleton and mitochondria are essential for normal cellular function. An assessment of such interactions is commonly based on bulk analysis of mitochondrial and cytoskeletal markers present in a given sample, which assumes complete binding between these two organelle types. Such measurements are biased because they rarely account for non-bound ‘free’ subcellular species. Here we report on the use of capillary electrophoresis with dual laser induced fluorescence detection (CE-LIF) to identify, classify, count and quantify properties of individual binding events of mitochondria and cytoskeleton. Mitochondria were fluorescently labeled with DsRed2 while F-actin, a major cytoskeletal component, was fluorescently labeled with Alexa488-phalloidin. In a typical subcellular fraction of L6 myoblasts, 79% of mitochondrial events did not have detectable levels of F-actin, while the rest had on average ~2 zeptomole F-actin, which theoretically represents a ~ 2.5-μm long network of actin filaments per event. Trypsin treatment of L6 subcellular fractions prior to analysis decreased the fraction of mitochondrial events with detectable levels of F-actin, which is expected from digestion of cytoskeletal proteins on the surface of mitochondria. The electrophoretic mobility distributions of the individual events were also used to further distinguish between cytoskeleton-bound from cytoskeleton-free mitochondrial events. The CE-LIF approach described here could be further developed to explore cytoskeleton interactions with other subcellular structures, the effects of cytoskeleton destabilizing drugs, and the progression of viral infections. PMID:21309532
Liu, Lei; Huang, Cheng; He, Zheng-Guo
2014-03-28
3-Methyladenine DNA glycosylase recognizes and excises a wide range of damaged bases and thus plays a critical role in base excision repair. However, knowledge on the regulation of DNA glycosylase in prokaryotes and eukaryotes is limited. In this study, we successfully characterized a TetR family transcriptional factor from Mycobacterium bovis bacillus Calmette-Guerin (BCG), namely BCG0878c, which directly regulates the expression of 3-methyladenine DNA glycosylase (designated as MbAAG) and influences the base excision activity of this glycosylase at the post-translational level. Using electrophoretic mobility shift assay and DNase I footprinting experiments, we identified two conserved motifs within the upstream region of mbaag specifically recognized by BCG0878c. Significant down-regulation of mbaag was observed in BCG0878c-overexpressed M. bovis BCG strains. By contrast, about 12-fold up-regulation of mbaag expression was found in bcg0878c-deleted mutant M. bovis BCG strains. β-Galactosidase activity assays also confirmed these results. Thus, BCG0878c can function as a negative regulator of mbaag expression. In addition, the regulator was shown to physically interact with MbAAG to enhance the ability of the glycosylase to bind damaged DNA. Interaction between the two proteins was further found to facilitate AAG-catalyzed removal of hypoxanthine from DNA. These results indicate that a TetR family protein can dually regulate the function of 3-methyladenine DNA glycosylase in M. bovis BCG both at the transcriptional and post-translational levels. These findings enhance our understanding of the expression and regulation of AAG in mycobacteria.
Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi
2003-01-01
Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.
Sintering of MnCo2O4 coatings prepared by electrophoretic deposition
DEFF Research Database (Denmark)
Bobruk, M.; Molin, Sebastian; Chen, Ming
2018-01-01
Sintering of MnCo2O4 coatings prepared by electrophoretic deposition on steel substrates has been studied in air and in reducing-oxidizing atmosphere. Effect of temperature and pO2 on the resulting coating density was evaluated from scanning electron microscopy images of polished cross sections...
DNA Sequencing by Capillary Electrophoresis
Karger, Barry L.; Guttman, Andras
2009-01-01
Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496
Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul
2013-07-15
There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.
Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz
2015-01-01
Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217
Rapid DNA analysis for automated processing and interpretation of low DNA content samples.
Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F
2016-01-01
Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample
Biery, B. J.; Stein, D. E.; Morton, D. H.; Goodman, S. I.
1996-01-01
The structure of the human glutaryl coenzyme A dehydrogenase (GCD) gene was determined to contain 11 exons and to span approximately 7 kb. Fibroblast DNA from 64 unrelated glutaric acidemia type I (GA1) patients was screened for mutations by PCR amplification and analysis of SSCP. Fragments with altered electrophoretic mobility were subcloned and sequenced to detect mutations that caused GA1. This report describes the structure of the GCD gene, as well as point mutations and polymorphisms fou...
Czech Academy of Sciences Publication Activity Database
Křížek, T.; Kubíčková, A.; Hladílková, Jana; Coufal, P.; Heyda, J.; Jungwirth, Pavel
2014-01-01
Roč. 35, č. 5 (2014), s. 617-624 ISSN 0173-0835 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : EOF markers * ion-specific effects * ion-specific mobilization * molecular dynamics simulations * neutral analytes Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.028, year: 2014
Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F
2014-06-01
Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.
The 2100MHz radiofrequency radiation of a 3G-mobile phone and the DNA oxidative damage in brain.
Sahin, Duygu; Ozgur, Elcin; Guler, Goknur; Tomruk, Arın; Unlu, Ilhan; Sepici-Dinçel, Aylin; Seyhan, Nesrin
2016-09-01
We aimed to evaluate the effect of 2100MHz radiofrequency radiation emitted by a generator, simulating a 3G-mobile phone on the brain of rats during 10 and 40 days of exposure. The female rats were randomly divided into four groups. Group I; exposed to 3G modulated 2100MHz RFR signal for 6h/day, 5 consecutive days/wk for 2 weeks, group II; control 10 days, were kept in an inactive exposure set-up for 6h/day, 5 consecutive days/wk for 2 weeks, group III; exposed to 3G modulated 2100MHz RFR signal for 6h/day, 5 consecutive days/wk for 8 weeks and group IV; control 40 days, were kept in an inactive exposure set-up for 6h/day, 5 consecutive days/wk for 8 weeks. After the genomic DNA content of brain was extracted, oxidative DNA damage (8-hydroxy-2'deoxyguanosine, pg/mL) and malondialdehyde (MDA, nmoL/g tissue) levels were determined. Our main finding was the increased oxidative DNA damage to brain after 10 days of exposure with the decreased oxidative DNA damage following 40 days of exposure compared to their control groups. Besides decreased lipid peroxidation end product, MDA, was observed after 40 days of exposure. The measured decreased quantities of damage during the 40 days of exposure could be the means of adapted and increased DNA repair mechanisms. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Debarati Chattopadhyay
2014-01-01
Full Text Available Nutraceutical compounds show antioxidant and prooxidant properties under stress conditions like cancer, diabetes, and other diseases. The objective of this study is to find the dichotomic behavior of caffeine, curcumin, and naringenin on DNA of diabetic and normal subjects in the presence and absence of copper, hydrogen peroxide, and complex of copper-hydrogen peroxide. Hydrogen peroxide releases hydroxyl free radicals (•OH on oxidation of Cu (I to Cu (II through Fenton-type reaction to cause DNA damage. In the results, agarose gel electrophoretic pattern speculates the prooxidant effect of caffeine and antioxidant effect of curcumin on DNA in the presence of copper and hydrogen peroxide. UV-Vis spectral analysis shows hyperchromism on addition of DNA to caffeine, hypochromism with curcumin, and subtle changes with naringenin. The chosen nutraceuticals act as inducers and quenchers of oxidative free radicals arising from diabetes.
Chromatographic and electrophoretic approaches in ink analysis.
Zlotnick, J A; Smith, F P
1999-10-15
Inks are manufactured from a wide variety of substances that exhibit very different chemical behaviors. Inks designed for use in different writing instruments or printing methods have quite dissimilar components. Since the 1950s chromatographic and electrophoretic methods have played important roles in the analysis of inks, where compositional information may have bearing on the investigation of counterfeiting, fraud, forgery, and other crimes. Techniques such as paper chromatography and electrophoresis, thin-layer chromatography, high-performance liquid chromatography, gas chromatography, gel electrophoresis, and the relatively new technique of capillary electrophoresis have all been explored as possible avenues for the separation of components of inks. This paper reviews the components of different types of inks and applications of the above separation methods are reviewed.
Fabrication of DNA nanotubes with an array of exterior magnetic nanoparticles.
Rafati, Adele; Zarrabi, Ali; Gill, Pooria
2017-10-01
Described here a methodology for arraying of magnetic nanoparticles (MNPs) on the surface of DNA nanotubes (DNTs). Positioning of magnetic nanoparticles at exterior surface of DNTs were shaped after self-assembling of oligonucleotide staples within an M13mp18 DNA scaffold via an origami process. The staples were partially labeled with biotin to be arrayed at the surface of DNTs. Gel retardation assay of the DNTs carrying magnetic nanoparticles indicated a reversely behavioral electrophoretic movement in comparison to the nanotubes have been demonstrated previously. Also, high resolution transmission electron microscopy confirmed positioning magnetic nanoparticles at the exterior surface of DNTs, correctly. Ultrastructural characteristics of these DNA nanotubes using atomic force microscopy demonstrated topographic heights on their surfaces formed through positioning of magnetic nanoparticles outside the tubules. This nanoarchitecture would be potential for multiple arraying of nanoparticles that those be useful as functionalized chimeric nanocarriers for developing novel nanodrugs and nanobiosensors. Copyright © 2017. Published by Elsevier B.V.
Fractionation of SWNT/nucleic acid complexes by agarose gel electrophoresis
International Nuclear Information System (INIS)
Vetcher, Alexandre A; Srinivasan, Srimeenakshi; Vetcher, Ivan A; Abramov, Semen M; Kozlov, Mikhail; Baughman, Ray H; Levene, Stephen D
2006-01-01
We show that aqueous dispersions of single-walled carbon nanotubes (SWNTs), prepared with the aid of nucleic acids (NAs) such as RNA or DNA, can be separated into fractions using agarose gel electrophoresis. In a DC electric field, SWNT/NA complexes migrate in the gel in the direction of positive potential to form well-defined bands. Raman spectroscopy as a function of band position shows that nanotubes having different spectroscopic properties possess different electrophoretic mobilities. The migration patterns for SWNT/RNA and SWNT/DNA complexes differ. Parallel elution of the SWNT/NA complexes from the gel during electrophoresis and subsequent characterization by AFM reveals differences in nanotube diameter, length and curvature. The results suggest that fractionation of nanotubes can be achieved by this procedure. We discuss factors affecting the mobility of the nanotube complexes and propose analytical applications of this technique
Fractionation of SWNT/nucleic acid complexes by agarose gel electrophoresis
Energy Technology Data Exchange (ETDEWEB)
Vetcher, Alexandre A [Institute of Biomedical Sciences and Technology and Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, TX 75083 (United States); Srinivasan, Srimeenakshi [Institute of Biomedical Sciences and Technology and Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, TX 75083 (United States); Vetcher, Ivan A [Institute of Biomedical Sciences and Technology and Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, TX 75083 (United States); Abramov, Semen M [NanoTech Institute, University of Texas at Dallas, Richardson, TX 75083 (United States); Kozlov, Mikhail [NanoTech Institute, University of Texas at Dallas, Richardson, TX 75083 (United States); Baughman, Ray H [NanoTech Institute, University of Texas at Dallas, Richardson, TX 75083 (United States); Levene, Stephen D [Institute of Biomedical Sciences and Technology and Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, TX 75083 (United States)
2006-08-28
We show that aqueous dispersions of single-walled carbon nanotubes (SWNTs), prepared with the aid of nucleic acids (NAs) such as RNA or DNA, can be separated into fractions using agarose gel electrophoresis. In a DC electric field, SWNT/NA complexes migrate in the gel in the direction of positive potential to form well-defined bands. Raman spectroscopy as a function of band position shows that nanotubes having different spectroscopic properties possess different electrophoretic mobilities. The migration patterns for SWNT/RNA and SWNT/DNA complexes differ. Parallel elution of the SWNT/NA complexes from the gel during electrophoresis and subsequent characterization by AFM reveals differences in nanotube diameter, length and curvature. The results suggest that fractionation of nanotubes can be achieved by this procedure. We discuss factors affecting the mobility of the nanotube complexes and propose analytical applications of this technique.
International Nuclear Information System (INIS)
Sharp, D.J.; Harjes, H.C.; Mann, G.A.
1989-01-01
Amorphous metal foil-wound inductors have been tested as ferromagnetic saturable inductive elements for pulsed-power (multi-terawatt) switching modules in the inertial confinement fusion program at Sandia National Laboratories. In simulated capacitor testing premature dielectric breakdown of thin polyethylene terephthalate film insulation in the inductor windings occurs at considerably below 2500 V. This appears to be due to inadvertant dielectric damage from micro-spikes on the amorphous foil surface. Electron micrographs and dielectric breakdown data illustrate that electrophoretically-applied dielectric coatings, deposited from organic aqueous colloid dispersions, can be used to provide insulating coatings on the foil which provide a 240% improvement (6000 V) in the breakdown strength of wound amorphous foil inductors. The theory and operation of a dedicated electrophoretic continuous coating system is described. The machine was constructed and successfully applied for dielectric coating of amorphous metal foil. Additional possible applications exist for practical dielectric coating of metallic films or foils used in various commercial wound-type capacitor structures. 7 refs., 9 figs
Energy Technology Data Exchange (ETDEWEB)
Garcia, P.; Hermoso, J.M.; Garcia, J.A.; Garcia, E.; Lopez, R.; Salas, M.
1986-04-01
Incubation of extracts of Cp-1-infected Streptococcus pneumoniae with (..cap alpha..-/sup 32/P)dATP produced a labeled protein with the electrophoretic mobility of the Cp-1 terminal protein. The reaction product was resistant to treatment with micrococcal nuclease and sensitive to treatment with proteinase K. Incubation of the /sup 32/P-labeled protein with 5 M piperidine for 4 h at 50/sup 0/C released 5'-dAMP, indicating that a covalent complex between the terminal protein and 5'-dAMP was formed in vitro. When the four deoxynucleoside triphosphates were included in the reaction mixture, a labeled complex of slower electrophoretic mobility in sodium dodecyl sulfate-polyacrylamide gels than the terminal protein-dAMP complex was also found, indicating that the Cp-1 terminal protein-dAMP complex can be elongated and, therefore, that it is an initiation complex. Treatment of the /sup 32/P-labeled terminal protein-dAMP complex with 5.8 M HCl at 110/sup 0/C for 2 h yielded phosphothreonine. These results, together with the resistance of the terminal protein-DNA linkage to hydroxylamine, suggest that the Cp-1 terminal protein is covalently linked to the DNA through a phosphoester bond between L-threonine and 5'-dAMP, namely, a O-5'-deoxyadenylyl-L-threonine bond.
International Nuclear Information System (INIS)
Hiscott, J.; Alper, D.; Cohen, L.; Leblanc, J.F.; Sportza, L.; Wong, A.; Xanthoudakis, S.
1989-01-01
The relationship between transcription of alpha and beta interferon (IFN-α and IFN-β) genes and the interaction of IFN promoter-binding transcription factors has been examined in monoblastoid U937 cells following priming with recombinant IFN-α2 (rIFN-α2) and Sendai virus induction. Pretreatment of U937 cells with rIFN-α2 prior to Sendai virus infection increased the mRNA levels of IFN-α1, IFN-α2, and IFN-β as well as the final yield of biologically active IFN. Analysis of nuclear protein-IFN promoter DNA interactions by electrophoretic mobility-shift assays demonstrated increased factor binding to IFN-α1 and IFN-β regulatory domains, although no new induction-specific complexes were identified. On the basis of competition electrophoretic mobility-shift assay results, factors interacting with the IFN-α1 and IFN-β promoters appear to be distinct DNA-binding proteins. Hybrid promoter-chloramphenicol acetyltransferase fusion plasmids, containing either the IFN-β regulatory element or the human immunodeficiency virus enhancer element linked to the simian virus 40 promoter, were analyzed for virus and phorbol ester inducibility in epithelial and lymphoid cells, respectively. These experiments suggest that induction of IFN gene expression may be controlled in part by transcription regulatory proteins binding to an NF-κB-like site within the IFN-β promoter
Particle separations by electrophoretic techniques
International Nuclear Information System (INIS)
Ballou, N.E.; Petersen, S.L.; Ducatte, G.R.; Remcho, V.T.
1996-03-01
A new method for particle separations based on capillary electrophoresis has been developed and characterized. It uniquely separates particles according to their chemical nature. Separations have been demonstrated with chemically modified latex particles and with inorganic oxide and silicate particles. Separations have been shown both experimentally and theoretically to be essentially independent of particle size in the range of about 0.2 μm to 10 μm. The method has been applied to separations of U0 2 particles from environmental particulate material. For this, an integrated method was developed for capillary electrophoretic separation, collection of separated fractions, and determinations of U0 2 and environmental particles in each fraction. Experimental runs with the integrated method on mixtures of UO 2 particles and environmental particulate material demonstrated enrichment factors of 20 for UO 2 particles in respect to environmental particles in the U0 2 containing fractions. This enrichment factor reduces the costs and time for processing particulate samples by the lexan process by a factor of about 20
Electrophoretic deposition of biomaterials
Boccaccini, A. R.; Keim, S.; Ma, R.; Li, Y.; Zhitomirsky, I.
2010-01-01
Electrophoretic deposition (EPD) is attracting increasing attention as an effective technique for the processing of biomaterials, specifically bioactive coatings and biomedical nanostructures. The well-known advantages of EPD for the production of a wide range of microstructures and nanostructures as well as unique and complex material combinations are being exploited, starting from well-dispersed suspensions of biomaterials in particulate form (microsized and nanoscale particles, nanotubes, nanoplatelets). EPD of biological entities such as enzymes, bacteria and cells is also being investigated. The review presents a comprehensive summary and discussion of relevant recent work on EPD describing the specific application of the technique in the processing of several biomaterials, focusing on (i) conventional bioactive (inorganic) coatings, e.g. hydroxyapatite or bioactive glass coatings on orthopaedic implants, and (ii) biomedical nanostructures, including biopolymer–ceramic nanocomposites, carbon nanotube coatings, tissue engineering scaffolds, deposition of proteins and other biological entities for sensors and advanced functional coatings. It is the intention to inform the reader on how EPD has become an important tool in advanced biomaterials processing, as a convenient alternative to conventional methods, and to present the potential of the technique to manipulate and control the deposition of a range of nanomaterials of interest in the biomedical and biotechnology fields. PMID:20504802
An AP endonuclease 1-DNA polymerase beta complex: theoretical prediction of interacting surfaces.
Directory of Open Access Journals (Sweden)
Alexej Abyzov
2008-04-01
Full Text Available Abasic (AP sites in DNA arise through both endogenous and exogenous mechanisms. Since AP sites can prevent replication and transcription, the cell contains systems for their identification and repair. AP endonuclease (APEX1 cleaves the phosphodiester backbone 5' to the AP site. The cleavage, a key step in the base excision repair pathway, is followed by nucleotide insertion and removal of the downstream deoxyribose moiety, performed most often by DNA polymerase beta (pol-beta. While yeast two-hybrid studies and electrophoretic mobility shift assays provide evidence for interaction of APEX1 and pol-beta, the specifics remain obscure. We describe a theoretical study designed to predict detailed interacting surfaces between APEX1 and pol-beta based on published co-crystal structures of each enzyme bound to DNA. Several potentially interacting complexes were identified by sliding the protein molecules along DNA: two with pol-beta located downstream of APEX1 (3' to the damaged site and three with pol-beta located upstream of APEX1 (5' to the damaged site. Molecular dynamics (MD simulations, ensuring geometrical complementarity of interfaces, enabled us to predict interacting residues and calculate binding energies, which in two cases were sufficient (approximately -10.0 kcal/mol to form a stable complex and in one case a weakly interacting complex. Analysis of interface behavior during MD simulation and visual inspection of interfaces allowed us to conclude that complexes with pol-beta at the 3'-side of APEX1 are those most likely to occur in vivo. Additional multiple sequence analyses of APEX1 and pol-beta in related organisms identified a set of correlated mutations of specific residues at the predicted interfaces. Based on these results, we propose that pol-beta in the open or closed conformation interacts and makes a stable interface with APEX1 bound to a cleaved abasic site on the 3' side. The method described here can be used for analysis in
Al-Serori, Halh; Ferk, Franziska; Kundi, Michael; Bileck, Andrea; Gerner, Christopher; Mišík, Miroslav; Nersesyan, Armen; Waldherr, Monika; Murbach, Manuel; Lah, Tamara T; Herold-Mende, Christel; Collins, Andrew R; Knasmüller, Siegfried
2018-01-01
Some epidemiological studies indicate that the use of mobile phones causes cancer in humans (in particular glioblastomas). It is known that DNA damage plays a key role in malignant transformation; therefore, we investigated the impact of the UMTS signal which is widely used in mobile telecommunications, on DNA stability in ten different human cell lines (six brain derived cell lines, lymphocytes, fibroblasts, liver and buccal tissue derived cells) under conditions relevant for users (SAR 0.25 to 1.00 W/kg). We found no evidence for induction of damage in single cell gel electrophoresis assays when the cells were cultivated with serum. However, clear positive effects were seen in a p53 proficient glioblastoma line (U87) when the cells were grown under serum free conditions, while no effects were found in p53 deficient glioblastoma cells (U251). Further experiments showed that the damage disappears rapidly in U87 and that exposure induced nucleotide excision repair (NER) and does not cause double strand breaks (DSBs). The observation of NER induction is supported by results of a proteome analysis indicating that several proteins involved in NER are up-regulated after exposure to UMTS; additionally, we found limited evidence for the activation of the γ-interferon pathway. The present findings show that the signal causes transient genetic instability in glioma derived cells and activates cellular defense systems.
Directory of Open Access Journals (Sweden)
М. I. Chopei
2014-08-01
Full Text Available The main mechanism of DNA track formation during comet assay of nucleoids, obtained after removal of cell membranes and most of proteins, is the extension to anode of negatively supercoiled DNA loops attached to proteins, remaining in nucleoid after lysis treatment. The composition of these residual protein structures and the nature of their strong interaction with the loop ends remain poorly studied. In this work we investigated the influence of chloroquine intercalation and denaturation of nucleoid proteins on the efficiency of electrophoretic track formation during comet assay. The results obtained suggest that even gentle protein denaturation is sufficient to reduce considerably the effectiveness of the DNA loop migration due to an increase in the loops size. The same effect was observed under local DNA unwinding upon chloroquine intercalation around the sites of the attachment of DNA to proteins. The topological interaction (protein intercalation into the double helix between DNA loop ends and nucleoid proteins is discussed.
Directory of Open Access Journals (Sweden)
Hussain Arif
2015-11-01
Full Text Available Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN, fisetin (FN, quercetin (QN, kaempferol (KL and galangin (GN. Using single cell alkaline gel electrophoresis (comet assay, we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.
Czech Academy of Sciences Publication Activity Database
Arnoštová, P.; Jedelsky, P. L.; Soukup, Tomáš; Žurmanová, J.
2011-01-01
Roč. 2011, - (2011), e634253 ISSN 1110-7243 R&D Projects: GA AV ČR IAAX01110901; GA ČR(CZ) GA304/08/0256 Institutional research plan: CEZ:AV0Z50110509 Keywords : cardiac MyHC isoforms * MyHC isoform mobility * effect of thyroid hormones * mass spectrometry * SDS-PAGE and western blot Subject RIV: ED - Physiology Impact factor: 2.436, year: 2011
International Nuclear Information System (INIS)
Putintseva, O.V.; Artykhov, V.G.; Kalaeva, E.A.
2000-01-01
The contribution of hem and globin components of electrophoretic fractions of UV-irradiated human carboxyhemoglobin to photo destruction of the protein was studied. The changes observed are the result of summation of some processes unequal in intensity and direction that take place in microgeterogenous media of photo modified protein. Photo sensitivity of hemoproteid in electrophoretic fraction depends on apoprotein condition, whereas the hem photo resistance cannot be the evidence of the photo stability of the whole molecule [ru
Energy Technology Data Exchange (ETDEWEB)
Velge,P.; Herler, M.; Johansson, J.; Roches, S.; Temoin, S.; Fedorov, A.; Gracieux, P.; Almo, S.; Goebel, W.; Cossart, P.
2007-01-01
The sequencing of prfA, encoding the transcriptional regulator of virulence genes, in 26 low-virulence field Listeria monocytogenes strains showed that eight strains exhibited the same single amino-acid substitution: PrfAK220T. These strains exhibited no expression of PrfA-regulated proteins and thus no virulence. This substitution inactivated PrfA, since expression of the PrfAK220T mutant gene in an EGD{Delta}prfA strain did not restore the haemolytic and phosphatidylcholine phospholipase C activities, in contrast to the wild-type prfA gene. The substitution of the lysine at position 220 occurred in the helix H. However, the data showed that the PrfAK220T protein is dimerized just as well as its wild-type counterpart, but does not bind to PrfA-boxes. PrfAK220T did not form a PrfA-DNA complex in electrophoretic mobility shift assays, but low concentrations of CI complexes (PrfAK220T-RNA polymerase-DNA complex) were formed by adding RNA polymerase, suggesting that PrfA interacted with RNA polymerase in solution in the absence of DNA. Formation of some transcriptionally active complexes was confirmed by in vitro runoff transcription assays and quantitative RT-PCR. Crystallographic analyses described the structure of native PrfA and highlighted the key role of allosteric changes in the activity of PrfA and especially the role of the Lys220 in the conformation of the helix-turn-helix (HTH) motif.
Development of two dimensional electrophoresis method using single chain DNA
International Nuclear Information System (INIS)
Ikeda, Junichi; Hidaka, So
1998-01-01
By combining a separation method due to molecular weight and a method to distinguish difference of mono-bases, it was aimed to develop a two dimensional single chain DNA labeled with Radioisotope (RI). From electrophoretic pattern difference of parent and variant strands, it was investigated to isolate the root module implantation control gene. At first, a Single Strand Conformation Polymorphism (SSCP) method using concentration gradient gel was investigated. As a result, it was formed that intervals between double chain and single chain DNAs expanded, but intervals of both single chain DNAs did not expand. On next, combination of non-modified acrylic amide electrophoresis method and Denaturing Gradient-Gel Electrophoresis (DGGE) method was examined. As a result, hybrid DNA developed by two dimensional electrophoresis arranged on two lines. But, among them a band of DNA modified by high concentration of urea could not be found. Therefore, in this fiscal year's experiments, no preferable result could be obtained. By the used method, it was thought to be impossible to detect the differences. (G.K.)
Length quantization of DNA partially expelled from heads of a bacteriophage T3 mutant
Energy Technology Data Exchange (ETDEWEB)
Serwer, Philip, E-mail: serwer@uthscsa.edu [Department of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900 (United States); Wright, Elena T. [Department of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900 (United States); Liu, Zheng; Jiang, Wen [Markey Center for Structural Biology, Department of Biological Sciences, Purdue University, West Lafayette, IN 47907 (United States)
2014-05-15
DNA packaging of phages phi29, T3 and T7 sometimes produces incompletely packaged DNA with quantized lengths, based on gel electrophoretic band formation. We discover here a packaging ATPase-free, in vitro model for packaged DNA length quantization. We use directed evolution to isolate a five-site T3 point mutant that hyper-produces tail-free capsids with mature DNA (heads). Three tail gene mutations, but no head gene mutations, are present. A variable-length DNA segment leaks from some mutant heads, based on DNase I-protection assay and electron microscopy. The protected DNA segment has quantized lengths, based on restriction endonuclease analysis: six sharp bands of DNA missing 3.7–12.3% of the last end packaged. Native gel electrophoresis confirms quantized DNA expulsion and, after removal of external DNA, provides evidence that capsid radius is the quantization-ruler. Capsid-based DNA length quantization possibly evolved via selection for stalling that provides time for feedback control during DNA packaging and injection. - Graphical abstract: Highlights: • We implement directed evolution- and DNA-sequencing-based phage assembly genetics. • We purify stable, mutant phage heads with a partially leaked mature DNA molecule. • Native gels and DNase-protection show leaked DNA segments to have quantized lengths. • Native gels after DNase I-removal of leaked DNA reveal the capsids to vary in radius. • Thus, we hypothesize leaked DNA quantization via variably quantized capsid radius.
Micrometer-sized TPM emulsion droplets with surface-mobile binding groups
van der Wel, Casper; van de Stolpe, Guido L.; Verweij, Ruben W.; Kraft, Daniela J.
2018-03-01
Colloids coated with lipid membranes have been widely employed for fundamental studies of lipid membrane processes, biotechnological applications such as drug delivery and biosensing, and more recently, for self-assembly. The latter has been made possible by inserting DNA oligomers with covalently linked hydrophobic anchors into the membrane. The lateral mobility of the DNA linkers on micrometer-sized droplets and solid particles has opened the door to creating structures with unprecedented structural flexibility. Here, we investigate micro-emulsions of TPM (3-(trimethoxysilyl)propyl methacrylate) as a platform for lipid monolayers and further functionalization with proteins and DNA oligonucleotides. TPM droplets can be produced with a narrow size distribution and are polymerizable, thus providing supports for model lipid membranes with controlled size and curvature. With fluorescence recovery after photobleaching, we observed that droplet-attached lipids, NeutrAvidin proteins, as well as DNA oligonucleotides all show mobility on the surface. We explored the assembly of micron-sized particles on TPM-droplets by exploiting either avidin-biotin interactions or double-stranded DNA with complementary single-stranded end groups. While the single molecules are mobile, the particles that are attached to them are not. We propose that this is caused by the heterogeneous nature of emulsified TPM, which forms an oligomer network that limits the collective motion of linkers, but allows the surface mobility of individual molecules.
Czech Academy of Sciences Publication Activity Database
Šalplachta, Jiří; Kubesová, Anna; Horký, J.; Matoušková, H.; Tesařová, Marie; Horká, Marie
2015-01-01
Roč. 407, č. 25 (2015), s. 7625-7635 ISSN 1618-2642 R&D Projects: GA MV VG20112015021 Institutional support: RVO:68081715 Keywords : bacteria * electrophoretic techniques * MALDI Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.125, year: 2015 http://hdl.handle.net/11104/0250090
Directory of Open Access Journals (Sweden)
ErsenAydın Yağmur
2015-10-01
Full Text Available Background: In this study, we investigated the lethal potency, electrophoretic protein pattern and in vivo effects of Hottentotta saulcyi scorpion venom in mice.Methods: Scorpions were collected at night, by using a UV lamp from Mardin Province, Turkey. Venom was obtained from mature H. saulcyi scorpions by electrical stimulation of the telson. The lethality of the venom was determined by i.v. injections using Swiss mice. In vivo effects of the venom were assessed by using the intraperitoneal route (ip injections into mice (20±1g and monitored for 24 h. The protein profiles of the scorpion venom were analyzed by NuPAGE® Novex® 4–12 % gradient Bis-Tris gel followed by Coomassie blue staining.Results: The lethal assay of the venom was 0.73 mg/kg in mice. We determined the electrophoretic protein pattern of this scorpion venom to be 4, 6, 9, 31, 35, 40, 46 and 69 kDa by SDS-PAGE. Analysis of electrophoresis indicated that H. saulcyi scorpion intoxicated mice exhibited autonomic nervous system symptoms (tachypnea, restlessness, hyperexcitability, convulsions, salivation, lacrimation, weakness.Conclusions: Hottentotta saulcyi scorpion venom includes short-chain neurotoxins and long-chain neurotoxins according to the electrophoretic protein patterns. The stings of H. saulcyi scorpion must be considered of risk for humans in the southeastern region, Turkey.
International Nuclear Information System (INIS)
Almeida, E.C.; Baldan, M.R.; Ferreira, N.G.; Edwards, E.R.
2009-01-01
Full text: The purpose of this work is to examine the electrophoretic deposition of carbon nanotubes powder on carbon fibers, produced at different heat treatments temperatures. Besides, a systematic study of the effects of graphitization index from substrate on the structure and morphology of CNTs has been available. Carbon fibers were produced from polyacrylonitrile at three different heat treatments temperatures, 1000, 1500 and 2000 deg C. The carbon fibers microstructure or its graphitization index may be controlled by the heat treatments temperatures. The electrophoretic deposition of carbon nanotubes was obtained with the powder of carbon nanotubes dispersed in water by ultrasonication to obtain dispersions of 0.05 mg/mL. The carbon fibers were immersed in the nanotube dispersion, and a positive potential of 10 V/cm was applied. Morphology and microstructure of carbon nanotubes on carbon fibers were obtained by scanning electron microscopy, Raman spectroscopy and X-ray photoelectron spectroscopy. (author)
Hasan, Md Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan
2016-01-05
Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2=3-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2=4-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy=2,2'-bipyridine, Phen=1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, (1)H NMR, (13)C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH∼7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4>3>1>2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4',6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87μM respectively. Copyright © 2015 Elsevier B.V. All rights reserved.
Grunden, A M; Self, W T; Villain, M; Blalock, J E; Shanmugam, K T
1999-08-20
Expression of the modABCD operon in Escherichia coli, which codes for a molybdate-specific transporter, is repressed by ModE in vivo in a molybdate-dependent fashion. In vitro DNase I-footprinting experiments identified three distinct regions of protection by ModE-molybdate on the modA operator/promoter DNA, GTTATATT (-15 to -8; region 1), GCCTACAT (-4 to +4; region 2), and GTTACAT (+8 to +14; region 3). Within the three regions of the protected DNA, a pentamer sequence, TAYAT (Y = C or T), can be identified. DNA-electrophoretic mobility experiments showed that the protected regions 1 and 2 are essential for binding of ModE-molybdate to DNA, whereas the protected region 3 increases the affinity of the DNA to the repressor. The stoichiometry of this interaction was found to be two ModE-molybdate per modA operator DNA. ModE-molybdate at 5 nM completely protected the modABCD operator/promoter DNA from DNase I-catalyzed hydrolysis, whereas ModE alone failed to protect the DNA even at 100 nM. The apparent K(d) for the interaction between the modA operator DNA and ModE-molybdate was 0.3 nM, and the K(d) increased to 8 nM in the absence of molybdate. Among the various oxyanions tested, only tungstate replaced molybdate in the repression of modA by ModE, but the affinity of ModE-tungstate for modABCD operator DNA was 6 times lower than with ModE-molybdate. A mutant ModE(T125I) protein, which repressed modA-lac even in the absence of molybdate, protected the same region of modA operator DNA in the absence of molybdate. The apparent K(d) for the interaction between modA operator DNA and ModE(T125I) was 3 nM in the presence of molybdate and 4 nM without molybdate. The binding of molybdate to ModE resulted in a decrease in fluorescence emission, indicating a conformational change of the protein upon molybdate binding. The fluorescence emission spectra of mutant ModE proteins, ModE(T125I) and ModE(Q216*), were unaffected by molybdate. The molybdate-independent mutant Mod
Qian, Cheng; Kovalchik, Kevin A; MacLennan, Matthew S; Huang, Xiaohua; Chen, David D Y
2017-06-01
Capillary electrophoresis frontal analysis (CE-FA) can be used to determine binding affinity of molecular interactions. However, its current data processing method mandate specific requirement on the mobilities of the binding pair in order to obtain accurate binding constants. This work shows that significant errors are resulted when the mobilities of the interacting species do not meet these requirements. Therefore, the applicability of CE-FA in many real word applications becomes questionable. An electrophoretic mobility-based correction method is developed in this work based on the flux of each species. A simulation program and a pair of model compounds are used to verify the new equations and evaluate the effectiveness of this method. Ibuprofen and hydroxypropyl-β-cyclodextrinare used to demonstrate the differences in the obtained binding constant by CE-FA when different calculation methods are used, and the results are compared with those obtained by affinity capillary electrophoresis (ACE). The results suggest that CE-FA, with the mobility-based correction method, can be a generally applicable method for a much wider range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yoshii, Katsuhiro; Tajima, Fumihisa; Ishijima, Sumio; Sagami, Ikuko
2015-01-20
Neuronal PAS domain protein 2 (NPAS2) is a core clock transcription factor that forms a heterodimer with BMAL1 to bind the E-box in the promoter of clock genes and is regulated by various environmental stimuli such as heme, carbon monoxide, and NAD(P)H. In this study, we investigated the effects of pH and NADPH on the DNA binding activity of NPAS2. In an electrophoretic mobility shift (EMS) assay, the pH of the reaction mixture affected the DNA binding activity of the NPAS2/BMAL1 heterodimer but not that of the BMAL1/BMAL1 homodimer. A change in pH from 7.0 to 7.5 resulted in a 1.7-fold increase in activity in the absence of NADPH, and NADPH additively enhanced the activity up to 2.7-fold at pH 7.5. The experiments using truncated mutants revealed that N-terminal amino acids 1-61 of NPAS2 were sufficient to sense the change in both pH and NADPH. We further analyzed the kinetics of formation and DNA binding of the NPAS2/BMAL1 heterodimer at various pH values. In the absence of NADPH, a change in pH from 6.5 to 8.0 decreased the KD(app) value of the E-box from 125 to 22 nM, with an 8-fold increase in the maximal level of DNA binding for the NPAS2/BMAL1 heterodimer. The addition of NADPH resulted in a further decrease in KD(app) to 9 nM at pH 8.0. Furthermore, NPAS2-dependent transcriptional activity in a luciferase assay using NIH3T3 cells also increased with the pH of the culture medium. These results suggest that NPAS2 has a role as a pH and metabolite sensor in regulating circadian rhythms.
Protein electrophoretic migration data from custom and commercial gradient gels
Directory of Open Access Journals (Sweden)
Andrew J. Miller
2016-12-01
Full Text Available This paper presents data related to the article “A method for easily customizable gradient gel electrophoresis” (A.J. Miller, B. Roman, E.M. Norstrom, 2016 [1]. Data is presented on the rate of electrophoretic migration of proteins in both hand-poured and commercially acquired acrylamide gradient gels. For each gel, migration of 9 polypeptides of various masses was measured upon completion of gel electrophoresis. Data are presented on the migration of proteins within separate lanes of the same gel as well as migration rates from multiple gels.
Variations in virulence between different electrophoretic types of Listeria monocytogenes
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk
2000-01-01
A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Hasan, Md. Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan
2016-01-01
Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2 = 3-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2 = 4-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy = 2,2‧-bipyridine, Phen = 1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, 1H NMR, 13C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH ∼ 7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4 > 3 > 1 > 2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4‧,6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87 μM respectively.
International Nuclear Information System (INIS)
Kurokawa, S.; Kikuchi, T.; Sakairi, M.; Takahashi, H.
2008-01-01
Micro-dot arrays and micro-walls of acrylic acid/melamine resin were fabricated on aluminum by anodizing, atomic force microscope (AFM) probe processing, and electrophoretic deposition. Barrier type anodic oxide films of 15 nm thickness were formed on aluminum and then the specimen was scratched with an AFM probe in a solution containing acrylic acid/melamine resin nano-particles to remove the anodic oxide film locally. After scratching, the specimen was anodically polarized to deposit acrylic acid/melamine resin electrophoretically at the film-removed area. The resin deposited on the specimen was finally cured by heating. It was found that scratching with the AFM probe on open circuit leads to the contamination of the probe with resin, due to positive shifts in the potential during scratching. Scratching of the specimen under potentiostatic conditions at -1.0 V, however, resulted in successful resin deposition at the film-removed area without probe contamination. The rate of resin deposition increased as the specimen potential becomes more positive during electrophoretic deposition. Arrays of resin dots with a few to several tens μm diameter and 100-1000 nm height, and resin walls with 100-1000 nm height and 1 μm width were obtained on specimens by successive anodizing, probe processing, and electrophoretic deposition
Energy Technology Data Exchange (ETDEWEB)
Kurokawa, S.; Kikuchi, T.; Sakairi, M. [Graduate School of Engineering, Hokkaido University, N-13, W-8, Kita-Ku, Sapporo 060-8628 (Japan); Takahashi, H. [Graduate School of Engineering, Hokkaido University, N-13, W-8, Kita-Ku, Sapporo 060-8628 (Japan)], E-mail: takahasi@elechem1-mc.eng.hokudai.ac.jp
2008-11-30
Micro-dot arrays and micro-walls of acrylic acid/melamine resin were fabricated on aluminum by anodizing, atomic force microscope (AFM) probe processing, and electrophoretic deposition. Barrier type anodic oxide films of 15 nm thickness were formed on aluminum and then the specimen was scratched with an AFM probe in a solution containing acrylic acid/melamine resin nano-particles to remove the anodic oxide film locally. After scratching, the specimen was anodically polarized to deposit acrylic acid/melamine resin electrophoretically at the film-removed area. The resin deposited on the specimen was finally cured by heating. It was found that scratching with the AFM probe on open circuit leads to the contamination of the probe with resin, due to positive shifts in the potential during scratching. Scratching of the specimen under potentiostatic conditions at -1.0 V, however, resulted in successful resin deposition at the film-removed area without probe contamination. The rate of resin deposition increased as the specimen potential becomes more positive during electrophoretic deposition. Arrays of resin dots with a few to several tens {mu}m diameter and 100-1000 nm height, and resin walls with 100-1000 nm height and 1 {mu}m width were obtained on specimens by successive anodizing, probe processing, and electrophoretic deposition.
Sevcik, J.; Stransky, Z.; Ingelse, B.A.; Lemr, K.
1996-01-01
This paper describes the development of a capillary zone electrophoretic method for chiral separation of three basic compounds of the selegiline synthetic pathway: ephedrine, methamphetamine and selegiline. The method developed allows one to separate the studied compounds in one run using a neutral
Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution
Stellwagen, Nancy C.
2009-01-01
This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510
Rollo, F; La Marca, A; Amici, A
1987-02-01
Twelve seed specimens of varying ages and from different archaeological sites were analyzed for the presence of polymerized DNA and RNA. Amongst the samples tested, one of Vitis vinifera from an archaeological site in Iran (2,000-3,000 B.C.) was found to be completely devoid of nucleic acids. Zea mais seeds of Precolumbial age from Peru (about 800 A.D.) contained depolymerized DNA and RNA. Samples of Vitis vinifera and Rubus sp. from a Lombard archaeological site (800 A.D.) as well as radiocarbon dated seeds from the site of the "Spring Sanctuary" near Metaponto (I-IV century B.C.) were found to contain polymerized DNA and rRNA bands. However the electrophoretic properties of the rRNAs in one case and hybridization experiments performed with cloned seed DNA in the other, clearly demonstrated that the polymerized nucleic acids were not of plant origin.
The Ins and Outs of DNA Fingerprinting the Infectious Fungi
Soll, David R.
2000-01-01
DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003
Regulation of Xenopus laevis DNA topoisomerase I activity by phosphorylation in vitro
International Nuclear Information System (INIS)
Kaiserman, H.B.; Ingebritsen, T.S.; Benbow, R.M.
1988-01-01
DNA topoisomerase I has been purified to electrophoretic homogeneity from ovaries of the frog Xenopus laevis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the most purified fraction revealed a single major band at 110 kDa and less abundant minor bands centered at 62 kDa. Incubation of the most purified fraction with immobilized calf intestinal alkaline phosphatase abolished all DNA topoisomerase enzymatic activity in a time-dependent reaction. Treatment of the dephosphorylated X. laevis DNA topoisomerase I with a X. laevis casein kinase type II activity and ATP restored DNA topoisomerase activity to a level higher than that observed in the most purified fraction. In vitro labeling experiments which employed the most purified DNA topoisomerase I fraction, [γ- 32 P]ATP, and the casein kinase type II enzyme showed that both the 110- and 62-kDa bands became phosphorylated in approximately molar proportions. Phosphoamino acid analysis showed that only serine residues became phosphorylated. Phosphorylation was accompanied by an increase in DNA topoisomerase activity in vitro. Dephosphorylation of DNA topoisomerase I appears to block formation of the initial enzyme-substrate complex on the basis of the failure of the dephosphorylated enzyme to nick DNA in the presence of camptothecin. The authors conclude that X. laevis DNA topoisomerase I is partially phosphorylated as isolated and that this phosphorylation is essential for expression of enzymatic activity in vitro. On the basis of the ability of the casein kinase type II activity to reactivate dephosphorylated DNA topoisomerase I, they speculate that this kinase may contribute to the physiological regulation of DNA topoisomerase I activity
Enzyme-linked immunosorbent assays for Z-DNA.
Thomas, M J; Strobl, J S
1988-10-01
Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e.l.i.s.a. was conducted in 48-well culture dishes at 37 degrees C using a rabbit polyclonal antiserum developed against Br-poly(dG-dC).poly(dG-dC), an alkaline phosphatase-conjugated second antibody, and p-nitrophenol as the substrate. Under conditions where antibody concentrations were not limiting, alkaline phosphatase activity was linear for 2 h. Dot blot e.l.i.s.a. conditions are described which allow quantification of Z-DNA [Br-poly(dG-dC).poly(dG-dC)] within the range 5-250 ng. Dot blot and transblot horseradish peroxidase e.l.i.s.a. are described that detect Z-DNA within supercoiled plasmid DNAs immobilized on diazophenylthioether (DPT) paper. In the transblot e.l.i.s.a., plasmid pUC8 derivatives containing 16, 24, or 32 residues of Z-DNA were electrophoresed in agarose gels and electrophoretically transferred to DPT paper. Z-DNA-antibody complexes were detected by the horseradish peroxidase-catalysed conversion of 4-chloro-1-naphthol to a coloured product that was covalently bound to the DPT paper. Z-DNA antibody reactivity was specific for supercoiled Z-DNA containing plasmids after removal of the antibodies cross-reactive with B-DNA by absorption onto native DNA-cellulose. The transblot e.l.i.s.a. was sensitive enough to detect 16 base pairs of alternating G-C residues in 100 ng of pUC8 DNA.
Energy Technology Data Exchange (ETDEWEB)
Vázquez, A., E-mail: alejandro.lqi@gmail.com [Universidad Autónoma de Nuevo León, Facultad de Ciencias Químicas, Av. Universidad S/N, San Nicolás de los Garza, 66455 Nuevo León (Mexico); Hernández-Uresti, D.B., E-mail: ing.dianahdz@gmail.com [Universidad Autónoma de Nuevo León, CICFIM–Facultad de Ciencias Físico Matemáticas, Av. Universidad S/N, San Nicolás de los Garza, 66455 Nuevo León (Mexico); Obregón, S. [Universidad Autónoma de Nuevo León, CICFIM–Facultad de Ciencias Físico Matemáticas, Av. Universidad S/N, San Nicolás de los Garza, 66455 Nuevo León (Mexico)
2016-11-15
Highlights: • CdS photocatalyst was prepared by electrophoretic deposition. • The CdS coating was used in the photodegradation of antibiotics. • O{sub 2}{sup −} and ·OH radicals were responsible for the degradation of tetracycline. - Abstract: The photocatalytic activities of CdS coatings formed by electrophoretic deposition (EPD) were evaluated through the photodegradation of an antibiotic, tetracycline. First, CdS nanoparticles were synthesized under microwave irradiation of aqueous solutions containing the cadmium and sulfur precursors at stoichiometric amounts and by using trisodium citrate as stabilizer. Microwave irradiation was carried out in a conventional microwave oven at 2.45 GHz and 1650 W of nominal power, for 60 s. The CdS nanoparticles were characterized by UV–vis spectrophotometry, photoluminescence and X-ray diffraction. Electrophoretic deposition parameters were 300 mV, 600 mV and 900 mV of applied voltage between aluminum plates separated by 1 cm. The fractal dimensions of the surfaces were evaluated by atomic force microscopy and correlated to the morphological and topographic characteristics of the coatings. The photocatalytic activity of the CdS coatings was investigated by means the photodegradation of the tetracycline antibiotic under simulated sunlight irradiation. According to the results, the photoactivity of the coatings directly depends on the concentration of the precursors and the applied voltage during the deposition. The material obtained at 600 mV showed the best photocatalytic behavior, probably due to its physical properties, such as optimum load and suitable aggregate size.
Reddy, S G; Cochran, B J; Worth, L L; Knutson, V P; Haddox, M K
1994-04-01
A high-resolution isoelectric focusing vertical slab gel method which can resolve proteins which differ by a single charge was developed and this method was applied to the study of the multiple isoelectric forms of ornithine decarboxylase. Separation of proteins at this high level of resolution was achieved by increasing the ampholyte concentration in the gels to 6%. Various lots of ampholytes, from the same or different commercial sources, differed significantly in their protein binding capacity. Ampholytes bound to proteins interfered both with the electrophoretic transfer of proteins from the gel to immunoblotting membranes and with the ability of antibodies to interact with proteins on the immunoblotting membranes. Increasing the amount of protein loaded into a gel lane also decreased the efficiency of the electrophoretic transfer and immunodetection. To overcome these problems, both gel washing and gel electrophoretic transfer protocols for disrupting the ampholyte-protein binding and enabling a quantitative electrophoretic transfer of proteins were developed. Two gel washing procedures, with either thiocyanate or borate buffers, and a two-step electrophoretic transfer method are described. The choice of which method to use to optimally disrupt the ampholyte-protein binding was found to vary with each lot of ampholytes employed.
Directory of Open Access Journals (Sweden)
Roberta Troia
2018-04-01
Full Text Available Canine gastric dilatation–volvulus (GDV is a life-threatening disease characterized by extensive tissue ischemia, tissue hypoperfusion, and systemic inflammation. Biomarkers that better reflect the severity of gastric necrosis and systemic inflammation would aid clinicians in the management of these patients. This study aimed to investigate the prognostic significance of cell-free DNA (cfDNA, high-mobility group box-1 (HMGB1, and procalcitonin (PCT in dogs with GDV. Concentrations of cfDNA, HMGB1, and PCT were measured in citrated plasma samples collected from 29 dogs with GDV at hospital admission. Additional data collected included baseline lactate concentrations, APPLEfast score, evidence of gastric necrosis, occurrence of postoperative complications, and outcome. Twenty-four healthy dogs were sampled as controls. Continuous variables between groups were compared with the Mann–Whitney U and correlations between continuous variables were assessed by calculation of Spearman’s correlation coefficient. Alpha was set at 0.05. Dogs with GDV had significantly greater concentrations of cfDNA, HMGB1, and PCT compared to controls (P = 0.0009, P = 0.004, and P = 0.009, respectively. PCT concentrations were significantly higher in non-survivors compared to survivors (P = 0.008. Dogs with gastric necrosis had significantly greater lactate concentrations compared to dogs without gastric necrosis (P = 0.0005. The APPLEfast score was not prognostic. Lactate and PCT concentrations were moderately, positively correlated (rs 0.51, P = 0.0005. Concentrations of the inflammatory biomarkers cfDNA, HMGB1, and PCT are increased in canine GDV. Only lactate and PCT concentrations were prognostic in this population of GDV dogs and were predictive of the presence of gastric necrosis and of non-survival to hospital discharge, respectively.
Troia, Roberta; Giunti, Massimo; Calipa, Stefano; Goggs, Robert
2018-01-01
Canine gastric dilatation-volvulus (GDV) is a life-threatening disease characterized by extensive tissue ischemia, tissue hypoperfusion, and systemic inflammation. Biomarkers that better reflect the severity of gastric necrosis and systemic inflammation would aid clinicians in the management of these patients. This study aimed to investigate the prognostic significance of cell-free DNA (cfDNA), high-mobility group box-1 (HMGB1), and procalcitonin (PCT) in dogs with GDV. Concentrations of cfDNA, HMGB1, and PCT were measured in citrated plasma samples collected from 29 dogs with GDV at hospital admission. Additional data collected included baseline lactate concentrations, APPLE fast score, evidence of gastric necrosis, occurrence of postoperative complications, and outcome. Twenty-four healthy dogs were sampled as controls. Continuous variables between groups were compared with the Mann-Whitney U and correlations between continuous variables were assessed by calculation of Spearman's correlation coefficient. Alpha was set at 0.05. Dogs with GDV had significantly greater concentrations of cfDNA, HMGB1, and PCT compared to controls ( P = 0.0009, P = 0.004, and P = 0.009, respectively). PCT concentrations were significantly higher in non-survivors compared to survivors ( P = 0.008). Dogs with gastric necrosis had significantly greater lactate concentrations compared to dogs without gastric necrosis ( P = 0.0005). The APPLE fast score was not prognostic. Lactate and PCT concentrations were moderately, positively correlated ( r s 0.51, P = 0.0005). Concentrations of the inflammatory biomarkers cfDNA, HMGB1, and PCT are increased in canine GDV. Only lactate and PCT concentrations were prognostic in this population of GDV dogs and were predictive of the presence of gastric necrosis and of non-survival to hospital discharge, respectively.
Troia, Roberta; Giunti, Massimo; Calipa, Stefano; Goggs, Robert
2018-01-01
Canine gastric dilatation–volvulus (GDV) is a life-threatening disease characterized by extensive tissue ischemia, tissue hypoperfusion, and systemic inflammation. Biomarkers that better reflect the severity of gastric necrosis and systemic inflammation would aid clinicians in the management of these patients. This study aimed to investigate the prognostic significance of cell-free DNA (cfDNA), high-mobility group box-1 (HMGB1), and procalcitonin (PCT) in dogs with GDV. Concentrations of cfDNA, HMGB1, and PCT were measured in citrated plasma samples collected from 29 dogs with GDV at hospital admission. Additional data collected included baseline lactate concentrations, APPLEfast score, evidence of gastric necrosis, occurrence of postoperative complications, and outcome. Twenty-four healthy dogs were sampled as controls. Continuous variables between groups were compared with the Mann–Whitney U and correlations between continuous variables were assessed by calculation of Spearman’s correlation coefficient. Alpha was set at 0.05. Dogs with GDV had significantly greater concentrations of cfDNA, HMGB1, and PCT compared to controls (P = 0.0009, P = 0.004, and P = 0.009, respectively). PCT concentrations were significantly higher in non-survivors compared to survivors (P = 0.008). Dogs with gastric necrosis had significantly greater lactate concentrations compared to dogs without gastric necrosis (P = 0.0005). The APPLEfast score was not prognostic. Lactate and PCT concentrations were moderately, positively correlated (rs 0.51, P = 0.0005). Concentrations of the inflammatory biomarkers cfDNA, HMGB1, and PCT are increased in canine GDV. Only lactate and PCT concentrations were prognostic in this population of GDV dogs and were predictive of the presence of gastric necrosis and of non-survival to hospital discharge, respectively. PMID:29686994
SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair
DEFF Research Database (Denmark)
McCord, Ronald A; Michishita, Eriko; Hong, Tao
2009-01-01
-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor......-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA...
Arora, Dhara; Singh, Neha; Bhatla, Satish C
2018-01-01
Tyrosine nitrated proteins can be detected in plant cells electrophoretically and their distribution can be monitored by confocal laser scanning microscopy (CLSM) imaging. One-dimensional polyacrylamide gel electrophoresis (1D PAGE) followed by Western blotting using polyclonal antibody against 3-nitrotyrosine residues enables detection of tyrosine nitrated proteins in plant cells. Here we describe detection of tyrosine nitrated proteins in the homogenates derived from sunflower (Helianthus annuus L.) seedling cotyledons. Total soluble proteins obtained from tissue homogenates are resolved using vertical gel electrophoresis followed by their electrophoretic transfer on to a microporous membrane support for immunodetection. Spatial distribution of tyrosine nitrated proteins can be visualized using an antibody against 3-nitrotyrosine residues. Immunofluorescent localization is performed by cutting 7 μm thick wax sections of tissue followed by incubation in primary anti-nitrotyrosine antibody (dilution 1:200) and secondary Cy-3 labeled anti-rabbit IgG antibody (dilution 1:1500). Confocal laser scanning microscopy analysis is undertaken using argon lasers (ex: 530-550 nm and em: 570 nm) at pinhole 1. Modulation in the abundance and spatial localization of tyrosine nitrated proteins in plant tissues can be monitored using these techniques.
Energy Technology Data Exchange (ETDEWEB)
Lee, Y.-H. [Department of Materials Science and Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan 70101, Taiwan (China); Kuo, C.-W. [Department of Resources Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan 70101, Taiwan (China); Shih, C.-J. [Faculty of Fragrance and Cosmetics, Kaohsiung Medical University, 100 Shi-Chuan 1st Road, Kaohsiung 807, Taiwan (China); Hung, I-M. [Department of Materials Science and Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan 70101, Taiwan (China); Fung, K.-Z. [Department of Materials Science and Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan 70101, Taiwan (China); Wen, S.-B. [Department of Resources Engineering, National Cheng Kung University, 1 Ta-Hsueh Road, Tainan 70101, Taiwan (China); Wang, M.-C. [Faculty of Fragrance and Cosmetics, Kaohsiung Medical University, 100 Shi-Chuan 1st Road, Kaohsiung 807, Taiwan (China)]. E-mail: cjshih@kmu.edu.tw
2007-02-15
An 8 mol% yttria-stabilized zirconia (8YSZ) films are electrophoretically deposited on the La{sub 0.8}Sr{sub 0.2}MnO{sub 3} substrate using 8YSZ nanocrystallites prepared by a sol-gel process. Effects of liquid suspension on the particle zeta potential and degree of agglomeration at different pH values are investigated. When the pH value deviates from the point of zero charge (PZC), the adsorption of protons on particle surfaces cause higher zeta potential and well-dispersed suspension. The optimal values of the iodine concentration, applied voltage and deposition time for the electrophoretic deposition of 8YSZ films are also found.
Sanchez-Moreno, M; Ortega, J E; Valero, A
1989-12-01
High levels of malate dehydrogenase were found in Trichuris ovis. Two molecular forms of the enzyme, of different cellular location and electrophoretic pattern, were isolated and purified. The activity of soluble malate dehydrogenase was greater than that of mitochondrial malate dehydrogenase. Both forms also displayed different electrophoretic profiles in comparison with purified extracts from goat (Capra hircus) liver. Substrate concentration directly affected enzyme activity. Host and parasite malate dehydrogenase activity were both inhibited by a series of benzimidazoles and pyrimidine-derived compounds, some of which markedly reduced parasite enzyme activity, but not host enzyme activity. Percentage inhibition by some pyrimidine derivatives was greater than that produced by benzimidazoles.
International Nuclear Information System (INIS)
Fang, Yuanxing; Lee, Wei Cheat; Canciani, Giacomo E.; Draper, Thomas C.; Al-Bawi, Zainab F.; Bedi, Jasbir S.; Perry, Christopher C.; Chen, Qiao
2015-01-01
Graphical abstract: - Highlights: • A novel method combining electrospinning and electrophoretic deposition was established for the creation of nanostructured semiconductor thin films. • The created thin films displayed a high chemical stability with a controllable thickness. • The PEC water splitting performance of the thin films was optimized by fine-tuning the thickness of the films. • A maximum photoconversion efficiency was achieved by 18 μm nanofibrous thin films. - Abstract: Electrophoretic deposition (EPD) of ground electrospun WO 3 nanofibers was applied to create photoanodes with controlled morphology for the application of photoelectrochemical (PEC) water splitting. The correlations between deposition parameters and film thicknesses were investigated with theoretical models to precisely control the morphology of the nanostructured porous thin film. The photoconversion efficiency was further optimized as a function of film thickness. A maximum photoconversion efficiency of 0.924% from electrospun WO 3 nanofibers that EPD deposited on a substrate was achieved at a film thickness of 18 μm.
Directory of Open Access Journals (Sweden)
Hacali Necefoglu
2007-06-01
Full Text Available The interaction of [Co(H2O4(p-NO2C6H4COO2]. 2H2O with sheep genomicDNA has been investigated by spectroscopic studies and electrophoresis measurements.The interaction between cobalt(II p-nitrobenzoate and DNA has been followed by gelelectrophoresis while the concentration of the complex was increased from 0 to 14 mM.The spectroscopic study and electrophoretic experiments support the fact that the complexbinds to DNA by intercalation via p-nitrobenzoate into the base pairs of DNA. Themobility of the bands decreased as the concentration of complex was increased, indicatingthat there was increase in interaction between the metal ion and DNA.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E
1999-07-15
RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.
Gill, Pooria; Ranjbar, Bijan; Saber, Reza; Khajeh, Khosro; Mohammadian, Mehdi
2011-01-01
Cauliflower-like DNAs are stem-loop DNAs that are fabricated periodically in inverted repetitions from deoxyribonucleic acid phosphates (dNTPs) by loop-mediated isothermal amplification (LAMP). Cauliflower-like DNAs have ladder-shape behaviors on gel electrophoresis, and increasing the time of LAMP leads to multiplying the repetitions, stem-loops, and electrophoretic bands. Cauliflower-like DNAs were fabricated via LAMP using two loop primers, two bumper primers, dNTPs, a λ-phage DNA template...
Automated Parallel Capillary Electrophoretic System
Li, Qingbo; Kane, Thomas E.; Liu, Changsheng; Sonnenschein, Bernard; Sharer, Michael V.; Kernan, John R.
2000-02-22
An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.
Loxdale, H D; Rhodes, J A; Fox, J S
1985-07-01
A study of variation in three peptidases (PEP-3 to -5) in a parthenogenetic S. avenae field population at Rothamsted using serial one-dimensional polyacrylamide gel electrophoresis (involving changes of gel concentration and electrophoretic run-time) increased the overall number of "allozymes" (mobility variants) detected from 10 under standard conditions (6% gels, 2 h run-time) to 22, as well as revealing putative heterozygous banding patterns under some test conditions. However, an examination of another enzyme, 6-phosphogluconate dehydrogenase (6-PGD) in a sample collected at Rothamsted the following year failed, using a combination of serial methods (changes of gel concentration) and isoelectric focusing, to increase the total number of 6-PGD bands separated (seven, none of which appeared to be allelic in origin). Nevertheless, some major bands were split into several bands, whilst other infrequent bands were either gained or lost. The findings are briefly discussed.
Directory of Open Access Journals (Sweden)
Meng Xianwei
2010-01-01
Full Text Available Abstract Carbon–iron oxide microspheres’ black pigments (CIOMBs had been prepared via ultrasonic spray pyrolysis of aqueous solutions containing ferrous chloride and glucose. Due to the presence of carbon, CIOMBs not only exhibited remarkably acid resistance, but also could be well dispersed in both polar solvents and nonpolar solvent. Finally, dispersions of hollow CIOMBs in tetrachloroethylene had successfully been applied in electrophoretic displays.
Electrophoretic Deposition as a New Bioactive Glass Coating Process for Orthodontic Stainless Steel
Kyotaro Kawaguchi; Masahiro Iijima; Kazuhiko Endo; Itaru Mizoguchi
2017-01-01
This study investigated the surface modification of orthodontic stainless steel using electrophoretic deposition (EPD) of bioactive glass (BG). The BG coatings were characterized by spectrophotometry, scanning electron microscopy with energy dispersive X-ray spectrometry, and X-ray diffraction. The frictional properties were investigated using a progressive load scratch test. The remineralization ability of the etched dental enamel was studied according to the time-dependent mechanical proper...
Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD
Directory of Open Access Journals (Sweden)
Silva L.M.
2001-01-01
Full Text Available The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA, developed by Heath et al. [Nucleic Acids Research (1993 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.
Czech Academy of Sciences Publication Activity Database
Drdlík, D.; Sláma, M.; Hadraba, Hynek; Cihlář, J.
2015-01-01
Roč. 41, č. 9 (2015), s. 11202-11212 ISSN 0272-8842 R&D Projects: GA ČR(CZ) GAP108/11/1644; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081723 Keywords : hydroxyapatite * zirconia * composite * electrophoretic deposition * porosity Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 2.758, year: 2015
Directory of Open Access Journals (Sweden)
Pascale Lesage
2016-10-01
Full Text Available Abstract The third international conference on Transposable Elements (ICTE was held 16–19 April 2016 in Saint Malo, France. Organized by the French Transposition Community (Research group of the CNRS: “Mobile genetic elements: from mechanism to populations, an integrative approach” and the French Society of Genetics, the conference’s goal was to bring together researchers who study transposition in diverse organisms, using multiple experimental approaches. The meeting gathered 180 participants from all around the world. Most of them contributed through poster presentations, invited talks and short talks selected from poster abstracts. The talks were organized into six scientific sessions: “Taming mobile DNA: self and non-self recognition”; “Trans-generational inheritance”; “Mobile DNA genome structure and organization, from molecular mechanisms to applications”; “Remembrance of (retrotransposon past: mobile DNA in genome evolution”; and finally “The yin and the yang of mobile DNA in human health”.
Energy Technology Data Exchange (ETDEWEB)
Ben-Yoav, Hadar, E-mail: benyoav@post.tau.ac.il [Department of Physical Electronics, School of Electrical Engineering, Faculty of Engineering, Tel Aviv University, Tel-Aviv 69978 (Israel); Amzel, Tal [Department of Physical Electronics, School of Electrical Engineering, Faculty of Engineering, Tel Aviv University, Tel-Aviv 69978 (Israel); Sternheim, Marek [Center for Nanoscience and Nanotechnology, Tel Aviv University, Tel-Aviv, 69978 (Israel); Belkin, Shimshon [Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, 91904 (Israel); Rubin, Adi [Department of Molecular Microbiology and Biotechnology, Faculty of Life Sciences, Tel Aviv University, Tel-Aviv, 69978 (Israel); Shacham-Diamand, Yosi [Department of Physical Electronics, School of Electrical Engineering, Faculty of Engineering, Tel Aviv University, Tel-Aviv 69978 (Israel); Freeman, Amihay [Center for Nanoscience and Nanotechnology, Tel Aviv University, Tel-Aviv, 69978 (Israel)
2011-11-01
Highlights: > We present an electrochemical whole-cell biochip that can apply electric fields. > We examine the integration of cells on a biochip using electrophoretic deposition. > The effect of electric fields on the whole-cell biosensor has been demonstrated. > Relatively short DC electric pulse improves the performance of whole-cell biosensors. > Prolonged AC electric fields deteriorated the whole-cell biosensor performance. - Abstract: This paper presents an integrated whole-cell biochip system where functioning cells are deposited on the solid micro-machined surfaces while specially designed indium tin oxide electrodes that can be used to apply controllable electric fields during various stages; for example during cell deposition. The electrodes can be used also for sensing currents associated with the sensing mechanisms of electrochemical whole-cell biosensors. In this work a new approach integrating live bacterial cells on a biochip using electrophoretic deposition is presented. The biomaterial deposition technique was characterized under various driving potentials and chamber configurations. An analytical model of the electrophoretic deposition kinetics was developed and presented here. The deposited biomass included genetically engineered bacterial cells that may respond to toxic material exposure by expressing proteins that react with specific analytes generating electrochemically active byproducts. In this study the effect of external electric fields on the whole-cell biochips has been successfully developed and tested. The research hypothesis was that by applying electric fields on bacterial whole-cells, their permeability to the penetration of external analytes can be increased. This effect was tested and the results are shown here. The effect of prolonged and short external electric fields on the bioelectrochemical signal generated by sessile bacterial whole-cells in response to the presence of toxins was studied. It was demonstrated that relatively
International Nuclear Information System (INIS)
Ben-Yoav, Hadar; Amzel, Tal; Sternheim, Marek; Belkin, Shimshon; Rubin, Adi; Shacham-Diamand, Yosi; Freeman, Amihay
2011-01-01
Highlights: → We present an electrochemical whole-cell biochip that can apply electric fields. → We examine the integration of cells on a biochip using electrophoretic deposition. → The effect of electric fields on the whole-cell biosensor has been demonstrated. → Relatively short DC electric pulse improves the performance of whole-cell biosensors. → Prolonged AC electric fields deteriorated the whole-cell biosensor performance. - Abstract: This paper presents an integrated whole-cell biochip system where functioning cells are deposited on the solid micro-machined surfaces while specially designed indium tin oxide electrodes that can be used to apply controllable electric fields during various stages; for example during cell deposition. The electrodes can be used also for sensing currents associated with the sensing mechanisms of electrochemical whole-cell biosensors. In this work a new approach integrating live bacterial cells on a biochip using electrophoretic deposition is presented. The biomaterial deposition technique was characterized under various driving potentials and chamber configurations. An analytical model of the electrophoretic deposition kinetics was developed and presented here. The deposited biomass included genetically engineered bacterial cells that may respond to toxic material exposure by expressing proteins that react with specific analytes generating electrochemically active byproducts. In this study the effect of external electric fields on the whole-cell biochips has been successfully developed and tested. The research hypothesis was that by applying electric fields on bacterial whole-cells, their permeability to the penetration of external analytes can be increased. This effect was tested and the results are shown here. The effect of prolonged and short external electric fields on the bioelectrochemical signal generated by sessile bacterial whole-cells in response to the presence of toxins was studied. It was demonstrated that
Directory of Open Access Journals (Sweden)
Mayra Eduardoff
2017-09-01
Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS
Regulators of ribonucleotide reductase inhibit Ty1 mobility in saccharomyces cerevisiae
Directory of Open Access Journals (Sweden)
O'Donnell John P
2010-11-01
Full Text Available Abstract Background Ty1 is a long terminal repeat retrotransposon of Saccharomyces cerevisiae, with a replication cycle similar to retrovirus replication. Structurally, Ty1 contains long terminal repeat (LTR regions flanking the gag and pol genes that encode for the proteins that enable Ty1 mobility. Reverse transcriptase produces Ty1 complementary (cDNA that can either be integrated back into the genome by integrase or recombined into the yeast genome through homologous recombination. The frequency of Ty1 mobility is temperature sensitive, with optimum activity occurring at 24-26°C. Results In this study, we identified two host genes that when deleted allow for high temperature Ty1 mobility: RFX1 and SML1. The protein products of these genes are both negative regulators of the enzyme ribonucleotide reductase, a key enzyme in regulating deoxyribonucleotide triphosphate (dNTP levels in the cell. Processing of Ty1 proteins is defective at high temperature, and processing is not improved in either rfx1 or sml1 deletion strains. Ty1 mobility at high temperature is mediated by homologous recombination of Ty1 cDNA to Ty1 elements within the yeast genome. We quantified cDNA levels in wild type, rfx1 and sml1 deletion background strains at different temperatures. Southern blot analysis demonstrated that cDNA levels were not markedly different between the wild type and mutant strains as temperatures increased, indicating that the increased Ty1 mobility is not a result of increased cDNA synthesis in the mutant strains. Homologous recombination efficiency was increased in both rfx1 and sml1 deletion strains at high temperatures; the rfx1 deletion strain also had heightened homologous recombination efficiency at permissive temperatures. In the presence of the dNTP reducing agent hydroxyurea at permissive temperatures, Ty1 mobility was stimulated in the wild type and sml1 deletion strains but not in the rfx1 deletion strain. Mobility frequency was greatly
Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.
Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François
2009-07-08
Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.
Mobile units of DNA in phytoplasma genomes.
Dickinson, Matt
2010-09-01
Phytoplasmas are obligate symbionts of plants and insects that are responsible for significant yield losses in diverse crops. Genome sequencing has revealed that many phytoplasma genomes appear to contain repeated genes organized in units of approximately 20 kb. These 'potential mobile units' (PMUs) resemble composite replicative transposons. PMUs contain several genes for recombination and some also contain putative 'virulence genes'. Genome alignments suggest that PMUs are involved in phytoplasma genome instability and recombination. In this edition of Molecular Microbiology, Hogenhout and colleagues report that one PMU from the aster yellows phytoplasma strain Witches' Broom (AY-WB) can exist as both a linear PMU within the chromosome and as an extrachromosomal circular form. The copy number of the circular form is much higher in the insect vector compared with the plant, and expression levels of genes present on the PMU are also higher in the insect. These observations suggest not only that this PMU could be a mobile element, but that it could also be involved in a phase-variation mechanism that allows the phytoplasma to adapt to its different hosts.
Zothansiama; Zosangzuali, Mary; Lalramdinpuii, Miriam; Jagetia, Ganesh Chandra
2017-01-01
Radiofrequency radiations (RFRs) emitted by mobile phone base stations have raised concerns on its adverse impact on humans residing in the vicinity of mobile phone base stations. Therefore, the present study was envisaged to evaluate the effect of RFR on the DNA damage and antioxidant status in cultured human peripheral blood lymphocytes (HPBLs) of individuals residing in the vicinity of mobile phone base stations and comparing it with healthy controls. The study groups matched for various demographic data including age, gender, dietary pattern, smoking habit, alcohol consumption, duration of mobile phone use and average daily mobile phone use. The RF power density of the exposed individuals was significantly higher (p base stations, showed significantly (p base station/s. The analysis of various antioxidants in the plasma of exposed individuals revealed a significant attrition in glutathione (GSH) concentration (p < 0.01), activities of catalase (CAT) (p < 0.001) and superoxide dismutase (SOD) (p < 0.001) and rise in lipid peroxidation (LOO) when compared to controls. Multiple linear regression analyses revealed a significant association among reduced GSH concentration (p < 0.05), CAT (p < 0.001) and SOD (p < 0.001) activities and elevated MN frequency (p < 0.001) and LOO (p < 0.001) with increasing RF power density.
Green, M; Wald, E R; Dashefsky, B; Barbadora, K; Wadowsky, R M
1996-01-01
Two nosocomial cases of Legionnaires' disease occurred in children. Legionella pneumophila serogroup 1 was isolated from both patients and 30 of 39 plumbing system sites in the hospital. The patient and hospital environmental isolates yielded identical field inversion gel electrophoretic patterns which differed from patterns observed with epidemiologically unrelated strains.
Behling-Kelly, Erica
2016-03-01
The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.
International Nuclear Information System (INIS)
Ajayi, Obafunso A; Wong, Chee Wei; Guitierrez, Daniel H; Peaslee, David; Cheng, Arthur; Chen, Bin; Gao, Theodore
2015-01-01
We report a scalable one-step electrode fabrication approach for synthesizing composite carbon-based supercapacitors with synergistic outcomes. Multi-walled carbon nanotubes (MWCNTs) were successfully integrated into our modified electrophoretic deposition process to directly form composite MWCNT–GO electrochemical capacitor electrodes (where GO is graphene oxide) with superior performance to solely GO electrodes. The measured capacitance improved threefold, reaching a maximum specific capacitance of 231 F g"−"1. Upon thermal reduction, MWCNT–GO electrode sheet resistance decreased by a factor of 8, significantly greater than the 2× decrease of those without MWCNTs. (paper)
Reagent-Free Electrophoretic Synthesis of Few-Atom-Thick Metal Oxide Nanosheets
DEFF Research Database (Denmark)
Hou, Chengyi; Zhang, Minwei; Zhang, Lili
2017-01-01
Engineering traditional materials into the new form of atomic and free-standing two-dimensional structures is of both fundamental interest and practical significance, but it is in general facing challenges especially for metal oxide semiconductors. We herein report an ultragreen method for the cost......-effective and fast preparation of atomic metal oxide nanosheets that can be further transformed into nanofilms. The method combines top-down building block synthesis and bottom-up electrophoretic assembly in water under ambient conditions, using only bulk metal and Milli-Q water without involving any additional...
Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul
2014-12-01
The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.
Principles of Micellar Electrokinetic Capillary Chromatography Applied in Pharmaceutical Analysis
Directory of Open Access Journals (Sweden)
Árpád Gyéresi
2013-02-01
Full Text Available Since its introduction capillary electrophoresis has shown great potential in areas where electrophoretic techniques have rarely been used before, including here the analysis of pharmaceutical substances. The large majority of pharmaceutical substances are neutral from electrophoretic point of view, consequently separations by the classic capillary zone electrophoresis; where separation is based on the differences between the own electrophoretic mobilities of the analytes; are hard to achieve. Micellar electrokinetic capillary chromatography, a hybrid method that combines chromatographic and electrophoretic separation principles, extends the applicability of capillary electrophoretic methods to neutral analytes. In micellar electrokinetic capillary chromatography, surfactants are added to the buffer solution in concentration above their critical micellar concentrations, consequently micelles are formed; micelles that undergo electrophoretic migration like any other charged particle. The separation is based on the differential partitioning of an analyte between the two-phase system: the mobile aqueous phase and micellar pseudostationary phase. The present paper aims to summarize the basic aspects regarding separation principles and practical applications of micellar electrokinetic capillary chromatography, with particular attention to those relevant in pharmaceutical analysis.
DEFF Research Database (Denmark)
Juul, Sissel; Iacovelli, Federico; Falconi, Mattia
2013-01-01
ABSTRACT We demonstrate temperature-controlled encapsulation and release of the enzyme horseradish peroxidase using a preassembled and covalently closed three-dimensional DNA cage structure as a controllable encapsulation device. The utilized cage structure was covalently closed and composed of 12...... to fold into hairpin structures. As demonstrated by gel-electrophoretic and fluorophore-quenching experiments this design imposed a temperature-controlled conformational transition capability to the structure, which allowed entrance or release of an enzyme cargo at 37 C while ensuring retainment...
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Porous SiO2/HAp Coatings on Cp-Titanium Grade 1 Surfaces Produced by Electrophoretic Deposition
Directory of Open Access Journals (Sweden)
Moskalewicz T.
2016-12-01
Full Text Available Porous hydroxyapatite doped SiO2 coatings were electrophoretically deposited (EPD on commercially pure titanium. The influence of EPD parameters on coatings quality was investigated. Microstructural observation was done using transmission and scanning electron microscopy as well as X-ray diffractometry.
International Nuclear Information System (INIS)
Nikitina, I.Yu.; Rodionova, N.K.; Pinchuk, L.B.; Lipskaya, A.I.; Roval', G.N.; Serkiz, Ya.I.
1992-01-01
As a result of the obtained data analysis two groups of animals with specific changes of lymphocyte mobility after irradiation with 100 and 400 cGy doses were found. Animals irradiated with 50 cGy doses reacted in a single manner. Apparently it is related with the value of animals' radiosensitivity. 6 refs.; 1 fig.; 1 table. (author)
DNA electrophoresis through microlithographic arrays
International Nuclear Information System (INIS)
Sevick, E.M.; Williams, D.R.M.
1996-01-01
Electrophoresis is one of the most widely used techniques in biochemistry and genetics for size-separating charged molecular chains such as DNA or synthetic polyelectrolytes. The separation is achieved by driving the chains through a gel with an external electric field. As a result of the field and the obstacles that the medium provides, the chains have different mobilities and are physically separated after a given process time. The macroscopically observed mobility scales inversely with chain size: small molecules move through the medium quickly while larger molecules move more slowly. However, electrophoresis remains a tool that has yet to be optimised for most efficient size separation of polyelectrolytes, particularly large polyelectrolytes, e.g. DNA in excess of 30-50 kbp. Microlithographic arrays etched with an ordered pattern of obstacles provide an attractive alternative to gel media and provide wider avenues for size separation of polyelectrolytes and promote a better understanding of the separation process. Its advantages over gels are (1) the ordered array is durable and can be re-used, (2) the array morphology is ordered and can be standardized for specific separation, and (3) calibration with a marker polyelectrolyte is not required as the array is reproduced to high precision. Most importantly, the array geometry can be graduated along the chip so as to expand the size-dependent regime over larger chain lengths and postpone saturation. In order to predict the effect of obstacles upon the chain-length dependence in mobility and hence, size separation, we study the dynamics of single chains using theory and simulation. We present recent work describing: 1) the release kinetics of a single DNA molecule hooked around a point, frictionless obstacle and in both weak and strong field limits, 2) the mobility of a chain impinging upon point obstacles in an ordered array of obstacles, demonstrating the wide range of interactions possible between the chain and
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Kojima, Kenji K; Kobayashi, Ichizo
2015-10-19
R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East
Electrophoretic Nanocrystalline Graphene Film Electrode for Lithium Ion Battery
International Nuclear Information System (INIS)
Kaprans, Kaspars; Bajars, Gunars; Kucinskis, Gints; Dorondo, Anna; Mateuss, Janis; Gabrusenoks, Jevgenijs; Kleperis, Janis; Lusis, Andrejs
2015-01-01
Graphene sheets were fabricated by electrophoretic deposition method from water suspension of graphene oxide followed by thermal reduction. The formation of nanocrystalline graphene sheets has been confirmed by scanning electron microscopy, X-ray diffraction and Raman spectroscopy. The electrochemical performance of graphene sheets as anode material for lithium ion batteries was evaluated by cycling voltammetry, galvanostatic charge-discharge cycling, and electrochemical impedance spectroscopy. Fabricated graphene sheets exhibited high discharge capacity of about 1120 mAh·g −1 and demonstrated good reversibility of lithium intercalation and deintercalation in graphene sheet film with capacity retention over 85 % after 50 cycles. Results show that nanocrystalline graphene sheets prepared by EPD demonstrated a high potential for application as anode material in lithium ion batteries
Electrophoretic formation of semiconductor layers with adjustable band gap
Shindrov, Alexander; Yuvchenko, Sergey; Vikulova, Maria; Tretyachenko, Elena; Zimnyakov, Dmitry; Gorokhovsky, Alexander
2017-11-01
The ceramic layers of the potassium polytitanates modified by transition metal salts were electrophoretically deposited onto the surface of glassy substrate coated with indium-tin oxide. The deposition allows obtaining a dense ceramic layer formed by composite agglomerates consisting of nanoscale particles with average size of 130-190 nm. The optical absorption spectra of the coatings modified in the mixtures of aqueous solutions of different transition metal salts were investigated. It was recognized that a bandgap value of these composites can be adjusted in a range from 1.4 to 2.3 eV depending the chemical composition of layered double hydroxide obtained during modification. This might be very promising for optoelectronic applications of such coatings due to an explicit control of optical properties.
Energy Technology Data Exchange (ETDEWEB)
Fang, Yuanxing; Lee, Wei Cheat; Canciani, Giacomo E.; Draper, Thomas C.; Al-Bawi, Zainab F. [Department of Chemistry, School of Life Sciences, University of Sussex, Brighton BN1 9QJ (United Kingdom); Bedi, Jasbir S. [School of Public Health & Zoonoses, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana 141004 Punjab (India); Perry, Christopher C. [Division of Biochemistry, School of Medicine, Loma Linda University, Loma Linda, CA 92350 (United States); Chen, Qiao, E-mail: qiao.chen@sussex.ac.uk [Department of Chemistry, School of Life Sciences, University of Sussex, Brighton BN1 9QJ (United Kingdom)
2015-12-15
Graphical abstract: - Highlights: • A novel method combining electrospinning and electrophoretic deposition was established for the creation of nanostructured semiconductor thin films. • The created thin films displayed a high chemical stability with a controllable thickness. • The PEC water splitting performance of the thin films was optimized by fine-tuning the thickness of the films. • A maximum photoconversion efficiency was achieved by 18 μm nanofibrous thin films. - Abstract: Electrophoretic deposition (EPD) of ground electrospun WO{sub 3} nanofibers was applied to create photoanodes with controlled morphology for the application of photoelectrochemical (PEC) water splitting. The correlations between deposition parameters and film thicknesses were investigated with theoretical models to precisely control the morphology of the nanostructured porous thin film. The photoconversion efficiency was further optimized as a function of film thickness. A maximum photoconversion efficiency of 0.924% from electrospun WO{sub 3} nanofibers that EPD deposited on a substrate was achieved at a film thickness of 18 μm.
Study of the 111In-DTPA complex by the electromigration method
International Nuclear Information System (INIS)
Ivanov, P.I.; Bozhikov, G.A.; Filossofov, D.V.; Maslov, O.D.; Milanov, M.V.; Dmitriev, S.N.; Bontchev, G.D.
2002-01-01
The electrophoretic behavior of the 111 In-DTPA radiopharmaceutical has been investigated. The stability constant, diffusion coefficient and effective charge of the complex as well as the temperature dependence of the electrophoretic mobility were determined
Energy Technology Data Exchange (ETDEWEB)
Johnson, T.J.; Davis, E.J.
2000-05-01
An experimental and theoretical investigation of the electrophoretic clarification rate of colloidal suspensions was conducted. The suspensions included a coal-washing effluent and a model system of TiO{sub 2} particles. A parametric study of TiO{sub 2} suspensions was performed to validate and analysis of the electrophoretic motion of the clarification front formed between a clear zone and the suspension. To measure the electric field strength needed in the prediction of the location of the front, a moveable probe and salt bridge were connected to a reference electrode. Using the measured electric field strengths, it was found that the numerical solution to the unit cell electrophoresis model agrees with the measured clarification rates. For suspensions with moderately thick electric double layers and high particle volume fractions the deviations from classical Smoluchowski theory are substantial, and the numerical analysis is in somewhat better agreement with the data than a prior solution of the problem. The numerical model reduces to the predictions of previous theories as the thickness of the electric double layer decreases, and it is in good agreement with the clarification rate measured for a coal-washing effluent suspension with thin electric double layers.
ssDNA degradation along capillary electrophoresis process using a Tris buffer.
Ric, Audrey; Ong-Meang, Varravaddheay; Poinsot, Verena; Martins-Froment, Nathalie; Chauvet, Fabien; Boutonnet, Audrey; Ginot, Frédéric; Ecochard, Vincent; Paquereau, Laurent; Couderc, François
2017-06-01
Tris-Acetate buffer is currently used in the selection and the characterization of ssDNA by capillary electrophoresis (CE). By applying high voltage, the migration of ionic species into the capillary generates a current that induces water electrolysis. This phenomenon is followed by the modification of the pH and the production of Tris derivatives. By injecting ten times by capillary electrophoresis ssDNA (50 nM), the whole oligonucleotide was degraded. In this paper, we will show that the Tris buffer in the running vials is modified along the electrophoretic process by electrochemical reactions. We also observed that the composition of the metal ions changes in the running buffer vials. This phenomenon, never described in CE, is important for fluorescent ssDNA analysis using Tris buffer. The oligonucleotides are degraded by electrochemically synthesized species (present in the running Tris vials) until it disappears, even if the separation buffer in the capillary is clean. To address these issues, we propose to use a sodium phosphate buffer that we demonstrate to be electrochemically inactive. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Németh, Eszter; Asaka, Masamitsu N; Kato, Kohsuke
2018-01-01
circular dichroism spectroscopy, and nano-electrospray ionisation mass spectrometry. In situ intramolecular activation of the nuclease domain was observed, resulting in specific cleavage of DNA with moderate activity. This study represents a new approach to AN design through integrated nucleases consisting......Application of artificial nucleases (ANs) in genome editing is still hindered by their cytotoxicity related to off-target cleavages. This problem can be targeted by regulation of the nuclease domain. Here, we provide an experimental survey of computationally designed integrated zinc finger...... nucleases, constructed by linking the inactivated catalytic centre and the allosteric activator sequence of the colicin E7 nuclease domain to the two opposite termini of a zinc finger array. DNA specificity and metal binding were confirmed by electrophoretic mobility shift assays, synchrotron radiation...
Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.
Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara
2017-02-20
The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.
High power density supercapacitor electrodes of carbon nanotube films by electrophoretic deposition
International Nuclear Information System (INIS)
Du Chunsheng; Pan Ning
2006-01-01
Carbon nanotube thin films have been successfully fabricated by the electrophoretic deposition technique. The supercapacitors built from such thin film electrodes have a very small equivalent series resistance, and a high specific power density over 20 kW kg -1 was thus obtained. More importantly, the supercapacitors showed superior frequency response. Our study also demonstrated that these carbon nanotube thin films can serve as coating layers over ordinary current collectors to drastically enhance the electrode performance, indicating a huge potential in supercapacitor and battery manufacturing
Effects of surfactants on spinning carbon nanotube fibers by an electrophoretic method
Directory of Open Access Journals (Sweden)
Jun Ma, Jie Tang, Qian Cheng, Han Zhang, Norio Shinya and Lu-Chang Qin
2010-01-01
Full Text Available Thin fibers were spun from a colloidal solution of single-walled carbon nanotubes (SWNTs using an electrophoretic method. Sodium dodecylbenzenesulfonate (NaDDBS was chosen as a surfactant and showed good performance owing to its special chemical structure. The highest spinning velocity reached 0.5 mm s−1. The resulting SWNT fibers had a tensile strength of 400 MPa and a conductivity of 355 S cm−1. Their mechanical and electrical properties were markedly improved after adding NaDDBS as the dispersant in water.
High quality DNA from human papillomavirus (HPV for PCR/RFLPs
Directory of Open Access Journals (Sweden)
Denise Wanderlei-Silva
2005-01-01
Full Text Available The analysis of DNA in clinical samples for a secure diagnostic has become indispensable nowadays. Techniques approaching isolation of high molecular weigth DNA of HPV could lead to efficient amplification and early clinical diagnosis of the virus DNA by PCR (polymerase chain reaction. We describe a fast, non-toxical, efficient and cheap method for DNA isolation of human papilloma virus (HPV from cervical smears using guanidine (DNAzol solution. A 450 bp DNA band correponding to the late region (L1 of the virus genome was detected by PCR, showing that the DNAzol extraction soluction generated a good viral DNA yield. The electrophoretic pattern after digestion with restriction endonucleases (RFLPs/PCR revealed the predominance of HPV-16 and HPV-33 in the samples from the State of Alagoas, Brazil.A detecção de DNA em amostras clínicas visando um diagnóstico mais seguro vem se tornando uma prática comum em laboratórios de análise clínica. Metodologias que objetivem o isolamento de DNA de alto peso molecular de HPV podem levar a uma amplificação precisa e diagnose precoce do DNA do vírus por PCR (reação de polimerase em cadeia. Nós descrevemos um método para o isolamento do DNA do vírus do papiloma humano de amostras cervicais utilizando o detergente guanidina (solução DNAzol. O método foi rápido, não-tóxico e eficiente. Uma banda de DNA de 450 pb correspondente à região tardia (L1 do genoma viral foi detectada por PCR, mostrando que a extração com DNAzol gerou quantidade suficiente de DNA para análise. O padrão eletroforético, após digestão com endonucleases de restrição (RFLPs/PCR, revelou predominância de HPV 16 e HPV-33 nas amostras no Estado de Alagoas, Brasil.
International Nuclear Information System (INIS)
Prasad, C. Krishna; Meyers, Craig; Zhan Dejin; You Hong; Chiriva-Internati, Maurizio; Mehta, Jawahar L.; Liu Yong; Hermonat, Paul L.
2003-01-01
Multiple epidemiologic studies show that adeno-associated virus (AAV) is negatively associated with cervical cancer (CX CA), a cancer which is positively associated with human papillomavirus (HPV) infection. Mechanisms for this correlation may be by Rep78's (AAV's major regulatory protein) ability to bind the HPV-16 p97 promoter DNA and inhibit transcription, to bind and interfere with the functions of the E7 oncoprotein of HPV-16, and to bind a variety of HPV-important cellular transcription factors such as Sp1 and TBP. c-Jun is another important cellular factor intimately linked to the HPV life cycle, as well as keratinocyte differentiation and skin development. Skin is the natural host tissue for both HPV and AAV. In this article it is demonstrated that Rep78 directly interacts with c-Jun, both in vitro and in vivo, as analyzed by Western blot, yeast two-hybrid cDNA, and electrophoretic mobility shift-supershift assay (EMSA supershift). Addition of anti-Rep78 antibodies inhibited the EMSA supershift. Investigating the biological implications of this interaction, Rep78 inhibited the c-Jun-dependent c-jun promoter in transient and stable chloramphenicol acetyl-transferase (CAT) assays. Rep78 also inhibited c-Jun-augmented c-jun promoter as well as the HPV-16 p97 promoter activity (also c-Jun regulated) in in vitro transcription assays in T47D nuclear extracts. Finally, the Rep78-c-Jun interaction mapped to the amino-half of Rep78. The ability of Rep78 to interact with c-Jun and down-regulate AP-1-dependent transcription suggests one more mechanism by which AAV may modulate the HPV life cycle and the carcinogenesis process
Electrophoretic Deposition of Gallium with High Deposition Rate
Directory of Open Access Journals (Sweden)
Hanfei Zhang
2014-12-01
Full Text Available In this work, electrophoretic deposition (EPD is reported to form gallium thin film with high deposition rate and low cost while avoiding the highly toxic chemicals typically used in electroplating. A maximum deposition rate of ~0.6 μm/min, almost one order of magnitude higher than the typical value reported for electroplating, is obtained when employing a set of proper deposition parameters. The thickness of the film is shown to increase with deposition time when sequential deposition is employed. The concentration of Mg(NO32, the charging salt, is also found to be a critical factor to control the deposition rate. Various gallium micropatterns are obtained by masking the substrate during the process, demonstrating process compatibility with microfabrication. The reported novel approach can potentially be employed in a broad range of applications with Ga as a raw material, including microelectronics, photovoltaic cells, and flexible liquid metal microelectrodes.
Preparation of platinum-free tubular dye-sensitized solar cells by electrophoretic deposition
Directory of Open Access Journals (Sweden)
Khwanchit Wongcharee
2016-10-01
Full Text Available Tubular dye-sensitized solar cells (DSSCs were developed by replacing expensive materials with lower cost materials as follows: (1 replacing conductive glass electrodes with titanium (Ti wires and (2 replacing platinum (Pt catalyst with the mixture of multi-walled carbon nanotubes, MWCNTs and Poly(3,4-ethylenedioxythiophene-poly(styrenesulfonate, PEDOT-PSS. Platinized counter electrodes were used as the standard counter electrodes for comparison. The effects of the chemical treatment of titanium wire substrate and electrophoretic deposition condition on the efficiency of DSSCs were also investigated. The chemical treatment of titanium wires was carried out by soaking the wires in HF-HNO3 solutions at three different concentrations of 0.8, 1.6 and 2.4 M and three different soaking durations of 5, 10 and 15 min. The optimum condition was found at HF-HNO3 concentration of 0.8 M and soaking duration of 10 min. Film coating on working electrodes was performed using electrophoretic technique at three different voltages of 5, 8 and 10 V and four different coating durations of 1, 3, 5 and 7 min. Then, the optimum condition at deposition voltage of 5 V and deposition duration of 5 min was applied for film deposition on counter electrodes. The efficiency of DSSC with CNTs/TiO2 counter electrode was 0.03%. The addition of PEDOT-PSS improved the efficiency of DSSC to 0.08%.
Stranieri, Angelica; Giordano, Alessia; Bo, Stefano; Braghiroli, Chiara; Paltrinieri, Saverio
2017-08-01
Objectives The aim of this study was to evaluate whether the frequency of electrophoretic changes in serum of cats with feline infectious peritonitis (FIP) changed in recent years vs past years. Methods Agarose gel electrophoresis (AGE) and capillary zone electrophoresis (CZE) from cats with FIP and healthy cats recorded in the periods 2004-2009 and 2013-2014 were retrospectively analysed. Relative and absolute values of each electrophoretic fraction were recorded and the number of cats showing single or combined electrophoretic changes consistent with FIP (hypoalbuminaemia, inverted albumin to globulin [A:G] ratio, increased total protein, total globulin, alpha [α] 2 -globulin and gamma [γ]-globulin concentration) were counted. Additionally, a visual analysis of electrophoretograms was also performed. Results for the two time periods were statistically compared. Results The details of 91 AGE procedures (41 from cats with FIP and 50 from healthy cats) and 45 CZE procedures (26 from cats with FIP and 19 from healthy cats) were obtained from the database. No significant differences between the two time periods were found both in FIP and in healthy cats analysed with CZE and in healthy cats analysed with AGE. Compared with 2004-2009, cats with FIP sampled in 2013-2014 with AGE showed a significantly lower concentration of total protein, γ-globulins and total globulins, and a significantly higher A:G ratio and percentage of albumin and α 2 -globulins. Using both AGE and CZE, in recent years the proportion of cats with high α2-globulins without gammopathy and the proportion of cats with gammopathy alone decreased. With a visual approach, the number of patterns considered as dubious increased in the second period with AGE (non-statistically significant). Conclusions and relevance The frequency of electrophoretic abnormalities in cats with FIP decreased in recent years, independently of the technique employed. Although the mechanism responsible for this change was
Energy Technology Data Exchange (ETDEWEB)
Shi, Wei; Han, Shijiao; Huang, Wei; Yu, Junsheng, E-mail: jsyu@uestc.edu.cn [State Key Laboratory of Electronic Thin Films and Integrated Devices, School of Optoelectronic Information, University of Electronic Science and Technology of China (UESTC), Chengdu 610054 (China)
2015-01-26
High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm{sup 2}/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role in enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.
Xiao, Wei; Xia, Hui; Fuh, Jerry Y. H.; Lu, Li
2010-05-01
CNT/MnO2 (birnessite-type) composite films have been successfully deposited on Ni-foil substrate via electrophoretic deposition (EPD). The unique EPD CNT/MnO2 composite film electrode shows enhanced electrical conductivity, good contact between composite films and the substrate and open porous structure, which makes the EPD composite films a promising electrode for high-power supercapacitors and lithium ion batteries.
Directory of Open Access Journals (Sweden)
Juan F Vega
Full Text Available The stabilization of human papillomavirus type 16 virus-like particles has been examined by means of different techniques including dynamic and static light scattering, transmission electron microscopy and electrophoretic mobility. All these techniques provide different and often complementary perspectives about the aggregation process and generation of stabilized virus-like particles after a period of time of 48 hours at a temperature of 298 K. Interestingly, static light scattering results point towards a clear colloidal instability in the initial systems, as suggested by a negative value of the second virial coefficient. This is likely related to small repulsive electrostatic interactions among the particles, and in agreement with relatively small absolute values of the electrophoretic mobility and, hence, of the net surface charges. At this initial stage the small repulsive interactions are not able to compensate binding interactions, which tend to aggregate the particles. As time proceeds, an increase of the size of the particles is accompanied by strong increases, in absolute values, of the electrophoretic mobility and net surface charge, suggesting enhanced repulsive electrostatic interactions and, consequently, a stabilized colloidal system. These results show that electrophoretic mobility is a useful methodology that can be applied to screen the stabilization factors for virus-like particles during vaccine development.
Cellular and molecular effects of electromagnetic radiation and sonic waves
Directory of Open Access Journals (Sweden)
Patricia Froes Meyer
2013-07-01
Full Text Available Electromagnetic radiation (in the form of pulsed magnetic fields, radiofrequency and intense pulsed light and mechanical agents (such as sonic waves have been used in physical therapy. The aim of this study was to assess the effects of low-intensity magnetic fields, sonic and radiofrequency waves, and intense pulsed light on the survival of Escherichia coli cultures and on the electrophoretic mobility of plasmid DNA. Exponentially growing E. coli AB1157 cultures and plasmid DNA samples were exposed to these physical agents and 0.9% NaCl (negative control and SnCl2 (positive control solutions. Aliquots of the cultures were diluted and spread onto a solidified rich medium. The colony-forming units were counted after overnight incubation and the survival fraction was calculated. Agarose gel electrophoresis was performed to visualise and quantify the plasmid topological forms. The results suggest that these agents do not alter the survival of E. coli cells or plasmid DNA electrophoresis mobility. Moreover, they do not protect against the lesive action of SnCl2. These physical agents therefore had no cytotoxic or genotoxic effects under the conditions studied.
International Nuclear Information System (INIS)
Hafeez, Md.; Rao, B.V.
1986-01-01
Preliminary work has been done to study certain responses induced by irradiated amphistome metacercariae used as a vaccine to immunise lambs, kids and calves. The electrophoretic pattern of the sera collected from lambs and kids vaccinated with gamma irradiated amphistome matacercariae (C.I. XXVI) has been reported in this study. (author). 10 refs., 1 table
Allison, Stuart A; Xin, Yao
2005-08-15
A boundary element (BE) procedure is developed to numerically calculate the electrophoretic mobility of highly charged, rigid model macroions in the thin double layer regime based on the continuum primitive model. The procedure is based on that of O'Brien (R.W. O'Brien, J. Colloid Interface Sci. 92 (1983) 204). The advantage of the present procedure over existing BE methodologies that are applicable to rigid model macroions in general (S. Allison, Macromolecules 29 (1996) 7391) is that computationally time consuming integrations over a large number of volume elements that surround the model particle are completely avoided. The procedure is tested by comparing the mobilities derived from it with independent theory of the mobility of spheres of radius a in a salt solution with Debye-Huckel screening parameter, kappa. The procedure is shown to yield accurate mobilities provided (kappa)a exceeds approximately 50. The methodology is most relevant to model macroions of mean linear dimension, L, with 1000>(kappa)L>100 and reduced absolute zeta potential (q|zeta|/k(B)T) greater than 1.0. The procedure is then applied to the compact form of high molecular weight, duplex DNA that is formed in the presence of the trivalent counterion, spermidine, under low salt conditions. For T4 DNA (166,000 base pairs), the compact form is modeled as a sphere (diameter=600 nm) and as a toroid (largest linear dimension=600 nm). In order to reconcile experimental and model mobilities, approximately 95% of the DNA phosphates must be neutralized by bound counterions. This interpretation, based on electrokinetics, is consistent with independent studies.
Organizing DNA repair in the nucleus: DSBs hit the road.
Marnef, Aline; Legube, Gaëlle
2017-06-01
In the past decade, large-scale movements of DNA double strand breaks (DSBs) have repeatedly been identified following DNA damage. These mobility events include clustering, anchoring or peripheral movement at subnuclear structures. Recent work suggests roles for motion in homology search and in break sequestration to preclude deleterious outcomes. Yet, the precise functions of these movements still remain relatively obscure, and the same holds true for the determinants. Here we review recent advances in this exciting area of research, and highlight that a recurrent characteristic of mobile DSBs may lie in their inability to undergo rapid repair. A major future challenge remains to understand how DSB mobility impacts on genome integrity. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Johnson, T.J.; Davis, E.J. [University of Washington, Seattle, WA (USA). Dept. of Chemical Engineering
2000-05-01
An experimental and theoretical investigation of the electrophoretic clarification rate of colloidal suspensions was conducted. The suspensions included a coal-washing effluent and a model system of TiO{sub 2} particles. A parametric study of TiO{sub 2} suspensions was performed to validate an analysis of the electrophoretic motion of the clarification front formed between a clear zone and the suspension. To measure the electric field strength needed in the prediction of the location of the front, a moveable probe and salt bridge were connected to a reference electrode. Using the measured electric field strength, it was found that the numerical solution to the unit cell electrophoresis model agrees with the measured clarification rates. For suspensions with moderately thick electric double layers and high particle volume fractions the deviations from classical Smoluchowski theory are substantial, and the numerical analysis is in somewhat better agreement with the data than a prior solution of the problem. The numerical model reduces to the predictions of previous theories as the thickness of the electric double layer decreases, and it is in good agreement with the clarification rate measured for a coal-washing effluent suspension with thin electric double layers. 21 refs., 8 figs., 4 tabs.
International Nuclear Information System (INIS)
Das, Debasish; Basu, Rajendra N.
2013-01-01
Graphical abstract: - Highlights: • Stable suspension of yttria stabilized zirconia (YSZ) obtained in isopropanol medium. • Suspension chemistry and process parameters for electrophoretic deposition optimized. • Deposited film quality changed with iodine and water (dispersants) concentration. • Dense YSZ film (∼5 μm) fabricated onto non-conducting porous NiO-YSZ anode substrate. - Abstract: Suspensions of 8 mol% yttria stabilized zirconia (YSZ) particulates in isopropanol medium are prepared using acetylacetone, iodine and water as dispersants. The effect of dispersants concentration on suspension stability, particle size distribution, electrical conductivity and pH of the suspensions are studied in detail to optimize the suspension chemistry. Electrophoretic deposition (EPD) has been conducted to produce thin and dense YSZ electrolyte films. Deposition kinetics have been studied in depth and good quality films on conducting substrate are obtained at an applied voltage of 15 V for 3 min. YSZ films are also fabricated on non-conducting NiO-YSZ anode substrate using a steel plate on the reverse side of the substrate. Upon co-firing at 1400 °C for 6 h a dense YSZ film of thickness ∼5 μm is obtained. Such a half cell (anode + electrolyte) can be used to fabricate a solid oxide fuel cell on applying a suitable cathode layer
Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.
Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar
2018-06-05
The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.
ZnO Nanoparticles Protect RNA from Degradation Better than DNA
Directory of Open Access Journals (Sweden)
Jayden McCall
2017-11-01
Full Text Available Gene therapy and RNA delivery require a nanoparticle (NP to stabilize these nucleic acids when administered in vivo. The presence of degradative hydrolytic enzymes within these environments limits the nucleic acids’ pharmacologic activity. This study compared the effects of nanoscale ZnO and MgO in the protection afforded to DNA and RNA from degradation by DNase, serum or tumor homogenate. For double-stranded plasmid DNA degradation by DNase, our results suggest that the presence of MgO NP can protect DNA from DNase digestion at an elevated temperature (65 °C, a biochemical activity not present in ZnO NP-containing samples at any temperature. In this case, intact DNA was remarkably present for MgO NP after ethidium bromide staining and agarose gel electrophoresis where these same stained DNA bands were notably absent for ZnO NP. Anticancer RNA, polyinosinic-polycytidylic acid (poly I:C is now considered an anti-metastatic RNA targeting agent and as such there is great interest in its delivery by NP. For it to function, the NP must protect it from degradation in serum and the tumor environment. Surprisingly, ZnO NP protected the RNA from degradation in either serum-containing media or melanoma tumor homogenate after gel electrophoretic analysis, whereas the band was much more diminished in the presence of MgO. For both MgO and ZnO NP, buffer-dependent rescue from degradation occurred. These data suggest a fundamental difference in the ability of MgO and ZnO NP to stabilize nucleic acids with implications for DNA and RNA delivery and therapy.
Sequence of a cDNA encoding turtle high mobility group 1 protein.
Zheng, Jifang; Hu, Bi; Wu, Duansheng
2005-07-01
In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.
Bifunctional Rhodium Intercalator Conjugates as Mismatch-Directing DNA Alkylating Agents
Schatzschneider, Ulrich; Barton, Jacqueline K.
2004-01-01
A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covale...
Electrophoretic deposition and field emission properties of patterned carbon nanotubes
International Nuclear Information System (INIS)
Zhao Haifeng; Song Hang; Li Zhiming; Yuan Guang; Jin Yixin
2005-01-01
Patterned carbon nanotubes on silicon substrates were obtained using electrophoretic method. The carbon nanotubes migrated towards the patterned silicon electrode in the electrophoresis suspension under the applied voltage. The carbon nanotubes arrays adhered well on the silicon substrates. The surface images of carbon nanotubes were observed by scanning electron microscopy. The field emission properties of the patterned carbon nanotubes were tested in a diode structure under a vacuum pressure below 5 x 10 -4 Pa. The measured emission area was about 1.0 mm 2 . The emission current density up to 30 mA/cm 2 at an electric field of 8 V/μm has been obtained. The deposition of patterned carbon nanotubes by electrophoresis is an alternative method to prepare field emission arrays
Electrophoretic deposition of nickel zinc ferrite nanoparticles into microstructured patterns
Directory of Open Access Journals (Sweden)
Stefan J. Kelly
2016-05-01
Full Text Available Using DC electric fields, nickel-zinc ferrite (Ni0.5Zn0.5Fe2O4 nanoparticles (Dh =16.6 ± 3.6 nm are electrophoretically deposited onto silicon substrates to form dense structures defined by photoresist molds. Parameters such as electric field, bath composition, and deposition time are tuned to produce films ranging in thickness from 177 to 805 nm. The deposited films exhibit soft magnetic properties with a saturation magnetization of 60 emu/g and a coercivity of 2.6 kA/m (33 Oe. Additionally, the influence of the photoresist mold on the deposit profile is studied, and patterned films with different shapes (lines, squares, circles, etc. are demonstrated with feature sizes down to 5 μm.
Otelaja, Obafemi O.
2014-11-12
© 2014 American Chemical Society. A facile room-temperature method for assembling colloidal copper sulfide (Cu2-xS) nanoparticles into highly electrically conducting films is presented. Ammonium sulfide is utilized for connecting the nanoparticles via ligand removal, which transforms the as-deposited insulating films into highly conducting films. Electronic properties of the treated films are characterized with a combination of Hall effect measurements, field-effect transistor measurements, temperature-dependent conductivity measurements, and capacitance-voltage measurements, revealing their highly doped p-type semiconducting nature. The spin-cast nanoparticle films have carrier concentration of ∼1019 cm-3, Hall mobilities of ∼3 to 4 cm2 V-1 s-1, and electrical conductivities of ∼5 to 6 S·cm-1. Our films have hole mobilities that are 1-4 orders of magnitude higher than hole mobilities previously reported for heat-treated nanoparticle films of HgTe, InSb, PbS, PbTe, and PbSe. We show that electrophoretic deposition (EPD) as a method for nanoparticle film assembly leads to an order of magnitude enhancement in film conductivity (∼75 S·cm-1) over conventional spin-casting, creating copper sulfide nanoparticle films with conductivities comparable to bulk films formed through physical deposition methods. The X-ray diffraction patterns of the Cu2-xS films, with and without ligand removal, match the Djurleite phase (Cu1.94S) of copper sulfide and show that the nanoparticles maintain finite size after the ammonium sulfide processing. The high conductivities reported are attributed to better interparticle coupling through the ammonium sulfide treatment. This approach presents a scalable room-temperature route for fabricating highly conducting nanoparticle assemblies for large-area electronic and optoelectronic applications.
Czech Academy of Sciences Publication Activity Database
Yatskiv, Roman; Grym, Jan; Brus, V.V.; Černohorský, Ondřej; Maryanchuk, P.D.; Bazioti, C.; Dimitrakopulos, G.P.; Komninou, Ph.
2014-01-01
Roč. 29, č. 4 (2014), Article number 045017 ISSN 0268-1242 R&D Projects: GA MŠk LD12014 Institutional support: RVO:67985882 Keywords : electrophoretic deposition * Pt nanoparticles * Schottky diodes Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 2.190, year: 2014
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Effects of 32 P incorporated in plasmid DNA: strand breaks and mutagenesis
International Nuclear Information System (INIS)
Fonseca, Adenilson de S. da; Felzenszwalb, Israel
1996-01-01
In order to study the 32 P decay effects in DNA, bacterial plasmid were labeled with different activities of the radioisotope in vivo: 1,2 and 6 x 10 5 Bk/ml of bacterial culture, leading to 1,2 and 6 x 10 3 Bk/μg of nucleic acid or in vitro: 0.7, 1.5 and 3.5 x 10 3 Bk/μg of nucleic acid, stored at -20 deg C and its electroforetic profiles, transformation capacity of wild type and DNA repair. E. coli mutants cells and mutagenesis, were followed during three months. The results achieved in this work suggest that: the decay of the incorporated 32 P in vivo is able to change the pBR322 electroforetic profile, we detected a decrease on the form III (super coiled) and increase on the form II (circular), indicating single strands breaks; the decay incorporated 32 in vitro does not modify the electrophoretic profile of pBR322, suggesting that in some way the effects of the radioactive decay of incorporated 32 P is dependent of the DNA topology, the damages induced by 32 P decay increase mutation frequency in pAC189 plasmids. MRF is increased by a factor of three after 6 t 1/2 of storage, indicating direct or indirect action through mismatch DNA repair pathway. (author)
Sol-gel synthesis of 45S5 bioglass – Prosthetic coating by electrophoretic deposition
Directory of Open Access Journals (Sweden)
Faure Joel
2013-11-01
Full Text Available In this work, the 45S5 bioactive glass has been prepared by the sol-gel process using an organic acid catalyst instead of nitric acid usually used. The physico-chemical and structural characterizations confirmed and validated the elemental composition of the resulting glass. In addition, the 45S5 bioactive glass powder thus obtained was successfully used to elaborate by electrophoretic deposition a prosthetic coating on titanium alloy Ti6Al4V.
Microencapsulated Electrophoretic Films for Electronic Paper Displays
Amundson, Karl
2003-03-01
Despite the dominance of liquid crystal displays, they do not perform some functions very well. While backlit liquid crystal displays can offer excellent color performance, they wash out in bright lighting and suffer from high power consumption. Reflective liquid crystal displays have limited brightness, making these devices challenging to read for long periods of time. Flexible liquid crystal displays are difficult to manufacture and keep stable. All of these attributes (long battery lifetime, bright reflective appearance, compatibility with flexible substrates) are traits that would be found in an ideal electronic paper display - an updateable substitute for paper that could be employed in electronic books, newspapers, and other applications. I will discuss technologies that are being developed for electronic-paper-like displays, and especially on particle-based technologies. A microencapsulated electrophoretic display technology is being developed at the E Ink corporation. This display film offers offer high brightness and an ink-on-paper appearance, compatibility with flexible substrates, and image stability that can lead to very low power consumption. I will present some of the physical and chemical challenges associated with making display films with high performance.
Chromatin mobility is increased at sites of DNA double-strand breaks
Krawczyk, P. M.; Borovski, T.; Stap, J.; Cijsouw, T.; ten Cate, R.; Medema, J. P.; Kanaar, R.; Franken, N. A. P.; Aten, J. A.
2012-01-01
DNA double-strand breaks (DSBs) can efficiently kill cancer cells, but they can also produce unwanted chromosome rearrangements when DNA ends from different DSBs are erroneously joined. Movement of DSB-containing chromatin domains might facilitate these DSB interactions and promote the formation of
International Nuclear Information System (INIS)
D'Orlye, Fanny; Reiller, Pascal E.
2014-01-01
The physicochemical properties of three different humic substances (HS) are probed using capillary zone electrophoresis in alkaline carbonate buffers, pH 10. Special attention is drawn to the impact of the electrolyte ionic strength and counter-ion nature, chosen within the alkali-metal series, on HS electrophoretic mobility. Taylor-Aris dispersion analysis provides insights into the hydrodynamic radius (R-H) distributions of HS. The smallest characterized entities are of nano-metric dimensions, showing neither ionic strength- nor alkali-metal-induced aggregation. These results are compared with the entities evidenced in dynamic light scattering measurements, the size of which is two order of magnitude higher, ca. 100 nm. The extended Onsager model provides a reasonable description of measured electrophoretic mobilities in the ionic strength range 1-50 mM, thus allowing the estimation of limiting mobilities and ionic charge numbers for the different HS samples. An unexpected HS electrophoretic mobility increase (in absolute value) is observed in the order Li + ≤ Na + ≤ K + ≤ Cs + and discussed either in terms of retarding forces or in terms of ion-ion interactions. (authors)
An, Qi
Recent advances in the synthesis and characterization of nanostructured composite materials have enabled a broad range of opportunities for engineering the properties of polymer-matrix materials. Carbon nanotubes (CNTs) are known to have exceptional mechanical, electrical and thermal properties. Because of their small size, CNTs can occupy regions between traditional micro-scale reinforcements and create a hierarchical micro/nano structure spanning several orders of magnitude. Since CNTs possess critical reinforcement dimensions below 100 nm, new opportunities exist for tailoring the fiber/matrix interphase regions and ultimately the mechanical and electrical performance of advanced fiber-composites with minimal impact on the fiber-dominated properties. This growing interest in nanoscale hybridization with conventional fiber reinforcement has highlighted the need to develop new processing techniques for successful CNT integration. In this work, a novel and industrially scalable approach for producing multi-scale hybrid carbon nanotube/fiber composites using an electrophoretic deposition (EPD) technique has been studied as an alternative to in situ chemical vapor deposition growth (CVD). EPD is a widely used industrial coating process employed in areas ranging from automotive to electronics production. The method has a number of benefits which include low energy use and the ability to homogenously coat complex shapes with well adhered films of controlled thickness and density. A stable aqueous dispersion of multi-walled carbon nanotubes (MWCNTs) was produced using a novel ozonolysis and ultrasonication (USO) technique that results in dispersion and functionalization in a single step. Networks of CNTs span between adjacent fibers and the resulting composites exhibit significant increases in electrical conductivity and considerable improvements in the interlaminar shear strength and fracture toughness. In order to better understand the underlying mechanisms behind the
Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.
2010-01-01
Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966
Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B
2010-04-01
Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.
Mathew, Dennis; Bhardwaj, Garima; Wang, Qi; Sun, Linlin; Ercan, Batur; Geetha, Manisavagam; Webster, Thomas J
2014-01-01
Plasma-spray deposition of hydroxyapatite on titanium (Ti) has proven to be a suboptimal solution to improve orthopedic-implant success rates, as demonstrated by the increasing number of orthopedic revision surgeries due to infection, implant loosening, and a myriad of other reasons. This could be in part due to the high heat involved during plasma-spray deposition, which significantly increases hydroxyapatite crystal growth into the nonbiologically inspired micron regime. There has been a push to create nanotopographies on implant surfaces to mimic the physiological nanostructure of native bone and, thus, improve osteoblast (bone-forming cell) functions and inhibit bacteria functions. Among the several techniques that have been adopted to develop nanocoatings, electrophoretic deposition (EPD) is an attractive, versatile, and effective material-processing technique. The in vitro study reported here aimed to determine for the first time bacteria responses to hydroxyapatite coated on Ti via EPD. There were six and three times more osteoblasts on the electrophoretic-deposited hydroxyapatite on Ti compared with Ti (control) and plasma-spray-deposited hydroxyapatite on Ti after 5 days of culture, respectively. Impressively, there were 2.9 and 31.7 times less Staphylococcus aureus on electrophoretic-deposited hydroxyapatite on Ti compared with Ti (control) and plasma-spray-deposited hydroxyapatite on Ti after 18 hours of culture, respectively. Compared with uncoated Ti and plasma-sprayed hydroxyapatite coated on Ti, the results provided significant promise for the use of EPD to improve bone-cell density and be used as an antibacterial coating without resorting to the use of antibiotics.
Rizvi, Masood Ahmad; Zaki, Mehvash; Afzal, Mohd; Mane, Manoj; Kumar, Manjeet; Shah, Bhahwal Ali; Srivastav, Saurabh; Srikrishna, Saripella; Peerzada, Ghulam Mustafa; Tabassum, Sartaj
2015-01-27
New pharmacophore organoselenium compound (1) was designed, synthesized and characterized by various spectroscopic methods (IR, ESI-MS, (1)H, (13)C and (77)Se NMR) and further confirmed by X-ray crystallography. Compound 1 consists of two 3,5-bis(trifluoromethyl)phenyl units which are connected to the selenium atom via the organometallic C-Se bond. In vitro DNA binding studies of 1 was investigated by absorption and emission titration methods which revealed that 1 recognizes the minor groove of DNA in accordance with molecular docking studies with the DNA duplex. Gel electrophoretic assay demonstrates the ability of 1 to cleave pBR322 DNA through hydrolytic process which was further validated by T4 religation assay. To understand the drug-protein interaction of which ultimate molecular target was DNA, the affinity of 1 towards HSA was also investigated by the spectroscopic and molecular modeling techniques which showed hydrophobic interaction in the subdomain IIA of HSA. Furthermore, the intracellular localization of 1 was evidenced by cell imaging studies using HeLa cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Electrophoretic variants of blood proteins in japanese, 5
International Nuclear Information System (INIS)
Fujita, Mikio; Satoh, Chiyoko; Asakawa, Jun-ichi; Nagahata, Yuko; Tanaka, Yoshiko; Hazama, Ryuji; Goriki, Kazuaki.
1985-08-01
The plasma ceruloplasmin (CP) of 22,367 children of atomic bomb survivors in Hiroshima and Nagasaki was examined for variants by electrophoresis. The sample was composed of 14,964 unrelated children and 7,403 siblings of the unrelated persons. A total of seven types of electrophoretic variants were detected; four migrating anodally and three cathodally to the normal B band. We have reported two of these variants, CP A sub(NG1) and CP C sub(NG1), previously but the other five, CP A sub(NG2), CP A sub(HR1), CP A sub(HR2), CP C sub(HR1), and CP C sub(HR2), are newly identified. The allelic frequency of CP*CNG1 was 0.00916, so that the variant is considered to be a polymorphic allele. Homozygosity for the CP*CNG1 allele was detected in five individuals. This is the first report of a homozygous phenotype for a CP variant in a Japanese population. Family study of the new five variants all demonstrated patterns of codominant inheritance. (author)
Czech Academy of Sciences Publication Activity Database
Drdlík, D.; Sláma, M.; Hadraba, Hynek; Drdlíková, K.; Cihlář, J.
2016-01-01
Roč. 42, č. 15 (2016), s. 16529-16534 ISSN 0272-8842 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Electrophoretic deposition * Electrical conductivity * Thick layer * Surface roughness * Hydroxyapatite Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 2.986, year: 2016
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
Energy Technology Data Exchange (ETDEWEB)
Xiao Wei; Xia Hui; Fuh, Jerry Y H; Lu Li, E-mail: luli@nus.edu.s [Department of Mechanical Engineering, National University of Singapore, 9 Engineering Drive 1, Singapore 117576 (Singapore)
2010-05-01
CNT/MnO{sub 2} (birnessite-type) composite films have been successfully deposited on Ni-foil substrate via electrophoretic deposition (EPD). The unique EPD CNT/MnO{sub 2} composite film electrode shows enhanced electrical conductivity, good contact between composite films and the substrate and open porous structure, which makes the EPD composite films a promising electrode for high-power supercapacitors and lithium ion batteries.
Directory of Open Access Journals (Sweden)
Martin Převorovský
Full Text Available CSL (CBF1/RBP-Jκ/Suppressor of Hairless/LAG-1 transcription factors are the effector components of the Notch receptor signalling pathway, which is critical for metazoan development. The metazoan CSL proteins (class M can also function in a Notch-independent manner. Recently, two novel classes of CSL proteins, designated F1 and F2, have been identified in fungi. The role of the fungal CSL proteins is unclear, because the Notch pathway is not present in fungi. In fission yeast, the Cbf11 and Cbf12 CSL paralogs play antagonistic roles in cell adhesion and the coordination of cell and nuclear division. Unusually long N-terminal extensions are typical for fungal and invertebrate CSL family members. In this study, we investigate the functional significance of these extended N-termini of CSL proteins.We identify 15 novel CSL family members from 7 fungal species and conduct bioinformatic analyses of a combined dataset containing 34 fungal and 11 metazoan CSL protein sequences. We show that the long, non-conserved N-terminal tails of fungal CSL proteins are likely disordered and enriched in phosphorylation sites and PEST motifs. In a case study of Cbf12 (class F2, we provide experimental evidence that the protein is proteolytically processed and that the N-terminus inhibits the Cbf12-dependent DNA binding activity in an electrophoretic mobility shift assay.This study provides insight into the characteristics of the long N-terminal tails of fungal CSL proteins that may be crucial for controlling DNA-binding and CSL function. We propose that the regulation of DNA binding by Cbf12 via its N-terminal region represents an important means by which fission yeast strikes a balance between the class F1 and class F2 paralog activities. This mode of regulation might be shared with other CSL-positive fungi, some of which are relevant to human disease and biotechnology.
Cell cycle-dependent mobility of Cdc45 determined in vivo by fluorescence correlation spectroscopy.
Directory of Open Access Journals (Sweden)
Ronan Broderick
Full Text Available Eukaryotic DNA replication is a dynamic process requiring the co-operation of specific replication proteins. We measured the mobility of eGFP-Cdc45 by Fluorescence Correlation Spectroscopy (FCS in vivo in asynchronous cells and in cells synchronized at the G1/S transition and during S phase. Our data show that eGFP-Cdc45 mobility is faster in G1/S transition compared to S phase suggesting that Cdc45 is part of larger protein complex formed in S phase. Furthermore, the size of complexes containing Cdc45 was estimated in asynchronous, G1/S and S phase-synchronized cells using gel filtration chromatography; these findings complemented the in vivo FCS data. Analysis of the mobility of eGFP-Cdc45 and the size of complexes containing Cdc45 and eGFP-Cdc45 after UVC-mediated DNA damage revealed no significant changes in diffusion rates and complex sizes using FCS and gel filtration chromatography analyses. This suggests that after UV-damage, Cdc45 is still present in a large multi-protein complex and that its mobility within living cells is consistently similar following UVC-mediated DNA damage.
Directory of Open Access Journals (Sweden)
Tokmakova Irina L
2007-11-01
Full Text Available Abstract Background RSF1010 is a well-studied broad-host-range plasmid able to be mobilized to different bacteria and plants. RSF1010-derived plasmid vectors are widely used in both basic research and industrial applications. In the latter case, exploiting of mobilizable plasmids or even the plasmids possessing negligible mobilization frequency, but containing DNA fragments that could promote conjugal transfer, is undesirable because of biosafety considerations. Previously, several mutations significantly decreasing efficiency of RSF1010 mobilization have been selected. Nevertheless, construction of the RSF1010 derivative lacking all known loci involved in the conjugal transfer has not been reported yet. Results Novel non-mobilizable derivatives of RSF1010 lacking all known DNA sequences involved in the mobilization process have been obtained due to the exploiting of λRed-driven recombination between the plasmid and a constructed in vitro linear DNA fragment. To provide auto-regulated transcription of the essential replication gene, repB, the plasmid loci oriT, mobC and mobA were substituted by the DNA fragment containing PlacUV5→lacI. Mobilization of the obtained RSFmob plasmid was not detected in standard tests. The derivative of RSFmob with increased copy number has been obtained after lacI elimination. High stability of both constructed plasmids has been demonstrated in Escherichia coli and Pantoea ananatis. Design of RSFmob allows easy substitution of PlacUV5 by any desirable promoter for construction of novel derivatives with changed copy number or host range. Conclusion Novel non-mobilizable derivatives of RSF1010 lacking all known DNA sequences involved in the mobilization process and stably maintained at least in E. coli and P. ananatis have been constructed. The obtained plasmids became the progenitors of new cloning vectors answering all biosafety requirements of genetically modified organisms used in scale-up production.
Institute of Scientific and Technical Information of China (English)
Chuandong Zheng; Xi Gu; Zhimei Zhong; Rui Zhu; Tianming Gao; Fang Wang
2012-01-01
In this study, we employed chromatin immunoprecipitation, a useful method for studying the locations of transcription factors bound to specific DNA regions in specific cells, to investigate amyloid precursor protein intracellular domain binding sites in chromatin DNA from hippocampal neurons of rats, and to screen out five putative genes associated with the learning and memory functions. The promoter regions of the calcium/calmodulin-dependent protein kinase II alpha and glutamate receptor-2 genes were amplified by PCR from DNA products immunoprecipitated by amyloid precursor protein intracellular domain. An electrophoretic mobility shift assay and western blot analysis suggested that the promoter regions of these two genes associated with learning and memory were bound by amyloid precursor protein intracellular domain (in complex form). Our experimental findings indicate that the amyloid precursor protein intracellular domain is involved in the transcriptional regulation of learning- and memory-associated genes in hippocampal neurons. These data may provide new insights into the molecular mechanism underlying the symptoms of progressive memory loss in Alzheimer's disease.
Continuous electrophoretic purification of individual analytes from multicomponent mixtures.
McLaren, David G; Chen, David D Y
2004-04-15
Individual analytes can be isolated from multicomponent mixtures and collected in the outlet vial by carrying out electrophoretic purification through a capillary column. Desired analytes are allowed to migrate continuously through the column under the electric field while undesired analytes are confined to the inlet vial by application of a hydrodynamic counter pressure. Using pressure ramping and buffer replenishment techniques, 18% of the total amount present in a bulk sample can be purified when the resolution to the adjacent peak is approximately 3. With a higher resolution, the yield could be further improved. Additionally, by periodically introducing fresh buffer into the sample, changes in pH and conductivity can be mediated, allowing higher purity (>or=99.5%) to be preserved in the collected fractions. With an additional reversed cycle of flow counterbalanced capillary electrophoresis, any individual component in a sample mixture can be purified providing it can be separated in an electrophoresis system.
On the Adsorption of DNA Origami Nanostructures in Nanohole Arrays.
Brassat, Katharina; Ramakrishnan, Saminathan; Bürger, Julius; Hanke, Marcel; Doostdar, Mahnaz; Lindner, Jörg K N; Grundmeier, Guido; Keller, Adrian
2018-05-22
DNA origami nanostructures are versatile substrates for the controlled arrangement of molecular capture sites with nanometer precision and thus have many promising applications in single-molecule bioanalysis. Here, we investigate the adsorption of DNA origami nanostructures in nanohole arrays which represent an important class of biosensors and may benefit from the incorporation of DNA origami-based molecular probes. Nanoholes with well-defined diameter that enable the adsorption of single DNA origami triangles are fabricated in Au films on Si wafers by nanosphere lithography. The efficiency of directed DNA origami adsorption on the exposed SiO 2 areas at the bottoms of the nanoholes is evaluated in dependence of various parameters, i.e., Mg 2+ and DNA origami concentrations, buffer strength, adsorption time, and nanohole diameter. We observe that the buffer strength has a surprisingly strong effect on DNA origami adsorption in the nanoholes and that multiple DNA origami triangles with 120 nm edge length can adsorb in nanoholes as small as 120 nm in diameter. We attribute the latter observation to the low lateral mobility of once adsorbed DNA origami on the SiO 2 surface, in combination with parasitic adsorption to the Au film. Although parasitic adsorption can be suppressed by modifying the Au film with a hydrophobic self-assembled monolayer, the limited surface mobility of the adsorbed DNA origami still leads to poor localization accuracy in the nanoholes and results in many DNA origami crossing the boundary to the Au film even under optimized conditions. We discuss possible ways to minimize this effect by varying the composition of the adsorption buffer, employing different fabrication conditions, or using other substrate materials for nanohole array fabrication.
Directory of Open Access Journals (Sweden)
Indraneel Mittra
2015-09-01
Full Text Available Mobile genetic elements play a major role in shaping biotic genomes and bringing about evolutionary transformations. Herein, a new class of mobile genetic elements is proposed in the form of circulating nucleic acids (CNAs derived from the billions of cells that die in the body every day due to normal physiology and that act intra-corporeally. A recent study shows that CNAs can freely enter into healthy cells, integrate into their genomes by a unique mechanism and cause damage to their DNA. Being ubiquitous and continuously arising, CNA-induced DNA damage may be the underlying cause of ageing, ageing-related disabilities and the ultimate demise of the organism. Thus, DNA seems to act in the paradoxical roles of both preserver and destroyer of life. This new class of mobile genetic element may be relevant not only to multi-cellular organisms with established circulatory systems, but also to other multi-cellular organisms in which intra-corporeal mobility of nucleic acids may be mediated via the medium of extra-cellular fluid.
International Nuclear Information System (INIS)
Maskin, Laura; Frankel, Nicolas; Gudesblat, Gustavo; Demergasso, Maria J.; Pietrasanta, Lia I.; Iusem, Norberto D.
2007-01-01
The Asr gene family is present in Spermatophyta. Its members are generally activated under water stress. We present evidence that tomato ASR1, one of the proteins of the family, accumulates in seed during late stages of embryogenesis, a physiological process characterized by water loss. In vitro, electrophoretic assays show a homo-dimeric structure for ASR1 and highlight strong non-covalent interactions between monomers prone to self-assemble. Direct visualization of single molecules by atomic force microscopy (AFM) confirms that ASR1 forms homodimers and that uncovers both monomers and dimers bind double stranded DNA
Rosner, A; Maslenin, L; Spiegel, S
1998-09-01
A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.
Fluid Delivery System For Capillary Electrophoretic Applications.
Li, Qingbo; Liu, Changsheng; Kane, Thomas E.; Kernan, John R.; Sonnenschein, Bernard; Sharer, Michael V.
2002-04-23
An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carrousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.
Energy Technology Data Exchange (ETDEWEB)
Benko, Aleksandra, E-mail: akbenko@gmail.com [AGH University of Science and Technology, Faculty of Materials Science and Ceramics, A. Mickiewicza 30 Ave., 30-059, Krakow (Poland); Nocuń, Marek [AGH University of Science and Technology, Faculty of Materials Science and Ceramics, A. Mickiewicza 30 Ave., 30-059, Krakow (Poland); Berent, Katarzyna; Gajewska, Marta [AGH University of Science and Technology, Academic Centre for Materials and Nanotechnology, A. Mickiewicza 30 Ave, 30-059, Krakow (Poland); Klita, Łukasz; Wyrwa, Jan; Błażewicz, Marta [AGH University of Science and Technology, Faculty of Materials Science and Ceramics, A. Mickiewicza 30 Ave., 30-059, Krakow (Poland)
2017-05-01
Highlights: • Different properties of the EPD-deposited CNTs layers may be altered by changing the applied solvent. • More conductive solvents guarantee higher values of the recorded current densities, increasing kinetics of the deposition and yielding layers of higher thicknesses. • In a less conductive, organic medium, mobility of the particles is reduced, allowing for optimal packing and densification of the CNTs layer. • Proper solvent selection in the EPD of CNTs may lead to obtainment of CNTs—substrate materials with conductivity that is superior to an unmodified substrate. - Abstract: Coating the material of choice with a layer of well-adhered carbon nanotubes is a subject of interest in many fields of materials science and industry. Electrophoretic deposition is one of the methods to handle this challenging task. In this process, careful designing of the deposition parameters is crucial in obtaining the product of strictly desired properties. This study was aimed to identify the influence of the diluent on the physicochemical ad electrochemical qualities of the final product. By analyzing the properties of the suspensions being used, we were able to hypothesize on the mechanisms of carbon nanotubes—liquid interactions and their outcome on the thickness, homogeneity, chemical and structural composition and electrical conductivity of the metal substrate covered with a layer of carbon nanotubes. We obtained a materials, composed of metal and a layer of CNTs, with conductivity that is superior to an unmodified metal. This types of materials may find numerous applications in fabrication of novel electronic devices, including the implantable electrodes for biomedicine—as reported in our previous studies, these types of coating are biocompatible.
Kiers, PJM; van der Mei, HC; Busscher, HJ; Bos, R.R.M.
Many Staphylococcus epidermidis strains possess capsule or slime layers and consequently the staphylococcal cell surface should be regarded as a soft, polyelectrolyte layer allowing electrophoretic fluid flow through a layer of fixed charges. The presence of such a soft layer decreases the energy
Directory of Open Access Journals (Sweden)
M.A. Bosse
2001-03-01
Full Text Available The problem of the effect of Joule heating generation on the hydrodynamic profile and the solute transport found in electrophoretic devices is addressed in this article. The research is focused on the following two problems: The first one is centered around the effect of Joule heating on the hydrodynamic velocity profile and it is referred to as "the carrier fluid problem." The other one is related to the effect of Joule heating on the solute transport inside electrophoretic cells and it is referred to as "the solute problem". The hydrodynamic aspects were studied first to yield the velocity profiles required for analysis of the solute transport problem. The velocity profile obtained in this study is analytical and the results are valid for non-Newtonian fluids carriers. To this end, the power-law model was used to study the effect of the rheology of the material in conjunction with the effect of Joule heating generation inside batch electrophoretic devices. This aspect of the research was then effectively used to study the effect of Joule heating generation on the motion of solutes (such as macromolecules under the influence of non-Newtonian carriers. This aspect of the study was performed using an area-averaging approach that yielded analytical results for the effective diffusivity of the device.
Determining the authenticity of athlete urine in doping control by DNA analysis.
Devesse, Laurence; Syndercombe Court, Denise; Cowan, David
2015-10-01
The integrity of urine samples collected from athletes for doping control is essential. The authenticity of samples may be contested, leading to the need for a robust sample identification method. DNA typing using short tandem repeats (STR) can be used for identification purposes, but its application to cellular DNA in urine has so far been limited. Here, a reliable and accurate method is reported for the successful identification of urine samples, using reduced final extraction volumes and the STR multiplex kit, Promega® PowerPlex ESI 17, with capillary electrophoretic characterisation of the alleles. Full DNA profiles were obtained for all samples (n = 20) stored for less than 2 days at 4 °C. The effect of different storage conditions on yield of cellular DNA and probability of obtaining a full profile were also investigated. Storage for 21 days at 4 °C resulted in allelic drop-out in some samples, but the random match probabilities obtained demonstrate the high power of discrimination achieved through targeting a large number of STRs. The best solution for long-term storage was centrifugation and removal of supernatant prior to freezing at -20 °C. The method is robust enough for incorporation into current anti-doping protocols, and was successfully applied to 44 athlete samples for anti-doping testing with 100% concordant typing. Copyright © 2015 John Wiley & Sons, Ltd.
Time-dependent electrophoresis of a dielectric spherical particle embedded in Brinkman medium
Saad, E. I.; Faltas, M. S.
2018-04-01
An expression for electrophoretic apparent velocity slip in the time-dependent flow of an electrolyte solution saturated in a charged porous medium within an electric double layer adjacent to a dielectric plate under the influence of a tangential uniform electric field is derived. The velocity slip is used as a boundary condition to solve the electrophoretic motion of an impermeable dielectric spherical particle embedded in an electrolyte solution saturated in porous medium under the unsteady Darcy-Brinkman model. Throughout the system, a uniform electric field is applied and maintains with constant strength. Two cases are considered, when the electric double layer enclosing the particle is thin, but finite and when of a particle with a thick double layer. Expressions for the electrophoretic mobility of the particle as functions of the relevant parameters are found. Our results indicate that the time scale for the growth of mobility is significant and small for high permeability. Generally, the effect of the relaxation time for starting electrophoresis is negligible, irrespective of the thickness of the double layer and permeability of the medium. The effects of the elapsed time, permeability, mass density and Debye length parameters on the fluid velocity, the electrophoretic mobility and the acceleration are shown graphically.
Restricted mobility of Dnmt1 in preimplantation embryos: implications for epigenetic reprogramming
Grohmann, Maik; Spada, Fabio; Schermelleh, Lothar; Alenina, Natalia; Bader, Michael; Cardoso, M Cristina; Leonhardt, Heinrich
2005-01-01
Background Mouse preimplantation development is characterized by both active and passive genomic demethylation. A short isoform of the prevalent maintenance DNA methyltransferase (Dnmt1S) is found in the cytoplasm of preimplantation embryos and transiently enters the nucleus only at the 8-cell stage. Results Using GFP fusions we show that both the long and short isoforms of Dnmt1 localize to the nucleus of somatic cells and the cytoplasm of preimplantation embryos and that these subcellular localization properties are independent of phosphorylation. Importantly, photobleaching techniques and salt extraction revealed that Dnmt1S has a very restricted mobility in the cytoplasm, while it is highly mobile in the nucleus of preimplantation embryos. Conclusion The restricted mobility of Dnmt1S limits its access to DNA and likely contributes to passive demethylation and epigenetic reprogramming during preimplantationdevelopment. PMID:16120212
Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.
Foley, Joe P; Blackney, Donna M; Ennis, Erin J
2017-11-10
The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum
Directory of Open Access Journals (Sweden)
Simeng Zhang
2018-04-01
Full Text Available In order to obtain superior electrode performances in capacitive deionization (CDI, the electrophoretic deposition (EPD was introduced as a novel strategy for the fabrication of carbon nanotube (CNT electrode. Preparation parameters, including the concentration of slurry components, deposition time and electric field intensity, were mainly investigated and optimized in terms of electrochemical characteristic and desalination performance of the deposited CNT electrode. The SEM image shows that the CNT material was deposited homogeneously on the current collector and a non-crack surface of the electrode was obtained. An optimal preparation condition of the deposited CNT electrode was obtained and specified as the Al (NO33 M concentration of 1.3 × 10−2 mol/L, the deposition time of 30 min and the electric field intensity of 15 V/cm. The obtained electrode performs an increasing specific mass capacitance of 33.36 F/g and specific adsorption capacity of 23.93 mg/g, which are 1.62 and 1.85 times those of the coated electrode respectively. The good performance of the deposited CNT electrode indicates the promising application of the EPD methodology in subsequent research and fabrication of the CDI electrodes for CDI process. Keywords: Carbon nanotube, Water treatment, Desalination, Capacitive deionization, Electrode fabrication, Electrophoretic deposition
International Nuclear Information System (INIS)
Darari, Alfin; Rismaningsih, Nurmanita; Ardiansah, Hafidh Rahman; Arifin,; Ningrum, Andini Novia; Subagio, Agus
2016-01-01
Energy crisis that occured in Indonesia suggests that energy supply could not offset the high rate request and needs an electric energy saving device which can save high voltage, safety, and unlimited lifetime. The weakness of batteries is durable but has a low power density while the capacitor has a high power density but it doesn’t durable. The renewal of this study is CNT-MnO_2 thin film fabrication method using electrophoretic deposition. Electrophoretic deposition is a newest method to deposited CNT using power supply with cheap, and make a good result. The result of FTIR analysis showed that the best CNT-MnO_2 composition is 75:25 and C-C bond is detected in fingerprint area. The result is electrode thin film homogen and characterized by X-ray diffraction (XRD) peaks 2θ=26,63° is characterization of graphite, and 2θ=43,97° is characterization of diamond Carbon type and measured by Scherrer formula results 52,3 nm material average size .EIS test results its capacitance about 7,86 F. from the data it can be concluded that CNT-MnO_2 potential electrode very promising for further study and has a potential to be a high capacitance, and fast charge supercapacitor which can be applied for electronic devices, energy converter, even electric car.
Bifunctional rhodium intercalator conjugates as mismatch-directing DNA alkylating agents.
Schatzschneider, Ulrich; Barton, Jacqueline K
2004-07-21
A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covalent modification was established on the basis of the enhanced depurination associated with N-alkylation. The site-selective alkylation at mismatched DNA renders these conjugates useful tools for the covalent tagging of DNA base pair mismatches and new chemotherapeutic design.
Motion of Knots in DNA Stretched by Elongational Fields
Klotz, Alexander R.; Soh, Beatrice W.; Doyle, Patrick S.
2018-05-01
Knots in DNA occur in biological systems, serve as a model system for polymer entanglement, and affect the efficacy of modern genomics technologies. We study the motion of complex knots in DNA by stretching molecules with a divergent electric field that provides an elongational force. We demonstrate that the motion of knots is nonisotropic and driven towards the closest end of the molecule. We show for the first time experimentally that knots can go from a mobile to a jammed state by varying an applied strain rate, and that this jamming is reversible. We measure the mobility of knots as a function of strain rate, demonstrating the conditions under which knots can be driven towards the ends of the molecule and untied.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-01-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...
Ancient mtDNA genetic variants modulate mtDNA transcription and replication.
Directory of Open Access Journals (Sweden)
Sarit Suissa
2009-05-01
Full Text Available Although the functional consequences of mitochondrial DNA (mtDNA genetic backgrounds (haplotypes, haplogroups have been demonstrated by both disease association studies and cell culture experiments, it is not clear which of the mutations within the haplogroup carry functional implications and which are "evolutionary silent hitchhikers". We set forth to study the functionality of haplogroup-defining mutations within the mtDNA transcription/replication regulatory region by in vitro transcription, hypothesizing that haplogroup-defining mutations occurring within regulatory motifs of mtDNA could affect these processes. We thus screened >2500 complete human mtDNAs representing all major populations worldwide for natural variation in experimentally established protein binding sites and regulatory regions comprising a total of 241 bp in each mtDNA. Our screen revealed 77/241 sites showing point mutations that could be divided into non-fixed (57/77, 74% and haplogroup/sub-haplogroup-defining changes (i.e., population fixed changes, 20/77, 26%. The variant defining Caucasian haplogroup J (C295T increased the binding of TFAM (Electro Mobility Shift Assay and the capacity of in vitro L-strand transcription, especially of a shorter transcript that maps immediately upstream of conserved sequence block 1 (CSB1, a region associated with RNA priming of mtDNA replication. Consistent with this finding, cybrids (i.e., cells sharing the same nuclear genetic background but differing in their mtDNA backgrounds harboring haplogroup J mtDNA had a >2 fold increase in mtDNA copy number, as compared to cybrids containing haplogroup H, with no apparent differences in steady state levels of mtDNA-encoded transcripts. Hence, a haplogroup J regulatory region mutation affects mtDNA replication or stability, which may partially account for the phenotypic impact of this haplogroup. Our analysis thus demonstrates, for the first time, the functional impact of particular mtDNA
Advanced purification strategy for CueR, a cysteine containing copper(I) and DNA binding protein
DEFF Research Database (Denmark)
Balogh, Ria K.; Gyurcsik, Béla; Hunyadi-Gulyás, Éva
2016-01-01
. A detailed understanding of their function may be exploited in potential health, environmental and analytical applications. Members of the MerR protein family sense a broad range of mostly late transition and heavy metal ions through their cysteine thiolates. The air sensitivity of latter groups makes...... the expression and purification of such proteins challenging. Here we describe a method for the purification of the copper-regulatory CueR protein under optimized conditions. In order to avoid protein precipitation and/or eventual aggregation and to get rid of the co-purifying Escherichia coli elongation factor...... any affinity tag. Structure and functionality tests performed with mass spectrometry, circular dichroism spectroscopy and electrophoretic gel mobility shift assays approved the success of the purification procedure....
Hierarchical transport of nanoparticles in a lyotropic lamellar phase
International Nuclear Information System (INIS)
Kimura, Yasuyuki; Mori, Teppei; Yamamoto, Akira; Mizuno, Daisuke
2005-01-01
The dynamics of nanosized colloidal particles dispersed in a hyper-swollen lyotropic lamellar phase of a nonionic surfactant has been studied by ac electrophoretic light scattering and direct tracking of particles under a microscope. The frequency spectrum of electrophoretic mobility shows two relaxation processes. These are originated from the hindrance of free diffusion of particles by the interaction between membranes and particles. By direct tracking measurement, we find that particles jump from site to site where they stay for a long time. This trap-jump process greatly decreases the mobility at low frequencies
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
International Nuclear Information System (INIS)
Atanassov, A.; Todorovska, E.; Trifonova, A.; Petrova, M.; Marinova, E.; Gramatikova, M.; Valcheva, D.; Zaprianov, S.; Mersinkov, N.
1998-01-01
Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-02-10
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-01-01
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-05-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 °C without any “coffee stain”. The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192×150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44±0.08 cm2·V-1·s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 °C in this case) during drying of the droplets.
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-01-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 degrees C without any "coffee stain". The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192 x 150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44 +/- 0.08 cm2.V-1.s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 degrees C in this case) during drying of the droplets.
Czech Academy of Sciences Publication Activity Database
Černohorský, Ondřej; Grym, Jan; Yatskiv, Roman; Pham, V. H.; Dickerson, J.H.
2016-01-01
Roč. 8, č. 30 (2016), s. 19680-19690 ISSN 1944-8244 R&D Projects: GA ČR GA15-17044S; GA MŠk(CZ) LD14111 Institutional support: RVO:67985882 Keywords : AOT reverse micelles * 3D growth * electrophoretic deposition Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 7.504, year: 2016
Maccari, Francesca; Volpi, Nicola
2002-09-01
We describe a method for blotting and immobilizing several nonsulfated and sulfated complex polysaccharides on membranes made hydrophilic and positively charged by a cationic detergent after their separation by conventional agarose gel electrophoresis. Nitrocellulose membranes were derivatized with the cationic detergent cetylpyridinium chloride (CPC) and mixtures of glycosaminoglycans (GAGs) were capillary-blotted after their separation in agarose gel electrophoresis in barium acetate/1,2-diaminopropane. Single purified species of variously sulfated polysaccharides were transferred onto the derivatized membranes after electrophoresis with an efficiency of 100% and stained with alcian blue (irreversible staining) and toluidine blue (reversible staining) permitting about 0.1 nug threshold of detection. Nonsulfated polyanions, hyaluronic acid, a fructose-containing polysaccharide with a chondroitin backbone purified from Escherichia coli U1-41, and its defructosylated product, were also electrophoretically separated and transferred onto membranes. The limit of detection for desulfated GAGs was about 0.1-0.5 nug after irreversible or reversible staining. GAG extracts from bovine, lung and aorta, and human aorta and urine were separated by agarose gel electrophoresis and blotted on CPC-treated nitrocellulose membranes. The polysaccharide composition of these extracts was determined. The membrane stained with toluidine blue (reversible staining) was destained and the same lanes used for immunological detection or other applications. Reversible staining was also applied to recover single species of polysaccharides after electrophoretic separation of mixtures of GAGs and their transfer onto membranes. Single bands were released from the membrane with an efficiency of 70-100% for further biochemical characterization.
cGAS senses long and HMGB/TFAM-bound U-turn DNA by forming protein-DNA ladders.
Andreeva, Liudmila; Hiller, Björn; Kostrewa, Dirk; Lässig, Charlotte; de Oliveira Mann, Carina C; Jan Drexler, David; Maiser, Andreas; Gaidt, Moritz; Leonhardt, Heinrich; Hornung, Veit; Hopfner, Karl-Peter
2017-09-21
Cytosolic DNA arising from intracellular pathogens triggers a powerful innate immune response. It is sensed by cyclic GMP-AMP synthase (cGAS), which elicits the production of type I interferons by generating the second messenger 2'3'-cyclic-GMP-AMP (cGAMP). Endogenous nuclear or mitochondrial DNA can also be sensed by cGAS under certain conditions, resulting in sterile inflammation. The cGAS dimer binds two DNA ligands shorter than 20 base pairs side-by-side, but 20-base-pair DNA fails to activate cGAS in vivo and is a poor activator in vitro. Here we show that cGAS is activated in a strongly DNA length-dependent manner both in vitro and in human cells. We also show that cGAS dimers form ladder-like networks with DNA, leading to cooperative sensing of DNA length: assembly of the pioneering cGAS dimer between two DNA molecules is ineffective; but, once formed, it prearranges the flanking DNA to promote binding of subsequent cGAS dimers. Remarkably, bacterial and mitochondrial nucleoid proteins HU and mitochondrial transcription factor A (TFAM), as well as high-mobility group box 1 protein (HMGB1), can strongly stimulate long DNA sensing by cGAS. U-turns and bends in DNA induced by these proteins pre-structure DNA to nucleate cGAS dimers. Our results suggest a nucleation-cooperativity-based mechanism for sensitive detection of mitochondrial DNA and pathogen genomes, and identify HMGB/TFAM proteins as DNA-structuring host factors. They provide an explanation for the peculiar cGAS dimer structure and suggest that cGAS preferentially binds incomplete nucleoid-like structures or bent DNA.
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.
1990-01-01
A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map
Solid-to-fluid DNA transition inside HSV-1 capsid close to the temperature of infection
Energy Technology Data Exchange (ETDEWEB)
Sae-Ueng, Udom; Li, Dong; Zuo, Xiaobing; Huffman, Jamie B.; Homa, Fred L.; Rau, Donald; Evilevitch, Alex
2014-10-01
DNA in the human Herpes simplex virus type 1 (HSV-1) capsid is packaged to a tight density. This leads to tens of atmospheres of internal pressure responsible for the delivery of the herpes genome into the cell nucleus. In this study we show that, despite its liquid crystalline state inside the capsid, the DNA is fluid-like, which facilitates its ejection into the cell nucleus during infection. We found that the sliding friction between closely packaged DNA strands, caused by interstrand repulsive interactions, is reduced by the ionic environment of epithelial cells and neurons susceptible to herpes infection. However, variations in the ionic conditions corresponding to neuronal activity can restrict DNA mobility in the capsid, making it more solid-like. This can inhibit intranuclear DNA release and interfere with viral replication. In addition, the temperature of the human host (37 °C) induces a disordering transition of the encapsidated herpes genome, which reduces interstrand interactions and provides genome mobility required for infection.
Gill, Pooria; Ranjbar, Bijan; Saber, Reza; Khajeh, Khosro; Mohammadian, Mehdi
2011-07-01
Cauliflower-like DNAs are stem-loop DNAs that are fabricated periodically in inverted repetitions from deoxyribonucleic acid phosphates (dNTPs) by loop-mediated isothermal amplification (LAMP). Cauliflower-like DNAs have ladder-shape behaviors on gel electrophoresis, and increasing the time of LAMP leads to multiplying the repetitions, stem-loops, and electrophoretic bands. Cauliflower-like DNAs were fabricated via LAMP using two loop primers, two bumper primers, dNTPs, a λ-phage DNA template, and a Bst DNA polymerase in 75- and 90-min periods. These times led to manufacturing two types of cauliflower-like DNAs with different contents of inverted repetitions and stem-loops, which were clearly indicated by two comparable electrophoresis patterns in agarose gel. LAMP-fabricated DNAs and natural dsB-DNA (salmon genomic DNA) were dialyzed in Gomori phosphate buffer (10 mM, pH 7.4) to be isolated from salts, nucleotides, and primers. Dialyzed DNAs were studied using UV spectroscopy, circular dichroism spectropolarimetry, and fluorescence spectrophotometry. Structural analyses indicated reduction of the molecular ellipticity and extinction coefficients in comparison with B-DNA. Also, cauliflower-like DNAs demonstrated less intrinsic and more extrinsic fluorescence in comparison with natural DNA. The overwinding and lengthening of the cauliflower-like configurations of LAMP DNAs led to changes in physical parameters of this type of DNA in comparison with natural DNA. The results obtained introduced new biomolecular characteristics of DNA macromolecules fabricated within a LAMP process and show the effects of more inverted repeats and stem-loops, which are manufactured by lengthening the process.
Energy Technology Data Exchange (ETDEWEB)
Cordero-Arias, L.; Cabanas-Polo, S.; Goudouri, O.M. [Institute of Biomaterials, Department of Materials Science and Engineering, University of Erlangen-Nuremberg, Cauerstrasse 6, D-91058 Erlangen (Germany); Misra, S.K. [Materials Science and Engineering, Indian Institute of Technology Gandhinagar, Ahmedabad 382424 (India); Gilabert, J. [Institute of Ceramics Materials (ITC), University Jaume I, Avenida Vicent SosBaynat, 12006 Castellon (Spain); Valsami-Jones, E. [School of Geography, Earth and Environmental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Sanchez, E. [Institute of Ceramics Materials (ITC), University Jaume I, Avenida Vicent SosBaynat, 12006 Castellon (Spain); Virtanen, S. [Institute for Surface Science and Corrosion (LKO, WW4), Department of Materials Science and Engineering, University of Erlangen-Nuremberg, Martensstrasse 7, D-91058 Erlangen (Germany); Boccaccini, A.R., E-mail: aldo.boccaccini@ww.uni-erlangen.de [Institute of Biomaterials, Department of Materials Science and Engineering, University of Erlangen-Nuremberg, Cauerstrasse 6, D-91058 Erlangen (Germany)
2015-10-01
Two organic/inorganic composite coatings based on alginate, as organic matrix, and zinc oxide nanoparticles (n-ZnO) with and without bioactive glass (BG), as inorganic components, intended for biomedical applications, were developed by electrophoretic deposition (EPD). Different n-ZnO (1–10 g/L) and BG (1–1.5 g/L) contents were studied for a fixed alginate concentration (2 g/L). The presence of n-ZnO was confirmed to impart antibacterial properties to the coatings against gram-negative bacteria Escherichia coli, while the BG induced the formation of hydroxyapatite on coating surfaces thereby imparting bioactivity, making the coating suitable for bone replacement applications. Coating composition was analyzed by thermogravimetric analysis (TG), Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD) and energy dispersive X-ray spectroscopy (EDS) analyses. Scanning electron microscopy (SEM) was employed to study both the surface and the cross section morphology of the coatings. Polarization curves of the coated substrates made in cell culture media at 37 °C confirmed the corrosion protection function of the novel organic/inorganic composite coatings. - Highlights: • Organic–inorganic nanocomposite coatings fabricated by electrophoretic deposition • nZnO and bioactive glass containing alginate coatings exhibit antibacterial effect. • Bioactive character and anticorrosion function of coatings demonstrated.
Energy Technology Data Exchange (ETDEWEB)
Darari, Alfin, E-mail: alfindarari@st.fisika.undip.ac.id [Physics Department, Science and Mathematics Faculty, Diponegoro University (Indonesia); Rismaningsih, Nurmanita [Chemistry Department, Science and Mathematics Faculty, Diponegoro University (Indonesia); Ardiansah, Hafidh Rahman; Arifin,; Ningrum, Andini Novia; Subagio, Agus, E-mail: agus-fadhil@yahoo.com
2016-04-19
Energy crisis that occured in Indonesia suggests that energy supply could not offset the high rate request and needs an electric energy saving device which can save high voltage, safety, and unlimited lifetime. The weakness of batteries is durable but has a low power density while the capacitor has a high power density but it doesn’t durable. The renewal of this study is CNT-MnO{sub 2} thin film fabrication method using electrophoretic deposition. Electrophoretic deposition is a newest method to deposited CNT using power supply with cheap, and make a good result. The result of FTIR analysis showed that the best CNT-MnO{sub 2} composition is 75:25 and C-C bond is detected in fingerprint area. The result is electrode thin film homogen and characterized by X-ray diffraction (XRD) peaks 2θ=26,63° is characterization of graphite, and 2θ=43,97° is characterization of diamond Carbon type and measured by Scherrer formula results 52,3 nm material average size .EIS test results its capacitance about 7,86 F. from the data it can be concluded that CNT-MnO{sub 2} potential electrode very promising for further study and has a potential to be a high capacitance, and fast charge supercapacitor which can be applied for electronic devices, energy converter, even electric car.
NMR assignments for the amino-terminal residues of trp repressor and their role in DNA binding
International Nuclear Information System (INIS)
Arrowsmith, C.H.; Carey, J.; Treat-Clemons, L.; Jardetzky, O.
1989-01-01
The trp repressor of Escherichia coli specifically binds to operator DNAs in three operons involved in tryptophan metabolism. The NMR spectra of repressor and a chymotryptic fragment lacking the six amino-terminal residues are compared. Two-dimensional J-correlated spectra of the two forms of the protein are superimposable except for cross-peaks that are associated with the N-terminal region. The chemical shifts and relaxation behavior of the N-terminal resonances suggest mobile arms. Spin-echo experiments on a ternary complex of repressor with L-tryptophan and operator DNA indicate that the termini are also disordered in the complex, although removal of the arms reduces the DNA binding energy. Relaxation measurements on the armless protein show increased mobility for several residues, probably due to helix fraying in the newly exposed N-terminal region. DNA binding by the armless protein does not reduce the mobility of these residues. Thus, it appears that the arms serve to stabilize the N-terminal helix but that this structural role does not explain their contribution to the DNA binding energy. These results suggest that the promiscuous DNA binding by the arms seen in the X-ray crystal structure is found in solution as well
Electrophoretic Deposition of Hydroxyapatite Film Containing Re-Doped MoS₂ Nanoparticles.
Shalom, Hila; Feldman, Yishay; Rosentsveig, Rita; Pinkas, Iddo; Kaplan-Ashiri, Ifat; Moshkovich, Alexey; Perfilyev, Vladislav; Rapoport, Lev; Tenne, Reshef
2018-02-26
Films combining hydroxyapatite (HA) with minute amounts (ca. 1 weight %) of (rhenium doped) fullerene-like MoS₂ (IF) nanoparticles were deposited onto porous titanium substrate through electrophoretic process (EPD). The films were analyzed by scanning electron microscopy (SEM), X-ray diffraction and Raman spectroscopy. The SEM analysis showed relatively uniform coatings of the HA + IF on the titanium substrate. Chemical composition analysis using energy dispersive X-ray spectroscopy (EDS) of the coatings revealed the presence of calcium phosphate minerals like hydroxyapatite, as a majority phase. Tribological tests were undertaken showing that the IF nanoparticles endow the HA film very low friction and wear characteristics. Such films could be of interest for various medical technologies. Means for improving the adhesion of the film to the underlying substrate and its fracture toughness, without compromising its biocompatibility are discussed at the end.
Trubetskoj, Oleg A; Richard, Claire; Guyot, Ghislain; Voyard, Guillaume; Trubetskaya, Olga E
2012-06-22
A combination of reversed-phase high performance liquid chromatography (RP HPLC) with on-line absorbance and fluorescence detection was used for analysis of chernozem soil humic acids (HAs) and their fractions A, B and C+D with different electrophoretic mobility (EM) and molecular size (MS). Samples were injected onto the column at the identical volume and absorbance. All chromatograms exhibit the resolution of seven peaks. The estimation of relative recovery of HAs and fractions from the reverse-phase column has been done. High MS fraction A, which possesses the low EM, is essentially more hydrophobic (73% of the fraction amount remained adsorbed on the column) and aliphatic than medium MS and EM fraction B (33% of the fraction amount remained adsorbed on the column). The most hydrophilic and aromatic properties belong to low MS fraction C+D, which possess the highest EM and practically was not adsorbed on the column. The hydrophobicity of the bulk HAs lies within the range of fractions hydrophobicity. The absorption spectra of bulk HAs, electrophoretic fractions A, B, C+D and corresponding RP HPLC peaks were featureless but had differences in the values of absorbance ratio at 300 and 400 nm (A3/A4). For fractions A and B this ratio gradually decreased from peak 1 to 7 (from 3.05 to 2.80 and 3.00 to 2.40, respectively). This trend was less pronounced in HAs and practically absent in fraction C+D, where ratio A3/A4 varied within a small range. The strong relationship between fluorescence properties, EM, MS, polarity and aliphaticity/aromaticity of HAs fractions was found. Humic and protein-like fluorescence had different polarity nature. The protein-like fluorescence is located in humic material which irreversibly adsorbed on the reverse-phase column and not subjected to RP HPLC characterization. The humic-like fluorescence at Ex/Em 270/450 nm is mostly located in the hydrophilic peak of low MS fraction C+D. Taking into account that high MS fraction A consisted
Czech Academy of Sciences Publication Activity Database
Drdlík, D.; Bartoníčková, E.; Hadraba, Hynek; Cihlář, J.
2014-01-01
Roč. 34, č. 14 (2014), s. 3365-3371 ISSN 0955-2219 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081723 Keywords : Anionic stabilization * Electric conductivity * Alumina * Electrophoretic deposition Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 2.947, year: 2014
Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing
Directory of Open Access Journals (Sweden)
Soares-Ramos Juliana R.L.
2003-01-01
Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.
Micro-rheology on (polymer-grafted) colloids using optical tweezers
International Nuclear Information System (INIS)
Gutsche, C; Elmahdy, M M; Kegler, K; Semenov, I; Stangner, T; Otto, O; Ueberschaer, O; Kremer, F; Keyser, U F; Krueger, M; Rauscher, M; Weeber, R; Harting, J; Kim, Y W; Lobaskin, V; Netz, R R
2011-01-01
Optical tweezers are experimental tools with extraordinary resolution in positioning (± 1 nm) a micron-sized colloid and in the measurement of forces (± 50 fN) acting on it-without any mechanical contact. This enables one to carry out a multitude of novel experiments in nano- and microfluidics, of which the following will be presented in this review: (i) forces within single pairs of colloids in media of varying concentration and valency of the surrounding ionic solution, (ii) measurements of the electrophoretic mobility of single colloids in different solvents (concentration, valency of the ionic solution and pH), (iii) similar experiments as in (i) with DNA-grafted colloids, (iv) the nonlinear response of single DNA-grafted colloids in shear flow and (v) the drag force on single colloids pulled through a polymer solution. The experiments will be described in detail and their analysis discussed.
Dziewit, Lukasz; Pyzik, Adam; Matlakowska, Renata; Baj, Jadwiga; Szuplewska, Magdalena; Bartosik, Dariusz
2013-03-14
Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria.
Friedrich, Sarah; Wang, Tza-Huei
Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.
International Nuclear Information System (INIS)
Friedland, W.; Kundrat, P.
2015-01-01
The module that simulates the kinetics and yields of radiation-induced chromosome aberrations within the biophysical code PARTRAC is described. Radiation track structures simulated by Monte Carlo methods are overlapped with multi-scale models of DNA and chromatin to assess the resulting DNA damage. Spatial mobility of individual DNA ends from double-strand breaks is modelled simultaneously with their processing by the non-homologous end-joining enzymes. To score diverse types of chromosome aberrations, the joined ends are classified regarding their original chromosomal location, orientation and the involvement of centromeres. A comparison with experimental data on dicentrics induced by gamma and alpha particles shows that their relative dose dependence is predicted correctly, although the absolute yields are overestimated. The critical model assumptions on chromatin mobility and on the initial damage recognition and chromatin remodelling steps and their future refinements to solve this issue are discussed. (authors)
Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs
DEFF Research Database (Denmark)
van Beest, M; Dooijes, D; van De Wetering, M
2000-01-01
Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...
Electrophoretic variation in low molecular weight lens crystallins from inbred strains of rats.
Donner, M E; Skow, L C; Kunz, H W; Gill, T J
1985-10-01
Analysis of rat lens soluble proteins by analytical isoelectric focusing detected two inherited electrophoretic differences in low molecular weight (LM) crystallins from inbred strains of rats (Rattus norvegicus). The polymorphic lens crystallins were shown to be similar to a genetically variant LM crystallin, LEN-1, previously described in mice (Mus musculus) and encoded on chromosome 1, at a locus linked to Pep-3 (dipeptidase). Linkage analysis demonstrated that the rat crystallin locus was loosely linked to Pep-3 at a recombination distance of 38 +/- 4.5 U. These data suggest the conservation of a large chromosomal region during the evolution of Rodentia and support the hypothesis that the gamma-crystallins are evolving more rapidly than alpha- or beta-crystallins.
Action of radiation on biosynthesis of hemoglobin and some of its electrophoretic fractions
International Nuclear Information System (INIS)
Starodub, N.F.; Kriklivyj, I.A.; Shur'yan, I.M.
1976-01-01
Biosynthesis of hemoglobin and some of its electrophoretic fractions in red cells of peripheral blood and spleen of irradiated (650 R) rats has been studied. Hemoglobin synthesis is found to be most drastically inhibited in the first and second fractions on the first and eighth days after irradiation and in the fifth and sixth fractions on the eighth day (less expressed). The synthesis is restored on the twelfth day, the process under study proceeding more slowly in the above-mentioned fractions than in others. In the course of radiation sickness, the biosynthesis of certain hemoglobin fractions varies differently in the hemoglobin-synthesizing cells of peripheral blood than in the cells of spleenic erythroid series
Directory of Open Access Journals (Sweden)
Liangping Zha
2017-07-01
Full Text Available The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ and L. japonica var. chinensis (rFLJ. Chlorogenic acid (CGAs were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2. We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica.
Directory of Open Access Journals (Sweden)
Yuki Kuroiwa
Full Text Available BACKGROUND: Methotrexate (MTX is an agent used in chemotherapy of tumors and autoimmune disease including rheumatoid arthritis (RA. In addition, MTX has some anti-inflammatory activity. Although dihydrofolate reductase (DHFR is a well-known target for the anti-tumor effect of MTX, the mode of action for the anti-inflammatory activity of MTX is not fully understood. METHODOLOGY/RESULT: Here, we performed a screening of MTX-binding proteins using T7 phage display with a synthetic biotinylated MTX derivative. We then characterized the interactions using surface plasmon resonance (SPR analysis and electrophoretic mobility shift assay (EMSA. Using a T7 phage display screen, we identified T7 phages that displayed part of high-mobility group box 1 (HMGB1 protein (K86-V175. Binding affinities as well as likely binding sites were characterized using genetically engineered truncated versions of HMGB1 protein (Al G1-K87, Bj: F88-K181, indicating that MTX binds to HMGB1 via two independent sites with a dissociation constants (KD of 0.50±0.03 µM for Al and 0.24 ± 0.01 µM for Bj. Although MTX did not inhibit the binding of HMGB1 to DNA via these domains, HMGB1/RAGE association was impeded in the presence of MTX. These data suggested that binding of MTX to part of the RAGE-binding region (K149-V175 in HMGB1 might be significant for the anti-inflammatory effect of MTX. Indeed, in murine macrophage-like cells (RAW 264.7, TNF-α release and mitogenic activity elicited by specific RAGE stimulation with a truncated monomeric HMGB1 were inhibited in the presence of MTX. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that HMGB1 is a direct binding protein of MTX. Moreover, binding of MTX to RAGE-binding region in HMGB1 inhibited the HMGB1/RAGE interaction at the molecular and cellular levels. These data might explain the molecular basis underlying the mechanism of action for the anti-inflammatory effect of MTX.
Šutka, A; Timusk, M; Saal, K; Kisand, V
2015-01-01
Optical properties of zinc oxide nanowire (NW) dilute suspensions in polydimethylsiloxane (PDMS) were investigated. Optical transmittance was found to decrease at the transition from chaotically oriented state to electrophoretically ordered state with the alignment of the NW along the direction of incident light. Previously reported observations of the behavior of dispersions containing oblong particles indicate that the transition of the orientation of particles from chaotic to ordered state...
Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA
International Nuclear Information System (INIS)
Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.
1993-01-01
Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs
Problems with multiple use of transfer buffer in protein electrophoretic transfer.
Dorri, Yaser; Kurien, Biji T; Scofield, R Hal
2010-04-01
Two-dimensional gel electrophoresis (2DE) and SDS-PAGE are the two most useful methods in protein separation. Proteins separated by 2DE or SDS-PAGE are usually transferred to membranes using a variety of methods, such as electrophoretic transfer, heat-mediated transfer, or nonelectrophoretic transfer, for specific protein detection and/or analysis. In a recent study, Pettegrew et al. claim to reuse transfer buffer containing methanol for at least five times for transferring proteins from SDS-PAGE to polyvinylidene difluoride. They add 150-200 ml fresh transfer solution each time for extended use as a result of loss of transfer buffer. Finally, they test efficiency of each protein transfer by chemiluminescence detection. Here, we comment on this report, as we believe this method is not accurate and useful for protein analysis, and it can cause background binding as well as inaccurate protein analysis.
Tang, Lilin; Zhang, Wenpeng; Zhao, Haiyan; Chen, Zilin
2015-08-01
A capillary-electrophoresis-based method for the screening of tyrosinase inhibitors in traditional Chinese medicines was developed. The method integrated electrophoretically mediated microanalysis with sandwich mode injection, partial filling, and rapid polarity switching techniques, and carried out on-column enzyme reaction and the separation of substrate and product. The conditions were optimized including the background electrolyte, mixing voltage, and the incubation time. Finally, the screening of nine standard natural compounds of traditional Chinese medicines was carried out. The inhibitors can be directly identified from the reduced peak area of the product compared to that obtained without any inhibitor. Chlorogenic acid (100 μM) showed inhibitory activity with the inhibitory percentage of 19.8%, while the other compounds showed no inhibitory activity. This method has great application potential in drug discovery from traditional Chinese medicines. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Teschome, Bezu; Facsko, Stefan; Gothelf, Kurt V; Keller, Adrian
2015-11-24
DNA origami has become an established technique for designing well-defined nanostructures with any desired shape and for the controlled arrangement of functional nanostructures with few nanometer resolution. These unique features make DNA origami nanostructures promising candidates for use as scaffolds in nanoelectronics and nanophotonics device fabrication. Consequently, a number of studies have shown the precise organization of metallic nanoparticles on various DNA origami shapes. In this work, we fabricated large arrays of aligned DNA origami decorated with a high density of gold nanoparticles (AuNPs). To this end, we first demonstrate the high-yield assembly of high-density AuNP arrangements on DNA origami adsorbed to Si surfaces with few unbound background nanoparticles by carefully controlling the concentrations of MgCl2 and AuNPs in the hybridization buffer and the hybridization time. Then, we evaluate two methods, i.e., hybridization to prealigned DNA origami and molecular combing in a receding meniscus, with respect to their potential to yield large arrays of aligned AuNP-decorated DNA origami nanotubes. Because of the comparatively low MgCl2 concentration required for the efficient immobilization of the AuNPs, the prealigned DNA origami become mobile and displaced from their original positions, thereby decreasing the alignment yield. This increased mobility, on the other hand, makes the adsorbed origami susceptible to molecular combing, and a total alignment yield of 86% is obtained in this way.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Evaluation of Cassia tora Linn. against oxidative stress-induced DNA and cell membrane damage
Directory of Open Access Journals (Sweden)
R Sunil Kumar
2017-01-01
Full Text Available Objective: The present study aims to evaluate antioxidants and protective role of Cassia tora Linn. against oxidative stress-induced DNA and cell membrane damage. Materials and Methods: The total and profiles of flavonoids were identified and quantified through reversed-phase high-performance liquid chromatography. In vitro antioxidant activity was determined using standard antioxidant assays. The protective role of C. tora extracts against oxidative stress-induced DNA and cell membrane damage was examined by electrophoretic and scanning electron microscopic studies, respectively. Results: The total flavonoid content of CtEA was 106.8 ± 2.8 mg/g d.w.QE, CtME was 72.4 ± 1.12 mg/g d.w.QE, and CtWE was 30.4 ± 0.8 mg/g d.w.QE. The concentration of flavonoids present in CtEA in decreasing order: quercetin >kaempferol >epicatechin; in CtME: quercetin >rutin >kaempferol; whereas, in CtWE: quercetin >rutin >kaempferol. The CtEA inhibited free radical-induced red blood cell hemolysis and cell membrane morphology better than CtME as confirmed by a scanning electron micrograph. CtEA also showed better protection than CtME and CtWE against free radical-induced DNA damage as confirmed by electrophoresis. Conclusion: C. tora contains flavonoids and inhibits oxidative stress and can be used for many health benefits and pharmacotherapy.
Avatar DNA Nanohybrid System in Chip-on-a-Phone
Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho
2014-05-01
Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording.
Shi, Y Y; Li, M; Liu, Q; Jia, Z J; Xu, X C; Cheng, Y; Zheng, Y F
2016-03-01
Electrophoretic deposition (EPD) is a facile and feasible technique to prepare functional nanocomposite coatings for application in orthopedic-related implants. In this work, a ternary graphene oxide-chitosan-hydroxyapatite (GO-CS-HA) composite coating on Ti substrate was successfully fabricated by EPD. Coating microstructure and morphologies were investigated by scanning electron microscopy, contact angle test, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis. It was found GO-CS surface were uniformly decorated by HA nanoparticles. The potentiodynamic polarization test in simulated body fluid indicated that the GO-CS-HA coatings could provide effective protection of Ti substrate from corrosion. This ternary composite coating also exhibited good biocompatibility during incubation with MG63 cells. In addition, the nanocomposite coatings could decrease the attachment of Staphylococcus aureus.
Microarray MAPH: accurate array-based detection of relative copy number in genomic DNA
Directory of Open Access Journals (Sweden)
Chan Alan
2006-06-01
Full Text Available Abstract Background Current methods for measurement of copy number do not combine all the desirable qualities of convenience, throughput, economy, accuracy and resolution. In this study, to improve the throughput associated with Multiplex Amplifiable Probe Hybridisation (MAPH we aimed to develop a modification based on the 3-Dimensional, Flow-Through Microarray Platform from PamGene International. In this new method, electrophoretic analysis of amplified products is replaced with photometric analysis of a probed oligonucleotide array. Copy number analysis of hybridised probes is based on a dual-label approach by comparing the intensity of Cy3-labelled MAPH probes amplified from test samples co-hybridised with similarly amplified Cy5-labelled reference MAPH probes. The key feature of using a hybridisation-based end point with MAPH is that discrimination of amplified probes is based on sequence and not fragment length. Results In this study we showed that microarray MAPH measurement of PMP22 gene dosage correlates well with PMP22 gene dosage determined by capillary MAPH and that copy number was accurately reported in analyses of DNA from 38 individuals, 12 of which were known to have Charcot-Marie-Tooth disease type 1A (CMT1A. Conclusion Measurement of microarray-based endpoints for MAPH appears to be of comparable accuracy to electrophoretic methods, and holds the prospect of fully exploiting the potential multiplicity of MAPH. The technology has the potential to simplify copy number assays for genes with a large number of exons, or of expanded sets of probes from dispersed genomic locations.
Microarray MAPH: accurate array-based detection of relative copy number in genomic DNA.
Gibbons, Brian; Datta, Parikkhit; Wu, Ying; Chan, Alan; Al Armour, John
2006-06-30
Current methods for measurement of copy number do not combine all the desirable qualities of convenience, throughput, economy, accuracy and resolution. In this study, to improve the throughput associated with Multiplex Amplifiable Probe Hybridisation (MAPH) we aimed to develop a modification based on the 3-Dimensional, Flow-Through Microarray Platform from PamGene International. In this new method, electrophoretic analysis of amplified products is replaced with photometric analysis of a probed oligonucleotide array. Copy number analysis of hybridised probes is based on a dual-label approach by comparing the intensity of Cy3-labelled MAPH probes amplified from test samples co-hybridised with similarly amplified Cy5-labelled reference MAPH probes. The key feature of using a hybridisation-based end point with MAPH is that discrimination of amplified probes is based on sequence and not fragment length. In this study we showed that microarray MAPH measurement of PMP22 gene dosage correlates well with PMP22 gene dosage determined by capillary MAPH and that copy number was accurately reported in analyses of DNA from 38 individuals, 12 of which were known to have Charcot-Marie-Tooth disease type 1A (CMT1A). Measurement of microarray-based endpoints for MAPH appears to be of comparable accuracy to electrophoretic methods, and holds the prospect of fully exploiting the potential multiplicity of MAPH. The technology has the potential to simplify copy number assays for genes with a large number of exons, or of expanded sets of probes from dispersed genomic locations.
International Nuclear Information System (INIS)
Asamoto, Makiko; Miyake, Shinji; Yonei, Yuka; Yamaura, Hiroyuki; Yahiro, Hidenori
2009-01-01
The electrochemical performances of Proton-conducting SOFC with La 0.7 Sr 0.3 FeO 3 (LSF) cathode fabricated by the electrophoretic deposition (EPD) technique were investigated. The EPD technique provided the uniform layer of LSF cathode with constant thickness and can easily control the thickness by changing an applied voltage. The power density of the SOFC cell was dependent on the thickness of LSF cathode. The activation energy was measured to elucidate the rate-determining step for LSF cathode reaction. (author)
Free-zone electrophoresis of animal cells. 1: Experiments on cell-cell interactions
Todd, P. W.; Hjerten, S.
1985-01-01
The electrophoretically migrating zones wasa monitored. The absence of fluid flows in the direction of migration permits direct measurement of electrophoretic velocities of any material. Sedimentation is orthogonal to electrokinetic motion and the effects of particle-particle interaction on electrophoretic mobility is studied by free zone electrophoresis. Fixed erythrocytes at high concentrations, mixtures of fixed erythrocytes from different animal species, and mixtures of cultured human cells were studied in low ionic strength buffers. The electrophoretic velocity of fixed erythrocytes was not altered by increasing cell concentration or by the mixing of erythrocytes from different species. When zones containing cultured human glial cells and neuroblastoma cells are permitted to interact during electrophoresis, altered migration patterns occur. It is found that cell-cell interactions depends upon cell type.
Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W
2013-07-08
Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.
International Nuclear Information System (INIS)
Rzepecki, R.; Markiewicz, E.; Szopa, J.
1995-01-01
The nuclear matrices from White bush (''Cucurbita pepo var. patisonina'') cell nuclei have been isolated using three methods: I, standard procedure involving extraction of cell nuclei with 2 M NaCl and 1% Triton X-100; II, the same with pre-treatment of cell nuclei with 0.5 mM CuSO 4 (stabilisation step); and III, method with extraction by lithium diiodosalicylate (LIS), and compared the polypeptide pattern. The isolated matrices specifically bind SAR DNA derived from human β-interferon gene in the exogenous SAR binding assay and in the gel mobility shift assay. Using IgG against the 32 kDa endonuclease we have found in the DNA-protein blot assay that this protein is one of the proteins binding SAR DNA. We have identified three proteins with molecular mass of 65 kDa, 60 kDa and 32 kDa which are responsible for SAR DNA binding in the gel mobility shift assay experiments. (author). 21 refs, 3 figs
Molecular mechanisms of DNA photodamage
International Nuclear Information System (INIS)
Starrs, S.M.
2000-05-01
Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA) n and (GA) n , and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a dimeric
Interfacing of DNA with carbon nanotubes for nanodevice applications
International Nuclear Information System (INIS)
Rastogi, Richa; Dhindsa, Navneet; Suri, C. Raman; Pant, B.D.; Tripathi, S.K.; Kaur, Inderpreet; Bharadwaj, Lalit M.
2012-01-01
In nanotechnology, carbon nanotubes are evolving as ‘hot spot’ due to their applications as most sensitive biosensors. Thus, study of effect of biomolecular interaction is prerequisite for their electrical application in biosensors and bioelectronics. Here, we have explored this effect on electrical properties of carbon nanotubes with DNA as a model biomolecule. A stable conjugate of carbon nanotubes with DNA is formed via covalent methodology employing quantum dot as fluoropore and characterized with various spectroscopic, fluoroscopic and microscopic techniques. CNT–DNA adduct showed decreased transconductance (from 614.46 μS to 1.34 μS) and shift of threshold voltage (from −0.85 V to 2.5 V) due to change in Schottky barriers at metal–nanotube contact. In addition, decrease in hole mobility (from 4.46 × 10 6 to 9.72 × 10 3 cm 2 V −1 s −1 ) and increase in ON-linear resistance (from 74 kΩ to 0.44 MΩ) conclude large change in device parameters. On the one hand, this substantial change in device parameters after interfacing with biomolecules supports application of carbon nanotubes in the field of biosensors while on the other hand, the same can limit their use in future power electronic devices where stability in device parameters is essential. -- Graphical abstract: Carbon nanotubes are interfaced with DNA via covalent interactions and characterized with spectroscopic, fluoroscopic and microscopic techniques. Electrical characterization of this stable SWNT–DNA conjugate shows decreased transconductance and shift of threshold voltage towards positive gate voltages. On the one hand, this substantial change in device parameters after interfacing with biomolecules supports application of carbon nanotubes in the field of biosensors while on the other hand, the same can limit their use in future power electronic devices where stability in device parameters is essential. Highlights: ► Effect of biomolecular (DNA) interaction on electrical
Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique.
Intarapanich, Apichart; Kaewkamnerd, Saowaluck; Shaw, Philip J; Ukosakit, Kittipat; Tragoonrung, Somvong; Tongsima, Sissades
2015-01-01
DNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained. We developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists. This work presents an automated genotyping tool from DNA
Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique
2015-01-01
Background DNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained. Results We developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists. Conclusions This work presents an
International Nuclear Information System (INIS)
Yang, Koho; Shen, Jung-Hsiung; Yang, Kai-Yun; Hung, I-Ming; Fung, Kuan-Zong; Wang, Moo-Chin
2007-01-01
The yttria-stabilized zirconia (YSZ) thin films electrophoretic deposited on the La 0.8 Sr 0.2 MnO 3 (LSM) substrate have been characterized by using zeta potential analysis, X-ray diffraction (XRD), scanning electron microscopy (SEM), and transmission electron microscopy (TEM). The La 2 Zr 2 O 7 (LZ) formed at the interface between the YSZ thin film and LSM substrate, after sintered at 1400 o C for 52 h, are identified by XRD. The zeta potential of the YSZ particles in pure ethanol-acetone is about 7.8 mV, but when the I 2 concentration is greater than 0.6 g/1, the zeta potential attains a constant value, 46 mV. The relation between deposit weight of the YSZ films and the applied voltage shows a non-linear behavior. Thickness of the YSZ thin film deposited on the LSM substrate by electrophoretic deposition is controlled by a diffusion process. A larger LZ with the thickness of 200 nm is formed at the interface between the YSZ film and the LSM substrate
Probing size-dependent electrokinetics of hematite aggregates
Energy Technology Data Exchange (ETDEWEB)
Kedra-Królik, Karolina; Rosso, Kevin M.; Zarzycki, Piotr
2017-02-01
Aqueous particle suspensions of many kinds are stabilized by the electrostatic potential developed at their surfaces from reaction with water and ions. An important and less well understood aspect of this stabilization is the dependence of the electrostatic surface potential on particle size. Surface electrostatics are typically probed by measuring particle electrophoretic mobilities and quantified in the electrokinetic potential (f), using commercially available Zeta Potential Analyzers (ZPA). Even though ZPAs provide frequency-spectra (histograms) of electrophoretic mobility and hydrodynamic diameter, typically only the maximal-intensity values are reported, despite the information in the remainder of the spectra. Here we propose a mapping procedure that inter-correlates these histograms to extract additional insight, in this case to probe particle size-dependent electrokinetics. Our method is illustrated for a suspension of prototypical iron (III) oxide (hematite, a-Fe2O3). We found that the electrophoretic mobility and f-potential are a linear function of the aggregate size. By analyzing the distribution of surface site types as a function of aggregate size we show that site coordination increases with increasing aggregate diameter. This observation explains why the acidity of the iron oxide particles decreases with increasing particle size.
Electrophoretic Deposition of Hydroxyapatite Film Containing Re-Doped MoS2 Nanoparticles
Directory of Open Access Journals (Sweden)
Hila Shalom
2018-02-01
Full Text Available Films combining hydroxyapatite (HA with minute amounts (ca. 1 weight % of (rhenium doped fullerene-like MoS2 (IF nanoparticles were deposited onto porous titanium substrate through electrophoretic process (EPD. The films were analyzed by scanning electron microscopy (SEM, X-ray diffraction and Raman spectroscopy. The SEM analysis showed relatively uniform coatings of the HA + IF on the titanium substrate. Chemical composition analysis using energy dispersive X-ray spectroscopy (EDS of the coatings revealed the presence of calcium phosphate minerals like hydroxyapatite, as a majority phase. Tribological tests were undertaken showing that the IF nanoparticles endow the HA film very low friction and wear characteristics. Such films could be of interest for various medical technologies. Means for improving the adhesion of the film to the underlying substrate and its fracture toughness, without compromising its biocompatibility are discussed at the end.
International Nuclear Information System (INIS)
Khalili, Vida; Khalil-Allafi, Jafar; Xia, Wei; Parsa, Alireza B.; Frenzel, Jan; Somsen, Christoph; Eggeler, Gunther
2016-01-01
Graphical abstract: - Highlights: • The stable composite suspensions of hydroxyapatite, silicon and multi-walled carbon nano-tubes was prepared using functionalization of and multi-walled carbon nano-tubes in HNO_3 vapor and triethanolamine as dispersing agent. • The zeta potential of composite suspensions is less than that of hydroxyapatite suspension. • The silicon particles presence in suspension causes to decrease the charge carrier in suspension and current density during electrophoretic deposition. • The orientation of multi-walled carbon nano-tubes to parallel direction of the applied electric field during electrophoretic deposition can facilitate their moving towards the cathode and increase current density. • The more zeta potential of suspension, the lower roughness of coatings during electrophoretic deposition. - Abstract: Preparing a stable suspension is a main step towards the electrophoretically depositing of homogeneous and dense composite coatings on NiTi for its biomedical application. In the present study, different composite suspensions of hydroxyapatite, silicon and multi-walled carbon nano-tubes were prepared using n-butanol and triethanolamine as media and dispersing agent, respectively. Multi-walled carbon nanotubes were first functionalized in the nitric acid vapor for 15 h at 175 °C, and then mixed into suspensions. Thermal desorption spectroscopy profiles indicate the formation of functional groups on multi-walled carbon nano-tubes. An excellent suspension stability can be achieved for different amounts of triethanolamine. The amount of triethanolamine can be increased by adding a second component to a stable hydroxyapatite suspension due to an electrostatic interaction between components in suspension. The stability of composite suspension is less than that of the hydroxyapatite suspension, due to density differences, which under the gravitational force promote the demixing. The scanning electron microscopy images of the
Sheikh, Mohammad; Feig, Jennifer; Gee, Becky; Li, Song; Savva, Michalakis
2003-06-01
A novel series of symmetric double-chained primary and tertiary 1,3-dialkoylamido monovalent cationic lipids were synthesized and evaluated for their transfection activities. In the absence of the helper lipid DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), only the primary and tertiary dioleoyl derivatives 1,3lmp5 and 1,3lmt5, respectively elicited transfection activity. This is a striking difference between symmetrical 1,2-diacyl glycerol-based monovalent cationic lipids that always found both dioleoyl and dimyristoyl analogues being efficient transfection reagents. In the presence of helper lipid, all cationic derivatives induced marker gene expression, except the dilauroyl analogues 1,3lmp1 and 1,3lmt1 that elicited no transfection activity. Combining electrophoretic mobility data of the lipoplexes at different charge ratios with transfection activity suggested two requirements for high transfection activity with monovalent double-chained cationic lipids, that is, binding/association of the lipid to the plasmid DNA and membrane fusion properties of the lipid layers surrounding the DNA.
Unique CCT repeats mediate transcription of the TWIST1 gene in mesenchymal cell lines
International Nuclear Information System (INIS)
Ohkuma, Mizue; Funato, Noriko; Higashihori, Norihisa; Murakami, Masanori; Ohyama, Kimie; Nakamura, Masataka
2007-01-01
TWIST1, a basic helix-loop-helix transcription factor, plays critical roles in embryo development, cancer metastasis and mesenchymal progenitor differentiation. Little is known about transcriptional regulation of TWIST1 expression. Here we identified DNA sequences responsible for TWIST1 expression in mesenchymal lineage cell lines. Reporter assays with TWIST1 promoter mutants defined the -102 to -74 sequences that are essential for TWIST1 expression in human and mouse mesenchymal cell lines. Tandem repeats of CCT, but not putative CREB and NF-κB sites in the sequences substantially supported activity of the TWIST1 promoter. Electrophoretic mobility shift assay demonstrated that the DNA sequences with the CCT repeats formed complexes with nuclear factors, containing, at least, Sp1 and Sp3. These results suggest critical implication of the CCT repeats in association with Sp1 and Sp3 factors in sustaining expression of the TWIST1 gene in mesenchymal cells
Czech Academy of Sciences Publication Activity Database
Malá, Zdeňka; Gebauer, Petr; Boček, Petr
2016-01-01
Roč. 935, SEP (2016), s. 249-257 ISSN 0003-2670 R&D Projects: GA ČR(CZ) GA16-09135S Institutional support: RVO:68081715 Keywords : electrophoretic focusing * CE-ESI-MS * capillary electrophoresis Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 4.950, year: 2016
Directory of Open Access Journals (Sweden)
Marioly Vernhes Tamayo
2017-08-01
Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.
Charge transfer in pi-stacked systems including DNA
International Nuclear Information System (INIS)
Siebbeles, L.D.A.
2003-01-01
Charge migration in DNA is a subject of intense current study motivated by long-range detection of DNA damage and the potential application of DNA as a molecular wire in nanoscale electronic devices. A key structural element, which makes DNA a medium for long-range charge transfer, is the array of stacked base pairs in the interior of the double helix. The overlapping pi-orbitals of the nucleobases provide a pathway for motion of charge carriers generated on the stack. This 'pi-pathway' resembles the columnarly stacked macrocyclic cores in discotic materials such as triphenylenes. The structure of these pi-stacked systems is highly disordered with dynamic fluctuations occurring on picosecond to nanosecond time scales. Theoretical calculations, concerning the effects of structural disorder and nucleobase sequence in DNA, on the dynamics of charge carriers are presented. Electronic couplings and localization energies of charge carriers were calculated using density functional theory (DFT). Results for columnarly stacked triphenylenes and DNA nucleobases are compared. The results are used to provide insight into the factors that control the mobility of charge carriers. Further, experimental results on the site-selective oxidation of guanine nucleobases in DNA (hot spots for DNA damage) are analyzed on basis of the theoretical results
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Molaei, A; Amadeh, A; Yari, M; Reza Afshar, M
2016-02-01
In this study chitosan/halloysite nanotube composite (CS/HNT) coatings were deposited by electrophoretic deposition (EPD) on titanium substrate. Using HNT particles were investigated as new substituents for carbon nanotubes (CNTs) in chitosan matrix coatings. The ability of chitosan as a stabilizing, charging, and blending agent for HNT particles was exploited. Furthermore, the effects of pH, electrophoretic bath, and sonicating duration were studied on the deposition of suspensions containing HNT particles. Microstructure properties of coatings showed uniform distribution of HNT particles in chitosan matrix to form smooth nanocomposite coatings. The zeta potential results revealed that at pH around 3 there is an isoelectric point for HNT and it would have cathodic and anionic states at pH values less and more than 3, respectively. Therefore, CS/HNT composite deposits were produced in the pH range of 2.5 to 3. The apatite inducing ability of chitosan-HNT composite coating assigned that HNT particles were biocompatible because they formed carbonated hydroxyapatite particles on CS/HNT coating in corrected simulated body fluid (C-SBF). Finally, electrochemical corrosion characterizations determined that corrosion resistance in CS/HNT coating has been improved compared to bare titanium substrate. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Wei, Xiao-ling; Xia, Yi; Liu, Xiao-min; Yang, Hui; Shen, Xiao-dong
2014-01-01
Highlights: • Sodium beta″ alumina electrolyte thin film is successfully prepared via electrophoretic deposition. • The ionic conductivity of the optimized electrolyte disk is 0.138 S cm -1 . • A Daniell-typed cell is built which approves the reversible Na + conduction at only 100 °C. - Abstract: With the desire to lowering the working temperature of Na-β″-Al 2 O 3 solid electrolyte (BASE) based batteries, electrophoretic deposition process is employed to fabricate 300 μm thick Na-β″-Al 2 O 3 sheet with densification microstructure and high ionic conductivity. Taguchi design of experiment approach with signal to noise ratio analysis is utilized to optimize the operation parameters. The results show that the TiO 2 content in the precursor powders is critical to determine the ionic conductivity of the resulting electrolyte. X-Ray diffraction analysis and X-ray photoelectron spectroscopy examination point out that Ti 4+ can enter the crystal lattice of Na-β″-Al 2 O 3 , which results in the variation of lattice parameters, densifies the microstructure and improves both β″ phase content and ionic conductivity of the resulting sample. The thin Na-β″-Al 2 O 3 disk obtained under the optimized conditions Exhibit 97% β″ phase content and relatively high ionic conductivity. Moreover, a Daniell-typed cell built with this optimized sample disk, using copper/zinc redox couples as electrodes and 1 M NaBF 4 in DMSO as the secondary electrolyte, shows reversible charge and discharge behaviors at relatively low temperature, 100 °C
DEFF Research Database (Denmark)
Troelsen, J T; Mitchelmore, C; Sjöström, H
1994-01-01
Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....
Mobile marketing for mobile games
Vu, Giang
2016-01-01
Highly developed mobile technology and devices enable the rise of mobile game industry and mobile marketing. Hence mobile marketing for mobile game is an essential key for a mobile game success. Even though there are many articles on marketing for mobile games, there is a need of highly understanding mobile marketing strategies, how to launch a mobile campaign for a mobile game. Besides that, it is essential to understand the relationship between mobile advertising and users behaviours. There...
International Nuclear Information System (INIS)
Mohd Roslie Ali; Shahrul Nizam Mohd Salleh
2009-01-01
Full text: Multi-Walled Carbon Nano tubes (MWCNT) were deposited onto Indium-Tin-Oxide (ITO)-coated glass substrates by introducing the use of Electrophoretic Deposition (EPD) as the method. The Multi-Walled Carbon Nano tubes (MWCNT) were dispersed ultrasonically in ethanol and sodium hydroxide (NaOH) to form stable suspension. The addition of Sodium Hydroxide in ethanol can stabilize the suspension, which was very important step before the deposition take place. Two substrates of Indium-Tin-Oxide(ITO)-coated glass placed in parallel facing each other (conductive side) into the suspension. The deposition occurs at room temperature, which the distance fixed at 1 cm between both electrodes and the voltage level applied was fixed at 400 V, respectively. The deposition time also was fixed at 30 minutes. The deposited ITO-Glass with Multi-Walled Carbon Nano tubes (MWCNT) will be characterized using Scanning Electron Microscope (SEM), Atomic Force Microscope (AFM), and Raman Microscope. The images of SEM shows that the Multi -Walled Carbon Nano tubes (MWCNT) were distributed uniformly onto the surface of ITO-Glass. The deposited ITO-Glass with Multi-Walled Carbon Nano tubes (MWCNT) could be the potential material in various practical applications such as field emission devices, fuel cells, and super capacitors. Electrophoretic deposition (EPD) technique was found to be an efficient technique in forming well distribution of Multi-Walled Carbon Nano tubes (MWCNT) onto ITO-Glass substrates, as proved in characterization methods, in which the optimum conditions will play the major role. (author)
International Nuclear Information System (INIS)
Deng, Chao; Jiang, Jianjun; Liu, Fa; Fang, Liangchao; Wang, Junbiao; Li, Dejia; Wu, Jianjun
2015-01-01
Graphical abstract: Carbon nanotube/carbon fiber hybrid fiber was proposed by the treatment with hydrogen peroxide and concentrated nitric acid combined with electrophoretic deposition process. - Highlights: • Carbon nanotube coated carbon fiber was prepared by two methods. • Uniform and dense CNTs network formed by oxidative treatments combined with EPD. • Pretreatment of the CF is beneficial to EPD of CNTs on carbon fiber surface. • CNTs enhanced the surface activity and wettability of carbon fibers. • CNTs have contributed to the interfacial properties of composite. - Abstract: To improve the interfacial performance of carbon fiber (CF) and epoxy resin, carbon nanotubes (CNTs) coatings were utilized to achieve this purpose through coating onto CF by the treatment with hydrogen peroxide and concentrated nitric acid combined with electrophoretic deposition (EPD) process. The influence of electrophoretically deposited CNTs coatings on the surface properties of CFs were investigated by Fourier transform infrared spectrometer, atomic force microscopy, scanning electron microscopy and dynamic contact angle analysis. The results indicated that the deposition of carbon nanotubes introduced some polar groups to carbon fiber surfaces, enhanced surface roughness and changed surface morphologies of carbon fibers. Surface wettability of carbon fibers may be significantly improved by increasing surface free energy of the fibers due to the deposition of CNTs. The thickness and density of the coatings increases with the introduction of pretreatment of the CF during the EPD process. Short beam shear test was performed to examine the effect of carbon fiber functionalization on mechanical properties of the carbon fiber/epoxy resin composites. The interfacial adhesion of CNTs/CF reinforced epoxy composites showed obvious enhancement of interlaminar shear strength by 60.2% and scanning electron microscope photographs showed that the failure mode of composites was changed
I.N.G. Silva; M.I.F. Guedes; M.F.G. Rocha; C.M.O. Medeiros; L.C. Oliveira; O.C. Moreira; M.F.S. Teixeira
2005-01-01
The hematological and serum proteins electrophoretic profiles of 13 dogs with distemper (Lentz inclusion body in leukocytes) were studied. The most frequent hematological findings were: normocitic normocromic anemia (61%), leukopenia (46%), left shount (54%), trombocytopenia (69%) and lymphopenia (85%). Electrophoretic analysis of serum proteins showed hypoproteinemia (54%), with reduced albumin and increased alfa-2 globulin. These findings can be used to support the clinical diagnosis of can...
Cross-linking and relaxation of supercoiled DNA by psoralen and light
International Nuclear Information System (INIS)
Yoakum, G.H.; Cole, R.S.
1978-01-01
Photoreaction of 4,5',8-trimethylpsoralen with superhelical ColE1 and ColE1amp DNA was studied. Changes in mobilities in agarose gels, formation of interstrand cross-links, and DNA strand breaks were determined. Psoralen and light treatment removed negative superhelical turns, and extensive treatments failed to produce positive superhelical turns in covalently closed plasmid DNA. The rate of relaxation of superhelical turns by psoralen photobinding appeared to be directly proportional to the number of superhelical turns remaining. A unique reaction mechanism is presented to explain these results. By this interpretation the initial rate of psoralen photobinding to superhelical DNA was estimated to be 3 times that for linear DNA, and the ratio of cross-linking to monofunctional adducts appears to be dependent on the superhelical conformation of the DNA. The estimated ratio of psoralen molecules bound to DNA strand breaks was 1.7 . 10 4 :1, and 70% of this breakage is caused by the light alone. (Auth.)
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Panitz, Janda K.; Reed, Scott T.; Ashley, Carol S.; Neiser, Richard A.; Moffatt, William C.
1999-01-01
Electrophoretically active sol-gel processes to fill, seal, and/or density porous, flawed, and/or cracked coatings on electrically conductive substrates. Such coatings may be dielectrics, ceramics, or semiconductors and, by the present invention, may have deposited onto and into them sol-gel ceramic precursor compounds which are subsequently converted to sol-gel ceramics to yield composite materials with various tailored properties.
Directory of Open Access Journals (Sweden)
Michael Van Meter
2016-09-01
Full Text Available The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6, promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK, phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose polymerase 1 (PARP1 to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.
Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.
Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh
2013-04-01
In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.
International Nuclear Information System (INIS)
Nusser, N.N.; Bartkowiak, D.; Roettinger, E.M.
2002-01-01
Aims: To examine the dose response of DNA damage and its modification by the radiosensitizer, 5-bromo-2'-deoxyuridine (BrdU). The sensitizing mechanism is analyzed with regard to its influence on the induction and repair of DNA double-strand breaks (DSBs). Material and Methods: Cells from three different human glioblastoma lines, A7, LH and U87MG, were X-irradiated with and without exposure to BrdU. DNA fragments were separated by field-inversion gel electrophoresis (FIGE) and quantified by fluorometry immediately and 24 h after irradiation. Results: In all cell lines, the dose response followed a linear-quadratic rather than a purely linear function. BrdU-treated cells exhibited a significantly higher amount of mobile DNA. In repair experiments with and without BrdU, the amount of mobile DNA fell close to control values within 24 h. Conclusions: The linear-quadratic model appropriately describes the X-ray induced fragmentation of DNA. BrdU sensitizing acts predominantly by increasing DNA fragility, and not by impairing damage repair. The amount of DSBs persistent after 24 h of repair is minimal, even after highly cytotoxic doses. However, it appears to depend on the extent of initial damage, causing sensitized cells to retain more DSBs than unsensitized cells. (orig.)
DEFF Research Database (Denmark)
Jensen, Kirsten; Kesmir, Can; Søndergaard, Ib
1996-01-01
The end-use quality of products made from doughs consisting of wheat flour and water is often dependent upon the storage (gluten) proteins of the grain endosperm. Today the electrophoretic patterns of the high molecular weight (HMW) glutenin subunits are used for quality selections in wheat breed...
Electrophoretic nanotechnology of composite electrodes for electrochemical supercapacitors.
Su, Y; Zhitomirsky, I
2013-02-14
The electrophoretic deposition (EPD) method has been developed for the fabrication of MnO(2)-multiwalled carbon nanotube (MWCNT) films for application in electrochemical supercapacitors (ESs). For MWCNT applications, which depend on electrical conductivity, it is challenging to achieve dispersion and EPD of pristine MWCNT and avoid defects due to chemical treatment or functionalization. An important finding was the possibility of efficient dispersion and controlled EPD of MWCNT using calconcarboxylic acid (CCA). Moreover, the use of CCA allowed efficient dispersion of MnO(2) in concentrated suspensions and EPD of MnO(2) films. The comparison of the experimental data for chromotrope FB (CFB) and CCA and chemical structures of the molecules provided insight into the mechanism of CCA adsorption on MnO(2). The fabrication of stable suspensions of MnO(2) nanoparticles containing MWCNT, and controlled codeposition of both materials is a crucial aspect in the EPD of composites. The new approach was based on the use of CCA as a charging and dispersing agent for EPD of MnO(2) nanoparticles and MWCNT. The deposition yield measurements at various experimental conditions and Fourier transform infrared spectroscopy data, coupled with results of electron microscopy, thermogravimetric, and differential thermal analysis provided evidence of the formation of MnO(2)-MWCNT composites. The electrochemical testing results and impedance spectroscopy data showed good capacitive behavior of the composite films and the beneficial effect of MWCNTs.