WorldWideScience

Sample records for dna base substitutions

  1. DNA polymerase beta can substitute for DNA polymerase I in the initiation of plasmid DNA replication.

    OpenAIRE

    1995-01-01

    We previously demonstrated that mammalian DNA polymerase beta can substitute for DNA polymerase I of Escherichia coli in DNA replication and in base excision repair. We have now obtained genetic evidence suggesting that DNA polymerase beta can substitute for E. coli DNA polymerase I in the initiation of replication of a plasmid containing a pMB1 origin of DNA replication. Specifically, we demonstrate that a plasmid with a pMB1 origin of replication can be maintained in an E. coli polA mutant ...

  2. Capacity of DNA Data Embedding Under Substitution Mutations

    CERN Document Server

    Balado, Félix

    2011-01-01

    A number of methods have been proposed over the last decade for encoding information using deoxyribonucleic acid (DNA), giving rise to the emerging area of DNA data embedding. Since a DNA sequence is conceptually equivalent to a sequence of quaternary symbols (bases), DNA data embedding (diversely called DNA watermarking or DNA steganography) can be seen as a digital communications problem where channel errors are tantamount to mutations of DNA bases. Depending on the use of coding or noncoding DNA hosts, which, respectively, denote DNA segments that can or cannot be translated into proteins, DNA data embedding is essentially a problem of communications with or without side information at the encoder. In this paper the Shannon capacity of DNA data embedding is obtained for the case in which DNA sequences are subject to substitution mutations modelled using the Kimura model from molecular evolution studies. Inferences are also drawn with respect to the biological implications of some of the results presented.

  3. The phylogenetic history of Selaginellaceae based on DNA sequences from the plastid and nucleus: extreme substitution rates and rate heterogeneity.

    Science.gov (United States)

    Korall, Petra; Kenrick, Paul

    2004-06-01

    Molecular phylogenetic research on Selaginellaceae has focused on the plastid gene rbcL, which in this family has unusually high substitution rates. Here we develop a molecular data set from the nuclear 26S ribosomal DNA gene with the aim of evaluating and extending the results of previous phylogenetic research. The 26S rDNA and the rbcL regions were sequenced for a sample of 23 species, which represent the main elements of species diversity in the family. The data were analysed independently and in combination using both maximum parsimony and Bayesian inference. Although several between genome differences were found, the general pattern of relationships uncovered by all analyses was very similar. Results corroborate the previous study supporting new groupings not previously recognised on morphological grounds. Substitution rates in the 26S rDNA were also found to be high (26% informative) for the region analysed, but lower than for rbcL (37% informative). These data indicate that high substitution rates might be widespread in all three genomes (i.e., plastid, mitochondrion, and nucleus).

  4. Evidence for Base Substitutions and Repair of DNA Mismatch Damage Induced by Low Energy N+ Ion Beam Implantation in E. coli

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Ever since the low energy N+ ion beam has been accepted, the mutations of ionizing radiation are attributable mainly to avoidance of DNA damages repair. Evidences based on in vivo proof results are limited. Using the E.coli wild type and mutator strains, the mutant frequencies suggest that base substitutions in rpoB gene are induced by the N+ implantation. A highly conserved region is selected to get the direct evidence for base substitutions by sequence of the high fidelity PCR amplification products in mutants. Most of the mutants (90.9%, 40/44) have at least one base substitution in the amplification region. The evidences for CG to TA (55%, 22/40), AT to GC (20%, 8/40) and TA to CG (5%, 2/40) transitions are identified. The transversions are AT to TA (15%, 6/40) and GC to CG (5%, 2/40). It is suggested that DNA cytosine methylase might play an important role in mismatch repair of DNA damage induced by N+ implantation by analysis of the mutant frequencies of mutator strains.

  5. Non-B DNA-forming sequences and WRN deficiency independently increase the frequency of base substitution in human cells

    DEFF Research Database (Denmark)

    Bacolla, Albino; Wang, Guliang; Jain, Aklank

    2011-01-01

    determined non-B DNA-induced mutation frequencies and spectra in human U2OS osteosarcoma cells and assessed the role of WRN in isogenic knockdown (WRN-KD) cells using a supF gene mutation reporter system flanked by triplex- or Z-DNA-forming sequences. Although both non-B DNA and WRN-KD served to increase...

  6. Synthesis, characterization, DNA interaction and pharmacological studies of substituted benzophenone derived Schiff base metal(II complexes

    Directory of Open Access Journals (Sweden)

    P. Subbaraj

    2015-03-01

    Full Text Available A new bidentate NO type Schiff base ligand (HL, derived from 2-hydroxy-4-methoxyphenylphenylmethanone with aniline and its metal(II [M = Mn, Co, Ni, Cu and Zn] complexes has been synthesized. The synthesized ligand and the metal(II complexes were structurally characterized by analytical, spectral (FT-IR, UV–vis., 1H NMR, FAB-Mass, TGA/DTA and EPR as well as molar conductance and magnetic studies. All the complexes are non-electrolytes having 1:2 stoichiometry. They adopt tetrahedral and octahedral geometry. Thermal behavior of metal(II complexes (1a–1c shows loss of coordinated water molecules in the first step followed by the decomposition of ligand moieties in a respective manner and leads to form an air stable metal oxide as the final residue. Micro crystalline nature and the presence of coordinated water molecules have been confirmed by powder XRD, SEM and thermal analyses. The ligand and its complexes have efficient bio-efficacy, DNA binding and cleavage ability.

  7. DNA barcoding of authentic and substitute samples of herb of the family Asparagaceae and Asclepiadaceae based on the ITS2 region

    Directory of Open Access Journals (Sweden)

    Padmalatha S Rai

    2012-01-01

    Full Text Available Background : Herbal drugs used to treat illness according to Ayurveda are often misidentified or adulterated with similar plant materials. Objective: To aid taxonomical identification, we used DNA barcoding to evaluate authentic and substitute samples of herb and phylogenetic relationship of four medicinal plants of family Asparagaceace and Asclepiadaceae. Materials and Methods : DNA extracted from dry root samples of two authentic and two substitutes of four specimens belonging to four species were subjected to polymerase chain reaction (PCR and DNA sequencing. Primers for nuclear DNA (nu ITS2 and plastid DNA (matK and rpoC1 were used for PCR and sequence analysis was performed by Clustal W. The intraspecific variation and interspecific divergence were calculated using MEGA V 4.0. Statistical Analysis : Kimura′s two parameter model, neighbor joining and bootstrapping methods were used in this work. Results: The result indicates the efficiency of amplification for ITS2 candidate DNA barcodes was 100% for four species tested. The average interspecific divergence is 0.12 and intraspecific variation was 0.232 in the case of two Asparagaceae species. In two Asclepiadaceae species, average interspecific divergence and intraspecific variation were 0.178 and 0.004 respectively. Conclusions: Our findings show that the ITS2 region can effectively discriminate Asparagus racemosus and Hemidesmus indicus from its substitute samples and hence can resolve species admixtures in raw samples. The ITS2 region may be used as one of the standard DNA barcodes to identify closely related species of family Asclepiadaceae but was noninformative for Asparagaceae species suggesting a need for the development of new markers for each family. More detailed studies involving more species and substitutes are warranted.

  8. TAL effector specificity for base 0 of the DNA target is altered in a complex, effector- and assay-dependent manner by substitutions for the tryptophan in cryptic repeat -1.

    Directory of Open Access Journals (Sweden)

    Erin L Doyle

    Full Text Available TAL effectors are re-targetable transcription factors used for tailored gene regulation and, as TAL effector-nuclease fusions (TALENs, for genome engineering. Their hallmark feature is a customizable central string of polymorphic amino acid repeats that interact one-to-one with individual DNA bases to specify the target. Sequences targeted by TAL effector repeats in nature are nearly all directly preceded by a thymine (T that is required for maximal activity, and target sites for custom TAL effector constructs have typically been selected with this constraint. Multiple crystal structures suggest that this requirement for T at base 0 is encoded by a tryptophan residue (W232 in a cryptic repeat N-terminal to the central repeats that exhibits energetically favorable van der Waals contacts with the T. We generated variants based on TAL effector PthXo1 with all single amino acid substitutions for W232. In a transcriptional activation assay, many substitutions altered or relaxed the specificity for T and a few were as active as wild type. Some showed higher activity. However, when replicated in a different TAL effector, the effects of the substitutions differed. Further, the effects differed when tested in the context of a TALEN in a DNA cleavage assay, and in a TAL effector-DNA binding assay. Substitution of the N-terminal region of the PthXo1 construct with that of one of the TAL effector-like proteins of Ralstonia solanacearum, which have arginine in place of the tryptophan, resulted in specificity for guanine as the 5' base but low activity, and several substitutions for the arginine, including tryptophan, destroyed activity altogether. Thus, the effects on specificity and activity generated by substitutions at the W232 (or equivalent position are complex and context dependent. Generating TAL effector scaffolds with high activity that robustly accommodate sites without a T at position 0 may require larger scale re-engineering.

  9. Role of Structure-Based Changes due to Somatic Mutation in Highly Homologous DNA-Binding and DNA-Hydrolyzing Autoantibodies Exemplified by A23P Substitution in the VH Domain

    Directory of Open Access Journals (Sweden)

    A. V. Kozyr

    2012-01-01

    Full Text Available Anti-DNA autoantibodies are responsible for tissue injury in lupus. A subset of DNA-specific antibodies capable of DNA cleavage can be even more harmful after entering the living cells by destroying nuclear DNA. Origins of anti-DNA autoantibodies are not fully understood, and the mechanism of induction of DNA-cleaving activity remains speculative. The autoantibody BV04-01 derived from lupus-prone mouse is the only DNA-hydrolyzing immunoglobulin with known 3D structure. Identification and analysis of antibodies homologous to BV04-01 may help to understand molecular bases and origins of DNA-cleaving activity of autoantibodies. BLAST search identified murine anti-DNA autoantibody MRL-4 with sequences of variable region genes highly homologous to those of autoantibody BV04-01. Despite significant homology to BV04-01, not only MRL-4 had no DNA-cleaving activity, but also reversion of its unusual P23 mutation to the germline alanine resulted in a dramatic loss of affinity to DNA. Contrary to this effect, transfer of the P23 mutation to the BV04-01 has resulted in a significant drop in DNA binding and almost complete loss of catalytic activity. In the present paper we analyzed the properties of two homologous autoantibodies and mutants thereof and discussed the implications of unusual somatic mutations for the development of autoantibodies with DNA-binding and DNA-hydrolyzing activity.

  10. Comparative analysis of inosine-substituted duplex DNA by circular dichroism and X-ray crystallography.

    Science.gov (United States)

    Peters, Justin P; Kowal, Ewa A; Pallan, Pradeep S; Egli, Martin; Maher, L James

    2017-09-04

    Leveraging structural biology tools, we report the results of experiments seeking to determine if the different mechanical properties of DNA polymers with base analog substitutions can be attributed, at least in part, to induced changes from classical B-form DNA. The underlying hypothesis is that different inherent bending and twisting flexibilities may characterize non-canonical B-DNA, so that it is inappropriate to interpret mechanical changes caused by base analog substitution as resulting simply from 'electrostatic' or 'base stacking' influences without considering the larger context of altered helical geometry. Circular dichroism spectra of inosine-substituted oligonucleotides and longer base-substituted DNAs in solution indicated non-canonical helical conformations, with the degree of deviation from a standard B-form geometry depending on the number of I⋅C pairs. X-ray diffraction of a highly inosine-substituted DNA decamer crystal (eight I⋅C and two A⋅T pairs) revealed an A-tract-like conformation with a uniformly narrow minor groove, reduced helical rise, and the majority of sugars adopting a C1'-exo (southeastern) conformation. This contrasts with the standard B-DNA geometry with C2'-endo sugar puckers (south conformation). In contrast, the crystal structure of a decamer with only four I⋅C pairs has a geometry similar to that of the reference duplex with eight G⋅C and two A⋅T pairs. The unique crystal geometry of the inosine-rich duplex is noteworthy given its unusual CD signature in solution and the altered mechanical properties of some inosine-containing DNAs.

  11. First paraben substituted cyclotetraphosphazene compounds and DNA interaction analysis with a new automated biosensor.

    Science.gov (United States)

    Çiftçi, Gönül Yenilmez; Şenkuytu, Elif; İncir, Saadet Elif; Yuksel, Fatma; Ölçer, Zehra; Yıldırım, Tuba; Kılıç, Adem; Uludağ, Yıldız

    2016-06-15

    Cancer, as one of the leading causes of death in the world, is caused by malignant cell division and growth that depends on rapid DNA replication. To develop anti-cancer drugs this feature of cancer could be exploited by utilizing DNA-damaging molecules. To achieve this, the paraben substituted cyclotetraphosphazene compounds have been synthesized for the first time and their effect on DNA (genotoxicity) has been investigated. The conventional genotoxicity testing methods are laborious, take time and are expensive. Biosensor based assays provide an alternative to investigate this drug/compound DNA interactions. Here for the first time, a new, easy and rapid screening method has been used to investigate the DNA damage, which is based on an automated biosensor device that relies on the real-time electrochemical profiling (REP™) technology. Using both the biosensor based screening method and the in vitro biological assay, the compounds 9 and 11 (propyl and benzyl substituted cyclotetraphosphazene compounds, respectively), have resulted in higher DNA damage than the others with 65% and 80% activity reduction, respectively.

  12. Substitution-diffusion based Image Cipher

    Directory of Open Access Journals (Sweden)

    Narendra K Pareek

    2011-03-01

    Full Text Available In this paper, a new image encryption scheme using a secret key of 128-bit size is proposed. In thealgorithm, image is partitioned into several key based dynamic blocks and further, each block passesthrough the eight rounds of diffusion as well as substitution process. In diffusion process, sequences ofblock pixels are rearranged within the block by a zigzag approach whereas block pixels are replaced withanother by using difference calculation of row and column in substitution process. Due to high order ofsubstitution and diffusion, common attacks like linear and differential cryptanalysis are infeasible. Theexperimental results show that the proposed technique is efficient and has high security features.

  13. DNA based computers II

    CERN Document Server

    Landweber, Laura F; Baum, Eric B

    1998-01-01

    The fledgling field of DNA computers began in 1994 when Leonard Adleman surprised the scientific community by using DNA molecules, protein enzymes, and chemicals to solve an instance of a hard computational problem. This volume presents results from the second annual meeting on DNA computers held at Princeton only one and one-half years after Adleman's discovery. By drawing on the analogy between DNA computing and cutting-edge fields of biology (such as directed evolution), this volume highlights some of the exciting progress in the field and builds a strong foundation for the theory of molecular computation. DNA computing is a radically different approach to computing that brings together computer science and molecular biology in a way that is wholly distinct from other disciplines. This book outlines important advances in the field and offers comprehensive discussion on potential pitfalls and the general practicality of building DNA based computers.

  14. Enzymatic techniques for the isolation of random single-base substitutions in vitro at high frequency.

    Science.gov (United States)

    Abarzúa, P; Marians, K J

    1984-04-01

    A general and efficient method has been developed to generate large numbers of single-base substitution mutations simply and rapidly. A unique f1 phage recombinant DNA cloning vector is described, which contains the phi X174 origin of viral strand DNA synthesis and allows one to direct mutagenesis to any specific segment of DNA. Gapped circular DNA is constructed by annealing viral single-stranded circular DNA [ss(c) DNA] with a mixture of linear duplex DNAs that have had their 3'-OH termini processively digested with Escherichia coli exonuclease III under conditions in which the resulting, newly generated 3'-OH termini present in the various hybrid molecules span the region of interest. Base changes are induced by misincorporation of an alpha-thiodeoxynucleoside triphosphate analog onto this primer-template, followed by DNA repair synthesis. The asymmetric segregation of mutants from wild-type sequences is accomplished by double-stranded replicative form DNA----ss(c) DNA synthesis in vitro, initiated from the phi X174 viral strand origin sequence present on the vector DNA. Mutated ss(c) DNA is screened by the dideoxy chain termination method. In one mutagenesis experiment, 21 independent single-base substitutions were isolated in a 72-nucleotide-long target region. DNA sequence analysis showed that all possible base transversions and transitions were represented.

  15. DNA Based Molecular Scale Nanofabrication

    Science.gov (United States)

    2015-12-04

    water adsorption on DNA origami template and its impact on DNA- mediated chemical reactions. We also extended the concept of DNA- mediated reaction to...addition, we have expanded our efforts to include DNA- mediated HF etching of SiÜ2, DNA- mediated nanoimprinting lithography, DNA-based patterning of self...detailed kinetics study of DNA- mediated chemical reactions. Examples of such reactions include chemical vapor deposition (CVD) of inorganic oxide and HF

  16. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    Science.gov (United States)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  17. Detecting Rare Triple Heteroplasmic Substitutions in the Mitochondrial DNA Control Region:A Potential Concern for Forensic DNA Studies

    Directory of Open Access Journals (Sweden)

    Saeid Morovvati

    2011-01-01

    Full Text Available Objective: Mitochondrial DNA (mtDNA is a useful tool for population studies, identificationof humans and forensic DNA studies. The existence of several hundreds copies ofmtDNA per cell permit its extraction from minute or degraded samples. In addition, thelevel of polymorphism in the hypervariable (HV region is high enough to permit its usein human identity testing. However, the presence of several heteroplasmy might lead toambiguous results.Materials and Methods: This study was an experiental study. This study evaluated heteroplasmyin the HV region of mtDNA in blood samples of 30 Iranians who belonged to tenunrelated families from three sequential generations (grandmother, mother and daughter.Results: There were no heteroplasmic substitutions in the HV1 region, but analysis ofHV2 showed heteroplasmic substitutions in two out ten families. In the first family thegrandmother showed heteroplasmy (T/C in nucleotide positions 146 and 151, howeverit was not detected in the mother and daughter. In second family, a triple heteroplasmy(T/C was detected in the daughter in nucleotide positions 146, 151 and 295, but theseheteroplasmic substitutions were not obvious in the grandmother and mother.Conclusion: Heteroplasmy in mtDNA is not a rare phenomenon and probably exists ineveryone, but a triple heteroplasmy in one family member is a novel finding. Our resultsdemonstrate that one or two sequence differences between samples in mtDNA do notwarrant exclusion. In our study, the average nucleotide difference between unrelated personsin the HV2 region was 2.8 nucleotides, whereas there was a triple heteroplasmy inone person which was not obvious in her family.

  18. Nanobiotechnology for hemoglobin-based blood substitutes.

    Science.gov (United States)

    Chang, T M S

    2009-04-01

    Nanobiotechnology is the assembling of biological molecules into nanodimension complexes. This has been used for the preparation of polyhemoglobin formed by the assembling of hemoglobin molecules into a soluble nanodimension complex. New generations of this approach include the nanobiotechnological assembly of hemoglobin, catalase, and superoxide dismutase into a soluble nanodimension complex. This acts as an oxygen carrier and an antioxidant for those conditions with potential for ischemiareperfusion injuries. Another recent novel approach is the assembling of hemoglobin and fibrinogen into a soluble nanodimension polyhemoglobin-fibrinogen complex that acts as an oxygen carrier with platelet-like activity. This is potentially useful in cases of extensive blood loss requiring massive replacement using blood substitutes, resulting in the need for the replacement of platelets and clotting factors. A further step is the preparation of nanodimension artificial red blood cells that contain hemoglobin and all the enzymes present in red blood cells.

  19. Emergence of fluoroquinolone-resistant Propionibacterium acnes caused by amino acid substitutions of DNA gyrase but not DNA topoisomerase IV.

    Science.gov (United States)

    Nakase, Keisuke; Sakuma, Yui; Nakaminami, Hidemasa; Noguchi, Norihisa

    2016-12-01

    With the aim of elucidating the mechanisms of fluoroquinolones resistance in Propionibacterium acnes, we determined the susceptibility of fluoroquinolones in 211 isolates from patients with acne vulgaris. We identified five isolates (2.4%) with reduced susceptibility to nadifloxacin (minimum inhibitory concentration ≥ 4 μg/ml). Determination of the sequences of the DNA gyrase (gyrA and gyrB) and DNA topoisomerase (parC and parE) genes showed the amino acid substitutions Ser101Leu and Asp105Gly of GyrA in four and one of the isolates, respectively. In vitro mutation experiments showed that low-level fluoroquinolone-resistant mutants with the Ser101Leu or Asp105Gly substitution in GyrA could be obtained from selection with ciprofloxacin and levofloxacin. The pattern of substitution (Ser101Trp in GyrA) caused by nadifloxacin selection was different from that induced by the other fluoroquinolones. In the isolation of further high-level resistant mutants, acquisition of another amino acid substitution of GyrB in addition to those of GyrA was detected, but there were no substitutions of ParC and ParE. In addition, the mutant prevention concentration and mutation frequency of nadifloxacin were lowest among the tested fluoroquinolones. The growth of the Ser101Trp mutant was lower than that of the other mutants. Our findings suggest that the Ser101Trp mutant of P. acnes emerges rarely and disappears immediately, and the risk for the prevalence of fluoroquinolones-resistant P. acnes differs according to the GyrA mutation type. To our knowledge, this study is the first to demonstrate the mechanisms of resistance to fluoroquinolones in P. acnes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Affinity modification of EcoRII DNA methyltransferase by the dialdehyde-substituted DNA duplexes: mapping the enzyme region that interacts with DNA.

    Science.gov (United States)

    Gritsenko, Oksana M; Koudan, Elizaveta V; Mikhailov, Sergey N; Ermolinsky, Boris S; Van Aerschot, Arthur; Herdewijn, Piet; Gromova, Elizaveta S

    2002-01-01

    Affinity modification of EcoRII DNA methyltransferase (M x EcoRII) by DNA duplexes containing oxidized 2'-O-beta-D-ribofuranosylcytidine (Crib*) or 1-(beta-D-galactopyranosyl)thymine (Tgal*) residues was performed. Cross-linking yields do not change irrespective of whether active Crib* replaces an outer or an inner (target) deoxycytidine within the EcoRII recognition site. Chemical hydrolysis of M x EcoRII in the covalent cross-linked complex with the Tgal*-substituted DNA indicates the region Gly268-Met391 of the methylase that is likely to interact with the DNA sugar-phosphate backbone. Both specific and non-specific DNA interact with the same M x EcoRII region. Our results support the theoretically predicted DNA binding region of M x EcoRII.

  1. Regiospecific Photocyclization of Mono- and Bis-Styryl-Substituted N-Heterocycles: A Synthesis of DNA-Binding Benzo[c]quinolizinium Derivatives.

    Science.gov (United States)

    Aliyeu, Tseimur M; Berdnikova, Daria V; Fedorova, Olga A; Gulakova, Elena N; Stremmel, Christopher; Ihmels, Heiko

    2016-10-07

    Regiospecific C-N photocyclization of mono- and bis-styryl-substituted N-heterocycles was investigated. We demonstrated that the C-N regiospecificity of the photoinduced electrocyclization is a general feature of ortho-styryl-substituted N-heterocycles comprising one and two nitrogen atoms. This phototransformation provides a straightforward synthesis of the pharmaceutically important benzo[c]quinolizinium cation and its aza-analogues. Noticeably, bis-styryl derivatives undergo only one-fold cyclization with the second styryl fragment remaining uninvolved in the cyclization process. Photocyclization products of monostyryl derivativatives intercalate into calf thymus DNA (ct DNA), whereas photocyclization products of bis-styryl derivativatives possess a mixed binding mechanism with ct DNA. The results can be used for development of novel DNA-targeting chemotherapeutics based on benzo[c]quinolizinium derivatives.

  2. DNA-based hybrid catalysis.

    Science.gov (United States)

    Rioz-Martínez, Ana; Roelfes, Gerard

    2015-04-01

    In the past decade, DNA-based hybrid catalysis has merged as a promising novel approach to homogeneous (asymmetric) catalysis. A DNA hybrid catalysts comprises a transition metal complex that is covalently or supramolecularly bound to DNA. The chiral microenvironment and the second coordination sphere interactions provided by the DNA are key to achieve high enantioselectivities and, often, additional rate accelerations in catalysis. Nowadays, current efforts are focused on improved designs, understanding the origin of the enantioselectivity and DNA-induced rate accelerations, expanding the catalytic scope of the concept and further increasing the practicality of the method for applications in synthesis. Herein, the recent developments will be reviewed and the perspectives for the emerging field of DNA-based hybrid catalysis will be discussed.

  3. DNA-Based Nanopore Sensing.

    Science.gov (United States)

    Liu, Lei; Wu, Hai-Chen

    2016-12-05

    Nanopore sensing is an attractive, label-free approach that can measure single molecules. Although initially proposed for rapid and low-cost DNA sequencing, nanopore sensors have been successfully employed in the detection of a wide variety of substrates. Early successes were mostly achieved based on two main strategies by 1) creating sensing elements inside the nanopore through protein mutation and chemical modification or 2) using molecular adapters to enhance analyte recognition. Over the past five years, DNA molecules started to be used as probes for sensing rather than substrates for sequencing. In this Minireview, we highlight the recent research efforts of nanopore sensing based on DNA-mediated characteristic current events. As nanopore sensing is becoming increasingly important in biochemical and biophysical studies, DNA-based sensing may find wider applications in investigating DNA-involving biological processes. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A single amino acid substitution confers enhanced methylation activity of mammalian Dnmt3b on chromatin DNA.

    Science.gov (United States)

    Shen, Li; Gao, Ge; Zhang, Ying; Zhang, He; Ye, Zhiqiang; Huang, Shichao; Huang, Jinyan; Kang, Jiuhong

    2010-10-01

    Dnmt3a and Dnmt3b are paralogous enzymes responsible for de novo DNA methylation but with distinguished biological functions. In mice, disruption of Dnmt3b but not Dnmt3a causes global DNA hypomethylation, especially in repetitive sequences, which comprise the large majority of methylated DNA in the genome. By measuring DNA methylation activity of Dnmt3a and Dnmt3b homologues from five species, we found that mammalian Dnmt3b possessed significantly higher methylation activity on chromatin DNA than Dnmt3a and non-mammalian Dnmt3b. Sequence comparison and mutagenesis experiments identified a single amino acid substitution (I662N) in mammalian Dnmt3b as being crucial for its high chromatin DNA methylation activity. Further mechanistic studies demonstrated this substitution markedly enhanced the binding of Dnmt3b to nucleosomes and hence increased the chromatin DNA methylation activity. Moreover, this substitution was crucial for Dnmt3b to efficiently methylate repetitive sequences, which increased dramatically in mammalian genomes. Consistent with our observation that Dnmt3b evolved more rapidly than Dnmt3a during the emergence of mammals, these results demonstrated that the I662N substitution in mammalian Dnmt3b conferred enhanced chromatin DNA methylation activity and contributed to functional adaptation in the epigenetic system.

  5. Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide

    DEFF Research Database (Denmark)

    Nielsen, P.E.; Egholm, M.; Berg, R.H.

    1991-01-01

    A polyamide nucleic acid (PNA) was designed by detaching the deoxyribose phosphate backbone of DNA in a computer model and replacing it with an achiral polyamide backbone. On the basis of this model, oligomers consisting of thymine-linked aminoethylglycyl units were prepared. These oligomers...... recognize their complementary target in double-stranded DNA by strand displacement The displacement is made possible by the extraordinarily high stability of the PNA-DNA hybrids. The results show that the backbone of DNA can be replaced by a polyamide, with the resulting oligomer retaining base...

  6. An Optimal Seed Based Compression Algorithm for DNA Sequences

    Directory of Open Access Journals (Sweden)

    Pamela Vinitha Eric

    2016-01-01

    Full Text Available This paper proposes a seed based lossless compression algorithm to compress a DNA sequence which uses a substitution method that is similar to the LempelZiv compression scheme. The proposed method exploits the repetition structures that are inherent in DNA sequences by creating an offline dictionary which contains all such repeats along with the details of mismatches. By ensuring that only promising mismatches are allowed, the method achieves a compression ratio that is at par or better than the existing lossless DNA sequence compression algorithms.

  7. Binding and interaction of di- and tri-substituted organometallic triptycene palladium complexes with DNA.

    Science.gov (United States)

    Kumari, Rina; Bhowmick, Sourav; Das, Neeladri; Das, Prolay

    2014-10-01

    Two triptycene-based ligands with pendant bromophenyl units have been prepared. These triptycene derivatives have been used as synthons for the synthesis of di and tri nuclear palladium complexes. The organic molecules and their corresponding organometallic complexes have been fully characterized using nuclear magnetic resonance (NMR), infrared (IR) spectroscopy and mass spectrometry. The mode of binding and effect of the complexes on pUC19 plasmid, calf thymus DNA and oligomer duplex DNA have been investigated by a host of analytical methods. The complexes brought about unwinding of supercoiled plasmid and the unwinding angle was found to be related to the binding affinity of the complexes with DNA, where both these parameters were guided by the structure of the complexes. Concentration-dependent inhibition of endonuclease activity of SspI and BamHI by the complexes indicates preference for G/C sequence for binding to DNA. However, neither the complexes did not introduce any cleavage at abasic site in oligomer duplex DNA, nor they created linear form of the plasmid upon co-incubation with the DNA samples. The interactions of the complexes with DNA were found to be strongly guided by the structure of the complexes, where intercalation as well as groove binding was observed, without inflicting any damage to the DNA. The mode of interaction of the complexes with DNA was further confirmed by isothermal calorimetry.

  8. Detection of soybean in soy-based meat substitutes.

    Science.gov (United States)

    Abd Allah, M A; Foda, Y H; el-Dashlouty, S; el-Sanafiry, N Y; Abu Salem, F M

    1986-01-01

    The statistical analysis of the available data indicated that the straight line equations of protein, fat, fibre, calcium, methionine, and lysine could successively be used for forecasting the added soy percent in a given recipe. On the other hand, the areas of the identified bands in the electropherograms of the investigated samples were considered a reasonable tool for the quantitative determination of whole soybean in soy-based meat substitutes.

  9. Quantifying the elevation of mitochondrial DNA evolutionary substitution rates over nuclear rates in the intertidal copepod Tigriopus californicus.

    Science.gov (United States)

    Willett, Christopher S

    2012-06-01

    Mitochondrial DNA (mtDNA) genomes generally evolve rapidly in animals, but considerable variation in the rates of evolution of mtDNA occurs among taxa. Higher levels of mutation will tend to increase the amount of polymorphism, which should also scale with population size, but there are mixed signals from previous studies on the evolutionary outcomes of the interactions of these processes. The copepod Tigriopus californicus provides an interesting model in which to study the evolution of mtDNA because it has high levels of divergence among populations and there is the suggestion that this divergence could be involved in reproductive isolation. This species also appears to have an elevated mtDNA substitution rate, but previous studies did not provide an accurate measurement. This article examines the rate of mtDNA substitution versus nuclear substitution in T. californicus and finds that the mtDNA rate for synonymous sites averages 55-fold higher, a level that exceeds the rates found in most other invertebrates. Levels of polymorphism are also examined in both mtDNA and nuclear genes, and it is shown that the effective population size of mtDNA genes is much lower than that of nuclear genes. In addition, no correlation between polymorphism in mtDNA and nuclear genes is found across populations, which suggest factors other than demography may shape polymorphism in this species. The results from this study suggest that mtDNA is evolving at a very rapid rate in this copepod species, and this could increase the likelihood that mtDNA evolution is involved in the generation of reproductive isolation.

  10. An Epitope-Substituted DNA Vaccine Improves Safety and Immunogenicity against Dengue Virus Type 2.

    Directory of Open Access Journals (Sweden)

    Chung-Tao Tang

    Full Text Available Dengue virus (DENV, a global disease, is divided into four serotypes (DENV1-4. Cross-reactive and non-neutralizing antibodies against envelope (E protein of DENV bind to the Fcγ receptors (FcγR of cells, and thereby exacerbate viral infection by heterologous serotypes via antibody-dependent enhancement (ADE. Identification and modification of enhancing epitopes may mitigate enhancement of DENV infection. In this study, we characterized the cross-reactive DB21-6 and DB39-2 monoclonal antibodies (mAbs against domain I-II of DENV; these antibodies poorly neutralized and potently enhanced DENV infection both in vitro and in vivo. In addition, two enhancing mAbs, DB21-6 and DB39-2, were observed to compete with sera antibodies from patients infected with dengue. The epitopes of these enhancing mAbs were identified using phage display, structural prediction, and mapping of virus-like particle (VLP mutants. N8, R9, V12, and E13 are the reactive residues of DB21-6, while N8, R9, and E13 are the reactive residues of DB39-2. N8 substitution tends to maintain VLP secretion, and decreases the binding activity of DB21-6 and DB39-2. The immunized sera from N8 substitution (N8R DNA vaccine exerted greater neutralizing and protective activity than wild-type (WT-immunized sera, both in vitro and in vivo. Furthermore, treatment with N8R-immunized sera reduced the enhancement of mortality in AG129 mice. These results support identification and substitution of enhancing epitope as a novel strategy for developing safe dengue vaccines.

  11. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    Science.gov (United States)

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved.

  12. Chiroplasmonic DNA-based nanostructures

    Science.gov (United States)

    Cecconello, Alessandro; Besteiro, Lucas V.; Govorov, Alexander O.; Willner, Itamar

    2017-09-01

    Chiroplasmonic properties of nanoparticles, organized using DNA-based nanostructures, have attracted both theoretical and experimental interest. Theory suggests that the circular dichroism spectra accompanying chiroplasmonic nanoparticle assemblies are controlled by the sizes, shapes, geometries and interparticle distances of the nanoparticles. In this Review, we present different methods to assemble chiroplasmonic nanoparticle or nanorod systems using DNA scaffolds, and we discuss the operations of dynamically reconfigurable chiroplasmonic nanostructures. The chiroplasmonic properties of the different systems are characterized by circular dichroism and further supported by high-resolution transmission electron microscopy or cryo-transmission electron microscopy imaging and theoretical modelling. We also outline the applications of chiroplasmonic assemblies, including their use as DNA-sensing platforms and as functional systems for information processing and storage. Finally, future perspectives in applying chiroplasmonic nanoparticles as waveguides for selective information transfer and their use as ensembles for chiroselective synthesis are discussed. Specifically, we highlight the upscaling of the systems to device-like configurations.

  13. Different type of DNA damage caused by three aziridinyl substituted cyclophosphazenes in a human small cell lung carcinoma cell line

    NARCIS (Netherlands)

    Zijlstra, J G; de Jong, Steven; van de Grampel, J C; de Vries, Liesbeth; Mulder, N H

    Aziridinyl substituted cyclophosphazenes are a new group of inorganic chemical agents with in vitro and in vivo cytotoxic activity. We investigated the mode of action on DNA of three different compounds, 1,3,3,5,5-pentakis (1-aziridinyl)-1 lambda 6,2,4,6,3 lambda 5,5 lambda 5-thiatriazadiphosphorine

  14. Ortho-substituted triptycene-based diamines, monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Ghanem, Bader Saleh

    2017-04-13

    Described herein are ortho-dimethyl-substituted and tetramethyi-substituted triptycene-containing diamine monomers and microporous triptycene-based poiyimides and poiyamides, and methods of making the monomers and polymers.

  15. Substitution and Haplotype Diversity Analysis on The Partial Sequence of The Mitochondrial DNA Cyt b of Indonesian Swamp Buffalo (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Akhmad Sukri

    2015-10-01

    Full Text Available This research aims to investigate the substitution pattern of nucleotide base and haplotype diversity of Indonesian swamp buffalo (Bubalus bubalis based on the mitochondrial DNA cyt b partial gene sequence. 17 samples were chosen from 7 different regions with each uniquely represents Indonesian biogeography which comprise Aceh, Riau, Madiun, Blitar, Lombok, South Borneo and Tana Toraja. The result of cyt b gene sequence alignment showed the presence of transition and transversion substitutions and the absence of insertion and deletion. The amount of transitions was found to be higher than that of transversions and the amount of substitution in pyrimidine was also higher than that in purine. The highest amount of transitions happened in base TàC which is a silent substitution. The result of median joining network analysis showed that Indonesian haplotype Bubalus bubalis could be classified into 16 haplotypes which form different haplogroups unique to their geographical region. The result of median joining network analysis also indicated that the genetic relationships of swamp buffaloes (Bubalus bubalis in Indonesia are highly influenced by their geographical locations.

  16. Molecular Design of Ionization-Induced Proton Switching Element Based on Fluorinated DNA Base Pair.

    Science.gov (United States)

    Tachikawa, Hiroto; Kawabata, Hiroshi

    2016-03-10

    To design theoretically the high-performance proton switching element based on DNA base pair, the effects of fluorine substitution on the rate of proton transfer (PT) in the DNA model base pair have been investigated by means of direct ab initio molecular dynamics (AIMD) method. The 2-aminopyridine dimer, (AP)2, was used as the model of the DNA base pair. One of the hydrogen atoms of the AP molecule in the dimer was substituted by a fluorine (F) atom, and the structures of the dimer, expressed by F-(AP)2, were fully optimized at the MP2/6-311++G(d,p) level. The direct AIMD calculations showed that the proton is transferred within the base pair after the vertical ionization. The rates of PT in F-(AP)2(+) were calculated and compared with that of (AP)2(+) without an F atom. It was found that PT rate is accelerated by the F-substitution. Also, the direction of PT between F-AP and AP molecules can be clearly controlled by the position of F-substitution (AP)2 in the dimer.

  17. DNA Microarray-Based Diagnostics.

    Science.gov (United States)

    Marzancola, Mahsa Gharibi; Sedighi, Abootaleb; Li, Paul C H

    2016-01-01

    The DNA microarray technology is currently a useful biomedical tool which has been developed for a variety of diagnostic applications. However, the development pathway has not been smooth and the technology has faced some challenges. The reliability of the microarray data and also the clinical utility of the results in the early days were criticized. These criticisms added to the severe competition from other techniques, such as next-generation sequencing (NGS), impacting the growth of microarray-based tests in the molecular diagnostic market.Thanks to the advances in the underlying technologies as well as the tremendous effort offered by the research community and commercial vendors, these challenges have mostly been addressed. Nowadays, the microarray platform has achieved sufficient standardization and method validation as well as efficient probe printing, liquid handling and signal visualization. Integration of various steps of the microarray assay into a harmonized and miniaturized handheld lab-on-a-chip (LOC) device has been a goal for the microarray community. In this respect, notable progress has been achieved in coupling the DNA microarray with the liquid manipulation microsystem as well as the supporting subsystem that will generate the stand-alone LOC device.In this chapter, we discuss the major challenges that microarray technology has faced in its almost two decades of development and also describe the solutions to overcome the challenges. In addition, we review the advancements of the technology, especially the progress toward developing the LOC devices for DNA diagnostic applications.

  18. Substitutions in the amino-terminal tail of neurospora histone H3 have varied effects on DNA methylation.

    Directory of Open Access Journals (Sweden)

    Keyur K Adhvaryu

    2011-12-01

    Full Text Available Eukaryotic genomes are partitioned into active and inactive domains called euchromatin and heterochromatin, respectively. In Neurospora crassa, heterochromatin formation requires methylation of histone H3 at lysine 9 (H3K9 by the SET domain protein DIM-5. Heterochromatin protein 1 (HP1 reads this mark and directly recruits the DNA methyltransferase, DIM-2. An ectopic H3 gene carrying a substitution at K9 (hH3(K9L or hH3(K9R causes global loss of DNA methylation in the presence of wild-type hH3 (hH3(WT. We investigated whether other residues in the N-terminal tail of H3 are important for methylation of DNA and of H3K9. Mutations in the N-terminal tail of H3 were generated and tested for effects in vitro and in vivo, in the presence or absence of the wild-type allele. Substitutions at K4, K9, T11, G12, G13, K14, K27, S28, and K36 were lethal in the absence of a wild-type allele. In contrast, mutants bearing substitutions of R2, A7, R8, S10, A15, P16, R17, K18, and K23 were viable. The effect of substitutions on DNA methylation were variable; some were recessive and others caused a semi-dominant loss of DNA methylation. Substitutions of R2, A7, R8, S10, T11, G12, G13, K14, and P16 caused partial or complete loss of DNA methylation in vivo. Only residues R8-G12 were required for DIM-5 activity in vitro. DIM-5 activity was inhibited by dimethylation of H3K4 and by phosphorylation of H3S10, but not by acetylation of H3K14. We conclude that the H3 tail acts as an integrating platform for signals that influence DNA methylation, in part through methylation of H3K9.

  19. Many amino acid substitution variants identified in DNA repair genes during human population screenings are predicted to impact protein function

    Energy Technology Data Exchange (ETDEWEB)

    Xi, T; Jones, I M; Mohrenweiser, H W

    2003-11-03

    Over 520 different amino acid substitution variants have been previously identified in the systematic screening of 91 human DNA repair genes for sequence variation. Two algorithms were employed to predict the impact of these amino acid substitutions on protein activity. Sorting Intolerant From Tolerant (SIFT) classified 226 of 508 variants (44%) as ''Intolerant''. Polymorphism Phenotyping (PolyPhen) classed 165 of 489 amino acid substitutions (34%) as ''Probably or Possibly Damaging''. Another 9-15% of the variants were classed as ''Potentially Intolerant or Damaging''. The results from the two algorithms are highly associated, with concordance in predicted impact observed for {approx}62% of the variants. Twenty one to thirty one percent of the variant proteins are predicted to exhibit reduced activity by both algorithms. These variants occur at slightly lower individual allele frequency than do the variants classified as ''Tolerant'' or ''Benign''. Both algorithms correctly predicted the impact of 26 functionally characterized amino acid substitutions in the APE1 protein on biochemical activity, with one exception. It is concluded that a substantial fraction of the missense variants observed in the general human population are functionally relevant. These variants are expected to be the molecular genetic and biochemical basis for the associations of reduced DNA repair capacity phenotypes with elevated cancer risk.

  20. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  1. General-base catalysed hydrolysis and nucleophilic substitution of activated amides in aqueous solutions

    NARCIS (Netherlands)

    Buurma, NJ; Blandamer, MJ; Engberts, JBFN; Buurma, Niklaas J.

    2003-01-01

    The reactivity of 1-benzoyl-3-phenyl-1,2,4-triazole (1a) was studied in the presence of a range of weak bases in aqueous solution. A change in mechanism is observed from general-base catalysed hydrolysis to nucleophilic substitution and general-base catalysed nucleophilic substitution. A slight tend

  2. Supramolecular metal complex systems based on crown-substituted tetrapyrroles

    Energy Technology Data Exchange (ETDEWEB)

    Tsivadze, Aslan Yu [Institute of Physical Chemistry, Russian Academy of Sciences, Moscow (Russian Federation)

    2004-01-31

    The characteristic features of the structures and properties of crown-substituted porphyrinates and phthalocyaninates are considered. Interactions of these compounds with alkali metal salts yield supramolecular ensembles. The factors determining the architecture of such ensembles are described.

  3. Metallic Nanostructures Based on DNA Nanoshapes

    Directory of Open Access Journals (Sweden)

    Boxuan Shen

    2016-08-01

    Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.

  4. Reversible Data Hiding Based on DNA Computing

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2017-01-01

    Full Text Available Biocomputing, especially DNA, computing has got great development. It is widely used in information security. In this paper, a novel algorithm of reversible data hiding based on DNA computing is proposed. Inspired by the algorithm of histogram modification, which is a classical algorithm for reversible data hiding, we combine it with DNA computing to realize this algorithm based on biological technology. Compared with previous results, our experimental results have significantly improved the ER (Embedding Rate. Furthermore, some PSNR (peak signal-to-noise ratios of test images are also improved. Experimental results show that it is suitable for protecting the copyright of cover image in DNA-based information security.

  5. Increased frequency of single base substitutions in a population of transcripts expressed in cancer cells

    Directory of Open Access Journals (Sweden)

    Bianchetti Laurent

    2012-11-01

    Full Text Available Abstract Background Single Base Substitutions (SBS that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. Methods We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE and Tag-seq (a combination of L-SAGE and deep sequencing, and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT, i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. Results In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP, catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST, i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC, healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. Conclusion If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic.

  6. Low pressure microfluidic-based DNA fragmentation

    NARCIS (Netherlands)

    Shui, Lingling; Sparreboom, Wouter; Bomer, Johan G.; Jin, Mingliang; Carlen, Edwin; van den Berg, Albert

    2011-01-01

    We report a low-pressure microfluidic deoxyribonucleic acid (DNA) fragmentation device based on a combination of me-chanical hydrodynamic shearing and low temperature sample heating. Conventional DNA fragmentation based on hydrody-namic shearing is capable of achieving fragment lengths (FL) < 10k bp

  7. Millimetre-wave isolator based on Al substituted Ba ferrite

    Science.gov (United States)

    Ustinov, A. B.; Vinnik, D. A.; Belyavskii, P. Yu; Gudkova, S. A.; Zakharchuk, I.; Lähderanta, E.

    2016-11-01

    A mm-wave isolator is fabricated and studied. The operating frequency of the devices is 78.5 GHz. A bandwidth at the level of -3 dB equals 1.6 GHz. The device used a flux grown single-crystal aluminum substituted barium ferrite.

  8. Treatment of xerostomia with polymer-based saliva substitutes in patients with Sjogren's syndrome

    NARCIS (Netherlands)

    vanderReijden, WA; vanderKwaak, H; Vissink, A; Veerman, ECI; Amerongen, AVN

    1996-01-01

    Objective. To determine the efficacy of 3 types of polymer-based saliva substitutes in reducing oral dryness in patients with Sjogren's syndrome (SS). Methods. Subjective efficacy of 3 different saliva substitutes (determined by self-administered questionnaire) was evaluated in a double-blind, place

  9. DNA-based applications in nanobiotechnology.

    Science.gov (United States)

    Abu-Salah, Khalid M; Ansari, Anees A; Alrokayan, Salman A

    2010-01-01

    Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

  10. DNA-based assembly lines and nanofactories.

    Science.gov (United States)

    Simmel, Friedrich C

    2012-08-01

    With the invention of the DNA origami technique, DNA self-assembly has reached a new level of sophistication. DNA can now be used to arrange molecules and other nanoscale components into almost arbitrary geometries-in two and even three dimensions and with nanometer precision. One exciting prospect is the realization of dynamic systems based on DNA, in which chemical reactions are precisely controlled by the spatial arrangement of components, ultimately resulting in nanoscale analogs of molecular assembly lines or 'nanofactories'. This review will discuss recent progress toward this goal, ranging from DNA-templated synthesis over artificial DNA-based enzyme cascades to first examples of 'molecular robots'. Copyright © 2012. Published by Elsevier Ltd.

  11. Alternative DNA base pairing through metal coordination.

    Science.gov (United States)

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  12. Is Quantitative HBsAg Measurement a Reliable Substitute for HBV DNA Quantitation?

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Mahdavi

    2015-07-01

    Conclusion: There are many factors affecting the correlation between serum HBV DNA copy number and HBsAg level such as genotype of HBV virus, phase of infection, methods of measurement, HBeAg status, and drug and types of treatment procedures. Therefore, these factors should be considered in further studies dealing with the correlation between quantitative HBV DNA and HBsAg tests.

  13. Substitutions of short heterologous DNA segments of intragenomic or extragenomic origins produce clustered genomic polymorphisms

    DEFF Research Database (Denmark)

    Harms, Klaus; Lunnan, Asbjørn; Hülter, Nils;

    2016-01-01

    In a screen for unexplained mutation events we identified a previously unrecognized mechanism generating clustered DNA polymorphisms such as microindels and cumulative SNPs. The mechanism, short-patch double illegitimate recombination (SPDIR), facilitates short single-stranded DNA molecules...... to invade and replace genomic DNA through two joint illegitimate recombination events. SPDIR is controlled by key components of the cellular genome maintenance machinery in the gram-negative bacterium Acinetobacter baylyi. The source DNA is primarily intragenomic but can also be acquired through horizontal...... gene transfer. The DNA replacements are nonreciprocal and locus independent. Bioinformatic approaches reveal occurrence of SPDIR events in the gram-positive human pathogen Streptococcus pneumoniae and in the human genome....

  14. In Vitro Antitumor Activity of a Keggin Vanadium-Substituted Polyoxomolybdate and Its ctDNA Binding Properties

    Directory of Open Access Journals (Sweden)

    Wen Qi

    2015-01-01

    Full Text Available A Keggin vanadium-substituted polyoxomolybdate, K5PMo10V2O40 (PMo10V2, has been synthesized and it’s antitumor effect against Hela cells was investigated. The calf thymus DNA (ctDNA binding ability of PMo10V2 was also evaluated by UV-Vis absorption spectra and fluorescence spectra. The identity and high purity of PMo10V2 was confirmed by elemental analysis and IR analysis. And the antitumor activity test of PMo10V2 was carried out on Hela cancer cells line by MTT assay. The results of MTT assay show that PMo10V2 significantly reduced the viability of Hela cells in a dose-dependent manner and exhibited stronger inhibitory activity against Hela cells at an IC50 of 800 μg/mL, which is more effective than the positive control, 5-Fu (P<0.05. The results of the UV-Vis absorption spectra and fluorescence spectra indicated the groove or outside stacking binding between PMo10V2 and ctDNA. These results show that the antitumor activity of PMo10V2 may be caused by the interactions between DNA and PMo10V2.

  15. QPSO-based adaptive DNA computing algorithm.

    Science.gov (United States)

    Karakose, Mehmet; Cigdem, Ugur

    2013-01-01

    DNA (deoxyribonucleic acid) computing that is a new computation model based on DNA molecules for information storage has been increasingly used for optimization and data analysis in recent years. However, DNA computing algorithm has some limitations in terms of convergence speed, adaptability, and effectiveness. In this paper, a new approach for improvement of DNA computing is proposed. This new approach aims to perform DNA computing algorithm with adaptive parameters towards the desired goal using quantum-behaved particle swarm optimization (QPSO). Some contributions provided by the proposed QPSO based on adaptive DNA computing algorithm are as follows: (1) parameters of population size, crossover rate, maximum number of operations, enzyme and virus mutation rate, and fitness function of DNA computing algorithm are simultaneously tuned for adaptive process, (2) adaptive algorithm is performed using QPSO algorithm for goal-driven progress, faster operation, and flexibility in data, and (3) numerical realization of DNA computing algorithm with proposed approach is implemented in system identification. Two experiments with different systems were carried out to evaluate the performance of the proposed approach with comparative results. Experimental results obtained with Matlab and FPGA demonstrate ability to provide effective optimization, considerable convergence speed, and high accuracy according to DNA computing algorithm.

  16. QPSO-Based Adaptive DNA Computing Algorithm

    Directory of Open Access Journals (Sweden)

    Mehmet Karakose

    2013-01-01

    Full Text Available DNA (deoxyribonucleic acid computing that is a new computation model based on DNA molecules for information storage has been increasingly used for optimization and data analysis in recent years. However, DNA computing algorithm has some limitations in terms of convergence speed, adaptability, and effectiveness. In this paper, a new approach for improvement of DNA computing is proposed. This new approach aims to perform DNA computing algorithm with adaptive parameters towards the desired goal using quantum-behaved particle swarm optimization (QPSO. Some contributions provided by the proposed QPSO based on adaptive DNA computing algorithm are as follows: (1 parameters of population size, crossover rate, maximum number of operations, enzyme and virus mutation rate, and fitness function of DNA computing algorithm are simultaneously tuned for adaptive process, (2 adaptive algorithm is performed using QPSO algorithm for goal-driven progress, faster operation, and flexibility in data, and (3 numerical realization of DNA computing algorithm with proposed approach is implemented in system identification. Two experiments with different systems were carried out to evaluate the performance of the proposed approach with comparative results. Experimental results obtained with Matlab and FPGA demonstrate ability to provide effective optimization, considerable convergence speed, and high accuracy according to DNA computing algorithm.

  17. Fluorescent trimethyl-substituted naphthyridine as a label-free signal reporter for one-step and highly sensitive fluorescent detection of DNA in serum samples.

    Science.gov (United States)

    Wang, Jiamian; Wang, Xiuyun; Wu, Shuo; Che, Ruping; Luo, Pinchen; Meng, Changgong

    2017-01-15

    A facile label-free sensing method is developed for the one-step and highly sensitive fluorescent detection of DNA, which couples the specific C-C mismatch bonding and fluorescent quenching property of a trimethyl-substituted naphthyridine dye (ATMND) with the exonuclease III (Exo III) assisted cascade target recycling amplification strategy. In the absence of target DNA, the DNA hairpin probe with a C-C mismatch in the stem and more than 4 bases overhung at the 3' terminus could entrap and quench the fluorescence of ATMND and resist the digestion of Exo III, thus showing a low fluorescence background. In the presence of the target, however, the hybridization event between the two protruding segments and the target triggers the digestion reaction of Exo III, recycles the initial target, and simultaneously releases both the secondary target analogue and the ATMND caged in the stem. The released initial and secondary targets take part in another cycle of digestion, thus leading to the release of a huge amount of free ATMND for signal transducing. Based on the fluorescence recovery, the as-proposed label-free fluorescent sensing strategy shows very good analytical performances towards DNA detection, such as a wide linear range from 10pM to 1μM, a low limit of detection of 6pM, good selectivity, and a facile one-step operation at room temperature. Practical sample analysis in serum samples indicates the method has good precision and accuracy, which may thus have application potentials for point-of-care screening of DNA in complex clinical and environmental samples.

  18. Synthesis, Characterization and Antibacterial Activity of Some Halo Substituted Schiff Bases

    Directory of Open Access Journals (Sweden)

    S. B. Junne

    2010-01-01

    Full Text Available Some new halo substituted Schiff bases have been prepared from different aromatic aldehydes and a series of substituted aromatic amines to form a number of potentially biologically active compounds. The structures of the Schiff bases have been characterized by using IR and 1HNMR spectroscopy. These compounds were screened against human pathogenic bacteria by agar diffusion method. Ampicillin was used as control.

  19. DNA Coding Based Knowledge Discovery Algorithm

    Institute of Scientific and Technical Information of China (English)

    LI Ji-yun; GENG Zhao-feng; SHAO Shi-huang

    2002-01-01

    A novel DNA coding based knowledge discovery algorithm was proposed, an example which verified its validity was given. It is proved that this algorithm can discover new simplified rules from the original rule set efficiently.

  20. NUCHLEOPHILIC SUBSTITUTION REACTION OF CYANIDE AND METHOXYDE IONS TO QUATERNARY MANNICH BASE FROM VANILLIN

    Directory of Open Access Journals (Sweden)

    Bambang Purwono

    2010-06-01

    Full Text Available The nucleophilic substitution reaction to quaternary Mannich base from vanillin has been investigated. Mannich reaction to vanillin was carried out by refluxing mixture of vanillin, formaldehyde and dimethyl amine. Quaternary ammonium halide salt was obtained from reaction of Mannich vanillin base with methyl iodide in THF solvents and yielded  93.28%. Nucleophilic substituion to the halide salts with cyanide nucleophile produced 4-hidroxy-3-methoxy-5-(cyanomethylbenzaldehyde in 54.39% yield, with methoxyde ion obtained  4-hidroxy- 3-methoxy-5-(methoxy-methyl-benzaldehide in 67.80% yield. The nucleophilic substitution reaction showed that substituen of trimethylamino quaternary Mannich base can act as a good leaving on nucleophilic reaction substitutions.   Keywords: Mannich Reaction, Vanillin, nucleophilic substitution.

  1. NUCLEOPHILIC SUBSTITUTION REACTION OF CYANIDE AND METHOXYDE IONS TO QUATERNARY MANNICH BASE FROM VANILLIN

    Directory of Open Access Journals (Sweden)

    Bambang Purwono

    2010-06-01

    Full Text Available The nucleophilic substitution reaction to quaternary Mannich base from vanillin has been investigated. Mannich reaction to vanillin was carried out by refluxing mixture of vanillin, formaldehyde and dimethyl amine. Quaternary ammonium halide salt was obtained from reaction of Mannich vanillin base with methyl iodide in THF solvents and yielded 93.28 %. Nucleophilic substituion to the halide salts with cyanide nucleophile produced 4-hidroxy-3-methoxy-5-(cyanomethylbenzaldehyde in 54.39% yield. Reaction with methoxyde ion yielded 4-hydroxy- 3-methoxy-5-(methoxy -methylbenzaldehyde in 67.80% yield. The nucleophilic substitution reaction showed that trimethylamino substituent of quaternary Mannich base can act as a good leaving group on nucleophilic substitution reactions. Keywords: Mannich reaction, vanillin, nucleophilic substitution

  2. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  3. Spectroscopic, molecular docking and structural activity studies of (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazide derivatives for DNA binding and their biological screening

    Science.gov (United States)

    Arshad, Nasima; Perveen, Fouzia; Saeed, Aamer; Channar, Pervaiz Ali; Farooqi, Shahid Iqbal; Larik, Fayaz Ali; Ismail, Hammad; Mirza, Bushra

    2017-07-01

    Acid catalyzed condensation of isoniazid with a number of suitably substituted aromatic and heterocyclic aldehydes was carried out in dry ethanol to afford the title (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazides (SF 1 - SF 4) in good yields. These compounds were characterized and further investigated for their binding with ds.DNA using UV- spectroscopy and molecular docking and for antitumor and antimicrobial potentials. A good correlation was found among spectroscopic, theoretical and biological results. UV- spectra in the presence of DNA concentrations and their data interpretation in terms binding constant ;Kb; and free energy change (ΔG) provided evidences for the significant and spontaneous binding of the compounds with DNA. Molecular docking studies and structural analysis further supported the UV-findings and indicated that the modes of interactions between bromo- (SF 1) and flouro- (SF 4) substituted isonicotinohydrazides is intercalation while methoxy- (SF 2) and hydroxy- (SF 3) substituted isonicotinohydrazides interact with DNA helix via groove binding. SF 1 exhibited comparatively higher Kb value (UV-; 8.07 × 103 M-1, docking; 8.11 × 103 M-1) which inferred that the respective compound muddles to DNA most powerfully. SF 1 has shown the lowest IC50 (345.3 μg/mL) value among all the compounds indicating its comparatively highest activity towards tumor inhibition. None of the compound has shown perceptible antibacterial and antifungal activities.

  4. UMD‐Predictor: A High‐Throughput Sequencing Compliant System for Pathogenicity Prediction of any Human cDNA Substitution

    Science.gov (United States)

    Salgado, David; Desvignes, Jean‐Pierre; Rai, Ghadi; Blanchard, Arnaud; Miltgen, Morgane; Pinard, Amélie; Lévy, Nicolas; Collod‐Béroud, Gwenaëlle

    2016-01-01

    ABSTRACT Whole‐exome sequencing (WES) is increasingly applied to research and clinical diagnosis of human diseases. It typically results in large amounts of genetic variations. Depending on the mode of inheritance, only one or two correspond to pathogenic mutations responsible for the disease and present in affected individuals. Therefore, it is crucial to filter out nonpathogenic variants and limit downstream analysis to a handful of candidate mutations. We have developed a new computational combinatorial system UMD‐Predictor (http://umd‐predictor.eu) to efficiently annotate cDNA substitutions of all human transcripts for their potential pathogenicity. It combines biochemical properties, impact on splicing signals, localization in protein domains, variation frequency in the global population, and conservation through the BLOSUM62 global substitution matrix and a protein‐specific conservation among 100 species. We compared its accuracy with the seven most used and reliable prediction tools, using the largest reference variation datasets including more than 140,000 annotated variations. This system consistently demonstrated a better accuracy, specificity, Matthews correlation coefficient, diagnostic odds ratio, speed, and provided the shortest list of candidate mutations for WES. Webservices allow its implementation in any bioinformatics pipeline for next‐generation sequencing analysis. It could benefit to a wide range of users and applications varying from gene discovery to clinical diagnosis. PMID:26842889

  5. Optimization of the BLASTN substitution matrix for prediction of non-specific DNA microarray hybridization

    DEFF Research Database (Denmark)

    Eklund, Aron Charles; Friis, Pia; Wernersson, Rasmus;

    2010-01-01

    DNA microarray measurements are susceptible to error caused by non-specific hybridization between a probe and a target (cross-hybridization), or between two targets (bulk-hybridization). Search algorithms such as BLASTN can quickly identify potentially hybridizing sequences. We set out to improve...

  6. DNA segregation in Escherichia coli cells with 5-bromodeoxyuridine-substituted nucleoids.

    Science.gov (United States)

    Cánovas, J L; Tresguerres, E F; Yousif, A M; López-Sáez, J F; Navarrete, M H

    1984-01-01

    The pattern of segregation of DNA in Escherichia coli K-12 was analyzed by labeling replicating DNA with 5-bromodeoxyuridine followed by differential staining of nucleoids. Three types of visible arrangement were found in four-nucleoid groups derived from a native nucleoid after two replication rounds. Type A, segregation of both old strands toward cell poles, appeared with the highest frequency (0.6 to 0.8). Type B, segregation of one old strand toward the cell pole and the other toward the cell center, was twice as frequent as type C, segregation of both old strands toward the cell center. These results confirm previous data showing that DNA segregation in E. coli is nonrandom while presenting a certain degree of randomness. The proportions of the three indicated types of arrangement suggest a new probabilistic model to explain the observed segregation pattern. It is proposed that DNA strands segregate either nonrandomly, with a probability of between 0 and 1, or randomly. In nonrandom segregation, both old strands are always directed toward cell poles. Experimental data reported here or by other authors fit better with the predictions of this model than with those of other previously proposed proposed deterministic or probabilistic models. Images PMID:6370953

  7. Ab-initio electronic structure method for substitutional disorder applied to iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Herbig, Alexander

    2016-02-12

    An ab-initio electronic structure method for substitutionally disordered real materials is developed within a pseudopotential density functional theory approach. The method is validated against exact diagonalization and for simple disordered CuZn alloys. The developed method is applied to iron-based superconductors. In particular, band renormalization effects due to various chemical substitutions in BaFe{sub 2}As{sub 2} are investigated and their Cooper pair breaking effects are compared.

  8. DNA Sequence Optimization Based on Continuous Particle Swarm Optimization for Reliable DNA Computing and DNA Nanotechnology

    Directory of Open Access Journals (Sweden)

    N. K. Khalid

    2008-01-01

    Full Text Available Problem statement: In DNA based computation and DNA nanotechnology, the design of good DNA sequences has turned out to be an essential problem and one of the most practical and important research topics. Basically, the DNA sequence design problem is a multi-objective problem and it can be evaluated using four objective functions, namely, Hmeasure, similarity, continuity and hairpin. Approach: There are several ways to solve multi-objective problem, however, in order to evaluate the correctness of PSO algorithm in DNA sequence design, this problem is converted into single objective problem. Particle Swarm Optimization (PSO is proposed to minimize the objective in the problem, subjected to two constraints: melting temperature and GCcontent. A model is developed to present the DNA sequence design based on PSO computation. Results: Based on experiments and researches done, 20 particles are used in the implementation of the optimization process, where the average values and the standard deviation for 100 runs are shown along with comparison to other existing methods. Conclusion: The results achieve verified that PSO can suitably solves the DNA sequence design problem using the proposed method and model, comparatively better than other approaches.

  9. Interaction of Hypocrellin B or Mono-cysteine Substituted Hypocrellin B with CT-DNA by Spectral Methods

    Institute of Scientific and Technical Information of China (English)

    Jia Hong ZHOU; Sheng Qin XIA; Xue Song WANG; Bao Wen ZHANG; Yi CAO

    2003-01-01

    The interaction of the anticancer drag hypocrellin B (HB) or the mono-cysteinesubstituted hypocrellin B (MCHB) and calf thymus deoxyribonucleic acid (CT-DNA) has beeninvestigated using spectral methods. The results of UV-visible spectra show that the HB andMCHB could intercalate into the base-stacking domain of the CT-DNA double helix. The studiesof fluorescence spectra and circular dichroism(CD) spectra also support the interacalationmechanism.

  10. Substitution of glutamate residue by lysine in the dimerization domain affects DNA binding ability of HapR by inducing structural deformity in the DNA binding domain.

    Directory of Open Access Journals (Sweden)

    Richa Singh

    Full Text Available HapR has been given the status of a high cell density master regulatory protein in Vibrio cholerae. Though many facts are known regarding its structural and functional aspects, much still can be learnt from natural variants of the wild type protein. This work aims at investigating the nature of functional inertness of a HapR natural variant harboring a substitution of a conserved glutamate residue at position 117 which participates in forming a salt bridge by lysine (HapRV2G-E(117K. Experimental evidence presented here reveals the inability of this variant to interact with various cognate promoters by in vitro gel shift assay. Furthermore, the elution profiles of HapRV2G-E(117K protein along with the wild type functional HapRV2G in size-exclusion chromatography as well as circular dichroism spectra did not reflect any significant differences in its structure, thereby indicating the intactness of dimer in the variant protein. To gain further insight into the global shape of the proteins, small angle X-ray scattering analysis (SAXS was performed. Intriguingly, increased radius of gyration of HapRV2G-E(117K of 27.5 Å in comparison to the wild type protein from SAXS data analyses implied a significant alteration in the global shape of the dimeric HapRV2G-E(117K protein. Structure reconstruction brought forth that the DNA binding domains were substantially "parted away" in this variant. Taken together, our data illustrates that substitution of the conserved glutamate residue by lysine in the dimerization domain induces separation of the two DNA binding domains from their native-like positioning without altering the dimeric status of HapR variant.

  11. Substitution of glutamate residue by lysine in the dimerization domain affects DNA binding ability of HapR by inducing structural deformity in the DNA binding domain.

    Science.gov (United States)

    Singh, Richa; Rathore, Yogendra Singh; Singh, Naorem Santa; Peddada, Nagesh; Ashish; Raychaudhuri, Saumya

    2013-01-01

    HapR has been given the status of a high cell density master regulatory protein in Vibrio cholerae. Though many facts are known regarding its structural and functional aspects, much still can be learnt from natural variants of the wild type protein. This work aims at investigating the nature of functional inertness of a HapR natural variant harboring a substitution of a conserved glutamate residue at position 117 which participates in forming a salt bridge by lysine (HapRV2G-E(117)K). Experimental evidence presented here reveals the inability of this variant to interact with various cognate promoters by in vitro gel shift assay. Furthermore, the elution profiles of HapRV2G-E(117)K protein along with the wild type functional HapRV2G in size-exclusion chromatography as well as circular dichroism spectra did not reflect any significant differences in its structure, thereby indicating the intactness of dimer in the variant protein. To gain further insight into the global shape of the proteins, small angle X-ray scattering analysis (SAXS) was performed. Intriguingly, increased radius of gyration of HapRV2G-E(117)K of 27.5 Å in comparison to the wild type protein from SAXS data analyses implied a significant alteration in the global shape of the dimeric HapRV2G-E(117)K protein. Structure reconstruction brought forth that the DNA binding domains were substantially "parted away" in this variant. Taken together, our data illustrates that substitution of the conserved glutamate residue by lysine in the dimerization domain induces separation of the two DNA binding domains from their native-like positioning without altering the dimeric status of HapR variant.

  12. Configuration-sensitive infrared bands and vibrational assignments of S-alkyldithizones based on isotopic substitutions

    Science.gov (United States)

    Yamada, Osamu; Hiura, Hidehumi; Igarashi, Takashi; Kaneko, Norio; Takahashi, Hiroaki

    By comparison of the infrared spectra of S-methyl-, S-ethyl- and S-isopropyidithizones in the solid state, the configuration-sensitive i.r. bands have been obtained for the trans-syn-s-trans and trans-anti-s-trans configurations with respect to the NN, CN and CN bonds of the formazan skeleton. The vibrational assignment of S-methyldithizone has been made based on the frequency shifts on isotopic substitutions: 1,5- 15N- and 2,4- 15N- substitutions, deuterium substitutions of the methyl group, phenyl groups and NH group, and deuterium substitutions of both phenyl and NH groups.

  13. Luminescent DNA- and agar-based membranes.

    Science.gov (United States)

    Leones, R; Fernandes, M; Ferreira, R A S; Cesarino, I; Lima, J F; Carlos, L D; Bermudez, V de Zea; Magon, C J; Donoso, J P; Silva, M M; Pawlicka, A

    2014-09-01

    Luminescent materials containing europium ions are investigated for different optical applications. They can be obtained using bio-macromolecules, which are promising alternatives to synthetic polymers based on the decreasing oil resources. This paper describes studies of the DNA- and Agar-europium triflate luminescent membranes and its potential technological applications are expanded to electroluminescent devices. Polarized optical microscopy demonstrated that the samples are birefringent with submicrometer anisotropy. The X-ray diffraction analysis revealed predominantly amorphous nature of the samples and the atomic force microscopy images showed a roughness of the membranes of 409.0 and 136.1 nm for the samples of DNA10Eu and Agar1.11Eu, respectively. The electron paramagnetic resonance spectra of the DNA(n)Eu membranes with the principal lines at g ≈ 2.0 and g ≈ 4.8 confirmed uniform distribution of rare earth ions in a disordered matrix. Moreover, these strong and narrow resonance lines for the samples of DNA(n)Eu when compared to the Agar(n)Eu suggested a presence of paramagnetic radicals arising from the DNA matrix. The emission spectra suggested that the Eu3+ ions occupy a single local environment in both matrices and the excitation spectra monitored around the Eu emission lines pointed out that the Eu3+ ions in the Agar host were mainly excited via the broad band component rather than by direct intra-4f(6) excitation, whereas the opposite case occurred for the DNA-based sample.

  14. Reversed DNA strand cleavage specificity in initiation of Cre-LoxP recombination induced by the His289Ala active-site substitution.

    Science.gov (United States)

    Gelato, Kathy A; Martin, Shelley S; Baldwin, Enoch P

    2005-11-25

    During the first steps of site-specific recombination, Cre protein cleaves and religates a specific homologous pair of LoxP strands to form a Holliday junction (HJ) intermediate. The HJ is resolved into recombination products through exchange of the second homologous strand pair. CreH289A, containing a His to Ala substitution in the conserved R-H-R catalytic motif, has a 150-fold reduced recombination rate and accumulates HJs. However, to produce these HJs, CreH289A exchanges the opposite set of strands compared to wild-type Cre (CreWT). To investigate how CreH289A and CreWT impose strand exchange order, we characterized their reactivities and strand cleavage preferences toward LoxP duplex and HJ substrates containing 8bp spacer substitutions. Remarkably, CreH289A had different and often opposite strand exchange preferences compared to CreWT with nearly all substrates. CreH289N was much less perturbed, implying that overall recombination rate and strand exchange depend more on His289 hydrogen bonding capability than on its acid/base properties. LoxP substitutions immediately 5' (S1 nucleotide) or 3' (S1' nucleotide) of the scissile phosphate had large effects on substrate utilization and strand exchange order. S1' substitutions, designed to alter base-unstacking events concomitant with Cre-induced LoxP bending, caused HJ accumulation and dramatically inverted the cleavage preferences. That pre-formed HJs were resolved via either strand in vitro suggests that inhibition of the "conformational switch" isomerization required to trigger the second strand exchange accounts for the observed HJ accumulation. Rather than reflecting CreWT behavior, CreH289A accumulates HJs of opposite polarity through a combination of its unique cleavage specificity and an HJ isomerization defect. The overall implication is that cleavage specificity is mediated by sequence-dependent DNA deformations that influence the scissile phosphate positioning and reactivity. A role of His289 may be to

  15. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  16. Substitution of Ala for Tyr567 in RB69 DNA Polymerase Allows dAMP and dGMP To Be Inserted opposite Guanidinohydantoin

    Energy Technology Data Exchange (ETDEWEB)

    Beckman, J.; Wang, M; Blaha, G; Wang, J; Konigsberg, W

    2010-01-01

    Continuous oxidative damage inflicted on DNA produces 7,8-dihydro-8-oxoguanine (8-oxoG), a commonly occurring lesion that can potentially cause cancer by producing G {yields} T transversions during DNA replication. Mild oxidation of 8-oxoG leads to the formation of hydantoins, specifically guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), which are 100% mutagenic because they encode almost exclusively the insertion of dAMP and dGMP (encoding G {yields} T and G {yields} C transversions, respectively). The wild-type (wt) pol {alpha} family DNA polymerase from bacteriophage RB69 (RB69pol) inserts dAMP and dGMP with low efficiency when situated opposite Gh. In contrast, the RB69pol Y567A mutant inserts both of these dNMPs opposite Gh with >100-fold higher efficiency than wt. We now report the crystal structure of the 'closed' preinsertion complex for the Y567A mutant with dATP opposite a templating Gh (R-configuration) in a 13/18mer primer-template (P/T) at 2.0 {angstrom} resolution. The structure data reveal that the Y to A substitution provides the nascent base pair binding pocket (NBP) with the flexibility to accommodate Gh by allowing G568 to move in the major-to-minor groove direction of the P/T. Thus, Gh is rejected as a templating base by wt RB69pol because G568 is inflexible, preventing Gh from pairing with the incoming dATP or dGTP base.

  17. A Markov chain Monte Carlo Expectation Maximization Algorithm for Statistical Analysis of DNA Sequence Evolution with Neighbor-Dependent Substitution Rates

    DEFF Research Database (Denmark)

    Hobolth, Asger

    2008-01-01

    The evolution of DNA sequences can be described by discrete state continuous time Markov processes on a phylogenetic tree. We consider neighbor-dependent evolutionary models where the instantaneous rate of substitution at a site depends on the states of the neighboring sites. Neighbor-dependent s...

  18. Cytotoxicity and DNA interactions of some platinum(II) complexes with substituted benzimidazole ligands.

    Science.gov (United States)

    Ozçelik, Azime Berna; Utku, Semra; Gümüş, Fatma; Keskin, Ayten Çelebi; Açık, Leyla; Yılmaz, Sükran; Ozgüngör, Adeviye

    2012-06-01

    In the present study, four Pt(II) complexes with 2-ethyl (1)/or benzyl (2)/or p-chlorobenzyl (3)/or 2-phenoxymethyl (4) benzimidazole carrier ligands were evaluated for their in vitro cytotoxic activities against the human HeLa cervix, oestrogen receptor-positive MCF-7 breast, and oestrogen receptor-negative MDA-MB 231 breast cancer cell lines. The plasmid DNA interactions and inhibition of the BamHI restriction enzyme activities of the complexes were also studied. Complex 3 was found to be more active than carboplatin for all examined cell lines and comparable with cisplatin, except for the HeLa cell line.

  19. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    Science.gov (United States)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  20. Random Coding Bounds for DNA Codes Based on Fibonacci Ensembles of DNA Sequences

    Science.gov (United States)

    2008-07-01

    COVERED (From - To) 6 Jul 08 – 11 Jul 08 4. TITLE AND SUBTITLE RANDOM CODING BOUNDS FOR DNA CODES BASED ON FIBONACCI ENSEMBLES OF DNA SEQUENCES ... sequences which are generalizations of the Fibonacci sequences . 15. SUBJECT TERMS DNA Codes, Fibonacci Ensembles, DNA Computing, Code Optimization 16...coding bound on the rate of DNA codes is proved. To obtain the bound, we use some ensembles of DNA sequences which are generalizations of the Fibonacci

  1. Substituted Polyfluorene-Based Hole Transport Layer with Tunable Solubility

    OpenAIRE

    Craciun, N. I.; Wildeman, J.; Blom, P. W. M.

    2010-01-01

    We report on the synthesis and electrical characterization of polyfluorene-triarylamine-based hole transport layers (HTLs). The solubility of the HTL can be tuned by adjustment of the chemical structure without loss of the charge transport properties. Double-layer polymer light-emitting diodes are constructed with an HTL that is not soluble in toluene at room temperature, combined with a poly(p-phenylene vinylene) (PPV)-derivative-based light-emitting layer. The addition of the HTL enhances t...

  2. Fluorescence Visual Detection of Herbal Product Substitutions at Terminal Herbal Markets by CCP-based FRET technique

    Science.gov (United States)

    Jiang, Chao; Yuan, Yuan; Yang, Guang; Jin, Yan; Liu, Libing; Zhao, Yuyang; Huang, Luqi

    2016-01-01

    Inaccurate labeling of materials used in herbal products may compromise the therapeutic efficacy and may pose a threat to medicinal safety. In this paper, a rapid (within 3 h), sensitive and visual colorimetric method for identifying substitutions in terminal market products was developed using cationic conjugated polymer-based fluorescence resonance energy transfer (CCP-based FRET). Chinese medicinal materials with similar morphology and chemical composition were clearly distinguished by the single-nucleotide polymorphism (SNP) genotyping method. Assays using CCP-based FRET technology showed a high frequency of adulterants in Lu-Rong (52.83%) and Chuan-Bei-Mu (67.8%) decoction pieces, and patented Chinese drugs (71.4%, 5/7) containing Chuan-Bei-Mu ingredients were detected in the terminal herbal market. In comparison with DNA sequencing, this protocol simplifies procedures by eliminating the cumbersome workups and sophisticated instruments, and only a trace amount of DNA is required. The CCP-based method is particularly attractive because it can detect adulterants in admixture samples with high sensitivity. Therefore, the CCP-based detection system shows great potential for routine terminal market checks and drug safety controls. PMID:27765955

  3. Synthesis and Biological Activities of Substituted Triazolethione Schiff Base

    Institute of Scientific and Technical Information of China (English)

    SUN, Xiao-Hong; TAO, Yan; LIU, Yuan-Fa; CHEN, Bang

    2007-01-01

    Six novel Schiff bases have been synthesized by the condensation reaction of 4-amino-5-(4-pyridyl)-2,4-dihydro-1,2,4-triazole-3-thione with various benzaldehydes. The structures of the compounds have been confirmed by 1H NMR, IR and elemental analysis. The preliminary bioassay indicated that the title compounds possessed good fungicidal activities to several vegetable pathogens.

  4. Substituted polyfluorene-based hole transport layer with tunable solubility

    NARCIS (Netherlands)

    Craciun, N.I.; Wildeman, J.; Blom, P.W.M.

    2010-01-01

    We report on the synthesis and electrical characterization of polyfluorene-triarylamine-based hole transport layers (HTLs). The solubility of the HTL can be tuned by adjustment of the chemical structure without loss of the charge transport properties. Double-layer polymer light-emitting diodes are c

  5. Substituted Polyfluorene-Based Hole Transport Layer with Tunable Solubility

    NARCIS (Netherlands)

    Craciun, N. I.; Wildeman, J.; Blom, P. W. M.

    2010-01-01

    We report on the synthesis and electrical characterization of polyfluorene-triarylamine-based hole transport layers (HTLs). The solubility of the HTL can be tuned by adjustment of the chemical structure without loss of the charge transport properties. Double-layer polymer light-emitting diodes are c

  6. Bone Substitute Fabrication Based on Dissolution-Precipitation Reactions

    Directory of Open Access Journals (Sweden)

    Kunio Ishikawa

    2010-02-01

    Full Text Available Although block- or granular-type sintered hydroxyapatite are known to show excellent tissue responses and good osteoconductivity, apatite powder elicits inflammatory response. For the fabrication of hydroxyapatite block or granules, sintering is commonly employed. However, the inorganic component of bone and tooth is not high crystalline hydroxyapatite but low crystalline B-type carbonate apatite. Unfortunately, carbonate apatite powder cannot be sintered due to its instability at high temperature. Another method to fabricate apatite block and/or granule is through phase transformation based on dissolution-precipitation reactions using a precursor phase. This reaction basically is the same as a setting and hardening reaction of calcium sulfate or plaster. In this paper, apatite block fabrication methods by phase transformation based on dissolution-precipitation reactions will be discussed, with a focus on the similarity of the setting and hardening reaction of calcium sulfate.

  7. A Comparative Analysis of the Costs of Substitute Care and Family Based Services. Monograph 2.

    Science.gov (United States)

    Hutchinson, Janet

    Family based services attempt to maintain and strengthen the client family and prevent family dissolution and the placement of a child or several children in substitute care. This study compared programs that serve children and their families in their home. Variances in program costs were attributed to differences in number of casework hours per…

  8. Communication: Electron ionization of DNA bases

    Science.gov (United States)

    Rahman, M. A.; Krishnakumar, E.

    2016-04-01

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.

  9. Substitution of Ala564 in the first zinc cluster of the deoxyribonucleic acid (DNA)-binding domain of the androgen receptor by Asp, Asn, or Leu exerts differential effects on DNA binding

    NARCIS (Netherlands)

    H.T. Brüggenwirth (Hennie); A.L.M. Boehmer (Annemie); J.M. Lobaccaro; L. Chiche; C. Sultan; J. Trapman (Jan); A.O. Brinkmann (Albert)

    1998-01-01

    textabstractIn the androgen receptor of a patient with androgen insensitivity, the alanine residue at position 564 in the first zinc cluster of the DNA-binding domain was substituted by aspartic acid. In other members of the steroid receptor family, either valine or ala

  10. Memory-Based Simple Heuristics as Attribute Substitution: Competitive Tests of Binary Choice Inference Models.

    Science.gov (United States)

    Honda, Hidehito; Matsuka, Toshihiko; Ueda, Kazuhiro

    2016-07-20

    Some researchers on binary choice inference have argued that people make inferences based on simple heuristics, such as recognition, fluency, or familiarity. Others have argued that people make inferences based on available knowledge. To examine the boundary between heuristic and knowledge usage, we examine binary choice inference processes in terms of attribute substitution in heuristic use (Kahneman & Frederick, 2005). In this framework, it is predicted that people will rely on heuristic or knowledge-based inference depending on the subjective difficulty of the inference task. We conducted competitive tests of binary choice inference models representing simple heuristics (fluency and familiarity heuristics) and knowledge-based inference models. We found that a simple heuristic model (especially a familiarity heuristic model) explained inference patterns for subjectively difficult inference tasks, and that a knowledge-based inference model explained subjectively easy inference tasks. These results were consistent with the predictions of the attribute substitution framework. Issues on usage of simple heuristics and psychological processes are discussed.

  11. Genetic structure of Xiphinema pachtaicum and X. index populations based on mitochondrial DNA variation.

    Science.gov (United States)

    Gutiérrez-Gutiérrez, Carlos; Castillo, Pablo; Cantalapiedra-Navarrete, Carolina; Landa, Blanca B; Derycke, Sofie; Palomares-Rius, Juan E

    2011-10-01

    The dagger nematodes Xiphinema pachtaicum and X. index are two of the most widespread and frequently occurring Xiphinema spp. co-infesting vineyards and other crops and natural habitats worldwide. Sexual reproduction is rare in these species. The primary objective of this study was to determine the genetic structure of X. pachtaicum and X. index populations using eight and seven populations, respectively, from different "wine of denomination of origin (D.O.) zones" in Spain and Sardinia (Italy), by studying mitochondrial (cytochrome oxidase c subunit 1 or COI) and nuclear (D2-D3 expansion segments of 28S rDNA) markers. Both Xiphinema spp. showed low intraspecific divergence among COI sequences, ranging from 0.2% (1 base substitution) to 2.3% (10 substitutions) in X. pachtaicum and from 0.2% (1 base substitution) to 0.4% (2 substitutions) in X. index. Population genetic structure was strong for both species. Nevertheless, molecular differences among grapevine-growing areas were not significant, and intrapopulation diversity was very low. It is hypothesized that this genetic homogeneity in the nematode populations reflects their predominant parthenogenetic reproduction mode and low dispersal abilities. Our results also show that X. pachtaicum populations in Spain have possibly been established from two different populations of origin. Results also demonstrated that the two DNA regions studied are suitable diagnostic markers for X. index and X. pachtaicum.

  12. Changes in DNA base sequence induced by gamma-ray mutagenesis of lambda phage and prophage

    Energy Technology Data Exchange (ETDEWEB)

    Tindall, K.R.; Stein, J.; Hutchinson, F.

    1988-04-01

    Mutations in the cI (repressor) gene were induced by gamma-ray irradiation of lambda phage and of prophage, and 121 mutations were sequenced. Two-thirds of the mutations in irradiated phage assayed in recA host cells (no induction of the SOS response) were G:C to A:T transitions; it is hypothesized that these may arise during DNA replication from adenine mispairing with a cytosine product deaminated by irradiation. For irradiated phage assayed in host cells in which the SOS response had been induced, 85% of the mutations were base substitutions, and in 40 of the 41 base changes, a preexisting base pair had been replaced by an A:T pair; these might come from damaged bases acting as AP (apurinic or apyrimidinic) sites. The remaining mutations were 1 and 2 base deletions. In irradiated prophage, base change mutations involved the substitution of both A:T and of G:C pairs for the preexisting pairs; the substitution of G:C pairs shows that some base substitution mechanism acts on the cell genome but not on the phage. In the irradiated prophage, frameshifts and a significant number of gross rearrangements were also found.

  13. DNA methylation profiling using bisulfite-based epityping of pooled genomic DNA.

    Science.gov (United States)

    Docherty, Sophia J; Davis, Oliver S P; Haworth, Claire M A; Plomin, Robert; Mill, Jonathan

    2010-11-01

    DNA methylation plays a vital role in normal cellular function, with aberrant methylation signatures being implicated in a growing number of human pathologies and complex human traits. Methods based on the modification of genomic DNA with sodium bisulfite are considered the 'gold-standard' for DNA methylation profiling on genomic DNA; however they require large amounts of DNA and may be prohibitively expensive when used on the large sample sizes necessary to detect small effects. DNA pooling approaches are already widely used in large-scale studies of DNA sequence and gene expression. In this paper, we describe the application of this economical DNA pooling technique to the study of DNA methylation profiles. This method generates accurate quantitative assessments of group DNA methylation averages, reducing the time, cost and amount of DNA starting material required for large-scale epigenetic investigation of disease phenotypes.

  14. Orbital-selective Mott phase of Cu-substituted iron-based superconductors

    Science.gov (United States)

    Liu, Yang; Zhao, Yang-Yang; Song, Yun

    2016-07-01

    We study the phase transition in Cu-substituted iron-based superconductors with a new developed real-space Green’s function method. We find that Cu substitution has strong effect on the orbital-selective Mott transition introduced by the Hund’s rule coupling. The redistribution of the orbital occupancy which is caused by the increase of the Hund’s rule coupling, gives rise to the Mott-Hubbard metal-insulator transition in the half-filled d xy orbital. We also find that more and more electronic states appear inside that Mott gap of the d xy orbital with the increase of Cu substitution, and the in-gap states around the Fermi level are strongly localized at some specific lattice sites. Further, a distinctive phase diagram, obtained for the Cu-substituted Fe-based superconductors, displays an orbital-selective insulating phase, as a result of the cooperative effect of the Hund’s rule coupling and the impurity-induced disorder.

  15. A1/A2-Diamino-Substituted Pillar[5]arene-Based Acid-Base-Responsive Host-Guest System.

    Science.gov (United States)

    Hu, Wei-Bo; Hu, Wen-Jing; Zhao, Xiao-Li; Liu, Yahu A; Li, Jiu-Sheng; Jiang, Biao; Wen, Ke

    2016-05-06

    An acid-base-responsive supramolecular host-guest system based on a planarly chiral A1/A2-diamino-substituted pillar[5]arene (1)/imidazolium ion recognition motif was created. The pillar[4]arene[1]diaminobenzene 1 can bring an electron-deficient imidazolium cation into its cylindrically shaped cavity under neutral or basic conditions and release it under acidic conditions.

  16. DNA-Based Vaccine Protects Against Zika in Animal Study

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_161959.html DNA-Based Vaccine Protects Against Zika in Animal Study ... In animals infected with Zika virus, the synthetic DNA-based vaccine was 100 percent effective in protecting ...

  17. DNA-Based Vaccine Guards Against Zika in Monkey Study

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_161106.html DNA-Based Vaccine Guards Against Zika in Monkey Study ... THURSDAY, Sept. 22, 2016 (HealthDay News) -- An experimental DNA-based vaccine protected monkeys from infection with the ...

  18. Feature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein Domains

    Directory of Open Access Journals (Sweden)

    Branislava Gemovic

    2013-01-01

    Full Text Available There are more than 500 amino acid substitutions in each human genome, and bioinformatics tools irreplaceably contribute to determination of their functional effects. We have developed feature-based algorithm for the detection of mutations outside conserved functional domains (CFDs and compared its classification efficacy with the most commonly used phylogeny-based tools, PolyPhen-2 and SIFT. The new algorithm is based on the informational spectrum method (ISM, a feature-based technique, and statistical analysis. Our dataset contained neutral polymorphisms and mutations associated with myeloid malignancies from epigenetic regulators ASXL1, DNMT3A, EZH2, and TET2. PolyPhen-2 and SIFT had significantly lower accuracies in predicting the effects of amino acid substitutions outside CFDs than expected, with especially low sensitivity. On the other hand, only ISM algorithm showed statistically significant classification of these sequences. It outperformed PolyPhen-2 and SIFT by 15% and 13%, respectively. These results suggest that feature-based methods, like ISM, are more suitable for the classification of amino acid substitutions outside CFDs than phylogeny-based tools.

  19. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas

    2012-06-06

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  20. A Secure and Efficient Image Encryption Scheme Based on Tent Map and Permutation-substitution Architecture

    Directory of Open Access Journals (Sweden)

    Ruisong Ye

    2014-03-01

    Full Text Available A secure image encryption scheme based on 2D skew tent map is proposed for the encryption of color images. The proposed encryption scheme is composed of one permutation process and one substitution process. The 3D color plain-image matrix is converted to 2D image matrix first, then 2D skew tent map is utilized to generate chaotic sequences, which are used for both permutation process and substitution process. The chaotic sequence for permutation process is dependent on plain-image and cipher keys, resulting in good key sensitivity and plaintext sensitivity. The substitution process is first initiated with the initial vectors generated by the cipher keys and 2D skew tent map, then the gray values of row and column pixels of 2D image matrix are mixed with the pseudorandom number sequences via bitxoring operation. Both permutation process and substitution process are executed row-by-row and column-by-column instead of pixel-by-pixel to improve the speed of encryption. The security and performance of the proposed image encryption have been analyzed, including histograms, correlation coefficients, information entropy, key sensitivity analysis, key space analysis, differential analysis, encryption/decryption rate analysis etc. All the experimental results suggest that the proposed image encryption scheme is robust and secure and can be used for secure image and video communication applications.

  1. Bioactive behavior of silicon substituted calcium phosphate based bioceramics for bone regeneration.

    Science.gov (United States)

    Khan, Ather Farooq; Saleem, Muhammad; Afzal, Adeel; Ali, Asghar; Khan, Afsar; Khan, Abdur Rahman

    2014-02-01

    Bone graft substitutes are widely used for bone regeneration and repair in defect sites resulting from aging, disease, trauma, or accident. With invariably increasing clinical demands, there is an urgent need to produce artificial materials, which are readily available and are capable of fast and guided skeletal repair. Calcium phosphate based bioactive ceramics are extensively utilized in bone regeneration and repair applications. Silicon is often utilized as a substituent or a dopant in these bioceramics, since it significantly enhances the ultimate properties of conventional biomaterials such as surface chemical structure, mechanical strength, bioactivity, biocompatibility, etc. This article presents an overview of the silicon substituted bioceramics, which have emerged as efficient bone replacement and bone regeneration materials. Thus, the role of silicon in enhancing the biological performance and bone forming capabilities of conventional calcium phosphate based bioceramics is identified and reviewed.

  2. Substitution of Ala for Tyr567 in RB69 DNA Polymerase Allows dAMP To Be Inserted Opposite 7,8-Dihydro-8-oxoguanine

    Energy Technology Data Exchange (ETDEWEB)

    Beckman, J.; Wang, M; Blaha, G; Wang, J; Konigsberg, W

    2010-01-01

    Accurate copying of the genome by DNA polymerases is challenging due in part to the continuous damage inflicted on DNA, which results from its contact with reactive oxygen species (ROS), producing lesions such as 7,8-dihydro-8-oxoguanine (8-oxoG). The deleterious effects of 8-oxoG can be attributed to its dual coding potential that leads to G {yields} T transversions. The wild-type (wt) pol {alpha} family DNA polymerase from bacteriophage RB69 (RB69pol) prefers to insert dCMP as opposed to dAMP when situated opposite 8-oxoG by >2 orders of magnitude as demonstrated using pre-steady-state kinetics (k{sub pol}/K{sub d,app}). In contrast, the Y567A mutant of RB69pol inserts both dCMP and dAMP opposite 8-oxoG rapidly and with equal efficiency. We have determined the structures of preinsertion complexes for the Y567A mutant with dATP and dCTP opposite a templating 8-oxoG in a 13/18mer primer-template (P/T) at resolutions of 2.3 and 2.1 {angstrom}, respectively. Our structures show that the 8-oxoG residue is in the anti conformation when paired opposite dCTP, but it flips to a syn conformation forming a Hoogstein base pair with an incoming dATP. Although the Y567A substitution does not significantly change the volume of the pocket occupied by anti-8-oxoG, it does provide residue G568 the flexibility to move deeper into the minor groove of the P/T to accommodate, and stabilize, syn-8-oxoG. These results support the hypothesis that it is the flexibility of the nascent base pair binding pocket (NBP) in the Y567A mutant that allows efficient insertion of dAMP opposite 8-oxoG.

  3. Envisioning the molecular choreography of DNA base excision repair.

    Science.gov (United States)

    Parikh, S S; Mol, C D; Hosfield, D J; Tainer, J A

    1999-02-01

    Recent breakthroughs integrate individual DNA repair enzyme structures, biochemistry and biology to outline the structural cell biology of the DNA base excision repair pathways that are essential to genome integrity. Thus, we are starting to envision how the actions, movements, steps, partners and timing of DNA repair enzymes, which together define their molecular choreography, are elegantly controlled by both the nature of the DNA damage and the structural chemistry of the participating enzymes and the DNA double helix.

  4. Regioselective Synthesis and Base Catalyzed Transacylation of Substituted 1H-Pyrazole-4-carboxamides

    Institute of Scientific and Technical Information of China (English)

    REN,Jun(任军); ZHANG,Xiao-Hong(张晓弘); LIU,Ying(刘莹); CHEN,Wei-Qiang(陈卫强); JIN,Gui-Yu(金桂玉)

    2002-01-01

    New type of substituted 1H-pyrazole-4-carboxamides were obtained by regioselective synthesis under the catalysis of different bases. The structures of the title compounds were confirmed by elemental analysis, 1H NMR, IR, MS and X-ray crystallogaphy. Compounds 1 were transacylated into their corresponding amides 3 in the presence of sodium hydride.Preliminary bioassays indicated that some compounds showed fungicidal activities against Rhizoctonia solani and Sclerotinia sclerotiorum.

  5. First principles calculations of the site substitution behavior in gamma prime phase in nickel based superalloys

    Science.gov (United States)

    Chaudhari, Mrunalkumar

    Nickel based superalloys have superior high temperature mechanical strength, corrosion and creep resistance in harsh environments and found applications in the hot sections as turbine blades and turbine discs in jet engines and gas generator turbines in the aerospace and energy industries. The efficiency of these turbine engines depends on the turbine inlet temperature, which is determined by the high temperature strength and behavior of these superalloys. The microstructure of nickel based superalloys usually contains coherently precipitated gamma prime (gamma') Ni3Al phase within the random solid solution of the gamma (gamma) matrix, with the gamma' phase being the strengthening phase of the superalloys. How the alloying elements partition into the gamma and gamma' phases and especially in the site occupancy behaviors in the strengthening gamma' phases play a critical role in their high temperature mechanical behaviors. The goal of this dissertation is to study the site substitution behavior of the major alloying elements including Cr, Co and Ti through first principles based calculations. Site substitution energies have been calculated using the anti-site formation, the standard defect formation formalism, and the vacancy formation based formalism. Elements such as Cr and Ti were found to show strong preference for Al sublattice, whereas Co was found to have a compositionally dependent site preference. In addition, the interaction energies between Cr-Cr, Co-Co, Ti-Ti and Cr-Co atoms have also been determined. Along with the charge transfer, chemical bonding and alloy chemistry associated with the substitutions has been investigated by examining the charge density distributions and electronic density of states to explain the chemical nature of the site substitution. Results show that Cr and Co atoms prefer to be close by on either Al sublattice or on a Ni-Al mixed lattice, suggesting a potential tendency of Cr and Co segregation in the gamma' phase.

  6. High-temperature Thermoelectric and Microstructural Characteristics of Ga Substituted on the Co-site in Cobalt-based Oxides

    DEFF Research Database (Denmark)

    Van Nong, Ngo; Yanagiya, S.; Sonne, Monica;

    2011-01-01

    The effects of Ga substitution on the Co-site on the high-temperature thermoelectric properties and microstructure are investigated for the misfitlayered Ca3Co4O9 and the complex perovskite-related Sr3RECo4O10.5 (RE = rare earth) cobalt-based oxides. For both systems, substitution of Ga for Co re...

  7. Cell response of calcium phosphate based ceramics, a bone substitute material

    Directory of Open Access Journals (Sweden)

    Juliana Marchi

    2013-01-01

    Full Text Available The aim of this study was to characterize calcium phosphate ceramics with different Ca/P ratios and evaluate cell response of these materials for use as a bone substitute. Bioceramics consisting of mixtures of hydroxyapatite (HAp and β-tricalcium phosphate (β-TCP powders in different proportions were pressed and sintered. The physical and chemical properties of these bioceramics were then characterized. Characterization of the biological properties of these materials was based on analysis of cell response using cultured fibroblasts. The number of cells attached to the samples was counted from SEM images of samples exposed to cell culture solution for different periods. These data were compared by analysis of variance (ANOVA complemented by the Tukey's test. The TCP sample had higher surface roughness and lower density. The adherence and growth of FMM1 cells on samples from all groups was studied. Even though the different calcium based ceramics exhibited properties which made them suitable as bone substitutes, those with higher levels of β-TCP revealed improved cell growth on their surfaces. These observations indicated two-phase calcium phosphate based materials with a β-TCP surface layer to be a promising bone substitute.

  8. Single-Base DNA Discrimination via Transverse Ionic Transport

    CERN Document Server

    Wilson, James

    2013-01-01

    We suggest to discriminate single DNA bases via transverse ionic transport, namely by detecting the ionic current that flows in a channel while a single-stranded DNA is driven through an intersecting nanochannel. Our all-atom molecular dynamics simulations indeed show that the ionic currents of the four bases are statistically distinct, thus offering another possible approach to sequence DNA.

  9. DNA nanostructure-based imaging probes and drug carriers.

    Science.gov (United States)

    Zhan, Pengfei; Jiang, Qiao; Wang, Zhen-Gang; Li, Na; Yu, Haiyin; Ding, Baoquan

    2014-09-01

    Self-assembled DNA nanostructures are well-defined nanoscale shapes, with uniform sizes, precise spatial addressability, and excellent biocompatibility. With these features, DNA nanostructures show great potential for biomedical applications; various DNA-based biomedical imaging probes or payload delivery carriers have been developed. In this review, we summarize the recent developments of DNA-based nanostructures as tools for diagnosis and cancer therapy. The biological effects that are brought about by DNA nanostructures are highlighted by in vitro and in vivo imaging, antitumor drug delivery, and immunostimulatory therapy. The challenges and perspectives of DNA nanostructures in the field of nanomedicine are discussed.

  10. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    2017-09-03

    Sep 3, 2017 ... HBV is distributed into various genotypes based on nucleic acid sequence variation. ... compared to genotype B and higher incidence of HCC in genotype D ... DNA sequencing technology to sequence HBV DNA polymerase ...

  11. A chaos-based approach to the design of cryptographically secure substitutions

    Energy Technology Data Exchange (ETDEWEB)

    Amigo, Jose M. [Centro de Investigacion Operativa, Universidad Miguel Hernandez, 03202 Elche (Spain)]. E-mail: jm.amigo@umh.es; Szczepanski, Janusz [Institute of Fundamental Technological Research, Polish Academy of Sciences, Swietokrzyska 21, PL-00-049 Warsaw (Poland); Kocarev, Ljupco [Institute for Nonlinear Science, University of California, San Diego. 9500 Gilman Drive, La Jolla, CA 92093-0402 (United States)

    2005-08-01

    We show that chaotic maps may be used for designing so-called substitution boxes for ciphers resistant to linear and differential cryptanalysis, providing an alternative to the algebraic methods. Our approach is based on the approximation of mixing maps by periodic transformations. The expectation behind is, of course, that the nice chaotic properties of such maps will be inherited by their approximations, at least if the convergence rate is appropriate and the associated partitions are sufficiently fine. We show that this is indeed the case and that, in principle, substitutions with close-to-optimal immunity to linear and differential cryptanalysis can be designed along these guidelines. We provide also practical examples and numerical evidence for this approximation philosophy.

  12. Composite Based Chitosan/Zinc-Doped HA as a Candidate Material for Bone Substitute Applications

    Science.gov (United States)

    Wicaksono, S. T.; Rasyida, A.; Purnomo, A.; Pradita, N. N.; Ardhyananta, H.; Hidayat, M. I. P.

    2017-05-01

    The composite based Zinc-doped in Chitosan/Hydroxyapatite was successfully prepared by wet mixing method through the addition of 10, 15, and 20wt% of chitosan. The addition of Chitosan increased the compressive strength and the modulus elasticity. However, it decreased the density and the surface hardness of HA-Zn. Mechanical characterization revealed that these composites are suitable as a candidate of a cancellous bone substitute. Composite with 10% chitosan has compressive strength and modulus elasticity of 57.03 MPa and 0.15 GPa, respectively. Hence, it has the physical and mechanical properties that meet the standards as a cancellous bone substitute material. Also, in vitro biocompatibility test against BHK-21 cells exhibited non-toxic materials.

  13. Fast Fourier Transform-based Support Vector Machine for Subcellular Localization Prediction Using Different Substitution Models

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    There are approximately 109 proteins in a cell. A hotspot in bioinformatics is how to identify a protein's subcellular localization, if its sequence is known. In this paper, a method using fast Fourier transform-based support vector machine is developed to predict the subcellular localization of proteins from their physicochemical properties and structural parameters. The prediction accuracies reached 83% in prokaryotic organisms and 84% in eukaryotic organisms with the substitution model of the c-p-v matrix (c, composition; p, polarity; and v, molecular volume). The overall prediction accuracy was also evaluated using the "leave-one-out" jackknife procedure. The influence of the substitution model on prediction accuracy has also been discussed in the work. The source code of the new program is available on request from the authors.

  14. Acid-base and coordination properties of Meso-substituted porphyrins in nonaqueous solutions

    Science.gov (United States)

    Pukhovskaya, S. G.; Nam, Dao Tkhe; Fien, Chan Ding; Domanina, E. N.; Ivanova, Yu. B.; Semeikin, A. S.

    2017-09-01

    Acid-base and coordination properties of alkyl and aryl meso-substituted porphyrins are studied spectrophotometrically in nonaqueous solutions. It is found that the nature of the substituent greatly affects the basicity of ligands for porphyrins characterized by a flat structure of macrocycle. The electronic effects of substituents have a much weaker influence on the kinetics of complexing. These effects could be due to the opposite orientation of some factors: an increase in the basicity and stability of the N-H bonds of porphyrin reaction centers. Dissociation constants p K b of the cationic forms of meso-substituted derivatives of porphyrin are measured. The values of p K b are in good agreement with classic concepts of the nature of substituents, particularly those indirectly included in the macrocycle through phenyl buffer rings.

  15. VSMP for Modeling the Biodegradability of Substituted Benzenes Based on Electrotopological State Indices for Atom Types

    Institute of Scientific and Technical Information of China (English)

    LIU Shu-Shen; YIN Da-Qiang; CUI Shi-Hai; WANG Lian-Sheng

    2005-01-01

    The electrotopological state (E-state) index was employed to characterize the structures of 51 substituted benzenes. Eleven E-state indices of the compounds were calculated by the computer program developed in our laboratory. The method for variable selection and modeling based on prediction (VSMP) was used to select an optimal combination of the variables from 11 E-state descriptors. Then the optimal descriptors were employed to model the relationship between the relative biodegradability of the substituted benzenes and their molecular structures. A novel 5-descriptor linear model was developed and the model has a high quality with the correlation coefficient and the root mean square error in estimation step being 0.9378 and 0.35, respectively, and these in leave-one-out cross-validation procedure being 0.9210 and 0.39, respectively.

  16. Patterns of nucleotide substitution in angiosperm cpDNA trnL (UAA)-F(GAA) regions

    NARCIS (Netherlands)

    Bakker, F.T.; Culham, A.; Gomez-Martinez, R.; Carvalho, J.; Compton, J.; Dawtrey, R.; Gibby, M.

    2000-01-01

    Patterns of substitution in chloroplast encoded trnL-F regions were compared between species of Actaea (Ranunculales), Digitalis (Scrophulariales), Drosera (Caryophyllales), Panicoideae (Poales), the small chromosome species clade of Pelargonium (Geraniales), each representing a different order of f

  17. Solvent-dependent enthalpic versus entropic anion binding by biaryl substituted quinoline based anion receptors.

    Science.gov (United States)

    Sun, Zhan-Hu; Albrecht, Markus; Raabe, Gerhard; Pan, Fang-Fang; Räuber, Christoph

    2015-01-08

    Anion receptors based on an 8-thiourea substituted quinoline with pentafluorinated (1a) or nonfluorinated (1b) biarylamide groups in the 2-position show similar binding of halide anions with somewhat higher association constants for the more acidic fluorinated derivative. Surprisingly, binding affinities for the halides in the case of the nonfluorinated 1b are similar in nonpolar chloroform or polar DMSO as solvent. Thorough thermodynamic investigations based on NMR van't Hoff analysis show that anion binding in chloroform is mainly enthalpically driven. In DMSO, entropy is the driving force for the binding of the ions with replacement of attached solvent.

  18. A new substitution-diffusion based image cipher using chaotic standard and logistic maps

    Science.gov (United States)

    Patidar, Vinod; Pareek, N. K.; Sud, K. K.

    2009-07-01

    In this paper, we propose a new loss-less symmetric image cipher based on the widely used substitution-diffusion architecture which utilizes chaotic standard and logistic maps. It is specifically designed for the coloured images, which are 3D arrays of data streams. The initial condition, system parameter of the chaotic standard map and number of iterations together constitute the secret key of the algorithm. The first round of substitution/confusion is achieved with the help of intermediate XORing keys calculated from the secret key. Then two rounds of diffusion namely the horizontal and vertical diffusions are completed by mixing the properties of horizontally and vertically adjacent pixels, respectively. In the fourth round, a robust substitution/confusion is accomplished by generating an intermediate chaotic key stream (CKS) image in a novel manner with the help of chaotic standard and logistic maps. The security and performance of the proposed image encryption technique has been analyzed thoroughly using various statistical analysis, key sensitivity analysis, differential analysis, key space analysis, speed analysis, etc. Results of the various types of analysis are encouraging and suggest that the proposed image encryption technique is able to manage the trade offs between the security and speed and hence suitable for the real-time secure image and video communication applications.

  19. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Fei Chen

    2003-01-01

    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  20. Stereocontrol of the Schiff Base of Substituted Benzaldehyde to Staudinger Cycloaddition Reaction

    Institute of Scientific and Technical Information of China (English)

    齐传民; 杨凌春; 孙彭利

    2003-01-01

    Syntheses of 4 novel chiral azetidin-2-one derivatives,which were characterized by 1H NMR,IR,specific rotation and elemental analysis,through Staudinger cycloaddition reaction of Schiff base of benzaldehyde with chlorine substitution at different position in benzene ring,were described.For the first time,this type of 3S,4R configuration azetidin-2-one monocrystals with many chiral centers [(3S,4R)-3-hydroxy-N-[(S)-(1-phenyl)ethyl]-4-(2''-chlorophenyl)-azetidin-2-one monocrystal]were obtained,the structures of which were determined by X-ray diffraction analysis.The effects of Schiff base of benzaldehyde with chlorine substitution at different position in benzene ring on stereoselectivity of Staudinger cycloaddition reaction products were discussed and the results are showed as below:2-chlorophenyl Schiff base favored to yield 3S,4R configuration product,but 4-chlorophenyl Schiff base favored to yield 3R,4S configuration product.The reaction orientation of 2,4-dichlorophenyl Schiff base was determined by corporate effect of 2- and 4-chlorine,and that of the 4-chlorine was more obvious.In contrast to 4-chlorophenyl,although the main product was 3R,4S configuration,3-chlorophenyl owned lower selectivity.

  1. Cannabis as a Substitute for Opioid-Based Pain Medication: Patient Self-Report.

    Science.gov (United States)

    Reiman, Amanda; Welty, Mark; Solomon, Perry

    2017-01-01

    Introduction: Prescription drug overdoses are the leading cause of accidental death in the United States. Alternatives to opioids for the treatment of pain are necessary to address this issue. Cannabis can be an effective treatment for pain, greatly reduces the chance of dependence, and eliminates the risk of fatal overdose compared to opioid-based medications. Medical cannabis patients report that cannabis is just as effective, if not more, than opioid-based medications for pain. Materials and Methods: The current study examined the use of cannabis as a substitute for opioid-based pain medication by collecting survey data from 2897 medical cannabis patients. Discussion: Thirty-four percent of the sample reported using opioid-based pain medication in the past 6 months. Respondents overwhelmingly reported that cannabis provided relief on par with their other medications, but without the unwanted side effects. Ninety-seven percent of the sample "strongly agreed/agreed" that they are able to decrease the amount of opiates they consume when they also use cannabis, and 81% "strongly agreed/agreed" that taking cannabis by itself was more effective at treating their condition than taking cannabis with opioids. Results were similar for those using cannabis with nonopioid-based pain medications. Conclusion: Future research should track clinical outcomes where cannabis is offered as a viable substitute for pain treatment and examine the outcomes of using cannabis as a medication assisted treatment for opioid dependence.

  2. Empirical codon substitution matrix

    Directory of Open Access Journals (Sweden)

    Gonnet Gaston H

    2005-06-01

    Full Text Available Abstract Background Codon substitution probabilities are used in many types of molecular evolution studies such as determining Ka/Ks ratios, creating ancestral DNA sequences or aligning coding DNA. Until the recent dramatic increase in genomic data enabled construction of empirical matrices, researchers relied on parameterized models of codon evolution. Here we present the first empirical codon substitution matrix entirely built from alignments of coding sequences from vertebrate DNA and thus provide an alternative to parameterized models of codon evolution. Results A set of 17,502 alignments of orthologous sequences from five vertebrate genomes yielded 8.3 million aligned codons from which the number of substitutions between codons were counted. From this data, both a probability matrix and a matrix of similarity scores were computed. They are 64 × 64 matrices describing the substitutions between all codons. Substitutions from sense codons to stop codons are not considered, resulting in block diagonal matrices consisting of 61 × 61 entries for the sense codons and 3 × 3 entries for the stop codons. Conclusion The amount of genomic data currently available allowed for the construction of an empirical codon substitution matrix. However, more sequence data is still needed to construct matrices from different subsets of DNA, specific to kingdoms, evolutionary distance or different amount of synonymous change. Codon mutation matrices have advantages for alignments up to medium evolutionary distances and for usages that require DNA such as ancestral reconstruction of DNA sequences and the calculation of Ka/Ks ratios.

  3. Appropriateness, acceptance and sensory preferences based on visual information: A web-based survey on meat substitutes in a meal context

    NARCIS (Netherlands)

    Elzerman, J.E.; Hoek, A.C.; Boekel, van T.; Luning, P.A.

    2015-01-01

    The aim of this study was to investigate the appropriateness, attractiveness, use-intention and (un)desirable sensory properties of meat substitutes in different dishes based only on visual information. A web-based survey was developed to let consumers assess the use of meat substitutes in different

  4. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    Science.gov (United States)

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-01

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  5. Electron acceptors based on alpha-position substituted PDI for OPV solar cells.

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Donglin; Wu, Qinghe; Cai, Zhengxu; Zheng, T; Chen, Wei; Lu, Jessica; Yu, L

    2016-02-23

    The ortho-position functionalized perylene diimide derivatives (alphaPPID, alphaPBDT) were synthesized and used as the electron acceptors in nonfullerene organic photovoltaics. Due to the good planarity of ortho-position functionalized PDI, the alphaPPID and alphaPBDT show strong tendency to form aggregate because of their enhanced intermolecular pie-pie interaction. Moreover, they maintain the pure domains and the same packing order as in the pure film if they are blended with PBT7-TH and the SCLC measurement also shows the high electron mobility. The inverted OPVs employing alphaPDI-based compounds as acceptor and PBT7-TH as the donor give the highest PCE of 4.92 % for alphaPBDT based device and 3.61 % for alphaPPID based device, which is 39 % and 4 % higher than that for their counterpart betaPBDT and betaPPID. The charge separation study shows the more efficient exciton dissociation at interfaces between PDI based compounds and PBT7-TH. The results suggest that compared to beta-substituted ones, alpha-substituted PDI derivatives are more promising electron acceptors for OPV.

  6. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...... and accumulation of DNA base lesions in clinical atherosclerosis is scarce. Here, we evaluated the transcriptional profile of a wide spectrum of BER components as well as DNA damage accumulation in atherosclerotic and non-atherosclerotic arteries. BER gene expression levels were analyzed in 162 carotid plaques, 8...... genes in atherosclerosis may contribute to lesional nuclear DNA stability but appears insufficient to maintain mtDNA integrity, potentially influencing mitochondrial function in cells within the atherosclerotic lesion....

  7. DNA chip based sensor for amperometric detection of infectious pathogens.

    Science.gov (United States)

    Singh, Swati; Kaushal, Ankur; Khare, Shashi; Kumar, Ashok

    2017-10-01

    Several infectious pathogens are found in human whose detection is essential for rapid cure of diseases. The most commonly found pathogen in human is Streptococcus pyogenes which leads to a wide range of infections from mild pharyngitis to rheumatic heart disease. An ultrasensitive DNA chip based sensor was developed for quick identification of pathogen S. pyogenes from patient throat swab samples. The amperometric response was measured after hybridization of specific probe with single stranded genomic DNA (ssG-DNA) from the patient samples. The DNA chip was characterized by FTIR, SEM and validated with suspected patient real samples. The sensitivity of the DNA chip based sensor was found 951.34(μA/cm(2))/ng DNA and lower limit of detection (LOD) was 130fg/6μL samples. The DNA chip based sensor is highly specific and takes only 30min for identification of specific pathogen. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A Markov chain Monte Carlo Expectation Maximization Algorithm for Statistical Analysis of DNA Sequence Evolution with Neighbor-Dependent Substitution Rates

    DEFF Research Database (Denmark)

    Hobolth, Asger

    2008-01-01

    -dependent substitution models are analytically intractable and must be analyzed using either approximate or simulation-based methods. We describe statistical inference of neighbor-dependent models using a Markov chain Monte Carlo expectation maximization (MCMC-EM) algorithm. In the MCMC-EM algorithm, the high...

  9. Synthesis, DNA binding ability and anticancer activity of 2-heteroaryl substituted benzimidazoles linked pyrrolo[2,1-c][1,4]benzodiazepine conjugates.

    Science.gov (United States)

    Kamal, Ahmed; Pogula, Praveen Kumar; Khan, Mohammed Naseer Ahmed; Seshadri, Bobburi Naga; Sreekanth, Kokkonda

    2013-08-01

    As a continuation of our efforts to develop the benzimidazole-PBD conjugates as potential anticancer agents, a series of heteroaryl substituted benzimidazole linked PBD conjugates has been synthesized and evaluated for their anticancer potential in 60 human cancer cell lines. Most of the compounds exhibited promising anticancer activity and interestingly, compounds 4c and 4d displayed significant activity in most of the cell lines tested. Whereas, compound 4e showed selectivity in renal cancer cells with GI50 values of <10 and 70 nM against RXF 393 and UO-31 cell lines, respectively. Further, these compounds also showed significant DNA-binding affinity by thermal denaturation study using duplex form of calf thymus (CT) DNA.

  10. Detecting Chemically Modified DNA Bases Using Surface Enhanced Raman Spectroscopy.

    Science.gov (United States)

    Barhoumi, Aoune; Halas, Naomi J

    2011-12-15

    Post-translational modifications of DNA- changes in the chemical structure of individual bases that occur without changes in the DNA sequence- are known to alter gene expression. They are believed to result in frequently deleterious phenotypic changes, such as cancer. Methylation of adenine, methylation and hydroxymethylation of cytosine, and guanine oxidation are the primary DNA base modifications identified to date. Here we show it is possible to use surface enhanced Raman spectroscopy (SERS) to detect these primary DNA base modifications. SERS detection of modified DNA bases is label-free and requires minimal additional sample preparation, reducing the possibility of additional chemical modifications induced prior to measurement. This approach shows the feasibility of DNA base modification assessment as a potentially routine analysis that may be further developed for clinical diagnostics.

  11. How to make DNA count: DNA-based diagnostic tools in veterinary parasitology.

    Science.gov (United States)

    Hunt, P W; Lello, J

    2012-05-04

    Traditional methods for the diagnosis of parasitic helminth infections of livestock have a number of limitations, such as the inability to distinguish mixed-species infections, a heavy reliance on technical experience and also sub-sampling errors. Some of these limitations may be overcome through the development of rapid and accurate DNA-based tests. For example, DNA-based tests can specifically detect individual species in a mixed infection at either the larval or egg stages, in the absence of morphological differences among species. Even so, some diagnostic problems remain the same, irrespective of whether a DNA-based or traditional method is used. For example, sub-sampling errors from an aggregated distribution are likely to persist. It is proposed, however, that DNA-based diagnostic technologies offer an opportunity to expand diagnostic capabilities, and are discussed in the current review. The future introduction of DNA-based diagnostic technologies into routine diagnostic settings will also be discussed.

  12. Tactile-Sight: A Sensory Substitution Device Based on Distance-Related Vibrotactile Flow

    Directory of Open Access Journals (Sweden)

    Leandro Cancar

    2013-06-01

    Full Text Available Sensory substitution is a research field of increasing interest with regard to technical, applied and theoretical issues. Among the latter, it is of central interest to understand the form in which humans perceive the environment. Ecological psychology, among other approaches, proposes that we can detect higher-order informational variables (in the sense that they are defined over substantial spatial and temporal intervals that specify our interaction with the environment. When using a vibrotactile sensory substitution device, it is reasonable to ask if stimulation on the skin may be exploitable to detect higher-order variables. Motivated by this question, a portable vibrotactile sensory substitution device was built, using distance-based information as a source and driving a large number of vibrotactile actuators (72 in the reported version, 120 max. The portable device was designed to explore real environments, allowing natural unrestricted movement for the user while providing contingent real-time vibrotactile information. Two preliminary experiments were performed. In the first one, participants were asked to detect the time to contact of an approaching ball in a simulated (desktop environment. Reasonable performance was observed in all experimental conditions, including the one with only tactile stimulation. In the second experiment, a portable version of the device was used in a real environment, where participants were asked to hit an approaching ball. Participants were able to coordinate their arm movements with vibrotactile stimulation in appropriate timing. We conclude that vibrotactile flow can be generated by distance-based activation of the actuators and that this stimulation on the skin allows users to perceive time-to-contact related environmental properties.

  13. Successful tactile based visual sensory substitution use functions independently of visual pathway integrity

    Directory of Open Access Journals (Sweden)

    Vincent eLee

    2014-05-01

    Full Text Available Purpose: We explored the microstructural differences between perinatally blind (PB, acquired blind (AB, and normally sighted controls (SC and related these differences to performance on functional tasks using a sensory substitution device (BrainPort. Methods: We enrolled 52 subjects (PB n=11; AQ n=35; NS n=6. Subjects spent 15 hours undergoing BrainPort device training. Outcomes of light perception, motion, direction, temporal resolution, grating, and acuity were tested at baseline and after training. Twenty-six of the subjects were scanned with a 3 Tesla MRI scanner for diffusion tensor imaging (DTI, and with a positron emission tomography (PET scanner for mapping regional brain glucose consumption during sensory substitution function. Non-parametric models were used to analyze fractional anisotropy (FA; a DTI measure of microstructural integrity of the brain via region-of-interest (ROI analysis and tract-based spatial statistics (TBSS. Results: At baseline, all subjects performed all tasks at chance level. After training, light perception, time resolution, location and grating acuity tasks improved significantly for all subject groups. ROI and TBSS analyses of FA maps show statistically significant differences (p≤0.025 in the bilateral optic radiations and some visual association areas between all 3 groups. No relationship was found between FA and functional performance with the BrainPort. Discussion: : All subjects showed performance improvements using the BrainPort irrespective of nature and duration of blindness. Definite brain areas with significant microstructural integrity changes exist among PB, AB, and NC, and these variations are most pronounced in the visual pathways. However, the use of sensory substitution devices is feasible irrespective of of microstructural integrity of the primary visual pathways between the eye and the brain. Therefore, tongue based devices devices may be usable for a broad array of non sighted persons.

  14. Tactile-Sight: A Sensory Substitution Device Based on Distance-Related Vibrotactile Flow

    Directory of Open Access Journals (Sweden)

    Leandro Cancar

    2013-06-01

    Full Text Available Sensory substitution is a research field of increasing interest with regard to technical, applied and theoretical issues. Among the latter, it is of central interest to understand the form in which humans perceive the environment. Ecological psychology, among other approaches, proposes that we can detect higher‐order informational variables (in the sense that they are defined over substantial spatial and temporal intervals that specify our interaction with the environment. When using a vibrotactile sensory substitution device, it is reasonable to ask if stimulation on the skin may be exploitable to detect higher‐order variables. Motivated by this question, a portable vibrotactile sensory substitution device was built, using distance‐based information as a source and driving a large number of vibrotactile actuators (72 in the reported version, 120 max. The portable device was designed to explore real environments, allowing natural unrestricted movement for the user while providing contingent real‐time vibrotactile information. Two preliminary experiments were performed. In the first one, participants were asked to detect the time to contact of an approaching ball in a simulated (desktop environment. Reasonable performance was observed in all experimental conditions, including the one with only tactile stimulation. In the second experiment, a portable version of the device was used in a real environment, where participants were asked to hit an approaching ball. Participants were able to coordinate their arm movements with vibrotactile stimulation in appropriate timing. We conclude that vibrotactile flow can be generated by distance‐based activation of the actuators and that this stimulation on the skin allows users to perceive time‐to‐ contact related environmental properties.

  15. DNA Based Electrochromic and Photovoltaic Cells

    Science.gov (United States)

    2012-01-01

    and biodegradable material, has low cost and good film forming properties, is not toxic and forms transparent solutions with high viscosity [17]. An...applications requires fundamental studies on DNA in solid state, in which the behavior is expected to be different than that in solution. DNA is an acid , but...function of temperature of the blends samples of DNA with poly(ethylene dioxythiophene):poly(styrene sulphonate ) (PEDOT:PSS), poly(orthoethoxy aniline

  16. Effect of lupine as cheese base substitution on technological and nutritional properties of processed cheese analogue.

    Science.gov (United States)

    Awad, Rezik Azab; Salama, Wafaa Mohammed; Farahat, Azza Mahmoud

    2014-01-01

    Healthy foods have been met with marked success in the last two decades. Lupine flours, protein concentrates, and isolates can be applied as a substance for enriching different kinds of food systems such as bakery products, lupine pasta, ice cream, milk substitutes. Imitation processed cheese is made from mixtures of dairy and/or non dairy proteins and fat/oils and is variously labeled analogue, artificial, extruded, synthetic and/or filled. Processed cheese can be formulated using different types of cheese with different degree of maturation, flavorings, emulsifying, salts, and/or several ingredients of non-dairy components. Non-dairy ingredients have been used in processed cheese for many dietary and economic reasons. In this study, lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). Matured Ras cheese (3 months old) was manufactured using fresh cow milk. Soft cheese curd was manufactured using fresh buffalo skim milk. Emulsifying salts S9s and Unsalted butter were used. Lupine termis paste was prepared by soaking the seeds in tap water for week with changing the water daily, and then boiled in water for 2 hrs, cooled and peeled. The peeled seeds were minced, blended to get very fine paste and kept frozen until used. Lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). The obtained PCA were analysed when fresh and during storage up to 3 months at 5±2°C for chemical composition, physical and sensory properties. The histopathological effect of lupines on alloxan diabetic albino rats and nutritional parameters were also investigated. Incorporation of lupine paste in PCA increased the ash and protein contents while meltability and penetration values of resultant products were decreased. Adding lupine in PSA formula had relatively increased the oil index and firmness of products. Feeding rats a balanced diet containing processed cheese

  17. Effect of lupine as cheese base substitution on technological and nutritional properties of processed cheese analogue

    Directory of Open Access Journals (Sweden)

    Rezik Azab Awad

    2014-03-01

    Full Text Available Background. Healthy foods have been met with marked success in the last two decades. Lupine flours, protein concentrates, and isolates can be applied as a substance for enriching different kinds of food systems such as bakery products, lupine pasta, ice cream, milk substitutes. Imitation processed cheese is made from mixtures of dairy and/or non dairy proteins and fat/oils and is variously labeled analogue, artifi cial, extruded, synthetic and/or fi lled. Processed cheese can be formulated using different types of cheese with different degree of maturation, fl avorings, emulsifying, salts, and/or several ingredients of non-dairy components. Non-dairy ingredients have been used in processed cheese for many dietary and economic reasons. In this study, lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA. Material and methods. Matured Ras cheese (3 months old was manufactured using fresh cow milk. Soft cheese curd was manufactured using fresh buffalo skim milk. Emulsifying salts S9s and Unsalted butter were used. Lupine termis paste was prepared by soaking the seeds in tap water for week with changing the water daily, and then boiled in water for 2 hrs, cooled and peeled. The peeled seeds were minced, blended to get very fi ne paste and kept frozen until used. Results. Lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA. The obtained PCA were analysed when fresh and during storage up to 3 months at 5±2°C for chemical composition, physical and sensory properties. The histopathological effect of lupines on alloxan diabetic albino rats and nutritional parameters were also investigated. Incorporation of lupine paste in PCA increased the ash and protein contents while meltability and penetration values of resultant products were decreased. Adding lupine in PSA formula had relatively increased the oil index and fi rmness of

  18. Chaotic Image Encryption Algorithm Based on Bit Permutation and Dynamic DNA Encoding.

    Science.gov (United States)

    Zhang, Xuncai; Han, Feng; Niu, Ying

    2017-01-01

    With the help of the fact that chaos is sensitive to initial conditions and pseudorandomness, combined with the spatial configurations in the DNA molecule's inherent and unique information processing ability, a novel image encryption algorithm based on bit permutation and dynamic DNA encoding is proposed here. The algorithm first uses Keccak to calculate the hash value for a given DNA sequence as the initial value of a chaotic map; second, it uses a chaotic sequence to scramble the image pixel locations, and the butterfly network is used to implement the bit permutation. Then, the image is coded into a DNA matrix dynamic, and an algebraic operation is performed with the DNA sequence to realize the substitution of the pixels, which further improves the security of the encryption. Finally, the confusion and diffusion properties of the algorithm are further enhanced by the operation of the DNA sequence and the ciphertext feedback. The results of the experiment and security analysis show that the algorithm not only has a large key space and strong sensitivity to the key but can also effectively resist attack operations such as statistical analysis and exhaustive analysis.

  19. A novel bio-sensor based on DNA strand displacement.

    Directory of Open Access Journals (Sweden)

    Xiaolong Shi

    Full Text Available DNA strand displacement technology performs well in sensing and programming DNA segments. In this work, we construct DNA molecular systems based on DNA strand displacement performing computation of logic gates. Specifically, a class of so-called "DNA neurons" are achieved, in which a "smart" way inspired by biological neurons encoding information is developed to encode and deliver information using DNA molecules. The "DNA neuron" is bistable, that is, it can sense DNA molecules as input signals, and release "negative" or "positive" signals DNA molecules. We design intelligent DNA molecular systems that are constructed by cascading some particularly organized "DNA neurons", which could perform logic computation, including AND, OR, XOR logic gates, automatically. Both simulation results using visual DSD (DNA strand displacement software and experimental results are obtained, which shows that the proposed systems can detect DNA signals with high sensitivity and accretion; moreover, the systems can process input signals automatically with complex nonlinear logic. The method proposed in this work may provide a new way to construct a sensitive molecular signal detection system with neurons spiking behavior in vitro, and can be used to develop intelligent molecular processing systems in vivo.

  20. Fluorescent probes based on side-chain chlorinated benzo[a]phenoxazinium chlorides: Studies of interaction with DNA

    Science.gov (United States)

    Raju, B. Rama; Gonçalves, M. Sameiro T.; Coutinho, Paulo J. G.

    2017-01-01

    The interaction of DNA with six water soluble benzo[a]phenoxazinium chlorides mono- or di-substituted with 3-chloropropyl groups at the O and N of 2- and 9-positions, along with methyl, hydroxyl and amine terminal groups at 5-positions, was investigated by photophysical techniques. The results indicated that almost all compounds intercalated in DNA base pairs at phosphate to dye ratio higher than 5. At lower values of this ratio, electrostatic binding mode with DNA was observed. Groove binding was detected mainly for the benzo[a]phenoxazinium dye with NH2·HBr terminal. The set of six benzo[a]phenoxazinium chlorides proved successful to label the migrating DNA in agarose gel electrophoresis assays. These finding proves the ability of these benzo[a]phenoxazinium dyes to strongly interact with DNA.

  1. Self-reported physical fitness of older persons: A substitute for performance-based measures of physical fitness?

    NARCIS (Netherlands)

    vanHeuvelen, M.J.G.; Kempen, G.I J M; Ormel, J.; deGreef, M.H.G.

    1997-01-01

    To evaluate the validity of self-report measures of physical fitness as substitutes for performance-based tests, self-reports and performance-based tests of physical fitness were compared. Subjects were a community-based sample of older adults (N = 624) aged 57 and over. The performance-based tests

  2. Self-reported physical fitness of older persons : A substitute for performance-based measures of physical fitness?

    NARCIS (Netherlands)

    vanHeuvelen, MJG; Kempen, GIJM; Ormel, J; de Greef, M.H.G.

    1997-01-01

    To evaluate the validity of self-report measures of physical fitness as substitutes for performance-based tests, self-reports and performance-based tests of physical fitness were compared. Subjects were a community-based sample of older adults (N = 624) aged 57 and over. The performance-based tests

  3. DNA duplex membrane effect for the electrochemical detection of single-base DNA mutations

    Institute of Scientific and Technical Information of China (English)

    Luo Chunxiong; Mao Yongdong; Ouyang Qi

    2006-01-01

    Here we report a new method to detect DNA point mutations.The method is based on the formation and deformation of double-stranded DNA(dsDNA)membranes on a gold surface.It can encage reporter molecules between the gold surface and the double-stranded DNA or keep them away from the gold surface.In these systems,Fe(CN)63- was used as the reporter.As the temperature increases,a sharp electrochemical signal change in the melting curve of wild-type dsDNA appears.At a special temperature,the and single base mutation target.Thus,the system provides a simple and sensitive method to detect DNA point mutations without labeling targets.

  4. Dependency-based algorithms for vector processing of sparse matrix forward/backward substitutions

    Energy Technology Data Exchange (ETDEWEB)

    Vuong, G.T.; Chahine, R. [Hydro-Quebec, Montreal, Quebec (Canada); Granelli, G.P.; Montagna, M. [Univ. di Pavia (Italy)

    1996-02-01

    In this paper two algorithms for forward/backward substitutions and their implementation on vector computers are considered. A dependency-based substitution algorithm (DBSA) is proposed and compared with the well known W-matrix method. According to DBSA, the non-zero entries of the factor matrices are rearranged in groups of elements (slices) leading to independent operations. In the implementation of the W-matrix method, the non-zero elements of the inverse factors are grouped in sets (pseudocolumns) to overcome the problem of dependency between addition operations. Test cases, performed on a CRAY X-MP2/216 and a CRAY Y-MP8/464 vector computer, are taken from real life power system problems and consist in the solution of linear systems with up to 12,000 equations. The maximum speed-ups achieved (with respect to a code based on standard sparsity programming) are near to 7 for complex arithmetic and to 11 for real arithmetic.

  5. Development of quantitative structure-metabolism (QSMR) relationships for substituted anilines based on computational chemistry.

    Science.gov (United States)

    Athersuch, Toby J; Wilson, Ian D; Keun, Hector C; Lindon, John C

    2013-09-01

    A novel stepwise classification approach for predicting the metabolic fate of substituted anilines, based on calculated physicochemical parameters of the parent anilines, was developed. Based on multivariate pattern recognition methods (PLS-DA or soft independent modelling of class analogy [SIMCA]), these models allowed prediction of N-acetylation and subsequent N-oxanilic acid formation. These classification methods provided an improved classification success when compared with existing quantitative structure-metabolism relationship models for substituted anilines. Modelling the physicochemical properties of the N-acetylated compounds was considered as an addition to the stepwise model. Inclusion of parameters describing the N-acetyl moiety had little effect on the predictive ability of a stepwise parent to N-acetyl to N-oxanilic acid PLS-DA model, and had a negative impact on that of SIMCA models. This was attributed to the relatively small contribution to the total parameter variance caused by differences arising as a result of N-acetylation compared to the contribution made by the substituent effects. Calculation of physicochemical properties incorporating the effect of solvation using ab initio methods improved the classification model in terms of both the visual separation in multivariate projections and prediction accuracy.

  6. Electroporation-based DNA delivery technology

    DEFF Research Database (Denmark)

    Gothelf, A; Gehl, Julie

    2014-01-01

    DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....

  7. Carbon-based electrode materials for DNA electroanalysis.

    Science.gov (United States)

    Kato, Dai; Niwa, Osamu

    2013-01-01

    This review addresses recent studies of newly developed carbon-based electrode materials and their use for DNA electroanalysis. Recently, new carbon materials including carbon nanotubes (CNT), graphene and diamond-based nanocarbon electrodes have been actively developed as sensing platforms for biomolecules, such as DNA and proteins. Electrochemical techniques using these new material-based electrodes can provide very simple and inexpensive sensing platforms, and so are expected to be used as one of the "post-light" DNA analysis methods, which include coulometric detection, amperometric detection with electroactive tags or intercalators, and potentiometric detection. DNA electroanalysis using these new carbon materials is summarized in view of recent advances on electrodes.

  8. Single base substitution causing the fragrant phenotype and development of a type-specific marker in aromatic coconut (Cocos nucifera).

    Science.gov (United States)

    Vongvanrungruang, A; Mongkolsiriwatana, C; Boonkaew, T; Sawatdichaikul, O; Srikulnath, K; Peyachoknagul, S

    2016-09-19

    The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.

  9. Biological evaluation of a cytotoxic 2-substituted benzimidazole copper(II) complex: DNA damage, antiproliferation and apoptotic induction activity in human cervical cancer cells.

    Science.gov (United States)

    Qiao, Xin; Ma, Zhong-Ying; Shao, Jia; Bao, Wei-Guo; Xu, Jing-Yuan; Qiang, Zhao-Yan; Lou, Jian-Shi

    2014-02-01

    Exploring novel chemotherapeutic agents is a great challenge in cancer medicine. To that end, 2-substituted benzimidazole copper(II) complex, [Cu(BMA)Cl2]·(CH3OH) (1) [BMA = N,N'-bis(benzimidazol-2-yl-methyl)amine], was synthesized and its cytotoxicity was characterized. The interaction between complex 1 and calf thymus DNA was detected by spectroscopy methods. The binding constant (K b = 1.24 × 10(4 )M(-1)) and the apparent binding constant (K app = 6.67 × 10(6 )M(-1)) of 1 indicated its moderate DNA affinity. Complex 1 induced single strand breaks of pUC19 plasmid DNA in the presence of H2O2 through an oxidative pathway. Cytotoxicity studies proved that complex 1 could inhibit the proliferation of human cervical carcinoma cell line HeLa in both time- and dose-dependent manners. The results of nuclei staining by Hoechst 33342 and alkaline single-cell gel electrophoresis proved that complex 1 caused cellular DNA damage in HeLa cells. Furthermore, treatment of HeLa cells with 1 resulted in S-phase arrest, loss of mitochondrial potential, and up-regulation of caspase-3 and -9 in HeLa cells, suggesting that complex 1 was capable of inducing apoptosis in cancer cells through the intrinsic mitochondrial pathway.

  10. Properties and ATRP activity of copper complexes with substituted tris(2-pyridylmethyl)amine-based ligands.

    Science.gov (United States)

    Kaur, Aman; Ribelli, Thomas G; Schröder, Kristin; Matyjaszewski, Krzysztof; Pintauer, Tomislav

    2015-02-16

    Synthesis, characterization, electrochemical studies, and ATRP activity of a series of novel copper(I and II) complexes with TPMA-based ligands containing 4-methoxy-3,5-dimethyl-substituted pyridine arms were reported. In the solid state, Cu(I)(TPMA*(1))Br, Cu(I)(TPMA*(2))Br, and Cu(I)(TPMA*(3))Br complexes were found to be distorted tetrahedral in geometry and contained coordinated bromide anions. Pseudo-coordination of the aliphatic nitrogen atom to the copper(I) center was observed in Cu(I)(TPMA*(2))Br and Cu(I)(TPMA*(3))Br complexes, whereas pyridine arm dissociation occurred in Cu(I)(TPMA*(1))Br. All copper(I) complexes with substituted TPMA ligands exhibited a high degree of fluxionality in solution. At low temperature, Cu(I)(TPMA*(1))Br was found to be symmetrical and monomeric, while dissociation of either unsubstituted pyridine and/or 4-methoxy-3,5-dimethyl-substituted pyridine arms was observed in Cu(I)(TPMA*(2))Br and Cu(I)(TPMA*(3))Br. On the other hand, the geometry of the copper(II) complexes in the solid state deviated from ideal trigonal bipyramidal, as confirmed by a decrease in τ values ([Cu(II)(TPMA*(1))Br][Br] (τ = 0.92) > [Cu(II)(TPMA*(3))Br][Br] (τ = 0.77) > [Cu(II)(TPMA*(2))Br][Br] (τ = 0.72)). Furthermore, cyclic voltammetry studies indicated a nearly stepwise decrease (ΔE ≈ 60 mV) of E1/2 values relative to SCE (TPMA (-240 mV) > TPMA*(1) (-310 mV) > TPMA*(2) (-360 mV) > TPMA*(3) (-420 mV)) on going from [Cu(II)(TPMA)Br][Br] to [Cu(II)(TPMA*(3))Br][Br], confirming that the presence of electron-donating groups in the 4 (-OMe) and 3,5 (-Me) positions of the pyridine rings in TPMA increases the reducing ability of the corresponding copper(I) complexes. This increase was mostly the result of a stronger influence of substituted TPMA ligands toward stabilization of the copper(II) oxidation state (log β(I) = 13.4 ± 0.2, log β(II) = 19.3 (TPMA*(1)), 20.5 (TPMA*(2)), and 21.5 (TPMA*(3))). Lastly, ARGET ATRP kinetic studies show that with

  11. DNA base excision repair nanosystem engineering: model development.

    Science.gov (United States)

    Sokhansanj, B A

    2005-01-01

    DNA base damage results from a combination of endogenous sources, (normal metabolism, increased metabolism due to obesity, stress from diseases such as arthritis and diabetes, and ischemia) and the environment (ingested toxins, ionizing radiation, etc.). If unrepaired DNA base damage can lead to diminished cell function, and potentially diseases and eventually mutations that lead to cancer. Sophisticated DNA repair mechanisms have evolved in all living cells to preserve the integrity of inherited genetic information and transcriptional control. Understanding a system like DNA repair is greatly enhanced by using engineering methods, in particular modeling interactions and using predictive simulation to analyze the impact of perturbations. We describe the use of such a "nanosystem engineering" approach to analyze the DNA base excision repair pathway in human cells, and use simulation to predict the impact of varying enzyme concentration on DNA repair capacity.

  12. Hamilton Graph Based on DNA Computing

    Institute of Scientific and Technical Information of China (English)

    ZHANGJia-xiu

    2004-01-01

    DNA computing is a novel method for solving a class of intractable computationalproblems in which the computing can grow exponentially with problem size. Up to now, manyaccomplishments have been achieved to improve its performance and increase its reliability.Hamilton Graph Problem has been solved by means of molecular biology techniques. A smallgraph was encoded in molecules of DNA, and the “operations” of the computation wereperformed with standard protocols and enzymes. This work represents further evidence forthe ability of DNA computing to solve NP-complete search problems.

  13. Influence of Boron Substitution on Conductance of Pyridine- and Pentane-Based Molecular Single Electron Transistors: First-Principles Analysis

    Science.gov (United States)

    Srivastava, Anurag; Santhibhushan, B.; Sharma, Vikash; Kaur, Kamalpreet; Shahzad Khan, Md.; Marathe, Madura; De Sarkar, Abir; Shahid Khan, Mohd.

    2016-04-01

    We have investigated the modeling of boron-substituted molecular single-electron transistor (SET), under the influence of a weak coupling regime of Coulomb blockade between source and drain metal electrodes. The SET consists of a single organic molecule (pyridine/pentane/1,2-azaborine/butylborane) placed over the dielectric, with boron (B) as a substituent. The impact of B-substitution on pyridine and pentane molecules in isolated, as well as SET, environments has been analyzed by using density functional theory-based ab initio packages Atomistix toolkit-Virtual NanoLab and Gaussian03. The performance of proposed SETs was analyzed through charging energies, total energy as a function of gate potential and charge stability diagrams. The analysis confirms that the B-substituted pentane (butylborane) and the boron-substituted pyridine (1,2-azaborine) show remarkably improved conductance in SET environment in comparison to simple pyridine and pentane molecules.

  14. Development and characterization of novel alginate-based hydrogels as vehicles for bone substitutes.

    Science.gov (United States)

    Morais, D S; Rodrigues, M A; Silva, T I; Lopes, M A; Santos, M; Santos, J D; Botelho, C M

    2013-06-05

    In this work three different hydrogels were developed to associate, as vehicles, with the synthetic bone substitute GR-HAP. One based on an alginate matrix (Alg); a second on a mixture of alginate and chitosan (Alg/Ch); and a third on alginate and hyaluronate (Alg/HA), using Ca(2+) ions as cross-linking agents. The hydrogels, as well as the respective injectable bone substitutes (IBSs), were fully characterized from the physical-chemical point of view. Weight change studies proved that all hydrogels were able to swell and degrade within 72 h at pH 7.4 and 4.0, being Alg/HA the hydrogel with the highest degradation rate (80%). Rheology studies demonstrated that all hydrogels are non-Newtonian viscoelastic fluids, and injectability tests showed that IBSs presented low maximum extrusion forces, as well as quite stable average forces. In conclusion, the studied hydrogels present the necessary features to be successfully used as vehicles of GR-HAP, particularly the hydrogel Alg/HA.

  15. Substitution of Concentrate with Mulberry Leaves in Ongole Grade Cattle Fed Rice Straw Based Diet

    Directory of Open Access Journals (Sweden)

    S. Syahrir

    2012-08-01

    Full Text Available An experiment was conducted to assess the substitution of concentrate with mulberry (Morus spp. leaves combined with rice straw offered to beef cattle. The study used 12 male Ongole grade cattle weighing 217+10.53 kg. Rations consisted of rice straw, mulberry leaves and concentrate. Research was carried out according to completely randomized design with 3 treatments and 4 replications for each treatment. The treatments were: P1= 50% rice straw + 50% concentrate; P2= 50% rice straw + 25% concentrate + 25% mulberry; P3= 50% rice straw + 50% mulberry. The results of the study indicated that rumen fermentation in cattlle fed on P2 ration was more effective than those receiving P1 and P3 rations. The fermentation was characterized by a higher production of total VFA and allantoin excretion in the urine. The presence of 1-deoxynojirimycin (DNJ compound of mulberry leaves in the rumen system in treatment P2 and P3 improved digestibility of fiber fractions of rice straw-based rations. Mulberry leaves in rations also accounted for isoacids in the rumen system, which supported the development of cellulolytic bacteria. In conclusion, mulberry leaves containing concentrate had a potency to substitute concentrate when used together with fiber source feed such as rice straw.

  16. DNA-based diagnosis of isolated sulfite oxidase deficiency by denaturing high-performance liquid chromatography.

    Science.gov (United States)

    Lam, Ching-Wan; Li, Chi-Keung; Lai, Chi-Kong; Tong, Sui-Fan; Chan, Kwok-Yin; Ng, Grace Sui-Fun; Yuen, Yuet-Ping; Cheng, Anna Wai-Fun; Chan, Yan-Wo

    2002-01-01

    Isolated sulfite oxidase deficiency is a rare autosomal recessive disease, characterized by severe neurological abnormalities, seizures, mental retardation, and dislocation of the ocular lenses, that often leads to death in infancy. There is a special demand for prenatal diagnosis, since no effective treatment is available for isolated sulfite oxidase deficiency. Until now, the cDNA sequence of the sulfite oxidase (SUOX) gene has been available, but the genomic sequence of the SUOX gene has not been published. In this study, we have performed a DNA-based diagnosis of isolated sulfite oxidase deficiency in a Chinese patient. To do so, we designed oligonucleotide primers for amplification of the predicted exons and intron-exon boundaries of the SUOX gene obtained from the completed draft version of the human genome. Using overlapping PCR products, we confirmed the flanking intronic sequences of the coding exons and that the entire 466-residue mature peptide is encoded by the last exon of the gene. We then performed mutation detection using denaturing high-performance liquid chromatography (DHPLC). The DHPLC chromatogram of exon 2b showed the presence of heteroduplex peaks only after mixing of the mutant DNA with the wild-type DNA, indicating the presence of a homozygous mutation. Direct DNA sequencing showed a homozygous base substitution at codon 160, changing the codon from CGG to CAG, which changes the amino acid from arginine to glutamine, i.e., R160Q. The DNA-based diagnosis of isolated sulfite oxidase deficiency will enable us to make an accurate determination of carrier status and to perform prenatal diagnosis of this disease. The availability of the genomic sequences of human genes from the completed draft human genome sequence will simplify the development of molecular genetic diagnoses of human diseases from peripheral blood DNA.

  17. Controlling charge current through a DNA based molecular transistor

    Science.gov (United States)

    Behnia, S.; Fathizadeh, S.; Ziaei, J.

    2017-01-01

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

  18. Circulating tumor DNA as a non-invasive substitute to metastasis biopsy for tumor genotyping and personalized medicine in a prospective trial across all tumor types.

    Science.gov (United States)

    Lebofsky, Ronald; Decraene, Charles; Bernard, Virginie; Kamal, Maud; Blin, Anthony; Leroy, Quentin; Rio Frio, Thomas; Pierron, Gaëlle; Callens, Céline; Bieche, Ivan; Saliou, Adrien; Madic, Jordan; Rouleau, Etienne; Bidard, François-Clément; Lantz, Olivier; Stern, Marc-Henri; Le Tourneau, Christophe; Pierga, Jean-Yves

    2015-04-01

    Cell-free tumor DNA (ctDNA) has the potential to enable non-invasive diagnostic tests for personalized medicine in providing similar molecular information as that derived from invasive tumor biopsies. The histology-independent phase II SHIVA trial matches patients with targeted therapeutics based on previous screening of multiple somatic mutations using metastatic biopsies. To evaluate the utility of ctDNA in this trial, as an ancillary study we performed de novo detection of somatic mutations using plasma DNA compared to metastasis biopsies in 34 patients covering 18 different tumor types, scanning 46 genes and more than 6800 COSMIC mutations with a multiplexed next-generation sequencing panel. In 27 patients, 28 of 29 mutations identified in metastasis biopsies (97%) were detected in matched ctDNA. Among these 27 patients, one additional mutation was found in ctDNA only. In the seven other patients, mutation detection from metastasis biopsy failed due to inadequate biopsy material, but was successful in all plasma DNA samples providing three more potential actionable mutations. These results suggest that ctDNA analysis is a potential alternative and/or replacement to analyses using costly, harmful and lengthy tissue biopsies of metastasis, irrespective of cancer type and metastatic site, for multiplexed mutation detection in selecting personalized therapies based on the patient's tumor genetic content.

  19. DNA barcoding: a genomic-based tool for authentication of phytomedicinals and its products

    Directory of Open Access Journals (Sweden)

    Balachandran KRS

    2015-12-01

    Full Text Available Karpaga Raja Sundari Balachandran, Saravanan Mohanasundaram, Sathishkumar Ramalingam Plant Genetic Engineering Laboratory, Department of Biotechnology, Bharathiar University, Coimbatore, Tamil Nadu, India Abstract: DNA barcoding helps to identify the plant materials based on short, standardized gene sequences in a rapid, accurate, and cost-effective manner. Recent reports reveal that DNA barcoding can be used for the assignment of unknown specimens to a taxonomic group, authentic identification of phytomedicinals, and in plant biodiversity conservation. Research indicates that there is no single universal barcode candidate for identification of all plant groups. Hence, comparative analysis of plant barcode loci is essential for choosing a best candidate for authenticating particular medicinal plant genus/families. Currently, both chloroplast/nuclear regions are used as universal barcodes for the authentication of phytomedicinals. A recent advance in genomics has further enhanced the progress in DNA barcoding of plants by the introduction of high-throughput techniques like next generation sequencing, which has paved the way for complete plastome sequencing that is now termed as super-barcodes. These approaches could improve the traditional ethno-botanical and scientific knowledge of phytomedicinals and their safe use. Hence, current focus is on the investigation of phytomedicinals and herbal product integrity and authenticity through DNA barcoding with the goal of protecting consumers from potential health risks associated with product substitution and contamination. Keywords: phytomedicinals, DNA barcoding, NGS, super-barcodes, authentication, ethno-genetics

  20. Antibody-controlled actuation of DNA-based molecular circuits

    Science.gov (United States)

    Engelen, Wouter; Meijer, Lenny H. H.; Somers, Bram; de Greef, Tom F. A.; Merkx, Maarten

    2017-02-01

    DNA-based molecular circuits allow autonomous signal processing, but their actuation has relied mostly on RNA/DNA-based inputs, limiting their application in synthetic biology, biomedicine and molecular diagnostics. Here we introduce a generic method to translate the presence of an antibody into a unique DNA strand, enabling the use of antibodies as specific inputs for DNA-based molecular computing. Our approach, antibody-templated strand exchange (ATSE), uses the characteristic bivalent architecture of antibodies to promote DNA-strand exchange reactions both thermodynamically and kinetically. Detailed characterization of the ATSE reaction allowed the establishment of a comprehensive model that describes the kinetics and thermodynamics of ATSE as a function of toehold length, antibody-epitope affinity and concentration. ATSE enables the introduction of complex signal processing in antibody-based diagnostics, as demonstrated here by constructing molecular circuits for multiplex antibody detection, integration of multiple antibody inputs using logic gates and actuation of enzymes and DNAzymes for signal amplification.

  1. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    Neurons are terminally differentiated cells with a high rate of metabolism and multiple biological properties distinct from their undifferentiated precursors. Previous studies showed that nucleotide excision DNA repair is downregulated in postmitotic muscle cells and neurons. Here, we characterize...... DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  2. Synthesis, characterization, DNA binding and in vitro antimicrobial studies of a novel tetra-substituted N-isopropyl-N-(4-ferrocenylphenyl)-N‧-(2,6-diethylphenyl)-N″-benzoylguanidine: Crystallographic structure and quantum chemical computations

    Science.gov (United States)

    Rauf, Muhammad Khawar; Gul, Rukhsana; Rashid, Zahid; Badshah, Amin; Tahir, Muhammad Nawaz; Shahid, Muhammad; Khan, Azim

    2015-02-01

    A novel tetra-substituted guanidine, N-isopropyl-N-(4-ferrocenylphenyl)-N‧-(2,6-diethylphenyl)-N″-benzoylguanidine (1), [(CH3)2CH)(C5H5FeC5H4C6H4)NC(NHCOC6H5)(NHC6H3(CH2CH3)2] has been synthesized and characterized by elemental analysis, FT-IR, multinuclear (1H, 13C) NMR spectroscopy, single crystal X-rays diffraction analysis and density functional theory based quantum chemical calculations. The torsion angles indicating that the guanidine moiety and carbonyl group are almost co-planar, due to the pseudo hexagonal ring formed by intramolecular Nsbnd H⋯O hydrogen bonds. The DNA interaction studies performed by cyclic voltammetry and UV-visible spectroscopy are in close agreement with the binding constants (K) 1.4 × 104 and 1.2 × 104 respectively. The shift in peak potential, current and absorption maxima of the studied ferrocenyl guanidine in the presence of DNA discovered that CV coupled with UV-vis spectroscopy could provide an opportunity to elaborate DNA interaction mechanism, a prerequisite for the design of new drug like agents and understanding the molecular basis of their action. The synthesized compound (1) has also been screened for their antibacterial and antifungal.

  3. Substituted naphthalenes: Stability, conformational flexibility and description of bonding based on ETS-NOCV method

    Science.gov (United States)

    Stanković, B.; Ostojić, B. D.; Gruden, M.; Popović, A.; Đorđević, D. S.

    2016-09-01

    For all dimethylnaphthalenes (DMNs) the transition from a planar ring conformation to a nonplanar one results in energy increase in the range 1.7-2.4 kcal/mol. There is a linear relationship between averaged rigidity constant and relative energy of DMNs. The relative stability of DMNs does not follow the aromatic stabilization based on NICS values. The ETS-NOCV analysis shows that more efficient bonding in the π-electron system is the origin of enhanced stability in laterally substituted (CH3, Cl and NO2) naphthalenes. The results for Caryl-CH3 system indicate more steric repulsion in going from 2,7-DMN to 1,8-DMN following the increase of relative energies.

  4. Structure-based design of nonpeptidic HIV protease inhibitors: the sulfonamide-substituted cyclooctylpyramones.

    Science.gov (United States)

    Skulnick, H I; Johnson, P D; Aristoff, P A; Morris, J K; Lovasz, K D; Howe, W J; Watenpaugh, K D; Janakiraman, M N; Anderson, D J; Reischer, R J; Schwartz, T M; Banitt, L S; Tomich, P K; Lynn, J C; Horng, M M; Chong, K T; Hinshaw, R R; Dolak, L A; Seest, E P; Schwende, F J; Rush, B D; Howard, G M; Toth, L N; Wilkinson, K R; Romines, K R

    1997-03-28

    Recently, cyclooctylpyranone derivatives with m-carboxamide substituents (e.g. 2c) were identified as potent, nonpeptidic HIV protease inhibitors, but these compounds lacked significant antiviral activity in cell culture. Substitution of a sulfonamide group at the meta position, however, produces compounds with excellent HIV protease binding affinity and antiviral activity. Guided by an iterative structure-based drug design process, we have prepared and evaluated a number of these derivatives, which are readily available via a seven-step synthesis. A few of the most potent compounds were further evaluated for such characteristics as pharmacokinetics and toxicity in rats and dogs. From this work, the p-cyanophenyl sulfonamide derivative 35k emerged as a promising inhibitor, was selected for further development, and entered phase I clinical trials.

  5. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  6. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Science.gov (United States)

    Chan, Kin; Sterling, Joan F; Roberts, Steven A; Bhagwat, Ashok S; Resnick, Michael A; Gordenin, Dmitry A

    2012-01-01

    Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA) is more prone to damage than double-strand DNA (dsDNA), due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions accurately.

  7. The effect of base pair mismatch on DNA strand displacement

    CERN Document Server

    Broadwater, Bo

    2016-01-01

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration, and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term, the concurrent displacement model, and used the first passage t...

  8. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  9. Statistical mechanics of base stacking and pairing in DNA melting

    OpenAIRE

    Ivanov, Vassili; Zeng, Yan; Zocchi, Giovanni

    2004-01-01

    We propose a statistical mechanics model for DNA melting in which base stacking and pairing are explicitly introduced as distinct degrees of freedom. Unlike previous approaches, this model describes thermal denaturation of DNA secondary structure in the whole experimentally accessible temperature range. Base pairing is described through a zipper model, base stacking through an Ising model. We present experimental data on the unstacking transition, obtained exploiting the observation that at m...

  10. Unique magnetic signatures of mismatched base pairs in DNA

    Science.gov (United States)

    Apalkov, Vadim; Berashevich, Julia; Chakraborty, Tapash

    2010-02-01

    Magnetic properties of DNA containing mispairs, such as different conformations of the GṡA mispair, or a GṡT mispair inserted into the DNA chain, have been theoretically investigated. The essential ingredients for these studies, the charge transfer integrals, were evaluated from the DNA sequences containing the mispair and optimized in the solvent. We find that the magnetic susceptibilities of the host DNA chain containing a large number of Watson-Crick base pairs are significantly altered in the presence of the mispairs, and the effects depend on the choice of mispairs. In particular, insertion of even a single GṡA mispair changes the nature of magnetization (sign of the susceptibility) of the host DNA. We propose that measurement of the magnetic properties of DNA might provide a direct route to detection and identification of those mispairs.

  11. DNA-based cryptographic methods for data hiding in DNA media.

    Science.gov (United States)

    Marwan, Samiha; Shawish, Ahmed; Nagaty, Khaled

    2016-12-01

    Information security can be achieved using cryptography, steganography or a combination of them, where data is firstly encrypted using any of the available cryptography techniques and then hid into any hiding medium. Recently, the famous genomic DNA has been introduced as a hiding medium, known as DNA steganography, due to its notable ability to hide huge data sets with a high level of randomness and hence security. Despite the numerous cryptography techniques, to our knowledge only the vigenere cipher and the DNA-based playfair cipher have been combined with the DNA steganography, which keeps space for investigation of other techniques and coming up with new improvements. This paper presents a comprehensive analysis between the DNA-based playfair, vigenere, RSA and the AES ciphers, each combined with a DNA hiding technique. The conducted analysis reports the performance diversity of each combined technique in terms of security, speed, hiding capacity in addition to both key size and data size. Moreover, this paper proposes a modification of the current combined DNA-based playfair cipher technique, which makes it not only simple and fast but also provides a significantly higher hiding capacity and security. The conducted extensive experimental studies confirm such outstanding performance in comparison with all the discussed combined techniques. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Organometallic ruthenium(II) complexes: synthesis, structure and influence of substitution at azomethine carbon towards DNA/BSA binding, radical scavenging and cytotoxicity.

    Science.gov (United States)

    Sathyadevi, Palanisamy; Krishnamoorthy, Paramasivam; Bhuvanesh, Nattamai S P; Kalaiselvi, Palaniswamy; Vijaya Padma, Viswanadha; Dharmaraj, Nallasamy

    2012-09-01

    Bivalent, ruthenium organometallics containing hydrazone ligands with the composition [RuH(CO)(PPh(3))(2)(L(1-3))] (4-6) have been synthesised from the reactions of [RuH(2)(CO)(PPh(3))(3)] and benzoic acid pyridine-2-ylmethylene-hydrazide (HL(1)) (1) /benzoic acid (1-pyridin-2-yl-ethylidene)-hydrazide (HL(2)) (2)/benzoic acid (phenyl-pyridin-2-yl-methylene)-hydrazide (HL(3)) (3) and characterised by various physico-chemical techniques. The X-ray crystal structure of one of the above complexes, [RuH(CO)(PPh(3))(2)(L(3))] (6) demonstrated a distorted octahedral coordination geometry around the metal centre. Results of our investigation on the effect of substitution (H or CH(3) or C(6)H(5)) at the azomethine carbon of coordinated hydrazone in these ruthenium chelates on the potential binding with DNA/BSA, free radical scavenging and cytotoxicity is presented.

  13. Novel substituted benzothiophene and thienothiophene carboxanilides and quinolones: synthesis, photochemical synthesis, DNA-binding properties, antitumor evaluation and 3D-derived QSAR analysis.

    Science.gov (United States)

    Aleksić, Maja; Bertoša, Branimir; Nhili, Raja; Uzelac, Lidija; Jarak, Ivana; Depauw, Sabine; David-Cordonnier, Marie-Hélène; Kralj, Marijeta; Tomić, Sanja; Karminski-Zamola, Grace

    2012-06-14

    A series of new N,N-dimethylaminopropyl- and 2-imidazolinyl-substituted derivatives of benzo[b]thienyl- and thieno[2,3-b]thienylcarboxanilides and benzo[b]thieno[2,3-c]- and thieno[3',2':4,5]thieno[2,3-c]quinolones were prepared. Quinolones were prepared by the reaction of photochemical dehydrohalogenation of corresponding anilides. Carboxanilides and quinolones were tested for the antiproliferative activity. 2-Imidazolinyl-substituted derivatives showed very prominent activity. By use of the experimentally obtained antitumor measurements, 3D-derived QSAR analysis was performed for the set of compounds. Highly predictive 3D-derived QSAR models were obtained, and molecular properties that have the highest impact on antitumor activity were identified. Carboxanilides 6a-c and quinolones 9a-c and 11a were evaluated for DNA binding propensities and topoisomerases I and II inhibition as part of their mechanism of action assessment. The evaluated differences in the mode of action nicely correlate with the results of the 3D-QSAR analysis. Taken together, the results indicate which modifications of the compounds from the series should further improve their anticancer properties.

  14. DNA nanostructures based biosensor for the determination of aromatic compounds.

    Science.gov (United States)

    Gayathri, S Baby; Kamaraj, P; Arthanareeswari, M; Devikala, S

    2015-10-15

    Graphite electrode was modified using multi-walled carbon nanotubes (MWCNT), chitosan (CS), glutaraldehyde (GTA) and DNA nanostructures (nsDNA). DNA nanostructures of 50 nm in size were produced from single DNA template sequence using a simple two step procedure and were confirmed using TEM and AFM analysis. The modified electrode was applied to the electrochemical detection of aromatic compounds using EIS. The modified electrode was characterized using differential pulse voltammetry (DPV), electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). For comparison, electrochemical results derived from single stranded (50 bp length) and double stranded (50 bp length) DNA based biosensors were used. The results indicate that the modified electrode prior to nsDNA immobilization provides a viable platform that effectively promotes electron transfer between nsDNA and the electrode. The mode of binding between the nsDNA and aromatic compounds was investigated using EIS, indicating that the dominant interaction is non-covalent. nsDNA based biosensor was observed to act as an efficient biosensor in selective and sensitive identification of aromatic compounds.

  15. A novel DNA computing model based on RecA-mediated triple-stranded DNA structure

    Institute of Scientific and Technical Information of China (English)

    Fang Gang; Zhang Shemin; Dong Yafei; Xu Jin

    2007-01-01

    The field of DNA computing emerged in 1994 after Adleman's paper was published. Henceforth, a few scholars solved some noted NP-complete problems in this way. And all these methods of DNA computing are based on conventional Watson-Crick hydrogen bond of doublehelical DNA molecule. In this paper, we show that the triple-stranded DNA structure mediated by RecA protein can be used for solving computational problems. Sequence-specific recognition of double-stranded DNA by oligonucleotide-directed triple helix (triplex) formation is used to carry out the algorithm. We present procedure for the 3-vertex-colorability problems. In our proposed procedure, it is suggested that it is possible to solve more complicated problems with more variables by this model.

  16. Synthesis, characterization of amide substituted dexibuprofen derivatives and their spectral, voltammetric and docking investigations for DNA binding interactions.

    Science.gov (United States)

    Arshad, Nasima; Zafran, Muhammad; Ashraf, Zaman; Perveen, Fouzia

    2017-04-01

    Three amide derivatives - methyl-2-[2-(4-isobutylphenyl)propanamido]propanoate (Dex-2), methyl 2-[2-(4-isobutylphenyl) propanamido]-3-phenylpropanoate (Dex-3) and methyl 2-[2-(4-isobutylphenyl)-propanamido]-4-methylpentanoate (Dex-4) of dexibuprofen (Dex-1) 2-(4-isobutylphenyl)propanoic acid were synthesized and conformed for structures by physical data and spectral analysis. Further, all the compounds were studied for their binding with ds.DNA through experimental (UV-visible/and fluorescence spectroscopy, cyclic voltammetry) and theoretical (molecular docking) techniques. Spectral and voltammetric responses as well as kinetic and thermodynamic data interpretations at stomach (4.7) and blood (7.4) pH and at human body temperature (37°C) indicated spontaneous interaction of all the compounds with DNA via intercalation and external bindings. The binding constants (Kb) and Gibbs free energy changes (-ΔG) were evaluated greater at pH7.4 attributing comparatively more significant binding of all the compounds with DNA at blood pH. Among all compounds, Dex-4 showed greater binding with DNA at both pH with greater Kb values i.e., {UV-visible: pH 4.7 (2.36×10(4)M(-1)); pH7.4 (2.42×10(4)M(-1)), fluorescence: pH4.7 (2.24×10(4)M(-1)); pH7.4 (2.56×10(4)M(-1)) and CV: pH4.7 (4.06×10(4)M(-1)); pH7.4 (4.89×10(4)M(-1))}. Binding site size (n) at both pH values was evaluated n≥1 for Dex-2 and Dex-4 which assured intercalation as a major mode of interaction between compounds and DNA. For Dex-1 and Dex-3 (n) was evaluated n≤1 at both pH values and the values n<1 indicated the possibility of binding via groove or electrostatic interactions. Electrochemical processes were found diffusion controlled and diffusion coefficients (Do) for all the compounds - DNA adducts were evaluated lesser than unbound compounds. Docking studies further supported DNA binding evidences obtained from spectral and electrochemical investigations. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. DNA-based tunable THz oscillator

    NARCIS (Netherlands)

    Malyshev, A. V.; Malyshev, V. A.; Dominguez-Adame, F.

    2009-01-01

    The intrinsic helix conformation of the DNA strands is known to be the key ingredient of control of the electric current through the molecule by the perpendicular (gate) electric field. We show theoretically that Bloch oscillations in periodic systems with helical conformation are also strongly affe

  18. Azolla as an Economic Substitute to Soybean Based Feed for Poultry

    Directory of Open Access Journals (Sweden)

    Dev Raj Paudel

    2015-12-01

    Full Text Available A study on azolla as an economical substitute to soybean based poultry feed was conducted. The experiment consisted of four treatments laid out in Completely Randomized Design (CRD with five replications. Each experimental unit consisted of three birds. For this purpose, eight-day old, unsexed Hubbard broiler chicks were weighed and randomly assigned to each treatment. Four different levels of azolla meal were incorporated in the starter and finisher ration at a level of 0%, 10%, 15%, and 20% respectively. Body weight, weight gain, feed consumption, and feed efficiency were measured. The average cumulative weekly body weight for all weeks were found to be significantly different (P<0.05 for the various treatments. Maximum cumulative body weight (1360 g was found in broiler fed T2 ration in 5th week. Similar trend was also observed in 6th week showing highest cumulative weight (1882 g in control diet (T1 which was at par with T2 (1841 g. Significantly highest (420.3 g live weight gain was observed in T2 diet during 5th week. Overall mean of weekly feed consumption was recorded highest (784.33 g in T2 diet. The economic analysis of net income/kg live weight was the highest (Rs 18.86 in T1 which was at par with T2 (Rs 18.35. Likewise, cost of production/bird was highest (Rs 124.5 in T1 and lowest (Rs 112.2 in T4. The results show that azolla meal could be utilized to substitute up to 10% soybean meal from overall production and economic point of view.

  19. Taxonomy of pasteurella anatipestifer. 1. DNA base composition and DNA-DNA hybridization analysis.

    Science.gov (United States)

    Bangun, A; Johnson, J L; Tripathy, D N

    1987-01-01

    DNA was isolated from 15 strains of Pasteurella anatipestifer and from one strain each of Moraxella nonliquefaciens, M. bovis, Pasteurella multocida, P. haemolytica, P. gallinarum, P. pneumotropica, and P. ureae. The guanine-plus-cytosine contents of P. anatipestifer ranged from 32 to 35 mole %, whereas those of Moraxella and Pasteurella spp. were much higher, ranging from 40 to 45 mole %. DNA-DNA hybridization analysis revealed that homology of nine P. anatipestifer strains to strains ATCC 11845 and PA 15 was 52 to 100%, whereas homology of Moraxella and Pasteurella strains to these strains was only 3 to 17%. Similarly, homology of P. anatipestifer strains, Moraxella, and Pasteurella species other than P. multocida to P. multocida reference strain P-2192 was low. These results strongly suggest that P. anatipestifer is genetically unrelated to either Pasteurella or Moraxella.

  20. Structural analysis of the dnaA and dnaN genes of Escherichia coli.

    Science.gov (United States)

    Ohmori, H; Kimura, M; Nagata, T; Sakakibara, Y

    1984-05-01

    The nucleotide sequence of the entire region containing the Escherichia coli dnaA and dnaN genes was determined. Base substitutions by such mutations as dnaA46, dnaA167, dnaN59, and dnaN806 were also identified. Analyses of coding frames, the mutational base substitutions, and other data indicate that dnaN follows dnaA, both have the same orientation, and are separated by only 4 bp. The deduced amino acid sequence specifies Mrs and isoelectric points consistent with those of the previously identified gene products. The transcriptional initiation site of the dnaA gene was assigned by analysis of in vitro RNA products. Examination of the intercistronic sequence and analysis of in vitro transcription supported the notion that the dnaA and dnaN genes constitute a single operon.

  1. Foods for Special Dietary Needs: Non-dairy Plant-based Milk Substitutes and Fermented Dairy-type Products.

    Science.gov (United States)

    Mäkinen, Outi Elina; Wanhalinna, Viivi; Zannini, Emanuele; Arendt, Elke Karin

    2016-01-01

    A growing number of consumers opt for plant-based milk substitutes for medical reasons or as a lifestyle choice. Medical reasons include lactose intolerance, with a worldwide prevalence of 75%, and cow's milk allergy. Also, in countries where mammal milk is scarce and expensive, plant milk substitutes serve as a more affordable option. However, many of these products have sensory characteristics objectionable to the mainstream western palate. Technologically, plant milk substitutes are suspensions of dissolved and disintegrated plant material in water, resembling cow's milk in appearance. They are manufactured by extracting the plant material in water, separating the liquid, and formulating the final product. Homogenization and thermal treatments are necessary to improve the suspension and microbial stabilities of commercial products that can be consumed as such or be further processed into fermented dairy-type products. The nutritional properties depend on the plant source, processing, and fortification. As some products have extremely low protein and calcium contents, consumer awareness is important when plant milk substitutes are used to replace cow's milk in the diet, e.g. in the case of dairy intolerances. If formulated into palatable and nutritionally adequate products, plant-based substitutes can offer a sustainable alternative to dairy products.

  2. A DNA based model for addition computation

    Institute of Scientific and Technical Information of China (English)

    GAO Lin; YANG Xiao; LIU Wenbin; XU Jin

    2004-01-01

    Much effort has been made to solve computing problems by using DNA-an organic simulating method, which in some cases is preferable to the current electronic computer. However, No one at present has proposed an effective and applicable method to solve addition problem with molecular algorithm due to the difficulty in solving the carry problem which can be easily solved by hardware of an electronic computer. In this article, we solved this problem by employing two kinds of DNA strings, one is called result and operation string while the other is named carrier. The result and operation string contains some carry information by its own and denotes the ultimate result while the carrier is just for carrying use. The significance of this algorithm is the original code, the fairly easy steps to follow and the feasibility under current molecular biological technology.

  3. A liquid-crystal-based DNA biosensor for pathogen detection

    Science.gov (United States)

    Khan, Mashooq; Khan, Abdur Rahim; Shin, Jae-Ho; Park, Soo-Young

    2016-03-01

    A liquid-crystal (LC)-filled transmission electron microscopy (TEM) grid cell coated with the cationic surfactant dodecyltrimethylammonium bromide (DTAB), to which a single-stranded deoxyribonucleic acid probe (ssDNAprobe) was adsorbed at the LC/aqueous interface (TEMDTAB/DNA), was applied for the highly specific detection of target DNA molecules. The DTAB-coated E7 (used LC mixture) in the TEM grid (TEMDTAB) exhibited a homeotropic orientation, and changed to a planar orientation upon adsorption of the ssDNAprobe. The TEMDTAB/DNA was then exposed to complementary (target) ssDNA, which resulted in a planar-to-homeotropic configurational change of E7 that could be observed through a polarized optical microscope under crossed polarizers. The optimum adsorption density (2 μM) of ssDNAprobe enabled the detection of ≥0.05 nM complementary ssDNA. This TEMDTAB/DNA biosensor could differentiate complementary ssDNA from mismatched ssDNA as well as double-stranded DNA. It also successfully detected the genomic DNAs of the bacterium Erwinia carotovora and the fungi Rhazictonia solani. Owe to the high specificity, sensitivity, and label-free detection, this biosensor may broaden the applications of LC-based biosensors to pathogen detection.

  4. DNA regulatory motif selection based on support vector machine ...

    African Journals Online (AJOL)

    DNA regulatory motif selection based on support vector machine (SVM) and its application in microarray ... African Journal of Biotechnology ... experiments to explore the underlying relationships between motif types and gene functions.

  5. Artifacts associated with the measurement of oxidized DNA bases.

    Science.gov (United States)

    Cadet, J; Douki, T; Ravanat, J L

    1997-10-01

    In this paper we review recent aspects of the measurement of oxidized DNA bases, currently a matter of debate. There has long been an interest in the determination of the level of oxidized bases in cellular DNA under both normal and oxidative stress conditions. In this respect, the situation is confusing because variations that may be as large as two orders of magnitude have been reported for the yield of the formation of 8-oxo-7,8-dihydroguanine (8-oxoGua) in similar DNA samples. However, recent findings clearly show that application of several assays like gas chromatography-mass spectrometry (GC-MS) and -32P--postlabeling may lead to a significant overestimation of the level of oxidized bases in cellular DNA. In particular, the silylation step, which is required to make the samples volatile for the GC-MS analysis, has been shown to induce oxidation of normal bases at the level of about one oxidized base per 10(4) normal bases. This has been found to be a general process that applies in particular to 8-oxoGua, 8-oxo-7, 8-dihydroadenine,5-hydroxycytosine, 5-(hydroxymethyl)uracil, and 5-formyluracil. Interestingly, prepurification of the oxidized bases from DNA hydrolysate prior to the derivatization reaction prevents artefactual oxidation. Under these conditions, the level of oxidized bases measured by GC-MS is similar to that obtained by HPLC associated with electrochemical detection (HPLC-EC). It should be added that the level of 8-oxo-7,8-dihydro-2;-deoxyguanosine in control cellular DNA has been found to be about fivefold lower than in earlier HPLC-EC measurements by using appropriate conditions of extraction and enzymatic digestion of DNA. Similar conclusions were reached by measuring formamidopyrimidine-DNA glycosylase sensitive sites as revealed by the single cell gel electrophoresis (comet) assay.

  6. Dynamic Simulation of Single DNA Molecule at the Base Level

    Institute of Scientific and Technical Information of China (English)

    LEI Xiao-Ling; WANG Xiao-Feng; HU Jun; FANG Hai-Ping

    2005-01-01

    @@ A mesoscopic discrete dsDNA model at the base level is proposed based on the statistical model (Phys. Rev. Lett.82 (1999) 4560). The numerical simulations reproduce the 65 pN plateau and those on the force vs extension for different supercoiling degrees are favourable with the experimental data. Our model has potential applications on the study of short DNA segments and provides a bridge between the statistical models and atomic modelling.

  7. How stable are the mutagenic tautomers of DNA bases?

    OpenAIRE

    Brovarets’ O. O.; Hovorun D. M.

    2010-01-01

    Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM) theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutage...

  8. Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of); Lee, Song Eun; Lee, Ho Won [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Kim, Young Kwan, E-mail: kimyk@wow.hongik.ac.kr [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Yoon, Seung Soo, E-mail: ssyoon@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of)

    2015-09-15

    This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm{sup 2}, respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm{sup 2}, respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs.

  9. Laterally substituted symmetric and nonsymmetric salicylideneimine-based bent-core mesogens

    Directory of Open Access Journals (Sweden)

    Sonja Findeisen-Tandel

    2012-01-01

    Full Text Available Bent-core mesogens have gained considerable importance due to their ability to form new mesophases with unusual properties. Relationships between the chemical structure of bent-core molecules and the type and physical properties of the formed mesophases are relatively unknown in detail and differ strongly from those known for calamitic liquid crystals. In this paper symmetric and nonsymmetric five-ring salicylideneaniline-based bent-core mesogens are presented, and the effect of lateral substituents attached at the outer phenyl rings (F, Cl, Br or the central phenyl ring (CH3 on the liquid-crystalline behaviour and on the physical properties is studied. Corresponding benzylideneaniline-based compounds were additionally prepared in order to study the influence of the intramolecular hydrogen bond. The occurring mesophases were investigated by differential scanning calorimetry, polarising microscopy, X-ray diffraction and dielectric and electro-optical measurements. The paper reports on new findings with respect to the structure–property relationships of bent-core mesogens. On one hand, the disruptive effect of laterally substituted halogen atoms, F, Cl and Br, on the mesophase behaviour of three isomeric series was much lower than expected. On the other hand, an increase of the clearing temperature by 34 K was observed, caused by small lateral substituents. The electro-optical behaviour, especially the type of polar switching and corresponding molecular movements, is sensitive to variations in the molecular structure.

  10. One-pot synthesis of substituted di-hydrofurans from Lewis base-catalyzed three-component condensation.

    Science.gov (United States)

    Zhong, Cheng; Liao, Tao; Tuguldur, Odbadrakh; Shi, Xiaodong

    2010-05-07

    A one-pot synthesis of substituted dihydrofurans was developed through a Lewis base-catalyzed three-component cascade condensation between nitroalkenes, aldehydes, and 1,3-dicarbonyl compounds. The desired cyclization products were prepared with a large substrate scope (22 examples) and excellent diastereoselectivity (only trans isomers) in good to excellent yields (up to 95%).

  11. A pedigree-based study of mitochondrial D-loop DNA sequence variation among Arabian horses.

    Science.gov (United States)

    Bowling, A T; Del Valle, A; Bowling, M

    2000-02-01

    Through DNA sequence comparisons of a mitochondrial D-loop hypervariable region, we investigated matrilineal diversity for Arabian horses in the United States. Sixty-two horses were tested. From published pedigrees they traced in the maternal line to 34 mares acquired primarily in the mid to late 19th century from nomadic Bedouin tribes. Compared with the reference sequence (GenBank X79547), these samples showed 27 haplotypes with altogether 31 base substitution sites within 397 bp of sequence. Based on examination of pedigrees from a random sampling of 200 horses in current studbooks of the Arabian Horse Registry of America, we estimated that this study defined the expected mtDNA haplotypes for at least 89% of Arabian horses registered in the US. The reliability of the studbook recorded maternal lineages of Arabian pedigrees was demonstrated by haplotype concordance among multiple samplings in 14 lines. Single base differences observed within two maternal lines were interpreted as representing alternative fixations of past heteroplasmy. The study also demonstrated the utility of mtDNA sequence studies to resolve historical maternity questions without access to biological material from the horses whose relationship was in question, provided that representatives of the relevant female lines were available for comparison. The data call into question the traditional assumption that Arabian horses of the same strain necessarily share a common maternal ancestry.

  12. A CLIQUE algorithm using DNA computing techniques based on closed-circle DNA sequences.

    Science.gov (United States)

    Zhang, Hongyan; Liu, Xiyu

    2011-07-01

    DNA computing has been applied in broad fields such as graph theory, finite state problems, and combinatorial problem. DNA computing approaches are more suitable used to solve many combinatorial problems because of the vast parallelism and high-density storage. The CLIQUE algorithm is one of the gird-based clustering techniques for spatial data. It is the combinatorial problem of the density cells. Therefore we utilize DNA computing using the closed-circle DNA sequences to execute the CLIQUE algorithm for the two-dimensional data. In our study, the process of clustering becomes a parallel bio-chemical reaction and the DNA sequences representing the marked cells can be combined to form a closed-circle DNA sequences. This strategy is a new application of DNA computing. Although the strategy is only for the two-dimensional data, it provides a new idea to consider the grids to be vertexes in a graph and transform the search problem into a combinatorial problem.

  13. NMR analysis of base-pair opening kinetics in DNA

    Science.gov (United States)

    Szulik, Marta W.; Voehler, Markus; Stone, Michael P.

    2014-01-01

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base pair opening and closing kinetics of individual double stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state of the art techniques and NMR instrumentation, including cryoprobes, is discussed. PMID:25501592

  14. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  15. Charge Transport across DNA-Based Three-Way Junctions.

    Science.gov (United States)

    Young, Ryan M; Singh, Arunoday P N; Thazhathveetil, Arun K; Cho, Vincent Y; Zhang, Yuqi; Renaud, Nicolas; Grozema, Ferdinand C; Beratan, David N; Ratner, Mark A; Schatz, George C; Berlin, Yuri A; Lewis, Frederick D; Wasielewski, Michael R

    2015-04-22

    DNA-based molecular electronics will require charges to be transported from one site within a 2D or 3D architecture to another. While this has been shown previously in linear, π-stacked DNA sequences, the dynamics and efficiency of charge transport across DNA three-way junction (3WJ) have yet to be determined. Here, we present an investigation of hole transport and trapping across a DNA-based three-way junction systems by a combination of femtosecond transient absorption spectroscopy and molecular dynamics simulations. Hole transport across the junction is proposed to be gated by conformational fluctuations in the ground state which bring the transiently populated hole carrier nucleobases into better aligned geometries on the nanosecond time scale, thus modulating the π-π electronic coupling along the base pair sequence.

  16. Spectroscopic investigation on the telomeric DNA base sequence repeat

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Telomeres are protein-DNA complexes at the terminals of linear chromosomes, which protect chromosomal integrity and maintain cellular replicative capacity.From single-cell organisms to advanced animals and plants,structures and functions of telomeres are both very conservative. In cells of human and vertebral animals, telomeric DNA base sequences all are (TTAGGG)n. In the present work, we have obtained absorption and fluorescence spectra measured from seven synthesized oligonucleotides to simulate the telomeric DNA system and calculated their relative fluorescence quantum yields on which not only telomeric DNA characteristics are predicted but also possibly the shortened telomeric sequences during cell division are imrelative fluorescence quantum yield and remarkable excitation energy innerconversion, which tallies with the telomeric sequence of (TTAGGG)n. This result shows that telomeric DNA has a strong non-radiative or innerconvertible capability.``

  17. Effect of the 3-halo substitution of the 2'-deoxy aminopyridinyl-pseudocytidine derivatives on the selectivity and stability of antiparallel triplex DNA with a CG inversion site.

    Science.gov (United States)

    Wang, Lei; Taniguchi, Yosuke; Okamura, Hidenori; Sasaki, Shigeki

    2017-07-15

    Triplex formation against a target duplex DNA has the potential to become a tool for the genome research. However, there is an intrinsic restriction on the duplex DNA sequences capable of forming the triplex DNA. Recently, we demonstrated the selective formation of the stable antiparallel triplexes containing the CG inversion sites using the 2'-deoxy-1-methylpseudocytidine derivative (ΨdC), whose amino group was conjugated with the 2-aminopyridine at its 5-position as an additional hydrogen bonding unit (AP-ΨdC). The 1-N of 2-aminopyridine was supposed to be protonated to form the hydrogen bond with the guanine of the CG inversion site. In this study, to test the effect of the 3-substitution of the 2-aminopyridine unit of AP-ΨdC on the triplex stability, we synthesized the 3-halogenated 2-aminopyridine derivatives of AP-ΨdC. The pKa values 1-N of the 2-aminopyridine unit of AP-ΨdC as the monomer nucleoside were determined to be 6.3 for 3-CH3 ((Me)AP-ΨdC), 6.1 for 3-H (AP-ΨdC), 4.3 for 3-Cl ((Cl)AP-ΨdC), 4.4 for 3-Br ((Br)AP-ΨdC), and 4.7 for 3-I ((I)AP-ΨdC), suggesting that all the halogenated AP-ΨdCs are not protonated under neutral conditions. Interestingly, although the recognition selectivity depends on the sequence context, the TFO having the sequence of the 3'-G-((I)AP-ΨdC)-A-5' context showed the selective triplex formation with the CG inversion site. These results suggest that the protonation at the 1-N position plays an important role in the stable and selective triplex formation of AP-ΨdC derivatives in any sequences. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.

    Science.gov (United States)

    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko

    2010-07-01

    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  19. Crystal and electronic structures of substituted halide perovskites based on density functional calculation and molecular dynamics

    Science.gov (United States)

    Takaba, Hiromitsu; Kimura, Shou; Alam, Md. Khorshed

    2017-03-01

    Durability of organo-lead halide perovskite are important issue for its practical application in a solar cells. In this study, using density functional theory (DFT) and molecular dynamics, we theoretically investigated a crystal structure, electronic structure, and ionic diffusivity of the partially substituted cubic MA0.5X0.5PbI3 (MA = CH3NH3+, X = NH4+ or (NH2)2CH+ or Cs+). Our calculation results indicate that a partial substitution of MA induces a lattice distortion, resulting in preventing MA or X from the diffusion between A sites in the perovskite. DFT calculations show that electronic structures of the investigated partially substituted perovskites were similar with that of MAPbI3, while their bandgaps slightly decrease compared to that of MAPbI3. Our results mean that partial substitution in halide perovskite is effective technique to suppress diffusion of intrinsic ions and tune the band gap.

  20. Cooperativity-based modeling of heterotypic DNA nanostructure assembly.

    Science.gov (United States)

    Shapiro, Anastasia; Hozeh, Avital; Girshevitz, Olga; Abu-Horowitz, Almogit; Bachelet, Ido

    2015-07-27

    DNA origami is a robust method for the fabrication of nanoscale 2D and 3D objects with complex features and geometries. The process of DNA origami folding has been recently studied, however quantitative understanding of it is still elusive. Here, we describe a systematic quantification of the assembly process of DNA nanostructures, focusing on the heterotypic DNA junction-in which arms are unequal-as their basic building block. Using bulk fluorescence studies we tracked this process and identified multiple levels of cooperativity from the arms in a single junction to neighboring junctions in a large DNA origami object, demonstrating that cooperativity is a central underlying mechanism in the process of DNA nanostructure assembly. We show that the assembly of junctions in which the arms are consecutively ordered is more efficient than junctions with randomly-ordered components, with the latter showing assembly through several alternative trajectories as a potential mechanism explaining the lower efficiency. This highlights consecutiveness as a new design consideration that could be implemented in DNA nanotechnology CAD tools to produce more efficient and high-yield designs. Altogether, our experimental findings allowed us to devise a quantitative, cooperativity-based heuristic model for the assembly of DNA nanostructures, which is highly consistent with experimental observations.

  1. Design, synthesis, characterization, and computational studies on benzamide substituted Mannich bases as novel, potential antibacterial agents.

    Science.gov (United States)

    Bala, Suman; Sharma, Neha; Kajal, Anu; Kamboj, Sunil

    2014-01-01

    A series of benzamide substituted Mannich bases (1-7) were synthesized. The synthesized derivatives were authenticated by TLC, UV-Visible, FTIR, NMR, and mass spectroscopic techniques and further screened for in vitro antibacterial activity by test tube dilution method using amoxicillin and cefixime as standard drugs. The compounds 5, 6, and 7 were found to be the most active antibacterial agents among all the synthesized compounds. The physicochemical similarity of the compounds with standard drugs was assessed by calculating various physicochemical properties using software programs. The percent similarity of synthesized compounds was found to be good and compound 1 was found to have higher percentage of similarity. The compounds were subjected to QSAR by multilinear regression using Analyze it version 3.0 software, and four statistically sound models were developed with R2 (0.963-0.997), Radj2 (0.529-0.982), and Q2 (0.998-0.999) with good F (2.35-65.56) values.

  2. Synthesis of Phthalyl Substituted Imidazolones and Schiff Bases as Antimicrobial Agents

    Directory of Open Access Journals (Sweden)

    Pramilla Sah

    2011-01-01

    Full Text Available A new series of phthalyl substituted imidazolones (4a–g and Schiff bases (5a–d were synthesized from 2-methyl-(m-nitro-1,3-dioxo-1,3-dihydro-(2H-isoindole-2-yl-5-amino-1,3,4-thiadiazole (3a–b. Compounds (3a–b were prepared by cyclisation of 2-(m-nitro-1,3-dioxo-1,3-dihydro-(2H-isoindole-2-ylmethyl ethanoate (2 with thiosemicarbazide. 2-(m-nitro-1,3-dioxo-1,3-dihydro-(2H-isoindole-2-ylethanoic acid (1 in presence of thionyl chloride and methanol gave the ester (2 while compound (1 was synthesized by aminolysis of phthalic anhydride with glycine. The compounds were characterized by spectral techniques of IR, 1H NMR, Mass and elemental analysis. All the synthesized compounds (4a–g and (5a–d were screened for their antibacterial activity against the pathogenic strains E. coli, P. aureus, C. freundii while antifungal activity was evaluated against A. niger, A. flavus, Penicillium sp. and C. albicans.

  3. Dynamic Pricing Based on Strategic Consumers and Substitutes in a Duopoly Setting

    Directory of Open Access Journals (Sweden)

    Gongbing Bi

    2014-01-01

    Full Text Available Based on the rational strategic consumers, we construct a dynamic game to build a two-period dynamic pricing model for two brands of substitutes which are sold by duopoly. The solution concept of the dynamic game is Nash equilibrium. In our model, consumers have been clearly segmented into several consumption classes, according to their expected value of the products. The two competing firms enter a pricing game and finally reach the state of Nash equilibrium. In addition, decision-making process with only myopic consumers existing in the market is analyzed. To make the paper more practical and realistic, the condition, in which the myopic and strategic consumers both exist in the market, is also considered and studied. In order to help the readers understand better and make it intuitively more clearly, a numerical example is given to describe the influence of the main parameters to the optimal prices. The result indicates that, to maintain the firms’ respective optimal profits, the prices of the products should be adjusted appropriately with the changes of product differentiation coefficient.

  4. PCR-based typing of DNA extracted from cigarette butts.

    Science.gov (United States)

    Hochmeister, M N; Budowle, B; Jung, J; Borer, U V; Comey, C T; Dirnhofer, R

    1991-01-01

    Limited genetic marker information can be obtained from saliva by typing by conventional serological means. Thus, the application of PCR-based DNA typing methods was investigated as a potential approach for typing genetic markers in saliva. DNA was isolated from 200 cigarettes smoked by 10 different individuals (20 cigarettes per individual) and from 3 cigarette butts recovered from 2 crime scenes (adjudicated cases) using a Chelex 100 extraction procedure. The amount of recovered human DNA was quantified by slot-blot analysis and ranged from approximately less than 2-160 ng DNA per cigarette butt for the 200 samples, and 8 ng, 50 ng, and 100 ng for the cigarette butts from the adjudicated cases. The DNA was successfully amplified by the polymerase chain reaction (PCR) for the HLA-DQ alpha locus (99 out of 100 samples) as well as for the variable number of tandem repeat (VNTR) locus D1S80 (99 out of 100 samples). Amplification and typing of DNA was successful on all samples recovered from the crime scenes. The results suggest that PCR-based typing of DNA offers a potential method for genetically characterizing traces of saliva on cigarette butts.

  5. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  6. Direct DNA Analysis with Paper-Based Ion Concentration Polarization.

    Science.gov (United States)

    Gong, Max M; Nosrati, Reza; San Gabriel, Maria C; Zini, Armand; Sinton, David

    2015-11-01

    DNA analysis is essential for diagnosis and monitoring of many diseases. Conventional DNA testing is generally limited to the laboratory. Increasing access to relevant technologies can improve patient care and outcomes in both developed and developing regions. Here, we demonstrate direct DNA analysis in paper-based devices, uniquely enabled by ion concentration polarization at the interface of patterned nanoporous membranes in paper (paper-based ICP). Hepatitis B virus DNA targets in human serum are simultaneously preconcentrated, separated, and detected in a single 10 min operation. A limit of detection of 150 copies/mL is achieved without prior viral load amplification, sufficient for early diagnosis of hepatitis B. We clinically assess the DNA integrity of sperm cells in raw human semen samples. The percent DNA fragmentation results from the paper-based ICP devices strongly correlate (R(2) = 0.98) with the sperm chromatin structure assay. In all cases, agreement was 100% with respect to the clinical decision. Paper-based ICP can provide inexpensive and accessible advanced molecular diagnostics.

  7. A novel image encryption algorithm based on DNA subsequence operation.

    Science.gov (United States)

    Zhang, Qiang; Xue, Xianglian; Wei, Xiaopeng

    2012-01-01

    We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc.) combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  8. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Science.gov (United States)

    Zhang, Qiang; Xue, Xianglian; Wei, Xiaopeng

    2012-01-01

    We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc.) combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack. PMID:23093912

  9. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2012-01-01

    Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  10. Age dependency of base modification in rabbit liver DNA

    Science.gov (United States)

    Yamamoto, O.; Fuji, I.; Yoshida, T.; Cox, A. B.; Lett, J. T.

    1988-01-01

    Age-related modifications of DNA bases have been observed in the liver of the New Zealand white (NZW) rabbit (Oryctolagus cuniculus), a lagomorph with a median life span in captivity of 5-7 yr. The ages of the animals studied ranged from 6 wk to 9 yr. After the DNA had been extracted from the liver cell nuclei and hydrolyzed with acid, the bases were analyzed by column chromatography with Cellulofine gels (GC-15-m). Two peaks in the chromatogram, which eluted before the four DNA bases, contained modified bases. Those materials, which were obtained in relatively large amounts from old animals, were highly fluorescent, and were shown to be crosslinked base products by mass spectrometry. The yield of crosslinked products versus rabbit age (greater than 0.5 yr) can be fitted by an exponential function (correlation coefficient: 0.76 +/- 0.09).

  11. A universal, photocleavable DNA base: nitropiperonyl 2'-deoxyriboside.

    Science.gov (United States)

    Pirrung, M C; Zhao, X; Harris, S V

    2001-03-23

    A universal, photochemically cleavable DNA base analogue would add desirable versatility to a number of methods in molecular biology. A novel C-nucleoside, nitropiperonyl deoxyriboside (NPdR, P), has been investigated for this purpose. NPdR can be converted to its 5'-DMTr-3'-CE-phosphoramidite and was incorporated into pentacosanucleotides by conventional synthesis techniques. The destabilizing effect on hybrid formation with a complementary strand when this P base opposes A, T, and G was found to be 3-5 kcal/mol, but 9 kcal/mol when it opposes C. Brief irradiation (lambda > 360 nm, 20 min) of DNA containing the P base and piperidine treatment causes strand cleavage giving the 3'- and 5'-phosphates. Two significant recent interests, universal/non-hydrogen-bonding base analogues and photochemical backbone cleavage, have thus been combined in a single molecule that serves as a light-based DNA scissors.

  12. A Rewritable, Random-Access DNA-Based Storage System

    Science.gov (United States)

    Tabatabaei Yazdi, S. M. Hossein; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica

    2015-09-01

    We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.

  13. Phylogenetic relationships of five pika species (genus Ochotona) based on mitochondrial DNA restriction maps

    Institute of Scientific and Technical Information of China (English)

    于宁; 郑昌琳; 施立明; 王文; 兰宏; 张亚平

    1996-01-01

    Restriction site mapping of mitochondrial DNA (mtDNA) with 16 restriction endonucleases was used to examine the phylogenetic relationships of Ochotona cansus, O. huangensis, O. thibetana, O. curzoniae and O. erythrotis. A 1-kb length variation between 0. erythrotis of subgenus Pika and other four species of subgenus Ochotona was observed, which may be a useful genetic marker for identifying the two subgenera. The phylogenetic tree constructed using PAUP based on 61 phylogenetically informative sites suggests that O. aythrotis diverged first, followed by O. cansus, while O. atrzoniae and O. huangensis are sister taxa related to O. thibetana. The results indicate that both O. cansus and O. huangensis should be treated as independent species. If the base substitution rate of pikas mtDNA was 2% per million years, then the divergence time of the two subgenera, Pika and Ochotona, is about 8.8 Ma ago of late Miocence, middle Bao-dian of Chinese mammalian age, and the divergence of the four species in subgenus

  14. Measurement of oxidatively generated base damage in cellular DNA.

    Science.gov (United States)

    Cadet, Jean; Douki, Thierry; Ravanat, Jean-Luc

    2011-06-03

    This survey focuses on the critical evaluation of the main methods that are currently available for monitoring single and complex oxidatively generated damage to cellular DNA. Among chromatographic methods, HPLC-ESI-MS/MS and to a lesser extent HPLC-ECD which is restricted to a few electroactive nucleobases and nucleosides are appropriate for measuring the formation of single and clustered DNA lesions. Such methods that require optimized protocols for DNA extraction and digestion are sensitive enough for measuring base lesions formed under conditions of severe oxidative stress including exposure to ionizing radiation, UVA light and high intensity UVC laser pulses. In contrast application of GC-MS and HPLC-MS methods that are subject to major drawbacks have been shown to lead to overestimated values of DNA damage. Enzymatic methods that are based on the use of DNA repair glycosylases in order to convert oxidized bases into strand breaks are suitable, even if they are far less specific than HPLC methods, to deal with low levels of single modifications. Several other methods including immunoassays and (32)P-postlabeling methods that are still used suffer from drawbacks and therefore are not recommended. Another difficult topic is the measurement of oxidatively generated clustered DNA lesions that is currently achieved using enzymatic approaches and that would necessitate further investigations.

  15. Microwave-induced inactivation of DNA-based hybrid catalyst in asymmetric catalysis.

    Science.gov (United States)

    Zhao, Hua; Shen, Kai

    2016-03-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA-metal ligand binding properties and thus poor DNA catalytic performance.

  16. DNA based random key generation and management for OTP encryption.

    Science.gov (United States)

    Zhang, Yunpeng; Liu, Xin; Sun, Manhui

    2017-09-01

    One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

  17. Using a Fluorescent Cytosine Analogue tC[superscript o] To Probe the Effect of the Y567 to Ala Substitution on the Preinsertion Steps of dNMP Incorporation by RB69 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Beckman, Jeff; Wang, Jimin; Konigsberg, William H. (Yale)

    2012-10-10

    Residues in the nascent base pair binding pocket (NBP) of bacteriophage RB69 DNA polymerase (RB69pol) are responsible for base discrimination. Replacing Tyr567 with Ala leads to greater flexibility in the NBP, increasing the probability of misincorporation. We used the fluorescent cytosine analogue, 1,3-diaza-2-oxophenoxazine (tC{sup o}), to identify preinsertion step(s) altered by NBP flexibility. When tC{sup o} is the templating base in a wild-type (wt) RB69pol ternary complex, its fluorescence is quenched only in the presence of dGTP. However, with the RB69pol Y567A mutant, the fluorescence of tC{sup o} is also quenched in the presence of dATP. We determined the crystal structure of the dATP/tC{sup o}-containing ternary complex of the RB69pol Y567A mutant at 1.9 {angstrom} resolution and found that the incoming dATP formed two hydrogen bonds with an imino-tautomerized form of tC{sup o}. Stabilization of the dATP/tC{sup o} base pair involved movement of the tC{sup o} backbone sugar into the DNA minor groove and required tilting of the tC{sup o} tricyclic ring to prevent a steric clash with L561. This structure, together with the pre-steady-state kinetic parameters and dNTP binding affinity, estimated from equilibrium fluorescence titrations, suggested that the flexibility of the NBP, provided by the Y567 to Ala substitution, led to a more favorable forward isomerization step resulting in an increase in dNTP binding affinity.

  18. DNA nanotechnology based on i-motif structures.

    Science.gov (United States)

    Dong, Yuanchen; Yang, Zhongqiang; Liu, Dongsheng

    2014-06-17

    CONSPECTUS: Most biological processes happen at the nanometer scale, and understanding the energy transformations and material transportation mechanisms within living organisms has proved challenging. To better understand the secrets of life, researchers have investigated artificial molecular motors and devices over the past decade because such systems can mimic certain biological processes. DNA nanotechnology based on i-motif structures is one system that has played an important role in these investigations. In this Account, we summarize recent advances in functional DNA nanotechnology based on i-motif structures. The i-motif is a DNA quadruplex that occurs as four stretches of cytosine repeat sequences form C·CH(+) base pairs, and their stabilization requires slightly acidic conditions. This unique property has produced the first DNA molecular motor driven by pH changes. The motor is reliable, and studies show that it is capable of millisecond running speeds, comparable to the speed of natural protein motors. With careful design, the output of these types of motors was combined to drive micrometer-sized cantilevers bend. Using established DNA nanostructure assembly and functionalization methods, researchers can easily integrate the motor within other DNA assembled structures and functional units, producing DNA molecular devices with new functions such as suprahydrophobic/suprahydrophilic smart surfaces that switch, intelligent nanopores triggered by pH changes, molecular logic gates, and DNA nanosprings. Recently, researchers have produced motors driven by light and electricity, which have allowed DNA motors to be integrated within silicon-based nanodevices. Moreover, some devices based on i-motif structures have proven useful for investigating processes within living cells. The pH-responsiveness of the i-motif structure also provides a way to control the stepwise assembly of DNA nanostructures. In addition, because of the stability of the i-motif, this

  19. Anticonvulsants Based on the α-Substituted Amide Group Pharmacophore Bind to and Inhibit Function of Neuronal Nicotinic Acetylcholine Receptors.

    Science.gov (United States)

    Krivoshein, Arcadius V

    2016-03-16

    Although the antiepileptic properties of α-substituted lactams, acetamides, and cyclic imides have been known for over 60 years, the mechanism by which they act remains unclear. I report here that these compounds bind to the nicotinic acetylcholine receptor (nAChR) and inhibit its function. Using transient kinetic measurements with functionally active, nondesensitized receptors, I have discovered that (i) α-substituted lactams and cyclic imides are noncompetitive inhibitors of heteromeric subtypes (such as α4β2 and α3β4) of neuronal nAChRs and (ii) the binding affinity of these compounds toward the nAChR correlates with their potency in preventing maximal electroshock (MES)-induced convulsions in mice. Based on the hypothesis that α-substituted amide group is the essential pharmacophore of these drugs, I found and tested a simple compound, 2-phenylbutyramide. This compound indeed inhibits nAChR and shows good anticonvulsant activity in mice. Molecular docking simulations suggest that α-substituted lactams, acetamides, and cyclic imides bind to the same sites on the extracellular domain of the receptor. These new findings indicate that inhibition of brain nAChRs may play an important role in the action of these antiepileptic drugs, a role that has not been previously recognized.

  20. Nanoscale Hybrid Langmuir-Blodgett Films Based on Cerium-Substituted Heteropolymolybdate and Polyquinoline

    Institute of Scientific and Technical Information of China (English)

    王峥; 柳士忠; 杜祖亮; 胡振纲; 张洪杰

    2003-01-01

    Nanoscale hybrid organic/inorganic Langmuir-Blodgett films of cerium-substituted heteropolymolybdates(Ce-HPMo) and π-conjugated macromolecule poly(1,2-dihydro-2,2,4-trimethyl)quinoline(PQ) were obtained with auxiliary film-forming material stearic acid(SA) or octadecylamine(ODA). The surface pressure-area isotherms illuminate the formation of the hybrid LB films of PQ/ODA/Ce-HPMo and P Q/SA/Ce-HPMo. The different film-forming mechanism was discussed when the different auxiliary film-forming materials were used in the system. The absorption spectra indicate that the molecules of PQ and Ce-HPMo are incorporated into the LB films. Tapping-mode AFM image reveals a granular surface texture of nanosized Ce-substituted heteropolymolybdate. STM image shows that the conductivity is greatly improved after Ce-substituted heteropolymolybdates are incorporated in the films.

  1. Ultrasensitive electrochemical cocaine biosensor based on reversible DNA nanostructure.

    Science.gov (United States)

    Sheng, Qinglin; Liu, Ruixiao; Zhang, Sai; Zheng, Jianbin

    2014-01-15

    We proposed an ultrasensitive electrochemical cocaine biosensor based on the three-dimensional (3D) DNA structure conversion of nanostructure from Triangular Pyramid Frustum (TPFDNA) to Equilateral Triangle (ETDNA). The presence of cocaine triggered the aptamer-composed DNA nanostructure change from "Close" to "Open", leading to obvious faradaic impedance changes. The unique properties with excellent stability and specific rigid structure of the 3D DNA nanostructure made the biosensing functions stable, sensitive, and regenerable. The Faradaic impedance responses were linearly related to cocaine concentration between 1.0 nM and 2.0 μM with a correlation coefficient of 0.993. The limit of detection was calculated to be 0.21 nM following IUPAC recommendations (3Sb/b). It is expected that the distinctive features of DNA nanostructure would make it potentially advantageous for a broad range of biosensing, bionanoelectronics, and therapeutic applications.

  2. Application of DNA-based methods in forensic entomology.

    Science.gov (United States)

    Wells, Jeffrey D; Stevens, Jamie R

    2008-01-01

    A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.

  3. Magnetic Propulsion of Microswimmers with DNA-Based Flagellar Bundles.

    Science.gov (United States)

    Maier, Alexander M; Weig, Cornelius; Oswald, Peter; Frey, Erwin; Fischer, Peer; Liedl, Tim

    2016-02-10

    We show that DNA-based self-assembly can serve as a general and flexible tool to construct artificial flagella of several micrometers in length and only tens of nanometers in diameter. By attaching the DNA flagella to biocompatible magnetic microparticles, we provide a proof of concept demonstration of hybrid structures that, when rotated in an external magnetic field, propel by means of a flagellar bundle, similar to self-propelling peritrichous bacteria. Our theoretical analysis predicts that flagellar bundles that possess a length-dependent bending stiffness should exhibit a superior swimming speed compared to swimmers with a single appendage. The DNA self-assembly method permits the realization of these improved flagellar bundles in good agreement with our quantitative model. DNA flagella with well-controlled shape could fundamentally increase the functionality of fully biocompatible nanorobots and extend the scope and complexity of active materials.

  4. Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements.

    Science.gov (United States)

    Rocher, Christophe; Letellier, Thierry; Copeland, William C; Lestienne, Patrick

    2002-06-01

    Different mechanisms have been proposed to account for mitochondrial DNA (mtDNA) instability based on the presence of short homologous sequences (direct repeats, DR) at the potential boundaries of mtDNA rearrangements. Among them, slippage-mispairing of the replication complex during the asymmetric replication cycle of the mammalian mitochondrial DNA has been proposed to account for the preferential localization of deletions. This mechanism involves a transfer of the replication complex from the first neo-synthesized heavy (H) strand of the DR1, to the DR2, thus bypassing the intervening sequence and producing a deleted molecule. Nevertheless, the nature of the bonds between the DNA strands remains unknown as the forward sequence of DR2, beyond the replication complex, stays double-stranded. Here, we have analyzed the base composition of the DR at the boundaries of mtDNA deletions and duplications and found a skewed pyrimidine content of about 75% in the light-strand DNA template. This suggests the possible building of a DNA triple helix between the G-rich neo-synthesized DR1 and the base-paired homologous G.C-rich DR2. In vitro experiments with the purified human DNA polymerase gamma subunits enabled us to show that the third DNA strand may be used as a primer for DNA replication, using a template with the direct repeat forming a hairpin, with which the primer could initiate DNA replication. These data suggest a novel molecular basis for mitochondrial DNA rearrangements through the distributive nature of the DNA polymerase gamma, at the level of the direct repeats. A general model accounting for large-scale mitochondrial DNA deletion and duplication is proposed. These experiments extend to a DNA polymerase from an eucaryote source the use of a DNA triple helix strand as a primer, like other DNA polymerases from phage and bacterial origins.

  5. Magnetophoretic-based microfluidic device for DNA Concentration.

    Science.gov (United States)

    Shim, Sangjo; Shim, Jiwook; Taylor, William R; Kosari, Farhad; Vasmatzis, George; Ahlquist, David A; Bashir, Rashid

    2016-04-01

    Nucleic acids serve as biomarkers of disease and it is highly desirable to develop approaches to extract small number of such genomic extracts from human bodily fluids. Magnetic particles-based nucleic acid extraction is widely used for concentration of small amount of samples and is followed by DNA amplification in specific assays. However, approaches to integrate such magnetic particles based capture with micro and nanofluidic based assays are still lacking. In this report, we demonstrate a magnetophoretic-based approach for target-specific DNA extraction and concentration within a microfluidic device. This device features a large chamber for reducing flow velocity and an array of μ-magnets for enhancing magnetic flux density. With this strategy, the device is able to collect up to 95 % of the magnetic particles from the fluidic flow and to concentrate these magnetic particles in a collection region. Then an enzymatic reaction is used to detach the DNA from the magnetic particles within the microfluidic device, making the DNA available for subsequent analysis. Concentrations of over 1000-fold for 90 bp dsDNA molecules is demonstrated. This strategy can bridge the gap between detection of low concentration analytes from clinical samples and a range of micro and nanofluidic sensors and devices including nanopores, nano-cantilevers, and nanowires.

  6. Broadband diffuse optical spectroscopy assessment of hemorrhage- and hemoglobin-based blood substitute resuscitation

    Science.gov (United States)

    Lee, Jangwoen; Kim, Jae G.; Mahon, Sari; Tromberg, Bruce J.; Mukai, David; Kreuter, Kelly; Saltzman, Darin; Patino, Renee; Goldberg, Robert; Brenner, Matthew

    2009-07-01

    Hemoglobin-based oxygen carriers (HBOCs) are solutions of cell-free hemoglobin (Hb) that have been developed for replacement or augmentation of blood transfusion. It is important to monitor in vivo tissue hemoglobin content, total tissue hemoglobin [THb], oxy- and deoxy-hemoglobin concentrations ([OHb], [RHb]), and tissue oxygen saturation (StO2=[OHb]/[THb]×100%) to evaluate effectiveness of HBOC transfusion. We designed and constructed a broadband diffuse optical spectroscopy (DOS) prototype system to measure bulk tissue absorption and scattering spectra between 650 and 1000 nm capable of accurately determining these tissue hemoglobin component concentrations in vivo. Our purpose was to assess the feasibility of using DOS to optically monitor tissue [OHb], [RHb], StO2, and total tissue hemoglobin concentration ([THb]=[OHb]+[RHb]) during HBOC infusion using a rabbit hypovolemic shock model. The DOS prototype probe was placed on the shaved inner thigh muscle of the hind leg to assess concentrations of [OHb], [RHb], [THb], as well as StO2. Hemorrhagic shock was induced in intubated New Zealand white rabbits (N=6) by withdrawing blood via a femoral arterial line to 20% blood loss (10-15 cc/kg). Hemoglobin glutamer-200 (Hb-200) 1:1 volume resuscitation was administered following the hemorrhage. These values were compared against traditional invasive measurements, serum hemoglobin concentration (sHGB), systemic blood pressure, heart rate, and blood gases. DOS revealed increases of [THb], [OHb], and tissue hemoglobin oxygen saturation after Hb-200 infusion, while blood total hemoglobin values continued did not increase; we speculate, due to hyperosmolality induced hemodilution. DOS enables noninvasive in vivo monitoring of tissue hemoglobin and oxygenation parameters during shock and volume expansion with HBOC and potentially enables the assessment of efficacy of resuscitation efforts using artificial blood substitutes.

  7. Solid-State Nanopore-Based DNA Sequencing Technology

    Directory of Open Access Journals (Sweden)

    Zewen Liu

    2016-01-01

    Full Text Available The solid-state nanopore-based DNA sequencing technology is becoming more and more attractive for its brand new future in gene detection field. The challenges that need to be addressed are diverse: the effective methods to detect base-specific signatures, the control of the nanopore’s size and surface properties, and the modulation of translocation velocity and behavior of the DNA molecules. Among these challenges, the realization of the high-quality nanopores with the help of modern micro/nanofabrication technologies is a crucial one. In this paper, typical technologies applied in the field of solid-state nanopore-based DNA sequencing have been reviewed.

  8. Effect of base sequence on the DNA cross-linking properties of pyrrolobenzodiazepine (PBD) dimers.

    Science.gov (United States)

    Rahman, Khondaker M; James, Colin H; Thurston, David E

    2011-07-01

    Pyrrolo[2,1-c][1,4]benzodiazepine (PBD) dimers are synthetic sequence-selective DNA minor-groove cross-linking agents that possess two electrophilic imine moieties (or their equivalent) capable of forming covalent aminal linkages with guanine C2-NH(2) functionalities. The PBD dimer SJG-136, which has a C8-O-(CH(2))(3)-O-C8'' central linker joining the two PBD moieties, is currently undergoing phase II clinical trials and current research is focused on developing analogues of SJG-136 with different linker lengths and substitution patterns. Using a reversed-phase ion pair HPLC/MS method to evaluate interaction with oligonucleotides of varying length and sequence, we recently reported (JACS, 2009, 131, 13 756) that SJG-136 can form three different types of adducts: inter- and intrastrand cross-linked adducts, and mono-alkylated adducts. These studies have now been extended to include PBD dimers with a longer central linker (C8-O-(CH(2))(5)-O-C8'), demonstrating that the type and distribution of adducts appear to depend on (i) the length of the C8/C8'-linker connecting the two PBD units, (ii) the positioning of the two reactive guanine bases on the same or opposite strands, and (iii) their separation (i.e. the number of base pairs, usually ATs, between them). Based on these data, a set of rules are emerging that can be used to predict the DNA-interaction behaviour of a PBD dimer of particular C8-C8' linker length towards a given DNA sequence. These observations suggest that it may be possible to design PBD dimers to target specific DNA sequences.

  9. Ab initio Study of Naptho-Homologated DNA Bases

    Energy Technology Data Exchange (ETDEWEB)

    Sumpter, Bobby G [ORNL; Vazquez-Mayagoitia, Alvaro [ORNL; Huertas, Oscar [Universitat de Barcelona; Fuentes-Cabrera, Miguel A [ORNL; Orozco, Modesto [Institut de Recerca Biomedica, Parc Cientific de Barcelona, Barcelona, Spain; Luque, Javier [Universitat de Barcelona

    2008-01-01

    Naptho-homologated DNA bases have been recently used to build a new type of size expanded DNA known as yyDNA. We have used theoretical techniques to investigate the structure, tautomeric preferences, base-pairing ability, stacking interactions, and HOMO-LUMO gaps of the naptho-bases. The structure of these bases is found to be similar to that of the benzo-fused predecessors (y-bases) with respect to the planarity of the aromatic rings and amino groups. Tautomeric studies reveal that the canonical-like form of naptho-thymine (yyT) and naptho-adenine (yyA) are the most stable tautomers, leading to hydrogen-bonded dimers with the corresponding natural nucleobases that mimic the Watson-Crick pairing. However, the canonical-like species of naptho-guanine (yyG) and naptho-cytosine (yyC) are not the most stable tautomers, and the most favorable hydrogen-bonded dimers involve wobble-like pairings. The expanded size of the naphto-bases leads to stacking interactions notably larger than those found for the natural bases, and they should presumably play a dominant contribution in modulating the structure of yyDNA duplexes. Finally, the HOMO-LUMO gap of the naptho-bases is smaller than that of their benzo-base counterparts, indicating that size-expansion of DNA bases is an efficient way of reducing their HOMO-LUMO gap. These results are examined in light of the available experimental evidence reported for yyT and yyC.

  10. Comparison of base substitutions in response to nitrogen ion implantation and 60Co-gamma ray irradiation in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Xie Chuan-Xiao

    2004-01-01

    Full Text Available To identify the specificity of base substitutions, a novel experimental system was established based on rifampicin-resistant (Rif r mutant screening and sequencing of the defined region of the rpoB gene in E. coli. We focused on comparing mutational spectra of base substitutions induced by either low energy nitrogen ion beam implantation or 60Co-gamma rays. The most significant difference in the frequency of specific kinds of mutations induced by low energy nitrogen ion beam was that CG ®TA transitions were significantly increased from 32 to 46, AT ®TA transversions were doubled from 7 to 15 in 50 mutants, respectively. The preferential base substitutions induced by nitrogen ion beam implantation were CG ®TA transitions, AT ®GC transitions, AT ®TA transversions, which account for 92.13% (82/89 of the total. The mutations induced by 60Co-gamma rays were preferentially GC ®AT and AT ®GC transitions, which totaled 84.31% (43/51.

  11. Strandwise translocation of a DNA glycosylase on undamaged DNA

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Yan; Nam, Kwangho; Spong, Marie C.; Banerjee, Anirban; Sung, Rou-Jia; Zhang, Michael; Karplus, Martin; Verdine, Gregory L. (Harvard)

    2012-05-14

    Base excision repair of genotoxic nucleobase lesions in the genome is critically dependent upon the ability of DNA glycosylases to locate rare sites of damage embedded in a vast excess of undamaged DNA, using only thermal energy to fuel the search process. Considerable interest surrounds the question of how DNA glycosylases translocate efficiently along DNA while maintaining their vigilance for target damaged sites. Here, we report the observation of strandwise translocation of 8-oxoguanine DNA glycosylase, MutM, along undamaged DNA. In these complexes, the protein is observed to translocate by one nucleotide on one strand while remaining untranslocated on the complementary strand. We further report that alterations of single base-pairs or a single amino acid substitution (R112A) can induce strandwise translocation. Molecular dynamics simulations confirm that MutM can translocate along DNA in a strandwise fashion. These observations reveal a previously unobserved mode of movement for a DNA-binding protein along the surface of DNA.

  12. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Directory of Open Access Journals (Sweden)

    Md. Mahbubur Rahman

    2015-02-01

    Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  13. Pharmacological mechanisms in the cardiovascular effects of DCLHb, a hemoglobin based blood substitute

    NARCIS (Netherlands)

    A. Gulati (Anil)

    1996-01-01

    textabstractThe search for a clinically useful blood substitute has been stimulated by the inherent limitations of the homologous blood transfusion system, particularly its sufficiency, safety and costs. Blood has been described as the "most complicated fluid in animals" (Winslow, 1992). An attempt

  14. Disability Insurance and Unemployment Insurance As Substitute Pathways: An Empirical Analysis Based on Employer Data

    NARCIS (Netherlands)

    Koning, P.; van Vuuren, D.

    2006-01-01

    In this paper, we estimate the degree of substitution between enrolment into Disability Insurance (DI) and Unemployment Insurance (UI) in the Netherlands. Starting in the 1990s many policy measures aimed at reducing DI enrolment, and increase labour force participation. We quantify whether these pol

  15. DNA methylation based biomarkers: Practical considerations and applications

    DEFF Research Database (Denmark)

    Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg

    2012-01-01

    of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...

  16. Finding human promoter groups based on DNA physical properties

    Science.gov (United States)

    Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong

    2009-10-01

    DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

  17. Antibody activation using DNA-based logic gates.

    Science.gov (United States)

    Janssen, Brian M G; van Rosmalen, Martijn; van Beek, Lotte; Merkx, Maarten

    2015-02-16

    Oligonucleotide-based molecular circuits offer the exciting possibility to introduce autonomous signal processing in biomedicine, synthetic biology, and molecular diagnostics. Here we introduce bivalent peptide-DNA conjugates as generic, noncovalent, and easily applicable molecular locks that allow the control of antibody activity using toehold-mediated strand displacement reactions. Employing yeast as a cellular model system, reversible control of antibody targeting is demonstrated with low nM concentrations of peptide-DNA locks and oligonucleotide displacer strands. Introduction of two different toehold strands on the peptide-DNA lock allowed signal integration of two different inputs, yielding logic OR- and AND-gates. The range of molecular inputs could be further extended to protein-based triggers by using protein-binding aptamers. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Finding human promoter groups based on DNA physical properties.

    Science.gov (United States)

    Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong

    2009-10-01

    DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

  19. Flow cytometry-based DNA hybridization and polymorphism analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cai, H.; Kommander, K.; White, P.S.; Nolan, J.P.

    1998-07-01

    Functional analysis of the humane genome, including the quantification of differential gene expression and the identification of polymorphic sites and disease genes, is an important element of the Human Genome Project. Current methods of analysis are mainly gel-based assays that are not well-suited to rapid genome-scale analyses. To analyze DNA sequence on a large scale, robust and high throughput assays are needed. The authors are developing a suite of microsphere-based approaches employing fluorescence detection to screen and analyze genomic sequence. The approaches include competitive DNA hybridization to measure DNA or RNA targets in unknown samples, and oligo ligation or extension assays to analyze single-nucleotide polymorphisms. Apart from the advances of sensitivity, simplicity, and low sample consumption, these flow cytometric approaches have the potential for high throughput multiplexed analysis using multicolored microspheres and automated sample handling.

  20. Poly(dimethylsiloxane) based microchip for DNA electrophoresis

    Institute of Scientific and Technical Information of China (English)

    LIU Changchun; CUI Dafu; WANG Li

    2004-01-01

    A novel poly(dimethylsiloxane)(PDMS) -based microchip for DNA separation through electrophoresis has been developed using a micro-electro-mechanical-system(MEMS) technology. Unlike previous hybrid PDMS microchip, one PDMS film is first created on glass support by pressing method in our microchip. Thus, increased band-broadening phenomena, arising from the material nonuniformity at the walls of microchannel, can be avoided in electrophoresis process. A low-viscosity hydroxypropylmethylcellulose-100 (HPMC-100) is used as the separation medium for fluorescent intercalator-labeled double-stranded DNA (dsDNA) fragments. Mannitol is introduced to PDMS-based microchip as a separation medium additive to enhance separation efficiency. At applied electric field strength of 150 V/cm, excellent separations of the PCR marker could be achieved with an effective separation distance of 25mm .

  1. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  2. Structures and spectroscopic properties of nonperipherally and peripherally substituted metal-free phthalocyanines: a substitution effect study based on density functional theory calculations.

    Science.gov (United States)

    Zhong, Aimin; Zhang, Yuexing; Bian, Yongzhong

    2010-11-01

    The molecular structures, molecular orbitals, atomic charges, electronic absorption spectra, and infrared (IR) and Raman spectra of a series of substituted metal-free phthalocyanine compounds with four (1, 3, 5, 7) or eight (2, 4, 6, 8) methoxyl (1, 2, 5, 6) or methylthio groups (3, 4, 7, 8) on the nonperipheral (1-4) or peripheral positions (5-8) of the phthalocyanine ring are studied by density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations. The calculated structural parameters and simulated electronic absorption and IR spectra are compared with the X-ray crystallography structures and the experimentally observed electronic absorption and IR spectra of the similar molecules, and good agreement between the calculated and experimental results is found. The substitution of the methoxyl or methylthio groups at the nonperipheral positions of the phthalocyanine ring has obvious effects on the molecular structure and spectroscopic properties of the metal-free phthalocyanine. Nonperipheral substitution has a more significant influence than peripheral substitution. The substitution effect increases with an increase in the number of substituents. The methylthio group shows more significant influence than the methoxyl group, despite the stronger electron-donating property of the methoxyl group than the methylthio group. The octa-methylthio-substituted metal-free phthalocyanine compounds have nonplanar structures whose low-lying occupied molecular orbitals and electronic absorption spectra are significantly changed by the substituents. The present systematical study will be helpful for understanding the relationship between structures and properties in phthalocyanine compounds and designing phthalocyanines with typical properties.

  3. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.

    Science.gov (United States)

    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej

    2015-08-01

    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  4. DNA methylation detection based on difference of base content

    Science.gov (United States)

    Sato, Shinobu; Ohtsuka, Keiichi; Honda, Satoshi; Sato, Yusuke; Takenaka, Shigeori

    2016-04-01

    Methylation frequently occurs in cytosines of CpG sites to regulate gene expression. The identification of aberrant methylation of certain genes is important for cancer marker analysis. The aim of this study was to determine the methylation frequency in DNA samples of unknown length and/or concentration. Unmethylated cytosine is known to be converted to thymine following bisulfite treatment and subsequent PCR. For this reason, the AT content in DNA increases with an increasing number of methylation sites. In this study, the fluorescein-carrying bis-acridinyl peptide (FKA) molecule was used for the detection of methylation frequency. FKA contains fluorescein and two acridine moieties, which together allow for the determination of the AT content of double-stranded DNA fragments. Methylated and unmethylated human genomes were subjected to bisulfide treatment and subsequent PCR using primers specific for the CFTR, CDH4, DBC1, and NPY genes. The AT content in the resulting PCR products was estimated by FKA, and AT content estimations were found to be in good agreement with those determined by DNA sequencing. This newly developed method may be useful for determining methylation frequencies of many PCR products by measuring the fluorescence in samples excited at two different wavelengths.

  5. Statistical mechanics of base stacking and pairing in DNA melting.

    Science.gov (United States)

    Ivanov, Vassili; Zeng, Yan; Zocchi, Giovanni

    2004-11-01

    We propose a statistical mechanics model for DNA melting in which base stacking and pairing are explicitly introduced as distinct degrees of freedom. Unlike previous approaches, this model describes thermal denaturation of DNA secondary structure in the whole experimentally accessible temperature range. Base pairing is described through a zipper model, base stacking through an Ising model. We present experimental data on the unstacking transition, obtained exploiting the observation that at moderately low pH this transition is moved down to experimentally accessible temperatures. These measurements confirm that the Ising model approach is indeed a good description of base stacking. On the other hand, comparison with the experiments points to the limitations of the simple zipper model description of base pairing.

  6. Ultrasensitive electrochemical DNA assay based on counting of single magnetic nanobeads by a combination of DNA amplification and enzyme amplification.

    Science.gov (United States)

    Zhang, Xiaoli; Li, Linlin; Li, Lu; Chen, Jia; Zou, Guizheng; Si, Zhikun; Jin, Wenrui

    2009-03-01

    An ultrasensitive electrochemical method for determination of DNA is developed based on counting of single magnetic nanobeads (MNBs) corresponding to single DNA sequences combined with a double amplification (DNA amplification and enzyme amplification). In this method, target DNA (t-DNA) is captured on a streptavidin-coated substrate via biotinylated capture DNA. Then, MNBs functionalized with first-probe DNAs (p1-DNA-MNBs) are conjugated to t-DNA sequences with a ratio of 1:1. Subsequently, the p1-DNA-MNBs are released from the substrate via dehybridization. The released p1-DNA-MNBs are labeled with alkaline phosphatase (AP) using biotinylated second-probe DNAs (p2-DNAs) and streptavidin-AP conjugates. The resultant AP-p2-DNA-p1-DNA-MNBs with enzyme substrate disodium phenyl phosphate (DPP) are continuously introduced through a capillary as the microsampler and microreactor at 40 degrees C. AP on the AP-p2-DNA-p1-DNA-MNBs converts a huge number of DPP into its product phenol, and phenol zones are produced around each moving AP-p2-DNA-p1-DNA-MNB. The phenol zones are continuously delivered to the capillary outlet and detected by a carbon fiber disk bundle electrode at 1.05 V. An elution curve with peaks is obtained. Each peak is corresponding to a phenol zone relative to single t-DNA sequence. The peaks on the elution curve are counted for quantification. The number of the peaks is proportional to the concentration of t-DNA in a range of 5.0 x 10(-16) to 1.0 x 10(-13) mol/L.

  7. A DNA-Based Encryption Method Based on Two Biological Axioms of DNA Chip and Polymerase Chain Reaction (PCR) Amplification Techniques.

    Science.gov (United States)

    Zhang, Yunpeng; Wang, Zhiwen; Wang, Zhenzhen; Liu, Xin; Yuan, Xiaojing

    2017-09-27

    Researchers have gained a deeper understanding of DNA-based encryption and its effectiveness in enhancing information security in recent years. However, there are many theoretical and technical issues about DNA-based encryption that need to be addressed before it can be effectively used in the field of security. Currently, the most popular DNA-based encryption schemes are based on traditional cryptography and the integration of existing DNA technology. These schemes are not completely based on DNA computing and biotechnology. Herein, as inspired by nature, encryption based on DNA has been developed, which is, in turn, based on two fundamental biological axioms about DNA sequencing: 1) DNA sequencing is difficult under the conditions of not knowing the correct sequencing primers and probes, and 2) without knowing the correct probe, it is difficult to decipher precisely and sequence the information of unknown and mixed DNA/peptide nucleic acid (PNA) probes, which only differ in nucleotide sequence, arranged on DNA chips (microarrays). In essence, when creating DNA-based encryption by means of biological technologies, such as DNA chips and polymerase chain reaction (PCR) amplification, the encryption method discussed herein cannot be decrypted, unless the DNA/PNA probe or PCR amplification is known. The biological analysis, mathematical analysis, and simulation results demonstrate the feasibility of the method, which provides much stronger security and reliability than that of traditional encryption methods. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  9. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  10. Indicator Based and Indicator - Free Electrochemical DNA Biosensors

    Science.gov (United States)

    2007-11-02

    of genomic material from infectious organisms. Methylene blue (MB) is an aromatic heterocycle that binds strongly to DNA via intercalation. MB...detection of disease- related point mutation in the guanine bases of the cyanobacteria . The resulting biosensors offer great promise for mismatch

  11. Mitochondrial and chloroplast DNA based phylogeny of Pelargonium (Geraniaceae)

    NARCIS (Netherlands)

    Bakker, F.T.; Culham, A.; Pankhurst, C.E.; Gibby, M.

    2000-01-01

    Overall phylogenetic relationships within the genus Pelargonium (Geraniaceae) were inferred based on DNA sequences from mitochondrial(mt)-encoded nad1 b/c exons and from chloroplast(cp)-encoded trnL (UAA) 5' exon-trnF (GAA) exon regions using two species of Geranium and Sarcocaulon vanderetiae as ou

  12. 19-electron intermediates in the Ligand Substitution of CpW(CO)3with a Lewis Base

    Energy Technology Data Exchange (ETDEWEB)

    Cahoon, James F.; Kling, Matthias F.; Sawyer, Karma R.; Frei,Heinz; Harris, Charles B.

    2005-12-14

    Odd electron species are important intermediates in organometallic chemistry, participating in a variety of catalytic and electron-transfer reactions which produce stable even-electron products. While electron deficient 17-electron (17e) radicals have been well characterized, the possible existence of short-lived 19-electron (19e) radicals has been a subject of continuing investigation. 19e radicals have been postulated as intermediates in the photochemical ligand substitution and disproportionation reactions of organometallic dimers containing a single metal-metal bond, yet the reactions of these intermediates on diffusion-limited time scales (ns-{micro}s) have never been directly observed. This study resolves the 19e dynamics in the ligand substitution of 17e radicals CpW(CO){sub 3}{sup {sm_bullet}} (Cp = C{sub 5}H{sub 5}) with the Lewis base P(OMe){sub 3}, providing the first complete description 19e reactivity.

  13. SMT-based Verification of LTL Specifications with Integer Constraints and its Application to Runtime Checking of Service Substitutability

    CERN Document Server

    Bersani, Marcello M; Frigeri, Achille; Pradella, Matteo; Rossi, Matteo

    2010-01-01

    An important problem that arises during the execution of service-based applications concerns the ability to determine whether a running service can be substituted with one with a different interface, for example if the former is no longer available. Standard Bounded Model Checking techniques can be used to perform this check, but they must be able to provide answers very quickly, lest the check hampers the operativeness of the application, instead of aiding it. The problem becomes even more complex when conversational services are considered, i.e., services that expose operations that have Input/Output data dependencies among them. In this paper we introduce a formal verification technique for an extension of Linear Temporal Logic that allows users to include in formulae constraints on integer variables. This technique applied to the substitutability problem for conversational services is shown to be considerably faster and with smaller memory footprint than existing ones.

  14. Endonuclease-based Method for Detecting the Sequence Specific DNA Binding Protein on Double-stranded DNA Microarray

    Institute of Scientific and Technical Information of China (English)

    Yun Fei BAI; Qin Yu GE; Tong Xiang LI; Jin Ke WANG; Quan Jun LIU; Zu Hong LU

    2005-01-01

    The double-stranded DNA (dsDNA) probe contains two different protein binding sites.One is for DNA- binding proteins to be detected and the other is for a DNA restriction enzyme.The two sites were arranged together with no base interval. The working principle of the capturing dsDNA probe is described as follows: the capturing probe can be cut with the DNA restriction enzyme (such as EcoR I) to cause a sticky terminal, if the probe is not bound with a target protein, and the sticky terminal can be extended and labeled with Cy3-dUTP by DNA polymerase. When the probe is bound with a target protein, the probe is not capable to be cut by the restriction enzyme because of space obstruction. The amount of the target DNA binding proteins can be measured according to the variations of fluorescent signals of the corresponding probes.

  15. Karyotyping of Brassica oleracea L.based on rDNA and Cot-1 DNA fluorescence in situ hybridization

    Institute of Scientific and Technical Information of China (English)

    WANG Taixia; WU Chunhong; HUANG Jinyong; WEI Wenhui

    2007-01-01

    To explore an effective and reliable karyotyping method in Brassica crop plants,Cot-1 DNA was isolated from Brassica oleracea genome,labeled as probe with Biotin-Nick Translation Mix kit,in situ hybridized to mitotic spreads,and where specific fluorescent bands showed on each chromosome pair.25S and 5S rDNA were labeled as probes with DIG-Nick Translation Mix kit and Biotin-Nick Translation Mix kit,respectively,in situ hybridized to mitotic preparations,where 25S rDNA could be detected on two chromosome pairs and 5S rDNA on only one.Cot-1 DNA contains rDNA and chromosome sites identity between Cot-1 DNA and 25S rDNA was determined by dual-colour fluorescence in situ hybridization.All these showed that the karyotyping technique based on a combination of rDNA and Cot-1 DNA chromosome landmarks is superior to all but one.A more exact karyotype ofB.oleracea has been analyzed based on a combination of rDNA sites,Cot-1 DNA fluorescent bands,chromosome lengths and arm ratios.

  16. Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

    Science.gov (United States)

    Sharma, Anshul Kumar; Kumar, Pankaj; Saini, Rajan; Bedi, R. K.; Mahajan, Aman

    2016-05-01

    A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC8/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC8 derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO2, NO, Cl2 and NH3 at operating temperature of 150˚C. It has been demonstrated that for Cl2 minimum detection limit of CuPcOC8/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl2.

  17. Thermotropic ruthenium(II)-containing metallomesogens based on substituted 1,10-phenanthroline ligands.

    Science.gov (United States)

    Cardinaels, Thomas; Ramaekers, Jan; Driesen, Kris; Nockemann, Peter; Van Hecke, Kristof; Van Meervelt, Luc; Goderis, Bart; Binnemans, Koen

    2009-03-16

    Imidazo[4,5-f]-1,10-phenanthroline and pyrazino[2,3-f]-1,10-phenanthroline substituted with long alkyl chains are versatile ligands for the design of metallomesogens because of the ease of ligand substitution. Whereas the ligands and the corresponding rhenium(I) complexes were not liquid-crystalline, mesomorphism was observed for the corresponding ionic ruthenium(II) complexes with chloride, hexafluorophosphate, and bistriflimide counterions. The mesophases were identified as smectic A phases by high-temperature small-angle X-ray scattering (SAXS) using synchrotron radiation. The transition temperatures depend on the anion, the highest temperatures being observed for the chloride salts and the lowest for the bistriflimide salts. The ruthenium(II) complexes are examples of luminescent ionic liquid crystals.

  18. Nanopore-based Fourth-generation DNA Sequencing Technology

    Institute of Scientific and Technical Information of China (English)

    Yanxiao Feng; Yuechuan Zhang; Cuifeng Ying; Deqiang Wang; Chunlei Du

    2015-01-01

    Nanopore-based sequencers, as the fourth-generation DNA sequencing technology, have the potential to quickly and reliably sequence the entire human genome for less than $1000, and possibly for even less than$100. The single-molecule techniques used by this technology allow us to further study the interaction between DNA and protein, as well as between protein and protein. Nanopore analysis opens a new door to molecular biology investigation at the single-molecule scale. In this article, we have reviewed academic achievements in nanopore technology from the past as well as the latest advances, including both biological and solid-state nanopores, and discussed their recent and potential applications.

  19. DNA-Based Self-Assembly of Fluorescent Nanodiamonds.

    Science.gov (United States)

    Zhang, Tao; Neumann, Andre; Lindlau, Jessica; Wu, Yuzhou; Pramanik, Goutam; Naydenov, Boris; Jelezko, Fedor; Schüder, Florian; Huber, Sebastian; Huber, Marinus; Stehr, Florian; Högele, Alexander; Weil, Tanja; Liedl, Tim

    2015-08-12

    As a step toward deterministic and scalable assembly of ordered spin arrays we here demonstrate a bottom-up approach to position fluorescent nanodiamonds (NDs) with nanometer precision on DNA origami structures. We have realized a reliable and broadly applicable surface modification strategy that results in DNA-functionalized and perfectly dispersed NDs that were then self-assembled in predefined geometries. With optical studies we show that the fluorescence properties of the nitrogen-vacancy color centers in NDs are preserved during surface modification and DNA assembly. As this method allows the nanoscale arrangement of fluorescent NDs together with other optically active components in complex geometries, applications based on self-assembled spin lattices or plasmon-enhanced spin sensors as well as improved fluorescent labeling for bioimaging could be envisioned.

  20. Fluorescence of size-expanded DNA bases: reporting on DNA sequence and structure with an unnatural genetic set.

    Science.gov (United States)

    Krueger, Andrew T; Kool, Eric T

    2008-03-26

    We recently described the synthesis and helix assembly properties of expanded DNA (xDNA), which contains base pairs 2.4 A larger than natural DNA pairs. This designed genetic set is under study with the goals of mimicking the functions of the natural DNA-based genetic system and of developing useful research tools. Here, we study the fluorescence properties of the four expanded bases of xDNA (xA, xC, xG, xT) and evaluate how their emission varies with changes in oligomer length, composition, and hybridization. Experiments were carried out with short oligomers of xDNA nucleosides conjugated to a DNA oligonucleotide, and we investigated the effects of hybridizing these fluorescent oligomers to short complementary DNAs with varied bases opposite the xDNA bases. As monomer nucleosides, the xDNA bases absorb light in two bands: one at approximately 260 nm (similar to DNA) and one at longer wavelength ( approximately 330 nm). All are efficient violet-blue fluorophores with emission maxima at approximately 380-410 nm and quantum yields (Phifl) of 0.30-0.52. Short homo-oligomers of the xDNA bases (length 1-4 monomers) showed moderate self-quenching except xC, which showed enhancement of Phifl with increasing length. Interestingly, multimers of xA emitted at longer wavelengths (520 nm) as an apparent excimer. Hybridization of an oligonucleotide to the DNA adjacent to the xDNA bases (with the xDNA portion overhanging) resulted in no change in fluorescence. However, addition of one, two, or more DNA bases in these duplexes opposite the xDNA portion resulted in a number of significant fluorescence responses, including wavelength shifts, enhancements, or quenching. The strongest responses were the enhancement of (xG)n emission by hybridization of one or more adenines opposite them, and the quenching of (xT)n and (xC)n emission by guanines opposite. The data suggest multiple ways in which the xDNA bases, both alone and in oligomers, may be useful as tools in biophysical analysis

  1. Micromechanics of base pair unzipping in the DNA duplex.

    Science.gov (United States)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov'yov, Andrey V

    2012-01-25

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G·C content and rather distinct for the parts with A·T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork.

  2. Ab initio study of effect of Co substitution on the magnetic properties of Ni and Pt-based Heusler alloys

    Science.gov (United States)

    Roy, Tufan; Chakrabarti, Aparna

    2017-04-01

    Using density functional theory based calculations, we have carried out in-depth studies of effect of Co substitution on the magnetic properties of Ni and Pt-based shape memory alloys. We show the systematic variation of the total magnetic moment, as a function of Co doping. A detailed analysis of evolution of Heisenberg exchange coupling parameters as a function of Co doping has been presented here. The strength of RKKY type of exchange interaction is found to decay with the increase of Co doping. We calculate and show the trend, how the Curie temperature of the systems vary with the Co doping.

  3. Persistence of DNA of Gaeumannomyces graminis var. tritici in soil as measured by a DNA-based assay.

    Science.gov (United States)

    Herdina; Neate, Stephen; Jabaji-Hare, Suha; Ophel-Keller, Kathy

    2004-02-01

    There are an increasing number of assays available for fungal plant pathogens based on DNA technology. We have developed such an assay for Gaeumannomyces graminis var. tritici (Ggt) in soil, using slot-blot hybridisation. To ensure the validity of DNA-based soil assays for the fungus, it is important to determine the stability of Ggt DNA in soil. This study was undertaken to quantify the DNA degradation of dead Ggt in soil using a DNA-based assay. Mycelia were killed using various treatments, then DNA was extracted and estimated by a slot-blot hybridisation technique using the specific Ggt DNA probe, pG158. Mycelia were also killed using a fungicide (triadimefon) at a concentration of 150-250 microg ml(-1). The amount of detectable DNA of Ggt, killed using triadimefon, declined by 82-93%. Inoculum in the form of diseased wheat roots, artificially inoculated ryegrass seed, particulate soil organic matter and whole soil was killed using heat-treatment. The amount of detectable DNA of Ggt declined markedly (90%) in both heat-treated roots and inoculated ryegrass seeds, and declined by 50% in both treated soil and soil organic matter. The rate of DNA degradation of Ggt in soil varied with the type of inoculum. The amount of detectable DNA of Ggt in dead mycelia declined by 99.8% after 4 days of incubation in soil. No DNA was detected after 8 days of incubation. In contrast, Ggt DNA in live mycelia declined by 70% after 8 days of incubation and declined to 10% of original DNA level after 32 days. In ground ryegrass seed inoculum, DNA in both killed and live Ggt declined by 50% after 8 days. In diseased roots, DNA from both live and killed Ggt did not appear to decline over 16 days. Estimates of the amount of Ggt in the soil using a DNA-based assay reflect both live and dead populations of the fungus. The rate of breakdown of DNA of the dead fungus is very high and the presence of dead fungi in roots probably a rare event so the DNA from dead fungus probably contributes

  4. Recognition of human telomeric G-quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety.

    Science.gov (United States)

    Bhowmik, Debipreeta; Fiorillo, Gaetano; Lombardi, Paolo; Kumar, G Suresh

    2015-12-01

    G-quadruplex forming sequences are widely distributed in human genome and serve as novel targets for regulating gene expression and chromosomal maintenance. They offer unique targets for anticancer drug development. Here, the interaction of berberine (BC) and two of its analogs bearing substitution at 9 and 13-position with human telomeric G-quadruplex DNA sequence has been investigated by biophysical techniques. Both the analogs exhibited several-fold higher binding affinity than berberine. The Scatchard binding isotherms revealed non-cooperative binding. 9-ω-amino hexyl ether analog (BC1) showed highest affinity (1.8 × 10(6) M(-1)) while the affinity of the 13-phenylpropyl analog (BC2) was 1.09 × 10(6) M(-1). Comparative fluorescence quenching and polarization anisotropy of the emission spectra gave evidence for a stronger stacking interaction of the analogs compared to berberine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberine. However, the binding of the analogs did not induce any major structural perturbation in the G-quadruplex structure, but led to higher thermal stability. Energetics of the binding indicated that the association of the analogs was exothermic and predominantly entropy driven phenomenon. Increasing the temperature resulted in weaker binding; the enthalpic contribution increased and the entropic contribution decreased. A small negative heat capacity change with significant enthalpy-entropy compensation established the involvement of multiple weak noncovalent interactions in the binding process. The 9-ω-amino hexyl ether analog stabilized the G-quadruplex structure better than the 13-phenyl alkyl analog.

  5. Changes in DNA base sequences in the mutant of Arabidopsis thaliana induced by low-energy N+ implantation

    Institute of Scientific and Technical Information of China (English)

    常凤启; 刘选明; 李银心; 贾庚祥; 马晶晶; 刘公社; 朱至清

    2003-01-01

    To reveal the mutation effect of low-energy ion implantation on Arabidopsis thaliana in vivo, T80II, a stable dwarf mutant, derived from the seeds irradiated by 30 keV N+ with the dose of 80×1015 ions/cm2 was used for Random Amplified Polymorphic DNA (RAPD) and base sequence analysis. The results indicated that among total 397 RAPD bands observed, 52 bands in T80II were different from those of wild type showing a variation frequency 13.1%. In comparison with the sequences of A. thaliana in GenBank, the RAPD fragments in T80II were changed greatly in base sequences with an average rate of one base change per 16.8 bases. The types of base changes included base transition, transversion, deletion and insertion. Among the 275 base changes detected, single base substitutions (97.09%) occurred more frequently than base deletions and insertions (2.91%). And the frequency of base transitions (66.55%) was higher than that of base transversions (30.55%). Adenine, thymine, guanine or cytosine could be replaced by any of other three bases in cloned DNA fragments in T80II. It seems that thymine was more sensitive to the irradiation than other bases. The flanking sequences of the base changes in RAPD fragments in T80II were analyzed and the mutational "hotspot" induced by low-energy ion implantation was discussed.

  6. Dependence of carrier doping on the impurity potential in transition-metal-substituted FeAs-based superconductors.

    Science.gov (United States)

    Ideta, S; Yoshida, T; Nishi, I; Fujimori, A; Kotani, Y; Ono, K; Nakashima, Y; Yamaichi, S; Sasagawa, T; Nakajima, M; Kihou, K; Tomioka, Y; Lee, C H; Iyo, A; Eisaki, H; Ito, T; Uchida, S; Arita, R

    2013-03-01

    In order to examine to what extent the rigid-band-like electron doping scenario is applicable to the transition metal-substituted Fe-based superconductors, we have performed angle-resolved photoemission spectroscopy studies of Ba(Fe(1-x)Ni(x))(2)As(2) (Ni-122) and Ba(Fe(1-x)Cu(x))(2)As(2) (Cu-122), and compared the results with Ba(Fe(1-x)Co(x))(2)As(2) (Co-122). We find that Ni 3d-derived features are formed below the Fe 3d band and that Cu 3d-derived ones further below it. The electron and hole Fermi surface (FS) volumes are found to increase and decrease with substitution, respectively, qualitatively consistent with the rigid-band model. However, the total extra electron number estimated from the FS volumes (the total electron FS volume minus the total hole FS volume) is found to decrease in going from Co-, Ni-, to Cu-122 for a fixed nominal extra electron number, that is, the number of electrons that participate in the formation of FS decreases with increasing impurity potential. We find that the Néel temperature T(N) and the critical temperature T(c) maximum are determined by the FS volumes rather than the nominal extra electron concentration or the substituted atom concentration.

  7. Bisulfite-based epityping on pooled genomic DNA provides an accurate estimate of average group DNA methylation

    Directory of Open Access Journals (Sweden)

    Docherty Sophia J

    2009-03-01

    Full Text Available Abstract Background DNA methylation plays a vital role in normal cellular function, with aberrant methylation signatures being implicated in a growing number of human pathologies and complex human traits. Methods based on the modification of genomic DNA with sodium bisulfite are considered the 'gold-standard' for DNA methylation profiling on genomic DNA; however, they require relatively large amounts of DNA and may be prohibitively expensive when used on the large sample sizes necessary to detect small effects. We propose that a high-throughput DNA pooling approach will facilitate the use of emerging methylomic profiling techniques in large samples. Results Compared with data generated from 89 individual samples, our analysis of 205 CpG sites spanning nine independent regions of the genome demonstrates that DNA pools can be used to provide an accurate and reliable quantitative estimate of average group DNA methylation. Comparison of data generated from the pooled DNA samples with results averaged across the individual samples comprising each pool revealed highly significant correlations for individual CpG sites across all nine regions, with an average overall correlation across all regions and pools of 0.95 (95% bootstrapped confidence intervals: 0.94 to 0.96. Conclusion In this study we demonstrate the validity of using pooled DNA samples to accurately assess group DNA methylation averages. Such an approach can be readily applied to the assessment of disease phenotypes reducing the time, cost and amount of DNA starting material required for large-scale epigenetic analyses.

  8. Rapid sequencing of DNA based on single-molecule detection

    Science.gov (United States)

    Soper, Steven A.; Davis, Lloyd M.; Fairfield, Frederick R.; Hammond, Mark L.; Harger, Carol A.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.; Nutter, Harvey L.; Shera, E. Brooks; Simpson, Daniel J.

    1991-07-01

    Sequencing the human genome is a major undertaking considering the large number of nucleotides present in the genome and the slow methods currently available to perform the task. The authors have recently reported on a scheme to sequence DNA rapidly using a non-gel based technique. The concept is based upon the incorporation of fluorescently labeled nucleotides into a strand of DNA, isolation and manipulation of a labeled DNA fragment and the detection of single nucleotides using ultra-sensitive laser-induced fluorescence detection following their cleavage from the fragment. Detection of individual fluorophores in the liquid phase was accomplished with time-gated detection following pulsed-laser excitation. The photon bursts from individual rhodamine 6G (R6G) molecules travelling through a laser beam have been observed, as have bursts from single fluorescently modified nucleotides. Using two different biotinylated nucleotides as a model system for fluorescently labeled nucleotides, the authors have observed synthesis of the complementary copy of M13 bacteriophage. Work with fluorescently labeled nucleotides is underway. Individual molecules of DNA attached to a microbead have been observed and manipulated with an epifluorescence microscope.

  9. Substitutional analysis

    CERN Document Server

    Rutherford, Daniel Edwin

    2013-01-01

    Classic monograph, suitable for advanced undergraduates and graduate students. Topics include calculus of permutations and tableaux, semi-normal representation, orthogonal and natural representations, group characters, and substitutional equations. 1968 edition.

  10. Sugar Substitutes

    Science.gov (United States)

    ... drinks. You may also have heard them called "artificial sweeteners" or "non-caloric sweeteners." They can be used ... of nutrition for your body.What sugar substitutes/artificial sweeteners are approved by the FDA?The following sugar ...

  11. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  12. Synthetic incorporation of Nile Blue into DNA using 2′-deoxyriboside substitutes: Representative comparison of (R- and (S-aminopropanediol as an acyclic linker

    Directory of Open Access Journals (Sweden)

    Daniel Lachmann

    2010-02-01

    Full Text Available The Nile Blue chromophore was incorporated into oligonucleotides using “click” chemistry for the postsynthetic modification of oligonucleotides. These were synthesized using DNA building block 3 bearing an alkyne group and reacted with the azide 4. (R-3-amino-1,2-propanediol was applied as the linker between the phosphodiester bridges. Two sets of DNA duplexes were prepared. One set carried the chromophore in an A-T environment, the second set in a G-C environment. Both were characterized by optical spectroscopy. Sequence-dependent fluorescence quenching was applied as a sensitive tool to compare the stacking interactions with respect to the chirality of the acyclic linker attachment. The results were compared to recent results from duplexes that carried the Nile Blue label in a sequentially and structurally identical context, except for the opposite chirality of the linker ((S-3-amino-1,2-propandiol. Only minor, negligible differences were observed. Melting temperatures, UV–vis absorption spectra together with fluorescence quenching data indicate that Nile Blue stacks perfectly between the adjacent base pairs regardless of whether it has been attached via an S- or R-configured linker. This result was supported by geometrically optimized DNA models.

  13. Stereodivergent Allylic Substitutions with Aryl Acetic Acid Esters by Synergistic Iridium and Lewis Base Catalysis.

    Science.gov (United States)

    Jiang, Xingyu; Beiger, Jason J; Hartwig, John F

    2017-01-11

    The preparation of all possible stereoisomers of a given chiral molecule bearing multiple stereocenters by a simple and unified method is a significant challenge in asymmetric catalysis. We report stereodivergent allylic substitutions with aryl acetic acid esters catalyzed synergistically by a metallacyclic iridium complex and benzotetramisole. Through permutations of the enantiomers of the two chiral catalysts, all four stereoisomers of the products bearing two adjacent stereocenters are accessible with high diastereoselectivity and enantioselectivity. The resulting chiral activated ester products can be converted readily to enantioenriched amides, unactivated esters, and carboxylic acids in a one-pot manner.

  14. A nonreciprocal racetrack resonator based on vacuum-annealed magnetooptical cerium-substituted yttrium iron garnet.

    Science.gov (United States)

    Goto, Taichi; Onbasli, Mehmet C; Kim, Dong Hun; Singh, Vivek; Inoue, M; Kimerling, Lionel C; Ross, C A

    2014-08-11

    Vacuum annealed polycrystalline cerium substituted yttrium iron garnet (CeYIG) films deposited by radio frequency magnetron sputtering on non-garnet substrates were used in nonreciprocal racetrack resonators. CeYIG annealed at 800°C for 30 min provided a large Faraday rotation angle, close to the single crystal value. Crystallinity, magnetic properties, refractive indices and absorption coefficients were measured. The resonant transmission peak of the racetrack resonator covered with CeYIG was non-reciprocally shifted by applying an in-plane magnetic field.

  15. Hairpin DNA probe based surface plasmon resonance biosensor used for the activity assay of E. coli DNA ligase.

    Science.gov (United States)

    Luan, Qingfen; Xue, Ying; Yao, Xin; Lu, Wu

    2010-02-01

    Using hairpin DNA probe self-structure change during DNA ligation process, a sensitive, label-free and simple method of E. coli DNA ligase assay via a home-built high-resolution surface plasmon resonance (SPR) instrument was developed. The DNA ligation process was monitored in real-time and the effects of single-base mutation on the DNA ligation process were investigated. Then an assay of E. coli DNA ligase was completed with a lower detection limit (0.6 nM), wider concentration range and better reproducibility. Moreover, the influence of Quinacrine on the activity of E. coli DNA ligase was also studied, which demonstrated that our method was useful for drug screening.

  16. Mink serum amyloid A protein. Expression and primary structure based on cDNA sequences.

    Science.gov (United States)

    Marhaug, G; Husby, G; Dowton, S B

    1990-06-15

    The nucleotide sequences of two mink serum amyloid A (SAA) cDNA clones have been analyzed, one (SAA1) 776 base pairs long and the other (SAA2) 552 base pairs long. Significant differences were discovered when derived amino acid sequences were compared with data for apoSAA isolated from high density lipoprotein. Previous studies of mink protein SAA and amyloid protein A (AA) suggest that only one SAA isotype is amyloidogenic. The cDNA clone for SAA2 defines the "amyloid prone" isotype while SAA1 is found only in serum. Mink SAA1 has alanine in position 10, isoleucine in positions 24, 67, and 71, lysine in position 27, and proline in position 105. Residue 10 in mink SAA2 is valine while arginine and asparagine are at positions 24 and 27, respectively, all characteristics of protein AA isolated from mink amyloid fibrils. Mink SAA2 also has valine in position 67, phenylalanine in position 71, and amino acid 105 is serine. It remains unknown why these six amino acid substitutions render SAA2 more amyloidogenic than SAA1. Eighteen hours after lipopolysaccharide stimulation, mink SAA mRNA is abundant in liver with relatively minor accumulations in brain and lung. Genes encoding both SAA isotypes are expressed in all three organs while no SAA mRNA was detectable in amyloid prone organs, including spleen and intestine, indicating that deposition of AA from locally synthesized SAA is unlikely. A third mRNA species (2.2 kilobases) was identified and hybridizes with cDNA probes for mink SAA1 and SAA2. In addition to a major primary translation product (molecular mass 14,400 Da) an additional product with molecular mass 28,000 Da was immunoprecipitable.

  17. Theoretical Studies on Electronic Spectra and Second-order Nonlinear Optical Properties of Barbituric Acid Derivatives Substituted with Schiff Base

    Institute of Scientific and Technical Information of China (English)

    SUN,Gang(孙刚); QIU,Yong-Qing(仇永清); SUN,Hai-Zhu(孙海珠); SU,Zhong-Min(苏忠民); FENG,Jing-Dong(冯静东); ZHU,Yu-Lan(朱玉兰)

    2004-01-01

    The structures of barbituric acid derivatives substituted with Schiff base were optimized using ab initio HF method at 6-31G basis set.Based on the optimized structures,the electronic spectra were obtained by INDO/CI method.The second-order nonlinear optical (NLO) coefficients βu were calculated according to the sum-over-states (SOS) formula.In addition,the effect of conjugation on electronic spectra and second-order NLO coefficients was investigated.The influence of exchange between C and N atoms as well as the substituted effect on the barbituric acid was discussed.It was indicated that the exchange between C and N atoms on Schiff base is important for enhancing the NLO coefficient of the whole molecule with donor and acceptor (D-A).Meanwhile significant changes in electron donation and acception were observed as substituents changes positions.Among the designed models,molecule 1b has maximal βμ value of 124.65 × 10-30 esu.About molecule 1b,barbituric acid is considered as an accepted electronic group and the position of N atom on Schiff base is close to it.

  18. Preclinical investigation of an innovative magnesium-based bone graft substitute for potential orthopaedic applications

    Directory of Open Access Journals (Sweden)

    Chen Liu

    2014-07-01

    Full Text Available Degradable or corrosive biometal is an attractive research and development (R&D area in clinical orthopaedics. This study was designed to investigate biomechanical and biological properties of magnesium (Mg and strontium (Sr with a focus on Mg-based metals, including pure Mg and Mg–xwt% Sr (x = 0.25, x = 1.0, x = 1.5, x = 2.5 alloys, as potential bone graft substitutes in respect to their mechanical strength, corrosion resistance, and cytocompatibility for further optimization and establishing indications for relevant in vivo applications. Our data showed that the tensile and compressive strength increased with addition of Sr because of the Mg17Sr2 precipitation strengthen. Compared with commercially used bone graft substitutes, the mechanical properties of Mg–Sr alloys were close to those of cortical bone, and the compressive strength could reach 300 MPa, suggesting its potential application for load-bearing bone as bone defect filler. The corrosion rates of Mg–xwt% Sr alloys were controlled in the range of 0.05–0.07 mm/y, indicating feasibility of bone grafting and the in situ bone repair process. Moreover, Mg–Sr alloys also exhibit good cytocompatibility and antibacterial properties. Our innovation presented in this work supported in vivo clinical indication-based assessment of biodegradable Mg-based metals that could be potential candidates for bone graft substitutes for future orthopaedic applications.

  19. Detection Tuna and Processed Products Based Protein and DNA Barcoding

    Directory of Open Access Journals (Sweden)

    Nuring Wulansari

    2015-11-01

    Full Text Available Tuna is the second largest fishery commodity in Indonesia after the shrimp. Since the high demand and the limited stock of tuna resulted in fraudulent chance. Authentication is required to meassure consumers regarding the accuracy of its labeling and food safety. In this study, the authentication was based on protein and DNA barcoding using cytochrome-b gene (cyt-b of the mitochondrial DNA as the target of gene. Primer of cyt b gene was designed based on the tuna species. This study aimed to identify the authenticity of tuna fresh and its processed products through protein using SDS-PAGE and DNA barcoding techniques. The phases of this research were protein electrophoresis by SDS-PAGE, DNA extraction, PCR amplification, electrophoresis and sequencing. Samples of fresh fish (Tu1, Tu2, Tu3, Tu4, and Tu5 and processed tuna (canned and steak were successfully extracted. Result showed that SDS-PAGE proved the damage of proteins in the processed tuna, so this method was not appropriate if it is used to identify the authenticity of tuna. PCR electrophoresis results showed that the samples of tuna, tuna steak, sushi, meat ball, abon, and caned tuna were successfully amplified in the range of 500-750 bp except Ka3, which was in line with the target of DNA (620 bp. Resulted sequences of Tu2, Tu3, Tu4 and Tu5 were identified according the results of morphometric namely T. albacares, while Tu1 was identified as T. obesus with homology level of 99%. Processed tunas (steak and canned tuna were identified as T. albacares, as stated on the labels.

  20. An environmentally benign one pot synthesis of substituted quinolines catalysed by fluoroboric acid based ionic liquid

    Indian Academy of Sciences (India)

    A Rajendran; C Karthikeyan; K Rajathi; D Ragupathy

    2012-07-01

    Organic synthesis generally required large amount of solvent, avoiding the use of organic solvents in synthesis is a paradigm shift directed at developing more benign chemistry, and with ionic liquids surprisingly can lead to access to new compounds. An elegant one-pot synthesis of quinoline derivatives has been achieved by reaction of substituted anilines with -ketoester at 60°C in ethanol using an ionic liquid [Et3NH]+[BF4]−as catalyst. All the reactions gave products with high degree of purity and excellent yield (78-93%) within the shorter span of time (20-65 min) than those reactions with conventional methods. The screening of solvents as well as the reuse of ionic liquid has been evaluated. The structure of the products has been elucidated by spectral and analytical data. The present scope and potential economic impact of the reaction are demonstrated by the synthesis of substituted quinolines. Remaining challenges and future perspectives of the new transformation are discussed.

  1. Synthesis and photophysical properties of metallophthalocyanines substituted with a benzofuran based fluoroprobe.

    Science.gov (United States)

    Yarasir, Meryem N; Kandaz, Mehmet; Güney, Orhan; Salih, Bekir

    2012-07-01

    The synthesis, characterization and photophysical properties of the tetra- {6-(-benzofuran-2-carboxylate)-hexylthio} substituted copper(II), cobalt(II), manganese(III) and zinc (II) phthalocyanines, {M[Pc(β-S(CH(2))(6)OCOBz-Furan)(4)], which were derived from 6-(3,4-dicyanophenylthio)-hexyl-2-benzofuranate (BzF) (1-4) are reported for the first time. The new compounds have been synthesized and fully characterized by elemental analysis, FTIR, UV-vis, (1)H- and (13)C NMR, MS (Maldi-TOF). In this work, we also report the effects of peripherally bound BzF substituent on the photophysical properties of metallo phthalocyanine derivatives. The effects of changing the central metal ions on quantum yield are discussed. It was found that the substitution of BzF groups on the framework of phthalocyanines diminished the fluorescence quantum yield of these complexes depending on paramagnetic behavior of central metal atoms. In addition, central metal atoms like Co and Cu also caused to decrease in quantum yield of phthalocyanine backbone.

  2. Manganese(I-Based CORMs with 5-Substituted 3-(2-PyridylPyrazole Ligands

    Directory of Open Access Journals (Sweden)

    Ralf Mede

    2017-01-01

    Full Text Available The reaction of [(OC5MnBr] with substituted 3-(2-pyridylpyrazoles 2-PyPzRH (1a-l in methanol or diethyl ether yields the yellow to orange manganese(I complexes [(OC3Mn(Br(2-PyPzRH] (2a-l, the substituents R being phenyl (a, 1-naphthyl (b, 2-anthracenyl (c, 1-pyrenyl (d, 4-bromophenyl (e, 3-bromophenyl (f, duryl (g, 2-pyridyl (h, 2-furanyl (i, 2-thienyl (j, ferrocenyl (k, and 1-adamantyl (l. The carbonyl ligands are arranged facially, leading to three chemically different CO ligands due to different trans-positioned Lewis donors. The diversity of the substituent R demonstrates that this photoCORM backbone can easily be varied with a negligible influence on the central (OC3MnBr fragment, because the structural parameters and the spectroscopic data of this unit are very similar for all these derivatives. Even the ferrocenyl complex 2k shows a redox potential for the ferrocenyl subunit which is identical to the value of the free 5-ferrocenyl-3-(2-pyridylpyrazole (1k. The ease of variation of the starting 5-substituted 3-(2-pyridylpyrazoles offers a modular system to attach diverse substituents at the periphery of the photoCORM complex.

  3. Novel organic dyes based on phenyl-substituted benzimidazole for dye sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Saltan, Gözde Murat [Department of Chemistry, Faculty of Arts and Science, Celal Bayar University, Yunus Emre, 45140 Manisa (Turkey); Dinçalp, Haluk, E-mail: haluk.dincalp@cbu.edu.tr [Department of Chemistry, Faculty of Arts and Science, Celal Bayar University, Yunus Emre, 45140 Manisa (Turkey); Kıran, Merve; Zafer, Ceylan [Solar Energy Institute, Ege University, Bornova, 35100 Izmir (Turkey); Erbaş, Seçil Çelik [Celal Bayar University, Materials Engineering Department, Faculty of Engineering, Yunus Emre, 45140 Manisa (Turkey)

    2015-08-01

    Two new sensitizers derived from benzimidazole core for dye-sensitized solar cell (DSSC) applications were designed and synthesized as D–π–A structures, in which two phenyl-substituted benzimidazole group, a phenyl ring and a cyanoacrylic acid were used as the electron donor, π-conjugated linkage and the electron acceptor, respectively. Effect of methoxy- and N,N-dimetylamino- moieties attached to the phenyl groups of benzimidazole were investigated by means of optical and photovoltaic measurements. The compounds exhibit broad absorption maximum at 387 nm with the tail extending up to 500 nm on TiO{sub 2}-coated thin film. The longer wavelength absorption band around 360 nm and the much longer decay components could be attributed to the existence of charge transfer state of the dyes in solutions. DSSC device fabricated by using methoxy substituted dye (BI5a) as a sensitizer shows much better incident photon-to-current conversion efficiency (IPCE) of 64% giving cell efficiency of 2.68%. - Graphical abstract: Display Omitted - Highlights: • Long decay times suggest the delayed fluorescence caused by the existence of ICT. • The best solar energy conversion efficiency was obtained for BI5a dye (2.68%). • More fluorescent BI5a dye gives higher photocurrent generation.

  4. Synthesis and photophysical properties of metallophthalocyanines substituted with a benzofuran based fluoroprobe

    Science.gov (United States)

    Yarasir, Meryem N.; Kandaz, Mehmet; Güney, Orhan; Salih, Bekir

    The synthesis, characterization and photophysical properties of the tetra- {6-(-benzofuran-2-carboxylate)-hexylthio} substituted copper(II), cobalt(II), manganese(III) and zinc (II) phthalocyanines, {M[Pc(β-S(CH2)6OCOBz-Furan)4], which were derived from 6-(3,4-dicyanophenylthio)-hexyl-2-benzofuranate (BzF) (1-4) are reported for the first time. The new compounds have been synthesized and fully characterized by elemental analysis, FTIR, UV-vis, 1H- and 13C NMR, MS (Maldi-TOF). In this work, we also report the effects of peripherally bound BzF substituent on the photophysical properties of metallo phthalocyanine derivatives. The effects of changing the central metal ions on quantum yield are discussed. It was found that the substitution of BzF groups on the framework of phthalocyanines diminished the fluorescence quantum yield of these complexes depending on paramagnetic behavior of central metal atoms. In addition, central metal atoms like Co and Cu also caused to decrease in quantum yield of phthalocyanine backbone.

  5. Cryptanalysis of an image encryption algorithm based on DNA encoding

    Science.gov (United States)

    Akhavan, A.; Samsudin, A.; Akhshani, A.

    2017-10-01

    Recently an image encryption algorithm based on DNA encoding and the Elliptic Curve Cryptography (ECC) is proposed. This paper aims to investigate the security the DNA-based image encryption algorithm and its resistance against chosen plaintext attack. The results of the analysis demonstrate that security of the algorithm mainly relies on one static shuffling step, with a simple confusion operation. In this study, a practical plain image recovery method is proposed, and it is shown that the images encrypted with the same key could easily be recovered using the suggested cryptanalysis method with as low as two chosen plain images. Also, a strategy to improve the security of the algorithm is presented in this paper.

  6. Hairpin DNA Switch for Ultrasensitive Spectrophotometric Detection of DNA Hybridization Based on Gold Nanoparticles and Enzyme Signal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Youyu; Tang, Zhiwen; Wang, Jun; Wu, Hong; Maham, Aihui; Lin, Yuehe

    2010-08-01

    A novel DNA detection platform based on a hairpin-DNA switch, nanoparticles, and enzyme signal amplification for ultrasensitive detection of DNA hybridization has been developed in this work. In this DNA assay, a “stem-loop” DNA probe dually labeled with a thiol at its 5’ end and a biotin at its 3’ end, respectively, was used. This probe was immobilized on the gold nanoparticles (AuNPs) anchored by a protein, globulin, on a 96-well microplate. In the absence of target DNA, the immobilized probe with the stem-loop structure shields the biotin from being approached by a bulky horseradish peroxidase linked-avidin (avidin-HRP) conjugate due to the steric hindrance. However, in the presence of target DNA, the hybridization between the hairpin DNA probe and the target DNA causes significant conformational change of the probe, which forces biotin away from the surface of AuNPs. As a result, the biotin becomes accessible by the avidin-HRP, and the target hybridization event can be sensitively detected via the HRP catalyzed substrate 3, 3', 5, 5'-tetramethylbenzidine using spectrophometric method. Some experimental parameters governing the performance of the assay have been optimized. At optimal conditions, this DNA assay can detect DNA at the concentration of femtomolar level by means of a signal amplification strategy based on the combination of enzymes and nanoparticles. This approach also has shown excellent specificity to distinguish single-base mismatches of DNA targets because of the intrinsic high selectivity of the hairpin DNA probe.

  7. Progress of DNA-based Methods for Species Identification

    Institute of Scientific and Technical Information of China (English)

    HU Zhen; ZHANG Su-hua; WANG Zheng; BIAN Ying-nan; LI Cheng-tao

    2015-01-01

    Species identification of biological samples is widely used in such fields as forensic science and food industry. A variety of accurate and reliable methods have been developed in recent years. The cur-rent reviewshows common target genes and screening criteria suitable for species identification, and de-scribed various DNA-based molecular biology methods about species identification. Additionally, it dis-cusses the future development of species identification combined with real-time PCR and sequencing technologies.

  8. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  9. Synthesis of substituted pyrazines

    Energy Technology Data Exchange (ETDEWEB)

    Pagoria, Philip F.; Zhang, Mao Xi

    2016-10-04

    A method for synthesizing a pyrazine-containing material according to one embodiment includes contacting an iminodiacetonitrile derivative with a base and a reagent selected from a group consisting of hydroxylamine, a hydroxylamine salt, an aliphatic primary amine, a secondary amine, an aryl-substituted alkylamine a heteroaryl-substituted alkyl amine, an alcohol, an alkanolamine and an aryl alcoholamine. Additional methods and several reaction products are presented. ##STR00001##

  10. Prediction of the enthalpies of vaporization for room-temperature ionic liquids: Correlations and a substitution-based additive scheme

    Energy Technology Data Exchange (ETDEWEB)

    Kabo, Gennady J. [Chemistry Faculty and Research Institute for Physical Chemical Problems, Belarusian State University, Leningradskaya 14, 220030 Minsk (Belarus); Paulechka, Yauheni U., E-mail: paulechka@gmail.com [Chemistry Faculty and Research Institute for Physical Chemical Problems, Belarusian State University, Leningradskaya 14, 220030 Minsk (Belarus); Zaitsau, Dzmitry H. [Department of Physical Chemistry, University of Rostock, Dr-Lorenz-Weg. 1, 18059 Rostock (Germany); Department of Physical Chemistry, Kazan Federal University, Kremlevskaya str. 18, 420008 Kazan (Russian Federation); Firaha, Alena S. [Chemistry Faculty and Research Institute for Physical Chemical Problems, Belarusian State University, Leningradskaya 14, 220030 Minsk (Belarus)

    2015-06-10

    Highlights: • The available literature data on Δ{sub l}{sup g}H for ionic liquids were analyzed. • Correlation equations for Δ{sub l}{sup g}H were derived using symbolic regression. • A substitution-based incremental scheme for Δ{sub l}{sup g}H was developed. • The proposed scheme has an advantage over the existing predictive procedures. - Abstract: The literature data on the enthalpies of vaporization for aprotic ionic liquids (ILs) published by the end of May 2014 were analyzed and the most reliable Δ{sub l}{sup g}H{sub m} values were derived for 68 ILs. The selected enthalpies of vaporization were correlated with density and surface tension using symbolic regression and a number of effective correlation equations were proposed. The substitution-based incremental scheme for prediction of the enthalpies of vaporization of imidazolium, pyridinium and pyrrolidinium ILs was developed. The standard error of the regression for the developed scheme is significantly lower than that for the atom-based group-contribution schemes proposed earlier.

  11. Direct Electrical Detection of DNA Hybridization Based on Electrolyte-Gated Graphene Field-Effect Transistor

    Science.gov (United States)

    Ohno, Yasuhide; Okamoto, Shogo; Maehashi, Kenzo; Matsumoto, Kazuhiko

    2013-11-01

    DNA hybridization was electrically detected by graphene field-effect transistors. Probe DNA was modified on the graphene channel by a pyrene-based linker material. The transfer characteristic was shifted by the negative charges on the probe DNA, and the drain current was changed by the full-complementary DNA while no current change was observed after adding noncomplementary DNA, indicating that the graphene field-effect transistor detected the DNA hybridization. In addition, the number of DNAs was estimated by the simple plate capacitor model. As a result, one probe DNA was attached on the graphene channel per 10×10 nm2, indicating their high density functionalization. We estimated that 30% of probe DNA on the graphene channel was hybridized with 200 nM full-complementary DNA while only 5% of probe DNA was bound to the noncomplementary DNA. These results will help to pave the way for future biosensing applications based on graphene FETs.

  12. Yttrium-substituted nanocrystalline TiO 2 photoanodes for perovskite based heterojunction solar cells

    KAUST Repository

    Qin, Peng

    2014-01-01

    We report the use of Y3+-substituted TiO2 (0.5%Y-TiO2) in solid-state mesoscopic solar cells, consisting of CH3NH3PbI3 as the light harvester and spiro-OMeTAD as the hole transport material. A power conversion efficiency of 11.2% under simulated AM 1.5 full sun illumination was measured. A 15% improvement in the short-circuit current density was obtained compared with pure TiO2, due to the effect of Y3+ on the dimensions of perovskite nanoparticles formed on the semiconductor surface, showing that the surface modification of the semiconductor is an effective way to improve the light harvesters\\' morphology and electron transfer properties in the solid-state mesoscopic solar cells. © 2013 The Royal Society of Chemistry.

  13. The Effects of NHC-Backbone Substitution on Efficiency in Ruthenium-based Olefin Metathesis

    Science.gov (United States)

    Kuhn, Kevin M.; Bourg, Jean-Baptiste; Chung, Cheol K.; Virgil, Scott C.; Grubbs, Robert H.

    2009-01-01

    A series of ruthenium olefin metathesis catalysts bearing N-heterocyclic carbene (NHC) ligands with varying degrees of backbone and N-aryl substitution have been prepared. These complexes show greater resistance to decomposition through C–H activation of the N-aryl group, resulting in increased catalyst lifetimes. This work has utilized robotic technology to examine the activity and stability of each catalyst in metathesis, providing insights into the relationship between ligand architecture and enhanced efficiency. The development of this robotic methodology has also shown that, under optimized conditions, catalyst loadings as low as 25 ppm can lead to 100% conversion in the ring-closing metathesis of diethyl diallylmalonate. PMID:19351207

  14. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    Science.gov (United States)

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  15. Synthesis; characterization and antimicrobial effects of composites based on multi-substituted hydroxyapatite and silver nanoparticles

    Science.gov (United States)

    Mocanu, Aurora; Furtos, Gabriel; Rapuntean, Sorin; Horovitz, Ossi; Flore, Chirila; Garbo, Corina; Danisteanu, Ancuta; Rapuntean, Gheorghe; Prejmerean, Cristina; Tomoaia-Cotisel, Maria

    2014-04-01

    Nano hydroxyapatite doped with zinc (0.2 wt%), silver (0.25 wt%) and gold (0.025 wt%), (HAP), has been obtained by an innovative wet chemical approach, coupled with a reduction process for silver and gold. The synthesized multi-substituted nano HAP was freeze-dried and calcined at 650 °C. Nano HAP has been characterized by XRD, FTIR spectroscopy and imaging techniques: TEM, SEM and AFM. Then, nano HAP was mixed with previously synthesized silver nanoparticles (AgNPs), in the amount of 9 wt%, to give a novel material (HAP-Ag). The AgNPs were prepared by the reduction of silver nitrate with glucose in alkaline medium. TEM and UV-Vis confirmed the formation of AgNPs with an average size of 12 nm. Further, organic matrix composites were obtained from a filler made of HAP and/or HAP-Ag and a mixture of monomers (such as bis-GMA and TEG-DMA), which were polymerized at various compositions in AgNPs content up to 5.4 wt%. Antibacterial activities of these composites were investigated against several different pathogenic species: Escherichia coli, Staphylococcus aureus, Staphylococcus spp., Bacillus cereus, and Candida albicans, using the Kirby-Bauer disk-diffusion method. Antibacterial activities are enhanced with increasing of silver content within composites. These effects clearly reveal that AgNPs can be effectively utilized in combination with multi-substituted HAP and polymeric matrix, both used as carriers, in order to improve their efficiency against various pathogenic species. These composites can be considered a promising antimicrobial material for coating of orthopedic and dental implants or used as bone cements in surgical applications.

  16. High magnetic exchange coupling constants: a density functional theory based study of substituted Schlenk diradicals.

    Science.gov (United States)

    Latif, Iqbal A; Hansda, Shekhar; Datta, Sambhu N

    2012-08-23

    The Schlenk diradical has been known since 1915. After a detailed experimental work by Rajca, its magnetic nature has remained more or less unexplored. We have investigated by quantum chemical calculations the nature of magnetic coupling in 11 substituted Schlenk diradicals. Substitution has been considered at the fifth carbon atom of the meta-phenylene moiety. The UB3LYP method has been used to study 12 diradicals including the original one. The 6-311G(d,p) basis set has been employed for optimization of molecular geometry in both singlet and triplet states for each species. The singlet optimization has led to the optimization of the broken-symmetry structure for 10 species including the unsubstituted one. This development makes it possible to carry out further broken symmetry calculations in two ways. The triplet calculation has been done using 6-311++G(d,p) basis set and the optimized triplet geometry in both procedures. The broken symmetry calculations have used the optimized geometries of either the triplet states or the broken symmetry solutions. The first method leads to the prediction of electron paramagnetic resonance (EPR) compatible magnetic exchange coupling constant (J) in the range 517-617 cm(-1). A direct optimization of the broken symmetry geometry gives rise to a lower estimate of J, in the range of 411-525 cm(-1) and compatible with macroscopic Curie studies. The calculated J for the unsubstituted Schlenk diradical is 512 cm(-1) that can be compared with 455 cm(-1) estimated by Rajca. In both cases, introduction of groups with +M and +I effects (Ingold's notation) decreases the J value from that for the unsubstituted Schlenk diradical while -I and -M groups at the same position increases J. These trends have been explained in terms of Hammett constants, atomic spin densities, and dihedral angles.

  17. Measurement of oxidative DNA damage by gas chromatography-mass spectrometry: ethanethiol prevents artifactual generation of oxidized DNA bases.

    Science.gov (United States)

    Jenner, A; England, T G; Aruoma, O I; Halliwell, B

    1998-04-15

    Analysis of oxidative damage to DNA bases by GC-MS enables identification of a range of base oxidation products, but requires a derivatization procedure. However, derivatization at high temperature in the presence of air can cause 'artifactual' oxidation of some undamaged bases, leading to an overestimation of their oxidation products, including 8-hydroxyguanine. Therefore derivatization conditions that could minimize this problem were investigated. Decreasing derivatization temperature to 23 degrees C lowered levels of 8-hydroxyguanine, 8-hydroxyadenine, 5-hydroxycytosine and 5-(hydroxymethyl)uracil measured by GC-MS in hydrolysed calf thymus DNA. Addition of the reducing agent ethanethiol (5%, v/v) to DNA samples during trimethylsilylation at 90 degrees C also decreased levels of these four oxidized DNA bases as well as 5-hydroxyuracil. Removal of guanine from hydrolysed DNA samples by treatment with guanase, prior to derivatization, resulted in 8-hydroxyguanine levels (54-59 pmol/mg of DNA) that were significantly lower than samples not pretreated with guanase, independent of the derivatization conditions used. Only hydrolysed DNA samples that were derivatized at 23 degrees C in the presence of ethanethiol produced 8-hydroxyguanine levels (56+/-8 pmol/mg of DNA) that were as low as those of guanase-pretreated samples. Levels of other oxidized bases were similar to samples derivatized at 23 degrees C without ethanethiol, except for 5-hydroxycytosine and 5-hydroxyuracil, which were further decreased by ethanethiol. Levels of 8-hydroxyguanine, 8-hydroxyadenine and 5-hydroxycytosine measured in hydrolysed calf thymus DNA by the improved procedures described here were comparable with those reported previously by HPLC with electrochemical detection and by GC-MS with prepurification to remove undamaged base. We conclude that artifactual oxidation of DNA bases during derivatization can be prevented by decreasing the temperature to 23 degrees C, removing air from the

  18. A Single Base Substitution Adjacent to the Stop Codon in the downstream of the SMP3 gene Affects its Post-trancriptional process in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Donny Widianto

    2015-11-01

    Full Text Available The smp3-1 mutant allele confers increased holding stability of heterologous plasmid, pSR1, and a temperature-sensitive growth defect which is remediable by the addition of 1 M sorbitol as the osmotic stabilizer. The smp3-1 allele contains two base substitutions; one is in the open reading frame and changed the 490th CAT (encoding Histidine to TAT (tyrosine, and the other one is an A for G substitution, at 2 bp downstream from termination codon. These base substitutions were separated each other by recombination at a BstNI site located between these two substitutions. The base substitution in the 3'' untranslated region was found to be lethal and the defect was unremediable by the osmotic stabilizer, while that in the open reading frame has no appreciable effect to the cell. Thus, both the base substitutions join together confer the smp3-1 mutant phenotype. The smp3-1 mutant cells cultivated at 37 OC in nutrient medium containing 1 M sorbitol showed similar smp3 transcription as in the wild type. These facts suggest that smp3-1 mutation has a defect in its post-transcriptional process.

  19. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  20. Main features of DNA-based immunization vectors

    Directory of Open Access Journals (Sweden)

    V. Azevedo

    1999-02-01

    Full Text Available DNA-based immunization has initiated a new era of vaccine research. One of the main goals of gene vaccine development is the control of the levels of expression in vivo for efficient immunization. Modifying the vector to modulate expression or immunogenicity is of critical importance for the improvement of DNA vaccines. The most frequently used vectors for genetic immunization are plasmids. In this article, we review some of the main elements relevant to their design such as strong promoter/enhancer region, introns, genes encoding antigens of interest from the pathogen (how to choose and modify them, polyadenylation termination sequence, origin of replication for plasmid production in Escherichia coli, antibiotic resistance gene as selectable marker, convenient cloning sites, and the presence of immunostimulatory sequences (ISS that can be added to the plasmid to enhance adjuvanticity and to activate the immune system. In this review, the specific modifications that can increase overall expression as well as the potential of DNA-based vaccination are also discussed.

  1. Ab initio study of effect of Co substitution on the magnetic properties of Ni and Pt-based Heusler alloys

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Tufan, E-mail: tufanroyburdwan@gmail.com [Theory and Simulations Lab, HRDS, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India); Homi Bhabha National Institute, Training School Complex, Anushaktinagar, Mumbai 400094 (India); Chakrabarti, Aparna [Theory and Simulations Lab, HRDS, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India); Homi Bhabha National Institute, Training School Complex, Anushaktinagar, Mumbai 400094 (India)

    2017-04-25

    Using density functional theory based calculations, we have carried out in-depth studies of effect of Co substitution on the magnetic properties of Ni and Pt-based shape memory alloys. We show the systematic variation of the total magnetic moment, as a function of Co doping. A detailed analysis of evolution of Heisenberg exchange coupling parameters as a function of Co doping has been presented here. The strength of RKKY type of exchange interaction is found to decay with the increase of Co doping. We calculate and show the trend, how the Curie temperature of the systems vary with the Co doping. - Highlights: • We discuss the effects of Co doping on magnetic properties of Ni/Pt based Heusler alloys. • Indirect RKKY interaction is maximum for shape memory alloy like systems. • We predict Pt{sub 2}MnSn as a probable ferromagnetic shape memory alloy.

  2. NMR-based conformation and dynamics of a tetrasaccharide-repeating sulfated fucan substituted by different counterions.

    Science.gov (United States)

    Soares, Paulo A G; Queiroz, Ismael N L; Santos, Gustavo R C; Mourão, Paulo A S; Pomin, Vitor H

    2016-11-01

    The sulfated fucan from the sea urchin Lytechinus variegatus is composed of the repetitive sequence [-3)-α-l-Fucp-4( OSO3-)-(1-3)-α-l-Fucp-2,4-di( OSO3-)-(1-3)-α-l-Fucp-2( OSO3-)-(1-3)-α-l-Fucp-2( OSO3-)-(1-]n . Conformation (of rings and chains) and dynamics of this tetrasaccharide-repeating sulfated fucan substituted by Na(+) , Ca(2+) , and Li(+) as counterions have been examined through experiments of liquid-state nuclear magnetic resonance spectroscopy. Scalar coupling and nuclear Overhauser effect (NOE)-based data have confirmed that all composing units occur as (1) C4 chair conformer regardless of the cation type, unit position within the repeating sequence, and sulfation type. Chain conformation determined by NOE signal pattern assisted by molecular modeling for a theoretical octasaccharide has shown a similar linear 3D structure for the three differently substituted forms. Data derived from spin-relaxation measurements have indicated a contribution of counterion type to dynamics. The calcium-based preparation has shown the highest mobility while the sodiated one showed the lowest mobility. The set of results from this work suggests that counterion type can affect the physicochemical properties of the structurally well-defined sulfated fucan. The counterion effect seems to impact more on the structural mobility than on average conformation of the studied sulfated glycan in solution.

  3. Physicochemical and acid gelation properties of commercial UHT-treated plant-based milk substitutes and lactose free bovine milk.

    Science.gov (United States)

    Mäkinen, Outi E; Uniacke-Lowe, Thérèse; O'Mahony, James A; Arendt, Elke K

    2015-02-01

    Physicochemical and acid gelation properties of UHT-treated commercial soy, oat, quinoa, rice and lactose-free bovine milks were studied. The separation profiles were determined using a LUMiSizer dispersion analyser. Soy, rice and quinoa milks formed both cream and sediment layers, while oat milk sedimented but did not cream. Bovine milk was very stable to separation while all plant milks separated at varying rates; rice and oat milks being the most unstable products. Particle sizes in plant-based milk substitutes, expressed as volume mean diameters (d4.3), ranged from 0.55μm (soy) to 2.08μm (quinoa) while the average size in bovine milk was 0.52μm. Particles of plant-based milk substitutes were significantly more polydisperse compared to those of bovine milk. Upon acidification with glucono-δ-lactone (GDL), bovine, soy and quinoa milks formed structured gels with maximum storage moduli of 262, 187 and 105Pa, respectively while oat and rice milks did not gel. In addition to soy products currently on the market, quinoa may have potential in dairy-type food applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. DNA-based influenza vaccines as immunoprophylactic agents toward universality.

    Science.gov (United States)

    Zhang, Han; El Zowalaty, Mohamed E

    2016-01-01

    Influenza is an illness of global public health concern. Influenza viruses have been responsible for several pandemics affecting humans. Current influenza vaccines have proved satisfactory safety; however, they have limitations and do not provide protection against unexpected emerging influenza virus strains. Therefore, there is an urgent need for alternative approaches to conventional influenza vaccines. The development of universal influenza vaccines will help alleviate the severity of influenza pandemics. Influenza DNA vaccines have been the subject of many studies over the past decades due to their ability to induce broad-based protective immune responses in various animal models. The present review highlights the recent advances in influenza DNA vaccine research and its potential as an affordable universal influenza vaccine.

  5. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William (Yale); (Alberta)

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  6. Pulse radiolysis studies of electron migration in DNA from DNA base-radical anions to nitroacridine intercalators in aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, R.F.; Patel, K.B. (Mount Vernon Hospital, Northwood (United Kingdom). Gray Lab.); Wilson, W.R. (Univ. of Auckland School of Medicine (New Zealand))

    1991-12-07

    The reactions of the aquated electron (e{sub aq}{sup -}) with intercalators of high reduction potential (nitracrine and related basic nitroacridines) has been investigated by pulse radiolysis in the presence of DNA in aqueous solution. Under conditions where the majority of the e{sub aq}{sup -} species react initially with DNA bases (high DNA:drug ratios) a slower subsequent electron transfer to the intercalator was observed. The rate of this intra-complex transfer, expressed as DNA base pairs traversed per second, was in the range (1.2-3.1) x 10{sup 5} base pairs s{sup -1} and increased in order of the one-electron reduction potentials of the DNA-bound intercalators. No transfer was seen to the much less electron affinic des-nitro analogue of the nitroacridines. Only a small proportion of the initial DNA base radicals ({<=}50%) underwent this intra-complex electron transfer. Even for the most efficient electron trap, nitracrine, the apparent mean electron migration distance was only three base pairs. A slow secondary reduction of nitroacridines ((0.08-5.0) x 10{sup 4} base pairs s{sup -1}) was also observed with a proportion of the essentially immobile {sup .}OH-induced DNA radicals. This secondary reaction may well serve as a measure of the mobility of the DNa-bound intercalators. This study therefore implies a lack of extensive migration of DNA-associated electrons in aqueous solution, although it does not exclude the possibility that more mobile electrons produced by direct ionization of DNA might migrate over large distances. (author).

  7. Direct visual detection of DNA based on the light scattering of silica nanoparticles on a human papillomavirus DNA chip.

    Science.gov (United States)

    Piao, Jing Yu; Park, Eun Hee; Choi, Kihwan; Quan, Bo; Kang, Dong Ho; Park, Pan Yun; Kim, Dai Sik; Chung, Doo Soo

    2009-12-15

    A detection system for a human papillomavirus (HPV) DNA chip based on the light scattering of aggregated silica nanoparticle probes is presented. In the assay, a target HPV DNA is sandwiched between the capture DNA immobilized on the chip and the probe DNA immobilized on the plain silica nanoparticle. The spot where the sandwich reaction occurs appears bright white and is readily distinguishable to the naked eye. Scanning electron microscopy images clearly show the aggregation of the silica nanoparticle probes. When three different sized (55 nm, 137 nm, 286 nm) plain silica nanoparticles were compared, probes of the larger silica nanoparticles showed a higher scattering intensity. Using 286-nm silica nanoparticles, the spots obtained with 200 pM of target DNA were visually detectable. The demonstrated capability to detect a disease related target DNA with direct visualization without using a complex detection instrument provides the prerequisite for the development of portable testing kits for genotyping.

  8. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs.

  9. Circulating tumor DNA as a non‐invasive substitute to metastasis biopsy for tumor genotyping and personalized medicine in a prospective trial across all tumor types

    National Research Council Canada - National Science Library

    Lebofsky, Ronald; Decraene, Charles; Bernard, Virginie; Kamal, Maud; Blin, Anthony; Leroy, Quentin; Rio Frio, Thomas; Pierron, Gaëlle; Callens, Céline; Bieche, Ivan; Saliou, Adrien; Madic, Jordan; Rouleau, Etienne; Bidard, François-Clément; Lantz, Olivier; Stern, Marc-Henri; Le Tourneau, Christophe; Pierga, Jean-Yves

    2015-01-01

    Cell‐free tumor DNA (ctDNA) has the potential to enable non‐invasive diagnostic tests for personalized medicine in providing similar molecular information as that derived from invasive tumor biopsies. The histology...

  10. Synthesis, characterization, fluorescence and biological studies of Mn(II, Fe(III and Zn(II complexes of Schiff bases derived from Isatin and 3-substituted-4-amino-5-mercapto-1,2,4-triazoles

    Directory of Open Access Journals (Sweden)

    Sangamesh A. Patil

    2014-12-01

    Full Text Available A series of Mn(II, Fe(III and Zn(II complexes have been synthesized with Schiff bases derived from isatin and 3-substituted-4-amino-5-mercapto-1,2,4-triazole. The elemental, spectroscopic (Infrared, nuclear magnetic resonance, ultraviolet-visible, fast atom bombardment-mass, fluorescence and electrochemistry and magnetic studies suggested that the metal complexes possess octahedral geometry. The Schiff bases and their metal complexes exhibit fluorescent properties. The antimicrobial studies of Schiff bases and their metal complexes against various bacterial (Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Bacillus subtilis and fungal (Aspergillus niger, and Penicillium chrysogenum species by the minimum inhibitory concentration method revealed that the metal complexes possess more healing antibacterial activities than the Schiff bases. DNA cleavage property of Mn(II, Fe(III and Zn(II complexes revealed the important role of metal ion in the biological system.

  11. Physics of base-pairing dynamics in DNA

    Science.gov (United States)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  12. Solvent substitution

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated.

  13. Applications of nanoparticles for DNA based rabies vaccine.

    Science.gov (United States)

    Shah, Muhammad Ali A; Khan, Sajid Umar; Ali, Zeeshan; Yang, Haowen; Liu, Keke; Mao, Lanlan

    2014-01-01

    Rabies is a fatal encephalomyelitis. Most cases occur in developing countries and are transmitted by dogs. The cell culture vaccines as associated with high cost; therefore, have not replaced the unsafe brain-derived vaccines. In the developing countries these brain-derived rabies vaccines still can be seen in action. Moreover, there will be a need for vaccines against rabies-related viruses against which classical vaccines are not always effective. The worldwide incidence of rabies and the inability of currently used vaccination strategies to provide highly potent and cost-effective therapy indicate the need for alternate control strategies. DNA vaccines have emerged as the safest vaccines and best remedy for complicated diseases like hepatitis, HIV, and rabies. A number of recombinant DNA vaccines are now being developed against several diseases such as AIDS and malaria. Therefore, it can be a valuable alternative for the production of cheaper rabies vaccines against its larger spectrum of viruses. In this review we report published data on DNA-based immunization with sequences encoding rabies with special reference to nanotechnology.

  14. Ultrathin oligonucleotide layers for fluorescence-based DNA sensors

    Science.gov (United States)

    Furch, M.; Ueberfeld, J.; Hartmann, Andreas; Bock, Daniel; Seeger, Stefan

    1996-11-01

    Preliminary investigations into the design of an affinity sensor using evanescent wave technology concentrate upon the means of immobilization of the receptor molecules. In this work DNA served as the selective recognition element. The molecular principle of a sequence-selective biosensor for DNA is based on a sandwich-hybridization assay wherein the analyte, a single-stranded (ss)DNA, bound specifically to both an immobilized capture probe and a dye-labeled oligonucleotide in free solution. The efficiency of the capture array depends on the density of highly organized oligonucleotides on the waveguide surface and correlates therefore directly with the specificity and the sensitivity of the sensor. In the present approach using the Langmuir- Blodgett technique cinnamoylbutylether-cellulose monolayers were transferred onto optical fibers or planar waveguides. These films served as matrices for the immobilization of biotinylated oligonucleotides via streptavidin. For the first time streptavidin was immobilized by that manner. The specificity of the streptavidin layer or the following bounded nucleic acid molecules were controlled by an enzyme- linked immunosorbent assay (ELISA). Finally, this application has also shown to be suitable for the detection of Salmonella, which is an important pathogen associated with acute gastroenteritidis and food borne diseases.

  15. Electrochemical DNA biosensor based on the BDD nanograss array electrode.

    Science.gov (United States)

    Jin, Huali; Wei, Min; Wang, Jinshui

    2013-04-10

    The development of DNA biosensor has attracted considerable attention due to their potential applications, including gene analysis, clinical diagnostics, forensic study and more medical applications. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry in this study. Electrochemical DNA biosensor was developed based on the BDD film electrode (fBDD) and BDD nanograss array electrode (nBDD). In comparison with fBDD and AuNPs/CA/fBDD electrode, the lower semicircle diameter of electrochemical impedance spectroscopy obtained on nBDD and AuNPs/CA/nBDD electrode indicated that the presence of nanograss array improved the reactive site, reduced the interfacial resistance, and made the electron transfer easier. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry. The experimental results demonstrated that the prepared AuNPs/CA/nBDD electrode was suitable for DNA hybridization with favorable performance of faster response, higher sensitivity, lower detection limit and satisfactory selectivity, reproducibility and stability.

  16. Potential bioactive Schiff base compounds: Synthesis, characterization, X-ray structures, biological screenings and interaction with Salmon sperm DNA

    Science.gov (United States)

    Sirajuddin, Muhammad; Uddin, Noor; Ali, Saqib; Tahir, Muhammad Nawaz

    2013-12-01

    Three Schiff base compounds ofN‧-substituted benzohydrazide and sulfonohydrazide derivatives: N‧-(2-hydroxy-3-methoxybenzylidene)-4-tert-butyl- benzohydrazide (1), N‧-(5-bromo-2-hydroxybenzylidene)-4-tert-butylbenzohydrazide (2) and N‧-(2-hydroxy-3-methoxybenzylidene)-4-methylbenzenesulfonohydrazide (3) were synthesized and characterized by elemental analysis, FT-IR, 1H, 13C NMR spectroscopy and single crystal analysis. The title compounds have been screened for their biological activities including, antibacterial, antifungal, antioxidant, cytotoxic, enzymatic activities as well as interaction with SS-DNA which showed remarkable activities in each area of research. The DNA binding of the compounds 1-3 with SS-DNA has been carried out with absorption spectroscopy, which reveals the binding propensity towards SS-DNA via intercalation mode of interaction. The intercalative mode of interaction is also supported by viscometric results. The synthesized compounds were also found to be effective against alkaline phosphatase enzyme. They also show significant to good antimicrobial activity against six bacterial and five fungal strains. The MIC (minimum inhibitory concentration) for antibacterial activity ranges from 1.95-500 μg/mL. Compounds 1-3 show cytotoxic activity comparable to the control. At higher conc. (100 μg/L) compound 3 shows 100% activity means that it has killed all brine shrimps. They were also found to be effective antioxidant of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) and show almost comparable antioxidant activity to that of the standard and known antioxidant, ascorbic acid.

  17. Synthesis, Structure and Solid State Properties of Cyclohexanemethylamine Substituted Phenalenyl Based Molecular Conductor

    Directory of Open Access Journals (Sweden)

    Robert C. Haddon

    2012-05-01

    Full Text Available We report the preparation, crystallization and solid state characterization of a cyclohexanemethylamine substituted spirobiphenalenyl radical; in the solid state the compound is iso-structural with its dehydro-analog (benzylamine-substitued compound, and the molecules packed in a one-dimensional fashion that we refer to as a π-step stack. Neighboring molecules in the stack interact via the overlap of one pair of active (spin bearing carbon atoms per phenalenyl unit. The magnetic susceptibility measurement indicates that in the solid state the radical remains paramagnetic and the fraction of Curie spins is 0.75 per molecule. We use the analytical form of the Bonner-Fisher model for the S = 1/2 antiferromagnetic Heisenberg chain of isotropically interacting spins with intrachain spin coupling constant J = 6.3 cm−1, to fit the experimentally observed paramagnetism [χp (T] in the temperature range 4–330 K. The measured room temperature conductivity (σRT = 2.4 × 10–3 S/cm is comparable with that of the iso-structural benzyl radical, even though the calculated band dispersions are smaller than that of the unsaturated analog.

  18. Synthesis and characterization of some heteroleptic copper(II) complexes based on meso-substituted dipyrrins

    Indian Academy of Sciences (India)

    Rakesh Kumar Gupta; Mahendra Yadav; Rampal Pandey; Daya Shankar Pandey

    2011-11-01

    The syntheses and characterizations of meso-substituted dipyrrins, 5-(4-imidazol-1-yl-phenyl)-dipyrromethene (4-impdpm), 5-(4-nitro-imidazol-1-yl-phenyl)-dipyrromethene, (4-nimpdpm), 5-(4-benzimidazol-1-yl-phenyl)-dipyrromethene (4-bimp-dpm) and heteroleptic complexes [Cu3(4-impdpm)2(hfacac)4] 1, [Cu(4-nimpdpm)(acac)] 2, [Cu(4-nimpdpm)(hfacac)] 3, [{Cu(4-bimpdpm)(acac)}] 4 and [{Cu(4-bimpdpm)-(hfacac)}] 5, imparting acetylacetonato (acac) and hexafluoroacetylacetonato (hfacac) groups as co-ligand have been described. The dipyrrins and complexes 1-5 have been characterized by elemental analyses and spectral (IR ESI-MS, NMR, electronic absorption and emission) studies. Crystal structures of 1, 3 and 4 have been authenticated by X-ray single crystal analyses. The reaction between 4-impdpm and Cu(hfacac)2 gave a trimetallic complex, under analogous conditions 4-nimpdpm and 4-bimpdpm reacted with Cu(acac)2 and Cu(hfacac)2·2H2O to afford mononuclear (2, 3) and 1D polymeric (4, 5) complexes.

  19. Analysis of Oseltamivir Resistance Substitutions in Influenza Virus Glycoprotein Neuraminidase using a Lentivirus-Based Surrogate Assay System

    Institute of Scientific and Technical Information of China (English)

    Jennifer Tisoncik-Go; Katie S Cordero; Lijun Rong

    2013-01-01

    Influenza A virus poses a great threat to global health,and oseltamivir (trade marked as Tamiflu),which targets influenza surface glycoprotein neuraminidase (NA),is used clinically as a major anti-influenza treatment.However,certain substitutions in NA can render an influenza virus resistant to this drug.In this study,using a lentiviral pseudotyping system,which alleviates the safety concerns of studying highly pathogenic influenza viruses such as avian influenza H5N 1,that utilizes influenza surface glycoproteins (hemagglutinin or HA,and NA) and an HIV-core combined with a luciferase reporter gene as a surrogate assay,we first assessed the functionality of NA by measuring pseudovirion release in the absence or presence of oseltamivir.We demonstrated that oseltamivir displays a dose-dependent inhibition on NA activity.In contrast,a mutant NA (H274Y) is more resistant to oseltamivir treatment.In addition,the effects of several previously reported substitution NA mutants were examined as well.Our results demonstrate that this lentivirus-based pseudotyping system provides a quick,safe,and effective way to assess resistance to neuraminidase inhibitors.And we believe that as new mutations appear in influenza isolates,their impact on the effectiveness of current and future anti-NA can be quickly and reliably evaluated by this assay.

  20. Effect of the Partial Substitution of V for Nb on the Magnetic Properties of Fe-based Nanocrystalline Alloy

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The variation of the magnetic properties of the nanocrystalline alloys for the partial substitution of V for Nb with crystallizing treatment temperature and time was investigated. The variation law of the magnetic properties with the annealing temperature and time is essentially the same. The magnetic properties of the Fe-based nanocrystalline alloys for the partial substitution of V for Nb reduce, and the crystallizing treatment temperature of the alloys increases. The optimum properties of Fe74Cu1Nb3Si13B9 nanocrystalline alloys crystallized at 550℃×60 min are μ0=9.2×104, μm=54.8×104, Hc=1.14 A/m and Bs=1.26 T. The best properties for Fe74Cu1Nb2.5V0.5Si13B9 alloys annealed at 560℃×60 min are μ0=8.79×104, μm=50.18×104, Hc=1.26 A/m and Bs=1.24 T.

  1. A High Excision Potential of TALENs for Integrated DNA of HIV-Based Lentiviral Vector

    OpenAIRE

    Hirotaka Ebina; Yuka Kanemura; Naoko Misawa; Tetsushi Sakuma; Tomoko Kobayashi; Takashi Yamamoto; Yoshio Koyanagi

    2015-01-01

    DNA-editing technology has made it possible to rewrite genetic information in living cells. Human immunodeficiency virus (HIV) provirus, an integrated form of viral complementary DNA in host chromosomes, could be a potential target for this technology. We recently reported that HIV proviral DNA could be excised from the chromosomal DNA of HIV-based lentiviral DNA-transduced T cells after multiple introductions of a clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 endonuc...

  2. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  3. Simple scalable nucleotic FPGA based short read aligner for exhaustive search of substitution errors

    Directory of Open Access Journals (Sweden)

    Fehér Péter

    2015-12-01

    Full Text Available With the advent of the new and continuously improving technologies, in a couple of years DNA sequencing can be as commonplace as a simple blood test. The growth of sequencing efficiency has a larger exponent than the Moore’s law of standard processors, hence alignment and further processing of sequenced data is the bottleneck. The usage of FPGA (Field Programmable Gate Arrays technology may provide an efficient alternative. We propose a simple algorithm for DNA sequence alignment, which can be realized efficiently by nucleotic principal agents of Non.Neumann nature. The prototype FPGA implementation runs on a small Terasic DE1-SoC demo board with a Cyclone V chip. We present test results and furthermore analyse the theoretical scalability of this system, showing that the execution time is independent of the length of reference genome sequences. A special advantage of this parallel algorithm is that it performs exhaustive search producing all match variants up to a predetermined number of point (mutation errors.

  4. Recognizing a Single Base in an Individual DNA Strand: A Step Toward Nanopore DNA Sequencing**

    Science.gov (United States)

    Ashkenasy, N.; Sánchez-Quesada, J.; Ghadiri, M. R.; Bayley, H.

    2007-01-01

    Functional supramolecular chemistry at the single-molecule level. Single strands of DNA can be captured inside α-hemolysin transmembrane pore protein to form single-species α-HL·DNA pseudorotaxanes. This process can be used to identify a single adenine nucleotide at a specific location on a strand of DNA by the characteristic reductions in the α-HL ion conductance. This study suggests that α-HL-mediated single-molecule DNA sequencing might be fundamentally feasible. PMID:15666419

  5. A New DNA-based Logical Gate Comes into Being

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ Across-disciplinary research team, headed by Prof. FAN Chunhai from the CAS Shanghai Institute of Applied Physics, Prof. HE Lin, a CAS Member, and Prof. ZHANG Zhizhou at the Bio-X Research Center under Shanghai Jiao Tong University (SJTU), succeeded in developing a new type of logical gates by applying the deoxyribozyme (DNAzyme), adding a new brick to the groundwork of a DNA-based computation. The related research results have been reported on the German journal Angew. Chem. Int.Ed., 2006, 45, 1759.

  6. Biomaterial-based Memory Device Development by Conducting Metallic DNA

    Science.gov (United States)

    2013-05-28

    basis of the redshift of UV absorption spectra, we think that the incorporation of metal ions may result in a reduction of the original DNA band gap ...memristor based on the changing of the boundary between the high-resistance and low-resistance layers of titanium dioxide TiO2 and TiO2 -x13. Their...microscope (FESEM, JEOL JSM-6500F ) was used to measure the morphology of patterned substrate. The gap width and length between electrodes are both

  7. DNA-energetics-based analyses suggest additional genes in prokaryotes

    Indian Academy of Sciences (India)

    Garima Khandelwal; Jalaj Gupta; B Jayaram

    2012-07-01

    We present here a novel methodology for predicting new genes in prokaryotic genomes on the basis of inherent energetics of DNA. Regions of higher thermodynamic stability were identified, which were filtered based on already known annotations to yield a set of potentially new genes. These were then processed for their compatibility with the stereo-chemical properties of proteins and tripeptide frequencies of proteins in Swissprot data, which results in a reliable set of new genes in a genome. Quite surprisingly, the methodology identifies new genes even in well-annotated genomes. Also, the methodology can handle genomes of any GC-content, size and number of annotated genes.

  8. Phylogeny of Korean Opuntia spp. based on multiple DNA regions

    OpenAIRE

    SRIKANTH, KRISHNAMOORTHY; WHANG, SUNG SOO

    2015-01-01

    Although Opuntia species are of high agronomic value in Korea, the taxonomic position of Korean Opuntia species has never been investigated. The taxonomic position of Korean Opuntia spp. Within the tribe Opuntieae was examined based on DNA sequence analysis of matK, trnL-F, atpB-rbcl, and ITS regions. The total amplified sequence length was 2977 bp; only 18 parsimonious informative sites were present, even though they belonged to different species. A phylogenetic tree using both the maximum l...

  9. Tetrahedron-structured DNA and functional oligonucleotide for construction of an electrochemical DNA-based biosensor.

    Science.gov (United States)

    Bu, Nan-Nan; Tang, Chun-Xia; He, Xi-Wen; Yin, Xue-Bo

    2011-07-21

    Tetrahedron-structured DNA (ts-DNA) in combination with a functionalized oligonucleotide was used to develop a "turn-on" biosensor for Hg(2+) ions. The ts-DNA provided an improved sensitivity and was used to block the active sites.

  10. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva

    2016-06-10

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  11. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  12. ProteDNA: a sequence-based predictor of sequence-specific DNA-binding residues in transcription factors.

    Science.gov (United States)

    Chu, Wen-Yi; Huang, Yu-Feng; Huang, Chun-Chin; Cheng, Yi-Sheng; Huang, Chien-Kang; Oyang, Yen-Jen

    2009-07-01

    This article presents the design of a sequence-based predictor named ProteDNA for identifying the sequence-specific binding residues in a transcription factor (TF). Concerning protein-DNA interactions, there are two types of binding mechanisms involved, namely sequence-specific binding and nonspecific binding. Sequence-specific bindings occur between protein sidechains and nucleotide bases and correspond to sequence-specific recognition of genes. Therefore, sequence-specific bindings are essential for correct gene regulation. In this respect, ProteDNA is distinctive since it has been designed to identify sequence-specific binding residues. In order to accommodate users with different application needs, ProteDNA has been designed to operate under two modes, namely, the high-precision mode and the balanced mode. According to the experiments reported in this article, under the high-precision mode, ProteDNA has been able to deliver precision of 82.3%, specificity of 99.3%, sensitivity of 49.8% and accuracy of 96.5%. Meanwhile, under the balanced mode, ProteDNA has been able to deliver precision of 60.8%, specificity of 97.6%, sensitivity of 60.7% and accuracy of 95.4%. ProteDNA is available at the following websites: http://protedna.csbb.ntu.edu.tw/, http://protedna.csie.ntu.edu.tw/, http://bio222.esoe.ntu.edu.tw/ProteDNA/.

  13. ProteDNA: a sequence-based predictor of sequence-specific DNA-binding residues in transcription factors

    OpenAIRE

    2009-01-01

    This article presents the design of a sequence-based predictor named ProteDNA for identifying the sequence-specific binding residues in a transcription factor (TF). Concerning protein–DNA interactions, there are two types of binding mechanisms involved, namely sequence-specific binding and nonspecific binding. Sequence-specific bindings occur between protein sidechains and nucleotide bases and correspond to sequence-specific recognition of genes. Therefore, sequence-specific bindings are esse...

  14. Syntool: A Novel Region-Based Intolerance Score to Single Nucleotide Substitution for Synonymous Mutations Predictions Based on 123,136 Individuals

    Directory of Open Access Journals (Sweden)

    Tongda Zhang

    2017-01-01

    Full Text Available Background. Synonymous mutation is the single nucleotide change that does not cause an amino acid change but can affect the rate and efficiency of translation. So recent increase in our knowledge has revealed a substantial contribution of synonymous mutations to human disease risk and other complex traits. Nevertheless, there are still rarely synonymous mutation prediction methods. Methods. Nonsynonymous and synonymous coding SNPs show similar likelihood and effect size of human disease association. Here we defined synonymous and missense variation as single nucleotide substitution variation. And then we evaluated the intolerance of genic transcripts to single nucleotide substitution variation based on gnomAD 123136 individuals. After regressing all variations on common variations, we defined residuals of regression model as every genomics region intolerance scores. Results. We constructed a total of 24799 nonoverlapped region-based intolerance score by their intolerance to single nucleotide substitution variation (Syntool. The results show that Syntool score can discriminate synonymous disease causing mutations in Human Gene Mutation Database (HGMD Professional and ClinVar database much better than others. Taken together, this study provides a novel prediction system for synonymous mutations, called Syntool, which could be helpful in identifying candidate synonymous disease causing mutations.

  15. Thermosetting composite matrix materials based on allyl and/or propargyl substituted cyclopentadiene, indene and fluorene

    Science.gov (United States)

    Tregre, Gregory Jude

    A series of all-hydrocarbon thermoset composite matrix resins was synthesized via electrophilic substitution of cyclopentadiene, indene, and fluorene ring systems with allyl and/or propargyl halides under phase transfer conditions. Reaction of cyclopentadiene with allyl chloride (ACP resin), propargyl bromide (PCP resin) or various feed ratios of allyl chloride and propargyl bromide (APCP resins) yielded mixtures of products with 2-6 substituents per cyclopentadiene ring. Reaction of indene with allyl chloride (Al resins) or propargyl bromide (PI resins) yielded mixtures of products with 2-4 substituents per indene. In both sets of resins the allyl functionality obtained a greater average degree of substitution than the analogous propargyl species. Differential scanning calorimetric (DSC) analysis of the multifunctional resins showed broad, high-energy thermal cures in all cases. The enthalpies of cure for ACP and PCP were 750 J/g and 805 J/g, respectively, with peak cure energies occurring at 310 and 248sp°C. The enthalpy of cure for APCP resins ranged from 750 J/g to 800 J/g with higher propargyl-functional resins yielding higher enthalpies of cure. Physically mixed ACP/PCP resin systems gave peak cure temperatures and energy values comparable to APCP resins. The enthalpies of cure for Al and PI-resins were 480 J/g and 630 J/g, respectively. Peak cure temperature for Al resin was 320sp°C, while the peak cure for PI resin occurred at 282sp°C. Infrared spectroscopy (IR) and nuclear magnetic resonance spectroscopy (NMR) were used to evaluate mechanisms of cure in the experimental resins. The allyl functional resins cured through a combination of ene reactions and polyaddition reactions. The propargyl functional resins cured through ene reactions and polyadditions but also underwent some cyclotrimerization of the propargyl functionalities. A small amount of autoxidation was seen in all of the resins. Thermal stability and carbon yields of the cured resins were

  16. A kinetic and structural investigation of DNA-Based asymmetric catalysis using first-generation ligands

    NARCIS (Netherlands)

    Rosati, Fiora; Boersma, Arnold J.; Klijn, Jaap E.; Meetsma, Auke; Feringa, Ben L.; Roelfes, Gerard

    2009-01-01

    The recently developed concept of DNA-based asymmetric catalysis involves the transfer of chirality from the DNA double helix in reactions using a noncovalently bound catalyst. To date, two generations of DNA-based catalysts have been reported that differ in the design of the ligand for the metal. H

  17. Sensory Substitution

    Science.gov (United States)

    Verrillo, Ronald T.

    The idea that the cutaneous surface may be employed as a substitute for the eyes and ears is by no means a modern notion. Although the sense of touch has long been considered as a surrogate for both the visual and auditory modalities, the focus of this chapter will be on the efforts to develop a tactile substitute for hearing, especially that of human speech. The visual system is our primary means of processing information about environmental space such as orientation, distance, direction and size. It is much less effective in making temporal discriminations. The auditory system is unparalleled in processing information that involves rapid sequences of temporal events, such as speech and music. The tactile sense is capable of processing both spatial and temporal information although not as effective in either domain as the eye or the ear.

  18. Substituting complements

    OpenAIRE

    Dari-Mattiacci, G.; Parisi, F.; Heller, M.

    2009-01-01

    The presence of multiple sellers in the provision of (nonsubstitutable) complementary goods leads to outcomes that are worse than those generated by a monopoly (with a vertically integrated production of complements), a problem known in the economic literature as complementary oligopoly and recently popularized in the legal literature as the tragedy of the anticommons. We ask the following question: how many substitutes for each complement are necessary to render the presence of multiple sell...

  19. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    DEFF Research Database (Denmark)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott

    2014-01-01

    slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I...... by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional......Base excision repair (BER) is the most prominent DNA repair pathway in human mitochondria. BER also results in a temporary generation of AP-sites, single-strand breaks and nucleotide gaps. Thus, incomplete BER can result in the generation of DNA repair intermediates that can disrupt mitochondrial...

  20. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  1. DNA microarray-based mutation discovery and genotyping.

    Science.gov (United States)

    Gresham, David

    2011-01-01

    DNA microarrays provide an efficient means of identifying single-nucleotide polymorphisms (SNPs) in DNA samples and characterizing their frequencies in individual and mixed samples. We have studied the parameters that determine the sensitivity of DNA probes to SNPs and found that the melting temperature (T (m)) of the probe is the primary determinant of probe sensitivity. An isothermal-melting temperature DNA microarray design, in which the T (m) of all probes is tightly distributed, can be implemented by varying the length of DNA probes within a single DNA microarray. I describe guidelines for designing isothermal-melting temperature DNA microarrays and protocols for labeling and hybridizing DNA samples to DNA microarrays for SNP discovery, genotyping, and quantitative determination of allele frequencies in mixed samples.

  2. Palm Based Mono-Diacylglyceride as an Emulsifier in Producing Chocolate with Cocoa Butter Substitute

    Directory of Open Access Journals (Sweden)

    Hasrul Abdi Hasibuan

    2015-08-01

    Full Text Available Emulsifier used in the preparation of chocolate has the function to stabilize fat and water that can prevent the occurrence of blooming. Emulsifier generallyused in the preparation of chocolate is lecithin. However as an alternative monodiacylglycerol (MDAG can be used. MDAG can be synthesized from vegetableoil such as palm oil and its fraction. This research was conducted to study the effect of palm MDAG and variation of its concentration on quality of chocolate. The palm MDAG used was palm kernel oil MDAG (MDAG PKO, palm oleinMDAG (MDAG POL, palm stearin MDAG (MDAG PS at the concentration between 0.3 to 0.9%. Results of the study showed that chocolate which usedpalm MDAG did not cause blooming. Increase of MDAG concentration tended to increase fat content but the reverse result was observed in the case of lecithin.The melting point of chocolate tended to increase with increasing concentration of MDAG POL and MDAG PS but the reverse result was observed in lecithin,meanwhile for MDAG PKO similar result was observed. The protein content of chocolate tended to decrease with increasing MDAG concentration but thereverseresult was observed in lecithin. Viscosity of chocolate with lecithin, MDAG PKO and MDAG POL decreased in accordance with increasing concentration,meanwhile in MDAG PS at the concentration of 0.3% in the beginning viscosity decreasedbut later on increased with increasing concentration. The use of emulsifierat the concentration of 0.3–0.9% did not have significant effect on fat content, melting point of fat and protein content, but it had significant effect on viscosity.Results of organoleptic testing showed that the use of palm MDAG have not significant effect on texture, taste, and appearance of chocolate. Types and concentrations of palm MDAG which were highly accepted by the panelist there wereMDAG PS and MDAG PKO with concentration 0.3% and 0.5%, respectively. Keywords: chocolate, cocoa butter substitute, lecithin, palm oil

  3. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair.

    Science.gov (United States)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott; Scheibye-Knudsen, Morten; Desler, Claus; Hickson, Ian D; Bohr, Vilhelm A

    2014-04-01

    Base excision repair (BER) is the most prominent DNA repair pathway in human mitochondria. BER also results in a temporary generation of AP-sites, single-strand breaks and nucleotide gaps. Thus, incomplete BER can result in the generation of DNA repair intermediates that can disrupt mitochondrial DNA replication and transcription and generate mutations. We carried out BER analysis in highly purified mitochondrial extracts from human cell lines U2OS and HeLa, and mouse brain using a circular DNA substrate containing a lesion at a specific position. We found that DNA ligation is significantly slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional mitochondria by autophagy.

  4. Magnetic particle-based sandwich sensor with DNA-modified carbon nanotubes as recognition elements for detection of DNA hybridization.

    Science.gov (United States)

    Hu, Po; Huang, Cheng Zhi; Li, Yuan Fang; Ling, Jian; Liu, Yu Ling; Fei, Liang Run; Xie, Jian Ping

    2008-03-01

    In this contribution, we design a visual sensor for DNA hybridization with DNA probe-modified magnetic particles (MPs) and multiwalled carbon nanotubes (MWNTs) without involving a visual recognition element such as fluorescent/chemiluminescent reagents. It was found that DNA probe-modified MWNTs, which could be dispersed in aqueous medium and have strong light scattering signals under the excitation of a light beam in the UV-vis region, could connect with DNA probe-modified MPs together in the presence of perfectly complementary target DNA and form a sandwich structure. In a magnetic field, the formed MP-MWNT species can easily be removed from the solution, resulting in a decrease of light scattering signals. Thus, a magnetic particle-based sandwich sensor could be developed to detect DNA hybridization by measuring the light scattering signals with DNA-modified MWNTs as recognition elements. Experiments showed that the DNA-modified MPs sensor could be reused at least 17 times and was stable for more than 6 months.

  5. Ultrafast dynamics in DNA base pairs following ultraviolet excitation.

    Science.gov (United States)

    Orr-Ewing, Andrew

    2015-03-01

    Photo-protective mechanisms in DNA are essential to maintain the integrity of the genetic code by preventing damage from absorption of solar ultraviolet (UV) radiation. We have used time-resolved infra-red (TRIR) spectroscopy to observe the dynamics of Watson-Crick nucleobase pairs following absorption of femtosecond UV laser pulses. The base pairs are prepared as nucleosides in solution, and photo-induced dynamics are probed in the carbonyl and N-H bond stretching regions using broadband IR pulses with picosecond time resolution. Results will be presented for the guanine-cytosine (G-C) base pair, contrasting the rapid recovery of ground-state products (the photo-protection pathway) with formation of other photoproducts which might represent photo-damage mechanisms. This work is a collaboration with the group of Prof F. Temps (Christian-Albrechts-Universitat zu Kiel). This research is supported by ERC Advanced Grant 290966 CAPRI.

  6. DNA-based programing of quantum dot properties.

    Science.gov (United States)

    Ma, Nan; Kelley, Shana O

    2013-01-01

    Nucleic acid molecules can serve as robust ligands for aqueous synthesis of semiconductor nanocrystals or quantum dots (QDs). QD properties including size, morphology, dispersity, emission maximum, and quantum yield are highly dependent on the sequences and structures of nucleic acids used for the synthesis. This synthetic strategy provides a novel facile means of constructing compact, stable, and biofunctionalized QDs in one step, which is of particular interest for a variety of applications such as biosensing, bioimaging, and self-assembly. This article summarizes recent advances in nucleic acid-templated QD synthesis with an emphasis on the nucleic acids-based programing of quantum dots properties. A variety of applications based on DNA-passivated QDs are also discussed. Copyright © 2012 Wiley Periodicals, Inc.

  7. The Study of Substitution and Elimination Reactions Using Gas Chromatography: An Examination of the Effects of Alkane and Base Structure on Product Distributions

    Science.gov (United States)

    Wharry, Donald L.

    2011-01-01

    An experiment that compares product distribution obtained by either substitution or elimination utilizing alkyl bromides and methoxide, ethoxide, or t-butoxide as the base (or nucleophile) is described. The change in product distribution caused by steric effects of the base and substrate are readily apparent. Prior work on this experiment focused…

  8. Quantum mechanical design of efficient second-order nonlinear optical materials based on heteroaromatic imido-substituted hexamolybdates: first theoretical framework of POM-based heterocyclic aromatic rings.

    Science.gov (United States)

    Janjua, Muhammad Ramzan Saeed Ashraf

    2012-11-05

    This work was inspired by a previous report (Janjua et al. J. Phys. Chem. A 2009, 113, 3576-3587) in which the nonlinear-optical (NLO) response strikingly improved with an increase in the conjugation path of the ligand and the nature of hexamolybdates (polyoxometalates, POMs) was changed into a donor by altering the direction of charge transfer with a second aromatic ring. Herein, the first theoretical framework of POM-based heteroaromatic rings is found to be another class of excellent NLO materials having double heteroaromatic rings. First hyperpolarizabilities of a large number of push-pull-substituted conjugated systems with heteroaromatic rings have been calculated. The β components were computed at the density functional theory (DFT) level (BP86 geometry optimizations and LB94 time-dependent DFT). The largest β values are obtained with a donor (hexamolybdates) on the benzene ring and an acceptor (-NO(2)) on pyrrole, thiophene, and furan rings. The pyrrole imido-substituted hexamolybdate (system 1c) has a considerably large first hyperpolarizability, 339.00 × 10(-30) esu, and it is larger than that of (arylimido)hexamolybdate, calculated as 0.302 × 10(-30) esu (reference system 1), because of the double aromatic rings in the heteroaromatic imido-substituted hexamolybdates. The heteroaromatic rings act as a conjugation bridge between the electron acceptor (-NO(2)) and donor (polyanion). The introduction of an electron donor into heteroaromatic rings significantly enhances the first hyperpolarizabilities because the electron-donating ability is substantially enhanced when the electron donor is attached to the heterocyclic aromatic rings. Interposing five-membered auxiliary fragments between strong donor (polyanion) or acceptor (-NO(2)) groups results in a large computed second-order NLO response. The present investigation provides important insight into the NLO properties of (heteroaromatic) imido-substituted hexamolybdate derivatives because these compounds

  9. DNA

    Science.gov (United States)

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  10. Trends in Substitution Models of Molecular Evolution

    Directory of Open Access Journals (Sweden)

    Miguel eArenas

    2015-10-01

    Full Text Available Substitution models of evolution describe the process of genetic variation through fixed mutations and constitute the basis of the evolutionary analysis at the molecular level. Almost forty years after the development of first substitution models, highly sophisticated and data-specific substitution models continue emerging with the aim of better mimicking real evolutionary processes. Here I describe current trends in substitution models of DNA, codon and amino acid sequence evolution, including advantages and pitfalls of the most popular models. The perspective concludes that despite the large number of currently available substitution models, further research is required for more realistic modeling, especially for DNA coding and amino acid data. Additionally, the development of more accurate complex models should be coupled with new implementations and improvements of methods and frameworks for substitution model selection and downstream evolutionary analysis.

  11. Recognizing a Single Base in an Individual DNA Strand: A Step Toward Nanopore DNA Sequencing**

    OpenAIRE

    Ashkenasy, N.; Sánchez-Quesada, J.; Ghadiri, M. R.; Bayley, H

    2005-01-01

    Functional supramolecular chemistry at the single-molecule level. Single strands of DNA can be captured inside α-hemolysin transmembrane pore protein to form single-species α-HL·DNA pseudorotaxanes. This process can be used to identify a single adenine nucleotide at a specific location on a strand of DNA by the characteristic reductions in the α-HL ion conductance. This study sug...

  12. DNA barcoding: error rates based on comprehensive sampling.

    Directory of Open Access Journals (Sweden)

    Christopher P Meyer

    2005-12-01

    Full Text Available DNA barcoding has attracted attention with promises to aid in species identification and discovery; however, few well-sampled datasets are available to test its performance. We provide the first examination of barcoding performance in a comprehensively sampled, diverse group (cypraeid marine gastropods, or cowries. We utilize previous methods for testing performance and employ a novel phylogenetic approach to calculate intraspecific variation and interspecific divergence. Error rates are estimated for (1 identifying samples against a well-characterized phylogeny, and (2 assisting in species discovery for partially known groups. We find that the lowest overall error for species identification is 4%. In contrast, barcoding performs poorly in incompletely sampled groups. Here, species delineation relies on the use of thresholds, set to differentiate between intraspecific variation and interspecific divergence. Whereas proponents envision a "barcoding gap" between the two, we find substantial overlap, leading to minimal error rates of approximately 17% in cowries. Moreover, error rates double if only traditionally recognized species are analyzed. Thus, DNA barcoding holds promise for identification in taxonomically well-understood and thoroughly sampled clades. However, the use of thresholds does not bode well for delineating closely related species in taxonomically understudied groups. The promise of barcoding will be realized only if based on solid taxonomic foundations.

  13. DNA surveillance: web-based molecular identification of whales, dolphins, and porpoises.

    Science.gov (United States)

    Ross, H A; Lento, G M; Dalebout, M L; Goode, M; Ewing, G; McLaren, P; Rodrigo, A G; Lavery, S; Baker, C S

    2003-01-01

    DNA Surveillance is a Web-based application that assists in the identification of the species and population of unknown specimens by aligning user-submitted DNA sequences with a validated and curated data set of reference sequences. Phylogenetic analyses are performed and results are returned in tree and table format summarizing the evolutionary distances between the query and reference sequences. DNA Surveillance is implemented with mitochondrial DNA (mtDNA) control region sequences representing the majority of recognized cetacean species. Extensions of the system to include other gene loci and taxa are planned. The service, including instructions and sample data, is available at http://www.dna-surveillance.auckland.ac.nz.

  14. Quality Control of Isothermal Amplified DNA Based on Short Tandem Repeat Analysis.

    Science.gov (United States)

    Kroneis, Thomas; El-Heliebi, Amin

    2015-01-01

    This protocol describes the use of a 16plex PCR for the purpose assessing DNA quality after isothermal whole genome amplification (WGA). In short, DNA products, generated by amplification multiple displacement amplification, are forwarded to PCR targeting 15 short tandem repeats (STR) as well as amelogenin generating up to 32 different PCR products. After amplification, the PCR products are separated via capillary electrophoresis and analyzed based on the obtained DNA profiles. Isothermal WGA products of good DNA quality will result in DNA profiles with efficiencies of >90 % of the full DNA profile.

  15. A Method of LSB substitution based on image blocks and maximum entropy

    Directory of Open Access Journals (Sweden)

    Mohamed Radouane

    2013-01-01

    Full Text Available In this paper we introduce an algorithm of digital watermarking based on embedding watermark into sub images with LSB technique. The watermark is embedded into specifics blocks of the host image, the selection of blocks are based on entropy value. The simulation results show that the visual quality of the watermarked image and the extracted watermark is good, this result is presented and proved by a high PSNR value.

  16. Substitutional group dependent colori/fluorimetric sensing of Mn2+, Fe3+ and Zn2+ ions by simple Schiff base chemosensor

    Science.gov (United States)

    Hariharan, P. S.; Anthony, Savarimuthu Philip

    2015-02-01

    Schiff base is one of the easiest synthesizable chemosensor and exhibit strong coordination with metal ions; the property that has been vastly exploited for metal ions sensing. Simple Schiff base chemosensors (1a-d and 2a-d) were synthesized and demonstrated substitutional group dependent colorimetric sensing of metal ions. Chemosensor without (1a, 2a) and OCH3 substitution (1b, 2b) did not show any significant colour change for metal ions. However, a highly selective colorimetric change (colourless to pink) for Mn2+ ions (10-6 M) was observed with diethylamine substituted 1c, 2c. Hydroxyl substitution (1d, 2d) leads to selective colorimetric sensing (colourless to orange) of Fe3+ ions (10-6 M). PVA thin films of 2c/2d were fabricated and demonstrated selective colorimetric sensing of Mn2+ and Fe3+ ions. The practical applicability of the synthesized chemosensors were also demonstrated by performing selective colorimetric sensing of Mn2+ and Fe3+ ions in real samples such as tap, ground, pond and river water. Effect of substitution on the fluorescence selectivity of Zn2+ has also been investigated.

  17. Microplate assay for screening the antibacterial activity of Schiff bases derived from substituted benzopyran-4-one.

    Science.gov (United States)

    Amin, Rehab M; Abdel-Kader, Nora S; El-Ansary, Aida L

    2012-09-01

    Schiff bases (SB(1)-SB(3)) were synthesized from the condensation of 6-formyl-7-hydroxy-5-methoxy-2-methylbenzopyran-4-one with 2-aminopyridine (SB(1)), p-phenylenediamine (SB(2)) and o-phenylenediamine (SB(3)), while Schiff bases (SB(4)-SB(6)) were synthesized by condensation of 5,7-dihydroxy-6-formyl-2-methylbenzopyran-4-one with 2-aminopyridine (SB(4)), p-phenylenediamine (SB(5)) and o-phenylenediamine (SB(6)). Schiff bases were characterized using elemental analysis, IR, UV-Vis, (1)H NMR, (13)C NMR and mass spectroscopy. These compounds were screened for antibacterial activities by micro-plate assay technique. Escherichia coli and Staphylococcus capitis were exposed to different concentrations of the Schiff bases. Results showed that the antibacterial effect of these Schiff bases on Gram-negative bacteria were higher than that on Gram-positive bacteria moreover, the Schiff bases containing substituent OCH(3) on position five have higher antibacterial activity than that containing hydroxy group on the same position.

  18. Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

    Science.gov (United States)

    Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

    2016-02-01

    The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

  19. Development of a lipase-based optical assay for detection of DNA

    DEFF Research Database (Denmark)

    Pinijsuwan, Suttiporn; Shipovskov, Stepan; Surareungchai, Werasak

    2011-01-01

    A lipase-based assay for detection of specific DNA sequences has been developed. Lipase from Candida antarctica was conjugated to DNA and captured on magnetic beads in a sandwich assay, in which the binding was dependent on the presence of a specific target DNA. For amplification and to generate...

  20. Pros and cons of methylation-based enrichment methods for ancient DNA

    DEFF Research Database (Denmark)

    Seguin-Orlando, Andaine; Gamba, Cristina; Der Sarkissian, Clio

    2015-01-01

    The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules contai...

  1. Phylogeny of Pelargonium (Geraniaceae) based on DNA sequences from three genomes

    NARCIS (Netherlands)

    Bakker, F.T.; Culham, A.; Hettiarachi, P.; Touloumendidou, T.; Gibby, M.

    2004-01-01

    Phylogenetic hypotheses for the largely South African genus Pelargonium L'Hér. (Geraniaceae) were derived based on DNA sequence data from nuclear, chloroplast and mitochondrial encoded regions. The datasets were unequally represented and comprised cpDNA trnL-F sequences for 152 taxa, nrDNA ITS seque

  2. Aryl substitution of pentacenes

    Directory of Open Access Journals (Sweden)

    Andreas R. Waterloo

    2014-07-01

    Full Text Available A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films, thermoanalytical methods (DSC and TGA, cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives. X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices.

  3. Bone substitute biomaterials

    CERN Document Server

    Mallick, K

    2014-01-01

    Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...

  4. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  5. Conservation and divergence of DNA methylation in eukaryotes: new insights from single base-resolution DNA methylomes.

    Science.gov (United States)

    Su, Zhixi; Han, Leng; Zhao, Zhongming

    2011-02-01

    DNA methylation is one of the most important heritable epigenetic modifications of the genome and is involved in the regulation of many cellular processes. Aberrant DNA methylation has been frequently reported to influence gene expression and subsequently cause various human diseases, including cancer. Recent rapid advances in next-generation sequencing technologies have enabled investigators to profile genome methylation patterns at single-base resolution. Remarkably, more than 20 eukaryotic methylomes have been generated thus far, with a majority published since November 2009. Analysis of this vast amount of data has dramatically enriched our knowledge of biological function, conservation and divergence of DNA methylation in eukaryotes. Even so, many specific functions of DNA methylation and their underlying regulatory systems still remain unknown to us. Here, we briefly introduce current approaches for DNA methylation profiling and then systematically review the features of whole genome DNA methylation patterns in eight animals, six plants and five fungi. Our systematic comparison provides new insights into the conservation and divergence of DNA methylation in eukaryotes and their regulation of gene expression. This work aims to summarize the current state of available methylome data and features informatively.

  6. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

    Science.gov (United States)

    Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

    2014-09-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

  7. A base-excision DNA-repair protein finds intrahelical lesion bases by fast sliding in contact with DNA

    NARCIS (Netherlands)

    Blainey, Paul C.; Oijen, Antoine M. van; Banerjee, Anirban; Verdine, Gregory L.; Xie, X. Sunney; Hippel, Peter H. von

    2006-01-01

    A central mystery in the function of site-specific DNA-binding proteins is the detailed mechanism for rapid location and binding of target sites in DNA. Human oxoguanine DNA glycosylase 1 (hOgg1), for example, must search out rare 8-oxoguanine lesions to prevent transversion mutations arising from o

  8. Direct electrochemical detection of PCR product based on charge transfer through DNA

    Institute of Scientific and Technical Information of China (English)

    ZHAO Hongtao; ZHANG Zhijie; JU Huangxian

    2005-01-01

    @@ Human genome project and genetic identification for inherited diseases will definitely have a profound impact on the diagnosis of diseases[1], which calls for rapid and accurate assays of DNA. Among different types of sensors, electrochemical DNA biosensors offer a promising alternative means[2,3]. Recent efforts to elucidate the mechanism of charge transfer in DNA have demonstrated that the charge transfer is sensitive to the perturbation in base stack[4,5]. Long-range charge transfer in DNA therefore has been showing great potential application in the development of DNA-based biosensors, especially in the study of single nucleotide polymorphs[7―10].

  9. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-09-01

    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion.

  10. Compatibility of selected plant-based shortening as lard substitute: microstructure, polymorphic forms and textural properties

    Directory of Open Access Journals (Sweden)

    N. A.M. Yanty

    2017-03-01

    Full Text Available A study was carried out to determine the compatibility of three plant-based shortening mixtures to lard shortening (LD in terms of microstructure, polymorphic forms, and textural properties. The shortenings of binary, ternary, and quaternary fat mixtures were prepared according to a standard procedure by blending mee fat (MF with palm stearin (PS in a 99:1 (w/w ratio; avocado fat (Avo with PS and cocoa butter (CB in a 84:7:9 (w/w ratio; palm oil (PO with PS, soybean oil (SBO and CB in a 38:5:52:5 (w/w ratio, respectively. The triacylglycerol composition, polymorphic forms, crystal morphology, and textural properties of the shortening were evaluated. This study found that all three plant-based shortenings and LD shortening were similar with respect to their consistency, hardness and compression and adhesiveness values. However, all plant-based shortening was found to be dissimilar to LD shortening with respect to microstructure.

  11. DNA-COMPACT: DNA COMpression based on a pattern-aware contextual modeling technique.

    Directory of Open Access Journals (Sweden)

    Pinghao Li

    Full Text Available Genome data are becoming increasingly important for modern medicine. As the rate of increase in DNA sequencing outstrips the rate of increase in disk storage capacity, the storage and data transferring of large genome data are becoming important concerns for biomedical researchers. We propose a two-pass lossless genome compression algorithm, which highlights the synthesis of complementary contextual models, to improve the compression performance. The proposed framework could handle genome compression with and without reference sequences, and demonstrated performance advantages over best existing algorithms. The method for reference-free compression led to bit rates of 1.720 and 1.838 bits per base for bacteria and yeast, which were approximately 3.7% and 2.6% better than the state-of-the-art algorithms. Regarding performance with reference, we tested on the first Korean personal genome sequence data set, and our proposed method demonstrated a 189-fold compression rate, reducing the raw file size from 2986.8 MB to 15.8 MB at a comparable decompression cost with existing algorithms. DNAcompact is freely available at https://sourceforge.net/projects/dnacompact/for research purpose.

  12. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  13. In Vitro Investigation of Self-Assembled Nanoparticles Based on Hyaluronic Acid-Deoxycholic Acid Conjugates for Controlled Release Doxorubicin: Effect of Degree of Substitution of Deoxycholic Acid

    Directory of Open Access Journals (Sweden)

    Wen-Hao Wei

    2015-03-01

    Full Text Available Self-assembled nanoparticles based on a hyaluronic acid-deoxycholic acid (HD chemical conjugate with different degree of substitution (DS of deoxycholic acid (DOCA were prepared. The degree of substitution (DS was determined by titration method. The nanoparticles were loaded with doxorubicin (DOX as the model drug. The human cervical cancer (HeLa cell line was utilized for in vitro studies and cell cytotoxicity of DOX incorporated in the HD nanoparticles was accessed by the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. In addition, cellular uptake of fluorescently labeled nanoparticles was also investigated. An increase in the degree of deoxycholic acid substitution reduced the size of the nanoparticles and also enhanced their drug encapsulation efficiency (EE, which increased with the increase of DS. A higher degree of deoxycholic acid substitution also lead to a lower release rate and an initial burst release of doxorubicin from the nanoparticles. In summary, the degree of substitution allows the modulation of the particle size, drug encapsulation efficiency, drug release rate, and cell uptake efficiency of the nanoparticles. The herein developed hyaluronic acid-deoxycholic acid conjugates are a good candidate for drug delivery and could potentiate therapeutic formulations for doxorubicin–mediated cancer therapy.

  14. Construction of high efficiency non-doped deep blue emitters based on phenanthroimidazole: remarkable substitution effects on the excited state properties and device performance.

    Science.gov (United States)

    Wang, Zhiming; Feng, Ying; Zhang, Shitong; Gao, Yu; Gao, Zhao; Chen, Yanming; Zhang, Xiaojuan; Lu, Ping; Yang, Bing; Chen, Ping; Ma, Yuguang; Liu, Shiyong

    2014-10-14

    Aryl-substituted phenanthroimidazoles (APIs) are beneficial due to their facile synthesis, thermal properties, high quantum yields, and exciton efficiencies obtained by a reverse intersystem crossing (RISC) process. However, it is puzzling how to combine high quantum yields, exciton utilizing ratios and color purity with stable blue-emitting compounds via coupling. Here, BPPI and N-BPPI are utilized as model compounds for understanding C2- and N1-substitution effects via constructing dimers in each coupling position. By integrating the information obtained from DFT calculations, photophysical analysis, and OLED performance, valuable guidance was obtained. C2-substituted groups typically offer a large orbital overlap between the LE states with large oscillator strengths, and play an important role in the maximum peak area and quantum yields. N1-substituted groups contribute to enhanced orbital coupling and cause excitons to transform freely between different excited states. Unexpected results from the decreased barriers of the N1-coupled system included the loss of PL efficiency and increased emission spectral width, which are important for efficiency and color purity of deep blue emitters. The substitution effects are consistent with most reported results. Therefore, this work may be useful for the generation of non-doped deep blue electroluminescent API-based materials.

  15. In vitro investigation of self-assembled nanoparticles based on hyaluronic acid-deoxycholic acid conjugates for controlled release doxorubicin: effect of degree of substitution of deoxycholic acid.

    Science.gov (United States)

    Wei, Wen-Hao; Dong, Xue-Meng; Liu, Chen-Guang

    2015-03-31

    Self-assembled nanoparticles based on a hyaluronic acid-deoxycholic acid (HD) chemical conjugate with different degree of substitution (DS) of deoxycholic acid (DOCA) were prepared. The degree of substitution (DS) was determined by titration method. The nanoparticles were loaded with doxorubicin (DOX) as the model drug. The human cervical cancer (HeLa) cell line was utilized for in vitro studies and cell cytotoxicity of DOX incorporated in the HD nanoparticles was accessed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. In addition, cellular uptake of fluorescently labeled nanoparticles was also investigated. An increase in the degree of deoxycholic acid substitution reduced the size of the nanoparticles and also enhanced their drug encapsulation efficiency (EE), which increased with the increase of DS. A higher degree of deoxycholic acid substitution also lead to a lower release rate and an initial burst release of doxorubicin from the nanoparticles. In summary, the degree of substitution allows the modulation of the particle size, drug encapsulation efficiency, drug release rate, and cell uptake efficiency of the nanoparticles. The herein developed hyaluronic acid-deoxycholic acid conjugates are a good candidate for drug delivery and could potentiate therapeutic formulations for doxorubicin-mediated cancer therapy.

  16. Biological evaluation of alginate-based hydrogels, with antimicrobial features by Ce(III) incorporation, as vehicles for a bone substitute

    OpenAIRE

    MORAIS, D.S.; Rodrigues, M. A.; Lopes, M A; Coelho, M.J.; Maurício, Ana Colette; Gomes, R; Amorim, Irina; Ferraz, M. P.; Santos,J.D.; Botelho, C. M.

    2013-01-01

    In this work three different hydrogels were developed to associate, as vehicles, with the synthetic bone substitute GR-HA. One based on an alginate matrix (Alg); a second on a mixture of alginate and chitosan (Alg/Ch); and a third on alginate and hyaluronate (Alg/HA), using Ca2+ ions as cross-linking agents. The hydrogels, as well as the respective injectable bone substitutes (IBSs), were fully characterized from the physical-chemical point of view. Weight change studies proved that all hydro...

  17. Effect of the application of a mucin-based saliva substitute on the oral microflora of xerostomic patients.

    Science.gov (United States)

    Weerkamp, A H; Wagner, K; Vissink, A; Gravenmade, E J

    1987-10-01

    A cross-sectional study among 46 xerostomic patients was carried out to determine the influence of a mucin-based artificial saliva on the microflora of standardized oral washings. Patient and non-xerostomic control groups were formed according to the use of saliva substitute (ad libitum or from an intraoral reservoir) and dentition (dentate, edentulous, full dentures). Only few differences were observed among the subgroups based on dentition within a specified salivary group. However, the total number of microorganisms and the proportions of veillonellae, actinomycetes, streptococci and S. salivarius were significantly reduced in xerostomic patients not using artificial saliva, whereas lactobacilli, Candida and S. mitior were significantly increased compared to the control groups. Ad libitum use of artificial saliva had little effect, but semi-continuous wetting of the oral cavity through an intra-oral reservoir reversed the xerostomia-induced shifts in the indigenous microflora. However, no significant effect was observed on the proportions of lactobacilli and yeasts, leaving a potentially acidogenic flora.

  18. Difluorobenzothiadiazole based two-dimensional conjugated polymers with triphenylamine substituted moieties as pendants for bulk heterojunction solar cells

    Directory of Open Access Journals (Sweden)

    W. H. Lee

    2017-11-01

    Full Text Available Three donor/acceptor (D/A-type two-dimensional polythiophenes (PTs; PBTFA13, PBTFA12, PBTFA11 featuring difluorobenzothiadiazole (DFBT derivatives as the conjugated (acceptor units in the polymer backbone and tertbutyl–substituted triphenylamine (tTPA-containing moieties as (donor pendants have been synthesized and characterized. These PTs exhibited good thermal stabilities, broad absorption spectra, and narrow optical band gaps. The cutoff wavelength of the UV–Vis absorption band was red-shifted upon increasing the content of the DFBT units in the PTs. Bulk heterojunction solar cells having an active layer comprising blends of the PTs and fullerene derivatives [6,6] phenyl-C61/71-butyric acid methyl ester (PC61BM/PC71BM were fabricated; their photovoltaic performance was strongly dependent on the content of the DFBT derivative in the PT. Incorporating a suitable content of the DFBT derivative in the polymer backbone enhanced the solar absorption ability and conjugation length of the PTs. The photovoltaic properties of the PBTFA13-based solar cells were superior to those of the PBTFA11- and PBTFA12-based solar cells.

  19. Effects of Ti and Zr Substituted on the Electrochemical Characteristics of MgNi-Based Alloy Electrodes

    Institute of Scientific and Technical Information of China (English)

    FENG Yan; JIAO Li-Fang; YUAN Hua-Tang; ZHAO Ming

    2007-01-01

    Mg-based hydrogen storage alloys MgNi, Mg0.9Ti0.1Ni, and Mg0.9Ti0.06Zr0.04Ni were successfully prepared by means of mechanical alloying (MA). The structure and the electrochemical characteristics of these Mg-based materials were studied. The X-ray diffraction (XRD) result shows that the main phases of the alloys exhibit amorphous structure. The scanning electron microscopy (SEM) photograph shows that the particle size of Ti and Zr substituted alloys was about 2-4 μm in diameter. The cycle lives of the alloys were prolonged by adding Ti and Zr. After 50charge-discharge cycles, the discharge capacity of Mg0.9Ti0.06Zr0.04Ni was 91.74% higher than that of MgNi alloy and 37.96% higher than that of Mg0.9Ti0.1Ni alloy. The main reason for the electrode capacity decay is the formation of Mg(OH)2 (product of Mg corrosion) at the surface of alloy. The potentiodynamic polarization result indicates that Ti and Zr doping improves the anticorrosion in an alkaline solution. The electrochemical impedance spectroscopy (EIS) results suggest that proper amount of Ti and Zr doping improves the electrochemical catalytic activity significantly.

  20. Evaluation of Osteoconductive and Osteogenic Potential of a Dentin-Based Bone Substitute Using a Calvarial Defect Model

    Directory of Open Access Journals (Sweden)

    Ibrahim Hussain

    2012-01-01

    Full Text Available The aim of this study was to assess the osteoconductive and osteogenic properties of processed bovine dentin using a robust rabbit calvarial defect model. In total, 16 New Zealand White rabbits were operated to create three circular defects in the calvaria. One defect was left unfilled, one filled with collected autogenous bone, and the third defect was filled with the dentin-based bone substitute. Following surgery and after a healing period of either 1 or 6 weeks, a CT scan was obtained. Following sacrificing, the tissues were processed for histological examination. The CT data showed the density in the area grafted with the dentin-based material was higher than the surrounding bone and the areas grafted with autologous bone after 1 week and 6 weeks of healing. The area left unfilled remained an empty defect after 1 week and 6 weeks. Histological examination of the defects filled with the dentin product after 6 weeks showed soft tissue encapsulation around the dentin particles. It can be concluded that the rabbit calvarial model used in this study is a robust model for the assessment of bone materials. Bovine dentin is a biostable material; however, it may not be suitable for repairing large 4-wall defects.

  1. A membrane based process for the upgrading of biogas to substituted natural gas (SNG) and recovery of carbondioxide for industrial use

    DEFF Research Database (Denmark)

    Norddahl, Birgir; dePreez, Jan

    2007-01-01

    A low pressure carbon molecular sieve (CMS) membrane based process to upgrade biogas from anaerobic digestion of agricultural waste to a substitute natural gas (SNG) has been tested on a pilot scale. The data extracted from the pilot plant was used to estimate membrane permeance and ideal...

  2. Synthesis, Characterization and Metal Ion Detection of Novel Fluoroionophores Based on Heterocyclic Substituted Alanines

    Directory of Open Access Journals (Sweden)

    M. Manuela M Raposo

    2007-10-01

    Full Text Available The synthesis of new fluorescent probes containing the thiophene andbenzoxazole moieties combined with an alanine residue is described. The resulting highlyfluorescent heterocyclic alanine derivatives respond via a quenching effect, withparamagnetic Cu(II and Ni(II metal ions and with diamagnetic Hg(II, as shown by theabsorption and steady-state fluorescence spectroscopy studies. The formation ofmononuclear or dinuclear metal complexes was postulated based on the presence of thefree carboxylic acid as binding site and also with the interaction with the donor atoms inthe chromophore. Interaction with other important biological metal ions such as Zn(II,Ca(II and Na(I was also explored.

  3. PCL-retaining versus PCL-substituting TKR - Outcome assessment based on the "forgotten joint score".

    Science.gov (United States)

    Thippanna, Rajshekar K; Mahesh, Pramod; Kumar, Malhar N

    2015-12-01

    Posterior cruciate ligament (PCL) retention or sacrifice figures prominently among the current controversies in total knee arthroplasty (TKA). Even though biomechanical advantages and disadvantages have been claimed for each type of TKA, clinical studies have not shown significant differences in the outcomes. In this retrospective study, the recently introduced "forgotten joint score" (FJS) was used to assess whether any differences exist between the two types of total knee replacement (TKR). FJ scores of 169 patients with PCL-retaining TKA and 178 patients with PCL sacrificing were obtained. The mean follow-up period was 3.5 years and the minimum follow-up period was 2.5 years. Both groups showed high FJ scores indicating that majority of the patients were oblivious to the presence of the artificial joint during daily activities. There was no statistically significant difference between the mean FJ scores of the two groups. Scores of subsets based on gender, age and unilateral and bilateral TKR also did not show significant differences. Since there are no clinically important differences between the two types of TKR, the choice of the TKA should be based on surgeon preferences and training and local conditions of the knee. Patient-reported outcomes appear to be similar regardless of the choice of TKA. Further prospective studies and validation of FJS outcomes with those of other questionnaires are essential to confirm the absence of differences between PCL retention and sacrifice.

  4. Structure based medicinal chemistry-driven strategy to design substituted dihydropyrimidines as potential antileishmanial agents.

    Science.gov (United States)

    Rashid, Umer; Sultana, Riffat; Shaheen, Nargis; Hassan, Syed Fahad; Yaqoob, Farhana; Ahmad, Muhammad Jawad; Iftikhar, Fatima; Sultana, Nighat; Asghar, Saba; Yasinzai, Masoom; Ansari, Farzana Latif; Qureshi, Naveeda Akhter

    2016-06-10

    In an attempt to explore novel and more potent antileishmanial compounds to diversify the current inhibitors, we pursued a medicinal chemistry-driven strategy to synthesize novel scaffolds with common pharmacophoric features of dihydropyrimidine and chalcone as current investigational antileishmanial compounds. Based on the reported X-ray structure of Pteridine reductase 1 (PTR1) from Leishmania major, we have designed a number of dihydropyrimidine-based derivatives to make specific interactions in PTR1 active site. Our lead compound 8i has shown potent in vitro antileishmanial activity against promastigotes of L. Major and Leishmania donovani with IC50 value of 0.47 μg/ml and 1.5 μg/ml respectively. The excellent in vitro activity conclusively revealed that our lead compound is efficient enough to eradicate both visceral and topical leishmaniasis. In addition, docking analysis and in silico ADMET predictions were also carried out. Predicted molecular properties supported our experimental analysis that these compounds have potential to eradicate both visceral and topical leishmaniasis.

  5. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Directory of Open Access Journals (Sweden)

    Katarzyna A. Wojcik

    2014-10-01

    Full Text Available Keratoconus (KC is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER. Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1 were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1 nor the c.2285T>C polymorphism of the poly(ADP-ribose polymerase-1 (PARP-1 was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease.

  6. A rapid synthesis of 2-substituted 1,2,3- triazole-1-oxide derivative starting from 4-(methyl)isonitrosoacetophenone and its Ni(II) complex: Characterization, DNA binding and cleavage properties

    Science.gov (United States)

    Gup, Ramazan; Erer, Oktay; Dilek, Nefise

    2017-02-01

    An efficient route, not including any metal salt as a catalyst, for the synthesis of a new 2-substituted 1,2,3- triazole-1-oxide is reported in this paper. The title compound has been synthesized via reacting 4-(methyl)isonitrosoacetophenone with hydrazine hydrate and dipyridyl ketone in high yield under mild reaction condition. The structure of the new 1,2,3-triazole-1-oxide has been characterized via single crystal X-ray and spectral studies. The 1:1 ratio reaction of the 1,2,3-triazole 1-oxide ligand with nickel(II) chloride gives the mononuclear complex [Ni(L)(DMF)(Cl)2] which is hexa-coordinated within an octahedral geometry. Characterization of the 1,2,3-triazole compound and its Ni(II) complex with FTIR, 1H and 13C NMR, UV-vis, TGA and elemental analysis also confirm the proposed structures for the compounds. The interactions of the compounds with Calf thymus DNA (CT-DNA) have been investigated via UV-visible spectra and viscosity measurements. The results suggested that both ligand and Ni(II) complex bind to DNA in electrostatic interaction and/or groove binding with a slight partial intercalation. DNA cleavage experiments have been also investigated by agarose gel electrophoresis in the presence and absence of an oxidative agent (H2O2). Both 1,2,3-triazole 1-oxide ligand and nickel(II) complex show nuclease activity, which significantly depends on concentrations of the compounds, both in the presence and absence of an oxidative agent. DNA binding and cleavage affinities of the Ni(II) complex is stronger than that of the 1,2,3-triazole 1-oxide ligand.

  7. Uranyl-selective PVC membrane electrodes based on some recently synthesized benzo-substituted macrocyclic diamides.

    Science.gov (United States)

    Shamsipur, Mojtaba; Soleymanpour, Ahmad; Akhond, Morteza; Sharghi, Hashem; Massah, Ahmad Reza

    2002-08-23

    Four different recently synthesized macrocyclic diamides were studied to characterize their abilities as uranyl ion carriers in PVC membrane electrodes. The electrodes based on macrocycle 1,18-diaza-3,4;15,16-dibenzo-5,8,11,14,21,24-hexaoxacyclohexaeicosane-2,17-dione resulted in a Nernstian response for UO(2)(2+) ion over wide concentration ranges. The linear concentration range for the polymeric membrane electrode (PME) is 3.0x10(-6)-8.2x10(-3) M with a detection limit of 2.2x10(-6) and that for the coated graphite electrode (CGE) is 5.0x10(-7)-1.5x10(-3) M with a detection limit of 3.5x10(-7) M. The electrodes manifest advantages of low resistance, very fast response and, most importantly, good selectivities relative to a wide variety of other cations.

  8. Strontium-selective membrane electrodes based on some recently synthesized benzo-substituted macrocyclic diamides.

    Science.gov (United States)

    Shamsipur, M; Rouhani, S; Sharghi, H; Ganjali, M R; Eshghi, H

    1999-11-01

    Eight different recently synthesized macrocyclic diamides were studied to characterize their abilities as strontium ion carriers in PVC membrane electrodes. The electrode based on 1,13-diaza-2,3;11,12-dibenzo-4,7,10-trioxacyclopentadecane-14,15-dione exhibits a Nernstian response for Sr(2+) ions over a wide concentration range (1.0 × 10(-)(1)-3.2 × 10(-)(5) M) with a limit of detection of 8.0 × 10(-)(6) M (0.7 ppm). The response time of the sensor is ∼10 s, and the membrane can be used for more than three months without observing any deviation. The electrode revealed comparatively good selectivities with respect to many alkali, alkaline earth, and transition metal ions. It was used as an indicator electrode in potentiometric titration of carbonate ions with a strontium ion solution.

  9. Cobalt(II)-selective membrane electrode based on a recently synthesized benzo-substituted macrocyclic diamide.

    Science.gov (United States)

    Shamsipur, M; Poursaberi, T; Rouhani, S; Niknam, K; Sharghi, H; Ganjali, M R

    2001-09-01

    A PVC-membrane electrode based on a recently synthesized 18-membered macrocyclic diamide is presented. The electrode reveals a Nernstian potentiometric response for Co2+ over a wide concentration range (2.0 x 10(-6)-1.0 x 10(-2) M). The electrode has a response time of about 10 s and can be used for at least 2 months without any divergence. The proposed sensor revealed very good selectivities for Co2+ over a wide variety of other metal ions, and could be used over a wide pH range (3.0-8.0). The detection limit of the sensor is 6.0 x 10(-7) M. It was successfully applied to the direct determination and potentiometric titration of cobalt ion.

  10. 3D printing of mineral–polymer bone substitutes based on sodium alginate and calcium phosphate

    Science.gov (United States)

    Egorov, Aleksey A; Fedotov, Alexander Yu; Mironov, Anton V; Popov, Vladimir K; Zobkov, Yury V

    2016-01-01

    Summary We demonstrate a relatively simple route for three-dimensional (3D) printing of complex-shaped biocompatible structures based on sodium alginate and calcium phosphate (CP) for bone tissue engineering. The fabrication of 3D composite structures was performed through the synthesis of inorganic particles within a biopolymer macromolecular network during 3D printing process. The formation of a new CP phase was studied through X-ray diffraction, Fourier transform infrared spectroscopy and scanning electron microscopy. Both the phase composition and the diameter of the CP particles depend on the concentration of a liquid component (i.e., the “ink”). The 3D printed structures were fabricated and found to have large interconnected porous systems (mean diameter ≈800 μm) and were found to possess compressive strengths from 0.45 to 1.0 MPa. This new approach can be effectively applied for fabrication of biocompatible scaffolds for bone tissue engineering constructions. PMID:28144529

  11. Isopropylation of benzene with 2-propanol over substituted large pore aluminophosphate-based molecular sieves

    Indian Academy of Sciences (India)

    K Joseph Antony Raj; V R Vijayaraghavan

    2004-03-01

    Large pore aluminophosphate-based molecular sieves like AlPO4-5, MAPO-5, MnAPO-5 and ZAPO-5 were synthesised hydrothermally using triethylamine as a structure directing agent. These materials were characterised by X-ray diffraction (XRD), 27Al and 31P MAS-NMR, ICP-MS, -butylamine- TPD, BET and SEM. The catalytic performance of these materials was tested for isopropylation of benzene with 2-propanol at 250, 300, 350 and 400°C. The products were cumene, -DIPB (-diisopropylbenzene) and -DIPB (-diisopropylbenzene). MnAPO-5 was found to be more active than the other catalysts. Maximum conversion (20%) was noted at 350°C over MnAPO-5. The selectivity to DIPB was found to decrease with time on stream but the selectivity to cumene showed an increase after 3 h of time on stream.

  12. Acid-base thermochemistry of gaseous oxygen and sulfur substituted amino acids (Ser, Thr, Cys, Met).

    Science.gov (United States)

    Riffet, Vanessa; Frison, Gilles; Bouchoux, Guy

    2011-11-07

    Acid-base thermochemistry of isolated amino acids containing oxygen or sulfur in their side chain (serine, threonine, cysteine and methionine) have been examined by quantum chemical computations. Density functional theory (DFT) was used, with B3LYP, B97-D and M06-2X functionals using the 6-31+G(d,p) basis set for geometry optimizations and the larger 6-311++G(3df,2p) basis set for energy computations. Composite methods CBS-QB3, G3B3, G4MP2 and G4 were applied to large sets of neutral, protonated and deprotonated conformers. Conformational analysis of these species, based on chemical approach and AMOEBA force field calculations, has been used to identify the lowest energy conformers and to estimate the population of conformers expected to be present at thermal equilibrium at 298 K. It is observed that G4, G4MP2, G3B3, CBS-QB3 composite methods and M06-2X DFT lead to similar conformer energies. Thermochemical parameters have been computed using either the most stable conformers or equilibrium populations of conformers. Comparison of experimental and theoretical proton affinities and Δ(acid)H shows that the G4 method provides the better agreement with deviations of less than 1.5 kJ mol(-1). From this point of view, a set of evaluated thermochemical quantities for serine, threonine, cysteine and methionine may be proposed: PA = 912, 919, 903, 938; GB = 878, 886, 870, 899; Δ(acid)H = 1393, 1391, 1396, 1411; Δ(acid)G = 1363, 1362, 1367, 1382 kJ mol(-1). This study also confirms that a non-negligible ΔpS° is associated with protonation of methionine and that the most acidic hydrogen of cysteine in the gas phase is that of the SH group. In several instances new conformers were identified thus suggesting a re-examination of several IRMPD spectra.

  13. Biofabrication of a PLGA-TCP-based porous bioactive bone substitute with sustained release of icaritin.

    Science.gov (United States)

    Xie, Xin-Hui; Wang, Xin-Luan; Zhang, Ge; He, Yi-Xin; Leng, Yang; Tang, Ting-Ting; Pan, Xiaohua; Qin, Ling

    2015-08-01

    A phytomolecule, icaritin, has been identified and shown to be osteopromotive for the prevention of osteoporosis and osteonecrosis. This study aimed to produce a bioactive poly (l-lactide-co-glycolide)-tricalcium phosphate (PLGA-TCP)-based porous scaffold incorporating the osteopromotive phytomolecule icaritin, using a fine spinning technology. Both the structure and the composition of icaritin-releasing PLGA-TCP-based scaffolds were evaluated by scanning electron microscopy (SEM). The porosity was quantified by both water absorption and micro-computed tomography (micro-CT). The mechanical properties were evaluated using a compression test. In vitro release of icaritin from the PLGA-TCP scaffold was quantified by high-performance liquid chromatography (HPLC). The attachment, proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) on the composite scaffold were evaluated. Both an in vitro cytotoxicity test and an in vivo test via muscular implantation were conducted to confirm the scaffold's biocompatibility. The results showed that the PLGA-TCP-icaritin composite scaffold was porous, with interconnected macro- (about 480 µm) and micropores (2-15 µm). The mechanical properties of the PLGA-TCP-icaritin scaffold were comparable with those of the pure PLGA-TCP scaffold, yet was spinning direction-dependent. Icaritin content was detected in the medium and increased with time. The PLGA-TCP-icaritin scaffold facilitated the attachment, proliferation and osteogenic differentiation of BMSCs. In vitro cytotoxicity test and in vivo intramuscular implantation showed that the composite scaffold had no toxicity with good biocompatibility. In conclusion, an osteopromotive phytomolecule, icaritin, was successfully incorporated into PLGA-TCP to form an innovative porous composite scaffold with sustained release of osteopromotive icaritin, and this scaffold had good biocompatibility and osteopromotion, suggesting its potential for orthopaedic

  14. Job shop scheduling problem based on DNA computing

    Institute of Scientific and Technical Information of China (English)

    Yin Zhixiang; Cui Jianzhong; Yang Yan; Ma Ying

    2006-01-01

    To solve job shop scheduling problem, a new approach-DNA computing is used in solving job shop scheduling problem. The approach using DNA computing to solve job shop scheduling is divided into three stands. Finally, optimum solutions are obtained by sequencing. A small job shop scheduling problem is solved in DNA computing, and the "operations" of the computation were performed with standard protocols, as ligation, synthesis, electrophoresis etc. This work represents further evidence for the ability of DNA computing to solve NP-complete search problems.

  15. DNA purification and gene typing:Based on multifunctional nanobeads

    Institute of Scientific and Technical Information of China (English)

    XIE Xin; ZHANG Xu; GAO Huafang; ZHANG Huan; CHEN Depu; CHENG Jing; FEI Weiyang

    2004-01-01

    In this report, a universal protocol for extracting genomic DNA from whole blood, saliva, and bacterial culture by using magnetic nanobeads as solid-phase absorbents was presented. The enrichment of target cells and adsorption of DNA have been functionally integrated onto the surfaces of the carboxyl-modified magnetic nano-beads, and the DNA segments bound on the surface of the beads can be directly used as PCR templates to amplify a target gene. The PCR products were applied to an oligonucleotide array to perform gene typing. The protocol proves to be simple, rapid, biologically and chemically nonhazardous, and promising for the microfabrication of DNA preparation chip.

  16. Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor

    Science.gov (United States)

    Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh

    2017-09-01

    The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.

  17. Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.

    Science.gov (United States)

    Gryson, Nicolas

    2010-03-01

    The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.

  18. Electrochemiluminescence induced photoelectrochemistry for sensing of the DNA based on DNA-linked CdS NPs superstructure with intercalator molecules.

    Science.gov (United States)

    Guo, Yingshu; Sun, Yuanshun; Zhang, Shusheng

    2011-02-07

    A novel detection protocol of DNA was developed using electrochemiluminescence (ECL) induced photoelectrochemistry (PEC) synthesis based on DNA-linked CdS NPs superstructure with methylene blue as the intercalator molecule.

  19. Differential interactions of plasmid DNA, RNA and genomic DNA with amino acid-based affinity matrices.

    Science.gov (United States)

    Sousa, Angela; Sousa, Fani; Queiroz, João A

    2010-09-01

    The development of a strategy to plasmid DNA (pDNA) purification has become necessary for the development of gene therapy and DNA vaccine production processes in recent years, since this nucleic acid and most of contaminants, such as RNA, genomic DNA and endotoxins, are negatively charged. An ideal separation methodology may be achieved with the use of affinity interactions between immobilized amino acids and nucleic acids. In this study, the binding behaviour of nucleic acids under the influence of different environmental conditions, such as the composition and ionic strength of elution buffer, and the temperature, is compared with various amino acids immobilized on chromatography resins. Supercoiled (sc) plasmid isoform was isolated with all matrices used, but in some cases preferential interactions with other nucleic acids were found. Particularly, lysine chromatography showed to be an ideal technology mainly on RNA purification using low salt concentration. On the other hand, arginine ligands have shown a greater ability to retain the sc isoform comparatively to the other nucleic acids retention, becoming this support more adequate to sc pDNA purification. The temperature variation, competitive elution and oligonucleotides affinity studies also allowed to recognize the dominant interactions inherent to biorecognition of pDNA molecule and the affinity matrices.

  20. DBD-Hunter: a knowledge-based method for the prediction of DNA-protein interactions.

    Science.gov (United States)

    Gao, Mu; Skolnick, Jeffrey

    2008-07-01

    The structures of DNA-protein complexes have illuminated the diversity of DNA-protein binding mechanisms shown by different protein families. This lack of generality could pose a great challenge for predicting DNA-protein interactions. To address this issue, we have developed a knowledge-based method, DNA-binding Domain Hunter (DBD-Hunter), for identifying DNA-binding proteins and associated binding sites. The method combines structural comparison and the evaluation of a statistical potential, which we derive to describe interactions between DNA base pairs and protein residues. We demonstrate that DBD-Hunter is an accurate method for predicting DNA-binding function of proteins, and that DNA-binding protein residues can be reliably inferred from the corresponding templates if identified. In benchmark tests on approximately 4000 proteins, our method achieved an accuracy of 98% and a precision of 84%, which significantly outperforms three previous methods. We further validate the method on DNA-binding protein structures determined in DNA-free (apo) state. We show that the accuracy of our method is only slightly affected on apo-structures compared to the performance on holo-structures cocrystallized with DNA. Finally, we apply the method to approximately 1700 structural genomics targets and predict that 37 targets with previously unknown function are likely to be DNA-binding proteins. DBD-Hunter is freely available at http://cssb.biology.gatech.edu/skolnick/webservice/DBD-Hunter/.

  1. Palm-based biofuel refinery (PBR) to substitute petroleum refinery: An energy and emergy assessment

    Energy Technology Data Exchange (ETDEWEB)

    Goh, Chun Sheng; Lee, Keat Teong [School of Chemical Engineering, Engineering Campus, Universiti Sains Malaysia, Seri Ampangan, 14300 Nibong Tebal, Seberang Perai Selatan, Pulau Pinang (Malaysia)

    2010-12-15

    As the most active palm industry cluster in the world, Malaysia produces enormous amount of biomass from the industry. This work studies the possibility of creating a renewable and sustainable source of energy by fully utilizing an area of land to provide liquid biofuel for the country. Palm-based biofuel refinery (PBR) proposed in this study has the ultimate goal to displace petroleum fuels and fulfill domestic energy demand. It fully utilizes indigenous palm biomass to fulfill 35.5% of energy demand in the country by using land area of only 8% of current palm cultivation. The operation concept of PBR is similar to petroleum refinery in which a single source feedstock (crude petroleum) can be processed to multiple products. In PBR, products from an oil palm plantation will be converted to various biofuel end products. Renewable biofuel such as biodiesel and bioethanol can be produced from crude palm oil and lignocellulosic residues. Energy and emergy assessment were made in this work to evaluate the sustainability and efficiency of PBR. Biofuel produced from PBR has a high energy equivalent of 31.56 MJ/kg as 1 ha of land can produce 182,142 MJ annually. Although there are still obstacles to be overcome, it is important for Malaysia to develop its own energy supply from indigenous resources as an initiative not only for security but also lower carbon emission. (author)

  2. CAN SORBENT-BASED GAS PHASE AIR CLEANING FOR VOCS SUBSTITUTE FOR VENTILATION IN COMMERCIAL BUILDINGS?

    Energy Technology Data Exchange (ETDEWEB)

    Fisk, William; Fisk, William J.

    2007-08-01

    This paper reviews current knowledge about the suitability of sorbent-based air cleaning for removing volatile organic compounds (VOCs) from the air in commercial buildings, as needed to enable reductions in ventilation rates and associated energy savings. The principles of sorbent air cleaning are introduced, criteria are suggested for sorbent systems that can counteract indoor VOC concentration increases from reduced ventilation, major findings from research on sorbent performance for this application are summarized, and related priority research needs are identified. Major conclusions include: sorbent systems can remove a broad range of VOCs with moderate to high efficiency, sorbent technologies perform effectively when challenged with VOCs at the low concentrations present indoors, and there is a large uncertainty about the lifetime and associated costs of sorbent air cleaning systems when used in commercial buildings for indoor VOC control. Suggested priority research includes: experiments to determine sorbent system VOC removal efficiencies and lifetimes considering the broad range and low concentration of VOCs indoors; evaluations of in-situ regeneration of sorbents; and an updated analysis of the cost of sorbent air cleaning relative to the cost of ventilation.

  3. Hemoglobin-Based Blood Substitutes and the Treatment of Sickle Cell Disease: More Harm than Help?

    Directory of Open Access Journals (Sweden)

    Abdu I. Alayash

    2017-01-01

    Full Text Available Intense efforts have been made by both industry and academia over the last three decades to produce viable hemoglobin (Hb-based oxygen carriers (HBOCs, also known as “blood substitutes”. Human trials conducted so far by several manufactures in a variety of clinical indications, including trauma, and elective surgeries have failed and no product has gained the Food and Drug Administration approval for human use. Safety concerns due to frequent incidences of hemodynamic, cardiac events, and even death led to the termination of some of these trials. Several second generation HBOC products that have been chemically and/or genetically modified (or in some cases ligated with carbon monoxide (CO found a new clinical application in conditions as complex as sickle cell disease (SCD. By virtue of higher oxygen affinity (P50 (R-state, and smaller size, HBOCs may be able to reach the microvasculature unload of oxygen to reverse the cycles of sickling/unsickling of the deoxy-sickle cell Hb (HbS (T-state, thus preventing vaso-occlusion, a central event in SCD pathophysiology. However, biochemically, it is thought that outside the red blood cell (due to frequent hemolysis, free HbS or infused HBOCs are capable of interfering with a number of oxidative and signaling pathways and may, thus, negate any benefit that HBOCs may provide. This review discusses the advantages and disadvantages of using HBOCs in SCD.

  4. Stretched and overwound DNA forms a Pauling-like structure with exposed bases.

    Science.gov (United States)

    Allemand, J F; Bensimon, D; Lavery, R; Croquette, V

    1998-11-24

    We investigate structural transitions within a single stretched and supercoiled DNA molecule. With negative supercoiling, for a stretching force >0.3 pN, we observe the coexistence of B-DNA and denatured DNA from sigma approximately -0.015 down to sigma = -1. Surprisingly, for positively supercoiled DNA (sigma > +0.037) stretched by 3 pN, we observe a similar coexistence of B-DNA and a new, highly twisted structure. Experimental data and molecular modeling suggest that this structure has approximately 2.62 bases per turn and an extension 75% larger than B-DNA. This structure has tightly interwound phosphate backbones and exposed bases in common with Pauling's early DNA structure [Pauling, L. & Corey, R. B. (1953), Proc. Natl. Acad. Sci. USA 39, 84-97] and an unusual structure proposed for the Pf1 bacteriophage [Liu, D. J. & Day, L. A. (1994) Science 265, 671-674].

  5. IN VIVO PERFORMANCE OF THE EXPERIMENTAL CHITOSAN BASED BONE SUBSTITUTE--ADVANCED THERAPY MEDICINAL PRODUCT. A STUDY IN SHEEP.

    Science.gov (United States)

    Bojar, Witold; Kucharska, Martyna; Ciach, Tomasz; Paśnik, Iwona; Korobowicz, Elzbieta; Patkowski, Krzysztof; Gruszecki, Tomasz; Szymanowski, Marek; Rzodkiewicz, Przemysław

    2016-01-01

    When evaluating a novel bone substitute material, advanced in vivo testing is an important step in development and safety affirmation. Sheep seems to be a valuable model for human bone turnover and remodeling activity. The experimental material composed with the stem cells is an advanced therapy medicinal product (acc. to EC Regulation 1394/2007). Our research focuses on histological differences in bone formation (guided bone regeneration--GBR) in sheep maxillas after implantation of the new chitosan/tricalcium phosphate/alginate (CH/TCP/Alg) biomaterial in comparison to the commercially available xenogenic bone graft and a/m enhanced with the stem cells isolated from the adipose tissue. Twelve adult female sheep of BCP synthetic line, weighing 60-70 kg were used for the study. The 11 mm diameter defects in maxilla bone were prepared with a trephine bur under general anesthesia and then filled with the bone substitute materials: CH/TCP/Alg, BioOss Collagen, Geistlich AG (BO), CH/TCP/Alg composed with the stem cells (CH/S) or left just with the blood clot (BC). Inbreeding cycle of the animals terminated at 4 months after surgery. Dissected specimens of the maxilla were evaluated histologically and preliminary under microtomography. Histological evaluation showed early new bone formation observed around the experimental biomaterial and commercially available BO. There were no features of purulent inflammation and necrosis, or granulomatous inflammation. Microscopic examination after 4 months following the surgery revealed trabecular bone formation around chitosan based bone graft and xenogenic material with no significant inflammatory response. Different results--no bone recreation were observed for the negative control (BC). In conclusion, the tested materials (CH/TCP/Alg and BO) showed a high degree of biocompatibility and some osteoconductivity in comparison with the control group. Although the handiness, granules size and setting time of CHffCP/Alg may be refined

  6. The Influence of Drug Testing and Benefit-Based Distribution of Opioid Substitution Therapy on Drug Abstinence.

    Science.gov (United States)

    Gabrovec, Branko

    2015-01-01

    The objective of our research was to discover whether the new approach to urine drug testing has a positive effect on users' abstinence, users' treatment, and their cooperation, while remaining user-friendly, and whether this approach is more cost-effective. The centers are focused on providing high-quality treatment within a cost-efficient program. In this study, we focus on the influence of drug testing and benefit-based distribution of opioid substitution therapy (BBDOST) on drug abstinence. The purpose of this study was to find any possible positive effect of modified distribution of the therapy and illicit drug testing on the number of users who are abstinent from illicit drugs and users who are not abstinent from illicit drugs as well as the users' opinion on BBDOST and testing. We are also interested in a difference in abstinence rates between those on BBDOST and those not receiving BBDOST. In 2010, the method of drug testing at the center was changed (less frequent and random drug testing) to enable its users faster access to BBDOST (take-home therapy). It was found that the number of drug-abstinent program participants has increased from initial 44.5% (2010) to 54.1% (2014). According to the program participants, the new method allows them to achieve and maintain abstinence from drugs more easily. In addition, they are also satisfied with the modified way of drug testing. This opinion does not change with age, gender, and acquired benefits.

  7. Lead-selective poly(vinyl chloride) electrodes based on some synthesized benzo-substituted macrocyclic diamides.

    Science.gov (United States)

    Kazemi, Sayed Yahya; Shamsipur, Mojtaba; Sharghi, Hashem

    2009-12-15

    A series of recently synthesized benzo- and pyridine-substituted macrocyclic diamides were studied to characterize their abilities as lead ion carriers in PVC membrane electrodes. The electrode based on 3,15,21-triaza-4,5;13,14-dibenzo-6,9,12-trioxabicycloheneicosa-1,17,19-triene-2,16-dione exhibits a Nernstian response for Pb2+ ions over a wide concentration range (1.3 x 10(-2) to 3.6 x 10(-6) mol L(-1)) with a limit of detection of 2.0 x 10(-6) mol L(-1) (0.4 ppm). The response time of the sensor is approximately 16 s, and the membrane can be used for more than two months without observing any deviation. The electrode revealed comparatively good selectivities with respect to many cations including alkali earth, transition and heavy metal ions. The proposed sensor could be used in pH range of 3.7-6.5. It was used as an indicator electrode in potentiometric titration of chromate ions with a lead ion solution.

  8. Achieving Adherence to Evidence-Based Practices: Are Health IT and Hospital-Physician Integration Complementary or Substitutive Strategies?

    Science.gov (United States)

    Everson, Jordan; Lee, Shoou-Yih Daniel; Adler-Milstein, Julia

    2016-12-01

    In response to evolving policies and conditions, hospitals have increased health information technology (HIT) adoption and strived to improve hospital-physician integration. While evidence suggests that both HIT and integration confer independent benefits, when combined, they may provide complementary means to achieve high performance or overlap to offset each other's contribution. We explore this relationship in the context of hospital adherence to evidence-based practices (EBPs). Using the American Hospital Association's Annual and IT Supplement surveys, and Centers for Medicare and Medicaid Services's Hospital Compare, we estimate the independent relationships and interactions between HIT and hospital-physician integration with respect to EBP adherence. HIT adoption and tight (but not loose) integration are independently associated with greater adherence to EBPs. The interaction between HIT adoption and tight integration is negative, consistent with an offsetting association between HIT adoption and integration in their relationship to EBP adherence. This finding reveals the need to be aware of potential substitutive effects from simultaneous pursuit of multiple approaches to performance improvement.

  9. Site-specific metal and ligand substitutions in a microporous Mn(2+)-based metal-organic framework.

    Science.gov (United States)

    Huxley, Michael; Coghlan, Campbell J; Burgun, Alexandre; Tarzia, Andrew; Sumida, Kenji; Sumby, Christopher J; Doonan, Christian J

    2016-03-14

    The precise tuning of the structural and chemical features of microporous metal-organic frameworks (MOFs) is a crucial endeavour for developing materials with properties that are suitable for specific applications. In recent times, techniques for preparing frameworks consisting of mixed-metal or ligand compositions have emerged. However, controlled spatial organisation of the components within these structures at the molecular scale is a difficult challenge, particularly when species possessing similar geometries or chemical properties are used. Here, we describe the synthesis of mixed-metal and ligand variants possessing the Mn3L3 (Mn-MOF-1; H2L = bis(4-(4'-carboxyphenyl)-3,5-dimethylpyrazolyl)methane) structure type. In the case of mixed-ligand synthesis using a mixture of L and its trifluoromethyl-functionalised derivative (H2L' = bis(4-(4'-carboxyphenyl)-3,5-di(trifluoromethyl)pyrazolyl)methane), a mixed-ligand product in which the L' species predominanantly occupies the pillar sites lining the pores is obtained. Meanwhile, post-synthetic metal exchange of the parent Mn3L3 compound using Fe(2+) or Fe(3+) ions results in a degree of cation exchange at the trinuclear carboxylate-based clusters and metalation at the pillar bispyrazolate sites. The results demonstrate the versatility of the Mn3L3 structure type toward both metal and ligand substitutions, and the potential utility of site-specific functionalisations in achieving even greater precision in the tuning of MOFs.

  10. Substituted benzamide inhibitors of human rhinovirus 3C protease: structure-based design, synthesis, and biological evaluation.

    Science.gov (United States)

    Reich, S H; Johnson, T; Wallace, M B; Kephart, S E; Fuhrman, S A; Worland, S T; Matthews, D A; Hendrickson, T F; Chan, F; Meador, J; Ferre, R A; Brown, E L; DeLisle, D M; Patick, A K; Binford, S L; Ford, C E

    2000-05-04

    A series of nonpeptide benzamide-containing inhibitors of human rhinovirus (HRV) 3C protease was identified using structure-based design. The design, synthesis, and biological evaluation of these inhibitors are reported. A Michael acceptor was combined with a benzamide core mimicking the P1 recognition element of the natural 3CP substrate. alpha,beta-Unsaturated cinnamate esters irreversibly inhibited the 3CP and displayed antiviral activity (EC(50) 0.60 microM, HRV-16 infected H1-HeLa cells). On the basis of cocrystal structure information, a library of substituted benzamide derivatives was prepared using parallel synthesis on solid support. A 1.9 A cocrystal structure of a benzamide inhibitor in complex with the 3CP revealed a binding mode similar to that initially modeled wherein covalent attachment of the nucleophilic cysteine residue is observed. Unsaturated ketones displayed potent reversible inhibition but were inactive in the cellular antiviral assay and were found to react with nucleophilic thiols such as DTT.

  11. Development of a DNA Sensor Based on Alkanethiol Self- Assembled Monolayer-Modified Electrodes

    Directory of Open Access Journals (Sweden)

    José M. Pingarrón

    2005-11-01

    Full Text Available An electrochemical DNA biosensor based on recognition of double or singlestranded DNA (ds-DNA/ss-DNA immobilised on a self-assembled modified gold electrodeis presented for denaturalisation and hybridisation detection. DNA is covalently bond on aself assembled 3-mercaptopropionic acid monolayer by using water soluble N-3-(dimethylaminopropyl-N´ethylcarbodiimide hydrochloride (EDC and Nhydroxisulfosuccinimide(NHSS as linkers. The interaction between the immobilised DNAand methylene blue (MB is investigated using square wave voltammetry (SWV. Theincrease or diminution of peak currents of the MB upon the hybridisation or denaturalisationevent at the modified electrode surface is studied.

  12. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de

    2006-01-01

    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....

  13. DNA mutation detection with chip-based temperature gradient capillary electrophoresis using a slantwise radiative heating system.

    Science.gov (United States)

    Zhang, Hui-Dan; Zhou, Jing; Xu, Zhang-Run; Song, Jin; Dai, Jing; Fang, Jin; Fang, Zhao-Lun

    2007-09-01

    A simple and robust chip-based temperature gradient capillary electrophoresis (TGCE) system was developed for DNA mutation/single-nucleotide polymorphism (SNP) analysis using a radiative heating system. Reproducible, stable and uniform temperature gradients were established along a 3 cm length of the electrophoretic separation channel using a single thermostated aluminium heater plate. The heater was slightly slanted relative to the plane of the glass chip at 0.2-1.3 degrees by inserting thin spacers between the plate and chip at one end to produce differences in radiative heating that created the temperature gradient. On-chip TGCE analyses of 4 mutant DNA model samples amplified from plasmid templates, each containing a single base substitution, with a wide range of melting temperatures, showed that mutations were successfully detected under a wide temperature gradient of 10 degrees C and within a short gradient region of about 3 cm (3.3 degrees C cm(-1) gradient). The radiative heating system was able to establish stable spatial temperature gradients along short microfluidic separation channels using simple peripheral equipment and manipulation while ensuring good resolution for detecting a wide range of mutations. Effectiveness of the system was demonstrated by the successful detection of K-ras gene mutations in 6 colon cancer cell lines.

  14. Substitutional impact on biological activity of new water soluble Ni(II) complexes: Preparation, spectral characterization, X-ray crystallography, DNA/protein binding, antibacterial activity and in vitro cytotoxicity.

    Science.gov (United States)

    Umadevi, C; Kalaivani, P; Puschmann, H; Murugan, S; Mohan, P S; Prabhakaran, R

    2017-02-01

    A series of new water soluble nickel(II) complexes containing triphenylphosphine and 4-methoxysalicylaldehyde-4(N)-substituted thiosemicarbazones were synthesized and characterized. Crystallographic investigations confirmed the structure of the complexes (1-4) having the general structure [Ni(4-Msal-Rtsc)(PPh3)] (Where R=H (1); CH3 (2); C2H5 (3); C6H5 (4)) which showed that thiosemicarbazone ligands coordinated to nickel(II) ion as ONS tridentate bibasic donor. DNA/BSA protein binding ability of the ligands and their new complexes were studied by taking calf-thymus DNA (CT-DNA) and Bovine serum albumin (BSA) through absorption and emission titrations. Ethidium bromide (EB) displacement study showed the intercalative binding trend of the complexes to DNA. From the albumin binding studies, the mechanism of quenching was found as static and the alterations in the secondary structure of BSA by the compounds were confirmed with synchronous spectral studies. The binding affinity of the complexes to CT-DNA and BSA has the order of [Ni(4-Msal-etsc)(PPh3)] (3) >[Ni(4-Msal-mtsc)(PPh3)] (2) >[Ni(4-Msal-tsc)(PPh3)] (1) >[Ni(4-Msal-ptsc)(PPh3)] (4). In vitro cytotoxicity of the complexes was tested on human lung cancer cells (A549), human cervical cancer cells (HeLa), human liver carcinoma cells (Hep G2). All the complexes exhibited significant activity against three cancer cells. Among them, complex 4 exhibited almost 2.5 fold activity than cisplatin in A549 and HepG2 cell lines. In HeLa cell line, the complexes exhibited significant activity which is less than cisplatin. While comparing the activity of the complexes in A549 and HepG2 cell lines it falls in the order 4>1>2>3>cisplatin. The results obtained from DNA, protein binding and cytotoxicity studies, it is concluded that the cytotoxicity of the complexes as determined by MTT assay were not unduly influenced by the complexes having different binding efficiency with DNA and protein. The complexes exhibited good spectrum

  15. Potential for DNA-based identification of Great Lakes fauna: Match and mismatch between taxa inventories and DNA barcode libraries

    Science.gov (United States)

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However, the abi...

  16. Direct electrochemical sensor for label-free DNA detection based on zero current potentiometry.

    Science.gov (United States)

    Wu, Nai-ying; Gao, Wei; He, Xu-lun; Chang, Zhu; Xu, Mao-tian

    2013-01-15

    A direct electrochemical DNA biosensor based on zero current potentiometry was fabricated by immobilization of ssDNA onto gold nanoparticles (AuNPs) coated pencil graphite electrode (PGE). One ssDNA/AuNPs/PGE was connected in series between clips of working and counter electrodes of a potentiostat, and then immersed into the solution together with a reference electrode, establishing a novel DNA biosensor for specific DNA detection. The variation of zero current potential difference (ΔE(zcp)) before and after hybridization of the self-assembled probe DNA with the target DNA was used as a signal to characterize and quantify the target DNA sequence. The whole DNA biosensor fabrication process was characterized by cyclic voltammetry and electrochemical impedance spectroscopy with the use of ferricyanide as an electrochemical redox indicator. Under the optimized conditions, ΔE(zcp) was linear with the concentrations of the complementary target DNA in the range from 10nM to 1μM, with a detection limit of 6.9nM. The DNA biosensor showed a good reproducibility and selectivity. Prepared DNA biosensor is facile and sensitive, and it eliminates the need of using exogenous reagents to monitor the oligonucleotides hybridization.

  17. New insights on the mechanism of quinoline-based DNA Methyltransferase inhibitors.

    Science.gov (United States)

    Gros, Christina; Fleury, Laurence; Nahoum, Virginie; Faux, Céline; Valente, Sergio; Labella, Donatella; Cantagrel, Frédéric; Rilova, Elodie; Bouhlel, Mohamed Amine; David-Cordonnier, Marie-Hélène; Dufau, Isabelle; Ausseil, Frédéric; Mai, Antonello; Mourey, Lionel; Lacroix, Laurent; Arimondo, Paola B

    2015-03-06

    Among the epigenetic marks, DNA methylation is one of the most studied. It is highly deregulated in numerous diseases, including cancer. Indeed, it has been shown that hypermethylation of tumor suppressor genes promoters is a common feature of cancer cells. Because DNA methylation is reversible, the DNA methyltransferases (DNMTs), responsible for this epigenetic mark, are considered promising therapeutic targets. Several molecules have been identified as DNMT inhibitors and, among the non-nucleoside inhibitors, 4-aminoquinoline-based inhibitors, such as SGI-1027 and its analogs, showed potent inhibitory activity. Here we characterized the in vitro mechanism of action of SGI-1027 and two analogs. Enzymatic competition studies with the DNA substrate and the methyl donor cofactor, S-adenosyl-l-methionine (AdoMet), displayed AdoMet non-competitive and DNA competitive behavior. In addition, deviations from the Michaelis-Menten model in DNA competition experiments suggested an interaction with DNA. Thus their ability to interact with DNA was established; although SGI-1027 was a weak DNA ligand, analog 5, the most potent inhibitor, strongly interacted with DNA. Finally, as 5 interacted with DNMT only when the DNA duplex was present, we hypothesize that this class of chemical compounds inhibit DNMTs by interacting with the DNA substrate.

  18. DNA Domino-Based Nanoscale Logic Circuit: A Versatile Strategy for Ultrasensitive Multiplexed Analysis of Nucleic Acids.

    Science.gov (United States)

    Ravan, Hadi; Amandadi, Mojdeh; Esmaeili-Mahani, Saeed

    2017-06-06

    In recent years, the analytical application of logical nanodevices has attracted much attention for making accurate decisions on molecular diagnosis. Herein, a DNA domino-based nanoscale logic circuit has been constructed by integrating three logic gates (AND-AND-YES) for simultaneous analysis of multiple nucleic acid biomarkers. In the first AND gate, a chimeric target DNA comprising of four biomarkers was hybridized to three biomarker-specific oligonucleotides (TRs) via their 5'-end regions and to a capture probe-magnetic microparticle. After harvesting the complex, 3' overhang regions of the TRs were labeled with three distinct monolayer double-stranded (ds) DNA-gold nanoparticles (DNA-AuNPs). Upon gleaning the complex and addition of initiator oligonucleotide, a series of toehold-mediated strand displacement reactions, which are reminiscent of a domino chain, spontaneously occurred between the confined dsDNAs on the nanoparticles' surface in the second AND gate. The output of the second gate entered into the last gate and triggered an exponential hairpin assembly to form four-way junction nanostructures. The resulting nanostructures bear split parts of DNAzyme at each end of the four arms which, in the presence of hemin, form catalytic hemin/G-quadruplex DNAzymes with peroxidase activity. The smart biosensor has exhibited a turn-on signal when all biomarkers are present in the sample. In fact, should any of the biomarkers be nonexistent, the signal remains turned-off. The biosensor can detect the biomarkers with a LOD value of 100 aM and a noticeable capability to discriminate single-nucleotide substitutions.

  19. Involvement of specialized DNA polymerases Pol II, Pol IV and DnaE2 in DNA replication in the absence of Pol I in Pseudomonas putida

    Energy Technology Data Exchange (ETDEWEB)

    Sidorenko, Julia; Jatsenko, Tatjana; Saumaa, Signe; Teras, Riho; Tark-Dame, Mariliis; Horak, Rita [Department of Genetics, Institute of Molecular and Cell Biology, Tartu University and Estonian Biocentre, 23 Riia Street, 51010 Tartu (Estonia); Kivisaar, Maia, E-mail: maiak@ebc.ee [Department of Genetics, Institute of Molecular and Cell Biology, Tartu University and Estonian Biocentre, 23 Riia Street, 51010 Tartu (Estonia)

    2011-09-01

    The majority of bacteria possess a different set of specialized DNA polymerases than those identified in the most common model organism Escherichia coli. Here, we have studied the ability of specialized DNA polymerases to substitute Pol I in DNA replication in Pseudomonas putida. Our results revealed that P. putida Pol I-deficient cells have severe growth defects in LB medium, which is accompanied by filamentous cell morphology. However, growth of Pol I-deficient bacteria on solid rich medium can be restored by reduction of reactive oxygen species in cells. Also, mutants with improved growth emerge rapidly. Similarly to the initial Pol I-deficient P. putida, its adapted derivatives express a moderate mutator phenotype, which indicates that DNA replication carried out in the absence of Pol I is erroneous both in the original Pol I-deficient bacteria and the adapted derivatives. Analysis of the spectra of spontaneous Rif{sup r} mutations in P. putida strains lacking different DNA polymerases revealed that the presence of specialized DNA polymerases Pol II and Pol IV influences the frequency of certain base substitutions in Pol I-proficient and Pol I-deficient backgrounds in opposite ways. Involvement of another specialized DNA polymerase DnaE2 in DNA replication in Pol I-deficient bacteria is stimulated by UV irradiation of bacteria, implying that DnaE2-provided translesion synthesis partially substitutes the absence of Pol I in cells containing heavily damaged DNA.

  20. Visualizing the search for radiation-damaged DNA bases in real time

    Science.gov (United States)

    Lee, Andrea J.; Wallace, Susan S.

    2016-11-01

    The Base Excision Repair (BER) pathway removes the vast majority of damages produced by ionizing radiation, including the plethora of radiation-damaged purines and pyrimidines. The first enzymes in the BER pathway are DNA glycosylases, which are responsible for finding and removing the damaged base. Although much is known about the biochemistry of DNA glycosylases, how these enzymes locate their specific damage substrates among an excess of undamaged bases has long remained a mystery. Here we describe the use of single molecule fluorescence to observe the bacterial DNA glycosylases, Nth, Fpg and Nei, scanning along undamaged and damaged DNA. We show that all three enzymes randomly diffuse on the DNA molecule and employ a wedge residue to search for and locate damage. The search behavior of the Escherichia coli DNA glycosylases likely provides a paradigm for their homologous mammalian counterparts.

  1. Novel approach for designing a thin and broadband microwave absorber in Ku band based on substituted M-hexaferrites

    Energy Technology Data Exchange (ETDEWEB)

    Afghahi, Seyyed Salman Seyyed [Department of Materials Engineering, Imam Hossein University, Tehran (Iran, Islamic Republic of); Jafarian, Mojtaba, E-mail: m.jafarian@srbiau.ac.ir [Young Researchers and Elite Club, Science and Research Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Atassi, Yomen [Department of Applied Physics, Higher Institute for Applied Sciences and Technology, Damascus (Syrian Arab Republic)

    2016-12-01

    The design of novel microwave absorbers in the Ku band is still challenging. The aim of this work is to report the design of a new Ku absorber based on the combination of three M-hexaferrites with the formula of BaX{sub 0.3}Y{sub 0.3}Cr{sub 0.3}Fe{sub 11.1}O{sub 19} (XY=Co{sup 2+}Zr{sup 4+}, Zn{sup 2+}Ti{sup 4+}, Mn{sup 2+}Ce{sup 4+}), 15 wt% of each in epoxy matrix. The results indicate the formation of a broadband absorber with a reflection loss (RL) lower than −10 dB over the whole bandwidth 13.75–18 GHz. It has three matching frequencies (14.2, 15.3 and 16.8 GHz) with RL (−29.2, −21.5 and −24.7 dB, respectively) at a matching thickness of only 2.5 mm. This is to be compared with the RL of the absorbers based on 45 wt% of each ferrite alone in epoxy matrix are (−15, −28.8 and −20 dB, respectively) at matching frequency of (14.15, 13.55 and 16.5 GHz) and a matching thickness of 4 mm. This favorable performance resulting from combining the three ferrites within the absorber may be attributed to the enhanced exchange coupling interactions between the three powders of distinct magnetic characteristics. - Highlights: • Design a novel microwave absorber in the Ku band. • Proper combination of the 3 types of substituted M-hexaferrites in one layer. • Making broad band absorber with a maximum RL of −29.2 dB at 14.2 GHz. • The sample had 4.2 GHz bandwidth at a matching thickness of only 2.5 mm.

  2. Hydrogen bonding versus stacking stabilization by modified nucleobases incorporated in PNA. DNA duplexes

    DEFF Research Database (Denmark)

    Sen, Anjana; Nielsen, Peter E

    2009-01-01

    The effects of incorporation of the modified nucleobases, 2,6-diaminopurine (D) (substituting for adenine) and 7-chloro-1,8-naphthyridin-2-(1H)-one (bicyclic thymine, bT) (substituting for thymine), that stabilize PNA.DNA duplex formation by increasing hydrogen bonding and/or base pair stacking...

  3. Effect of the substitutional groups on the electrochemistry, kinetic of thermal decomposition and kinetic of substitution of some uranyl Schiff base complexes

    Energy Technology Data Exchange (ETDEWEB)

    Asadi, Zahra; Nasrollahi, Rahele; Ranjkeshshorkaei, Mohammad; Firuzabadi, Fahimeh Dehghani [Shiraz Univ. (Iran, Islamic Republic of). Chemistry Dept.; Dusek, Michal; Fejfarova, Karla [ASCR, Prague (Czech Republic). Inst. of Physics

    2016-05-15

    Uranyl(VI) complexes, [UO{sub 2}(X-saloph)(solvent)], where saloph denotes N,N{sup '}-bis(salicylidene)-1,2-phenylenediamine and X = NO{sub 2}, Cl, Me, H; were synthesized and characterized by 61H NMR, IR, UV-Vis spectroscopy, thermal gravimetry (TG), cyclic voltammetry, elemental analysis (C.H.N) and X-ray crystallography. X-ray crystallography of [UO{sub 2}(4-nitro-saloph)(DMF)] revealed coordination of the uranyl by the tetradentate Schiff base ligand and one solvent molecule, resulting in seven-coordinated uranium. The complex of [UO{sub 2}(4-nitro-saloph)(DMF)] was also synthesized in nano form. Transmission electron microscopy image showed nano-particles with sizes between 30 and 35 nm. The TG method and analysis of Coats-Redfern plots revealed that the kinetics of thermal decomposition of the complexes is of the first-order in all stages. The kinetics and mechanism of the exchange reaction of the coordinated solvent with tributylphosphine was investigated by spectrophotometric method. The second-order rate constants at four temperatures and the activation parameters showed an associative mechanism for all corresponding complexes with the following trend: 4-Nitro > 4-Cl > H > 4-Me. It was concluded that the steric and electronic properties of the complexes were important for the reaction rate. For analysis of anticancer properties of uranyl Schiff base complexes, cell culture and MTT assay was carried out. These results showed a reduction of jurkat cell line concentration across the complexes.

  4. Microcantilver-based DNA hybridization sensors for Salmonella identification

    Directory of Open Access Journals (Sweden)

    Carlo Ricciardi

    2012-02-01

    Full Text Available The detection of pathogenic microorganisms in foods remains a challenging since the safety of foodstuffs has to be ensured by the food producing companies. Conventional methods for the detection and identification of bacteria mainly rely on specific microbiological and biochemical identification. Biomolecular methods, are commonly used as a support for traditional techniques, thanks to their high sensitivity, specificity and not excessive costs. However, new methods like biosensors for example, can be an exciting alternative to the more traditional tecniques for the detection of pathogens in food. In this study we report Salmonella enterica serotype Enteritidis DNA detection through a novel class of label-free biosensors: microcantilevers (MCs. In general, MCs can operate as a microbalance and is used to detect the mass of the entities anchored to the cantilever surface using the decrease in the resonant frequency. We use DNA hybridization as model reaction system and for this reason, specific single stranded probe DNA of the pathogen and three different DNA targets (single-stranded complementary DNA, PCR product and serial dilutions of DNA extracted from S. Enteritidis strains were applied. Two protocols were reported in order to allow the probe immobilization on cantilever surface: i MC surface was functionalized with 3-aminopropyltriethoxysilane and glutaraldehyde and an amino-modified DNA probe was used; ii gold-coated sensors and thiolated DNA probes were used in order to generate a covalent bonding (Th-Au. For the first one, measures after hybridization with the PCR product showed related frequency shift 10 times higher than hybridization with complementary probe and detectable signals were obtained at the concentrations of 103 and 106 cfu/mL after hybridization with bacterial DNA. There are currently optimizations of the second protocol, where preliminary results have shown to be more uniform and therefore more precise within each of the

  5. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de;

    2006-01-01

    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...

  6. Ultratrace DNA Detection Based on the Condensing-Enrichment Effect of Superwettable Microchips.

    Science.gov (United States)

    Xu, Li-Ping; Chen, Yanxia; Yang, Gao; Shi, Wanxin; Dai, Bing; Li, Guannan; Cao, Yanhua; Wen, Yongqiang; Zhang, Xueji; Wang, Shutao

    2015-11-18

    A sensitive nucleic acid detection platform based on superhydrophilic microwells spotted on a superhydrophobic substrate is fabricated. Due to the wettability differences, ultratrace DNA molecules are enriched and the fluorescent signals are amplified to allow more sensitive detection. The biosensing interface based on superwettable materials provides a simple and cost-effective way for ultratrace DNA sensing.

  7. Instance-based concept learning from multiclass DNA microarray data

    Directory of Open Access Journals (Sweden)

    Dubitzky Werner

    2006-02-01

    Full Text Available Abstract Background Various statistical and machine learning methods have been successfully applied to the classification of DNA microarray data. Simple instance-based classifiers such as nearest neighbor (NN approaches perform remarkably well in comparison to more complex models, and are currently experiencing a renaissance in the analysis of data sets from biology and biotechnology. While binary classification of microarray data has been extensively investigated, studies involving multiclass data are rare. The question remains open whether there exists a significant difference in performance between NN approaches and more complex multiclass methods. Comparative studies in this field commonly assess different models based on their classification accuracy only; however, this approach lacks the rigor needed to draw reliable conclusions and is inadequate for testing the null hypothesis of equal performance. Comparing novel classification models to existing approaches requires focusing on the significance of differences in performance. Results We investigated the performance of instance-based classifiers, including a NN classifier able to assign a degree of class membership to each sample. This model alleviates a major problem of conventional instance-based learners, namely the lack of confidence values for predictions. The model translates the distances to the nearest neighbors into 'confidence scores'; the higher the confidence score, the closer is the considered instance to a pre-defined class. We applied the models to three real gene expression data sets and compared them with state-of-the-art methods for classifying microarray data of multiple classes, assessing performance using a statistical significance test that took into account the data resampling strategy. Simple NN classifiers performed as well as, or significantly better than, their more intricate competitors. Conclusion Given its highly intuitive underlying principles – simplicity

  8. DNA-based materials and their device applications (Conference Presentation)

    Science.gov (United States)

    Rau, Ileana; Kajzar, François; Grote, James G.

    2016-10-01

    In the last decade a lot of interest was paid to DNA materials in view of their practical applications in photonics and in electronics. This aspect is especially due to the fact that this polymer is eco-friendly, originating from renewable resources and can be obtained from any animal or vegetable waste. In this respect many studies have shown that DNA is an intriguing biopolymer which can find applications in many fields. In this paper we will review and discuss the functionalization of DNA and some practical applications.

  9. Solid phase based DNA solution of the coloring problem

    Institute of Scientific and Technical Information of China (English)

    PAN Linqiang; LIU Guangwu; XU Jin; LIU Yachun

    2004-01-01

    DNA computing has the potential to tackle computationally difficult problems that have real-world implications.The parallel search capabilities of DNA make it a valuable tool for approaching intractable computational problems,for which conventional computers have limited potentials.Up to now,many accomplishments have been achieved to improve its performance and increase its reliability.In this paper,the coloring problem has been solved by means of molecular biology techniques.The coloring problem is a well-known NP-complete problem.This work represents further evidence for the ability of DNA computing to solve NP-complete problems.

  10. DNA gridiron nanostructures based on four-arm junctions.

    Science.gov (United States)

    Han, Dongran; Pal, Suchetan; Yang, Yang; Jiang, Shuoxing; Nangreave, Jeanette; Liu, Yan; Yan, Hao

    2013-03-22

    Engineering wireframe architectures and scaffolds of increasing complexity is one of the important challenges in nanotechnology. We present a design strategy to create gridiron-like DNA structures. A series of four-arm junctions are used as vertices within a network of double-helical DNA fragments. Deliberate distortion of the junctions from their most relaxed conformations ensures that a scaffold strand can traverse through individual vertices in multiple directions. DNA gridirons were assembled, ranging from two-dimensional arrays with reconfigurability to multilayer and three-dimensional structures and curved objects.

  11. Anodized aluminum oxide-based capacitance sensors for the direct detection of DNA hybridization.

    Science.gov (United States)

    Kang, Bongkeun; Yeo, Unjin; Yoo, Kyung-Hwa

    2010-03-15

    We fabricated a capacitance sensor based on an anodized aluminum oxide (AAO) nanoporous structure to detect DNA hybridization. We utilized Au film deposited on the surface of the AAO membrane and Au nanowires infiltrating the nanopores as the top and bottom electrodes, respectively. When completely complementary target DNA molecules were added to the sensor-immobilized DNA molecule probes, the capacitance was reduced; with a concentration of 1pM, the capacitance decreased by approximately 10%. We measured the capacitance change for different concentrations of the target DNA solution. A linear relationship was found between the capacitance change and DNA concentration on a semi-logarithmic scale. We also investigated the possibility of detecting DNA molecules with a single-base mismatch to the probe DNA molecule. In contrast to complementary target DNA molecules, the addition of one-base mismatch DNA molecules caused no significant change in capacitance, demonstrating that DNA hybridization was detected with single nucleotide polymorphism sensitivity. (c) 2009 Elsevier B.V. All rights reserved.

  12. An electrochemical DNA biosensor based on Oracet Blue as a label for detection of Helicobacter pylori.

    Science.gov (United States)

    Hajihosseini, Saeedeh; Nasirizadeh, Navid; Hejazi, Mohammad Saeid; Yaghmaei, Parichereh

    2016-10-01

    An innovative method of a DNA electrochemical biosensor based on Oracet Blue (OB) as an electroactive label and gold electrode (AuE) for detection of Helicobacter pylori, was offered. A single-stranded DNA probe with a thiol modification was covalently immobilized on the surface of the AuE by forming an Au-S bond. Differential pulse voltammetry (DPV) was used to monitor DNA hybridization by measuring the electrochemical signals of reduction of the OB binding to double-stranded DNA (ds-DNA). Our results showed that OB-based DNA biosensor has a decent potential for detection of single-base mismatch in target DNA. Selectivity of the proposed DNA biosensor was further confirmed in the presence of non-complementary and complementary DNA strands. Under optimum conditions, the electrochemical signal had a linear relationship with the concentration of the target DNA ranging from 0.3nmolL(-1) to 240.0nmolL(-1), and the detection limit was 0.17nmolL(-1), whit a promising reproducibility and repeatability.

  13. Substitute potting compound for Sylgard 93-119 based on Sylgard 184 and Q3-6527 dielectric gel

    Energy Technology Data Exchange (ETDEWEB)

    Flowers, G.L.; Switzer, S.T.

    1978-06-01

    Development of a substitute potting compound developed by Pantex to replace the no longer available Dow Corning 93-119 is described. The specific approach taken in this development utilized Dow Corning Sylgard 184 as the basic starting material, altering its viscosity with Dow Corning Dielectric Gel Q3-6527 and then modifying the cure rate with Dow Corning Accelerator Q3-6559. Various tests were run to characterize both chemical and physical properties of the substitutes as well as the initial 93-119 and the starting raw materials. Summaries of the data peculiar to this substitute are presented here whereas a more detailed examination of the test methods and results for the overall project are presented in another report. The properties of two substitutes developed from the two extremes of viscosity to be expected for Sylgard 184 during production are presented. These substitutes are easily quick-frozen in the catalyzed state for production use upon thawing. They are however somewhat more difficult to deaerate and eventually cure to a harder state than the original DC 93-119.

  14. Ultrasensitive cDNA detection of dengue virus RNA using electrochemical nanoporous membrane-based biosensor.

    Directory of Open Access Journals (Sweden)

    Varun Rai

    Full Text Available A nanoporous alumina membrane-based ultrasensitive DNA biosensor is constructed using 5'-aminated DNA probes immobilized onto the alumina channel walls. Alumina nanoporous membrane-like structure is carved over platinum wire electrode of 76 µm diameter dimension by electrochemical anodization. The hybridization of complementary target DNA with probe DNA molecules attached inside the pores influences the pore size and ionic conductivity. The biosensor demonstrates linear range over 6 order of magnitude with ultrasensitive detection limit of 9.55×10(-12 M for the quantification of ss-31 mer DNA sequence. Its applicability is challenged against real time cDNA PCR sample of dengue virus serotype1 derived from asymmetric PCR. Excellent specificity down to one nucleotide mismatch in target DNA sample of DENV3 is also demonstrated.

  15. Silica-Based Solid Phase Extraction of DNA on a Microchip

    Institute of Scientific and Technical Information of China (English)

    陈晓芳; 沈科跃; 刘鹏; 郭旻; 程京; 周玉祥

    2004-01-01

    Micro total analysis systems for chemical and biological analysis have attracted much attention.However,microchips for sample preparation and especially DNA purification are still underdeveloped.This work describes a solid phase extraction chip for purifying DNA from biological samples based on the adsorption of DNA on bare silica beads prepacked in a microchannel.The chip was fabricated with poly-dimethylsiloxane.The silica beads were packed in the channel on the chip with a tapered microchannel to form the packed bed.Fluorescence detection was used to evaluate the DNA adsorbing efficiency of the solid phase.The polymerase chain reaction was used to evaluate the quality of the purified DNA for further use.The extraction efficiency for the DNA extraction chip is approximately 50% with a 150-nL extraction volume.Successful amplification of DNA extracted from human whole blood indicates that this method is compatible with the polymerase chain reaction.

  16. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    DEFF Research Database (Denmark)

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong

    2011-01-01

    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...... in the presence of different buffers was well investigated, and thus, the optimized salt concentration allowed for discrimination of single-mismatched DNA (MMT) from perfectly matched DNA (PMT). Therefore, quantitative information concerning the target analyte was translated into a colorimetric signal, which...

  17. DNA-Based Photonic Bandgap Structures and Devices

    Science.gov (United States)

    2009-11-29

    Genes to Machines: DNA Nanomechanical Devices, Trends in Biochemical Sciences 30, 119-125 (2005). 4. N.C. Seeman. Structural DNA Nanotechnology: An... kpc ≥ ω , k becomes purely real.. If the dispersion relation just given is written as =++ 22)( kpkak 1ε 2)( c ω , it resembles that for modes in a...waveguide. By analogy, the frequency region for which 1ε 22)( kpc < ω will be referred to as cutoff. IV. APPLICATIONS The presence of molecules

  18. A Novel DNA-Based Vaccine Methodology for Aids

    Science.gov (United States)

    1998-11-01

    delivery of DNA to the tongue suggests the tongue may be an inductive site for mucosal immunity . 18 To evaluate the immune effects of IL-6, we delivered DNA...indicate the enhanced protection seen with IL-6 and tongue delivery is not due to induction of localized mucosal immunity . These results further suggest...that the tongue is not an inductive site for mucosal immunity . However, these results do not account for potential differences between the mouse and

  19. Structure-based analysis of HU-DNA binding.

    Science.gov (United States)

    Swinger, Kerren K; Rice, Phoebe A

    2007-01-26

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently published Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from approximately 10-14.5 kcal/mol, representing K(d) values in the nanomolar to low picomolar range, and a maximum stabilization of at least approximately 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.

  20. Structure-based Analysis to Hu-DNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently published Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.

  1. Nano-Bio Electronic Devices Based on DNA Bases and Proteins

    Science.gov (United States)

    Rinaldi, R.; Maruccio, G.; Bramanti, A.; Visconti, P.; Biasco, A.; Arima, V.; D'Amico, S.; Cingolani, R.

    A key challenge of the current research in nanoelectronics is the realization of biomolecular devices. The biomolecules have specific functionalies that can be exploited for the implementation of electronic and optoelectronic devices. Different nanotechnological strategies have been pursued to implement the biomolecular devices, following a bottom-up or a topdown approach depending on the used biomolecule and on its functionality. In this paper we present our results on the implementation of nano-biomolecular devices based on modified DNA nucleosides and metalloproteins.

  2. DNA origami-based standards for quantitative fluorescence microscopy.

    Science.gov (United States)

    Schmied, Jürgen J; Raab, Mario; Forthmann, Carsten; Pibiri, Enrico; Wünsch, Bettina; Dammeyer, Thorben; Tinnefeld, Philip

    2014-01-01

    Validating and testing a fluorescence microscope or a microscopy method requires defined samples that can be used as standards. DNA origami is a new tool that provides a framework to place defined numbers of small molecules such as fluorescent dyes or proteins in a programmed geometry with nanometer precision. The flexibility and versatility in the design of DNA origami microscopy standards makes them ideally suited for the broad variety of emerging super-resolution microscopy methods. As DNA origami structures are durable and portable, they can become a universally available specimen to check the everyday functionality of a microscope. The standards are immobilized on a glass slide, and they can be imaged without further preparation and can be stored for up to 6 months. We describe a detailed protocol for the design, production and use of DNA origami microscopy standards, and we introduce a DNA origami rectangle, bundles and a nanopillar as fluorescent nanoscopic rulers. The protocol provides procedures for the design and realization of fluorescent marks on DNA origami structures, their production and purification, quality control, handling, immobilization, measurement and data analysis. The procedure can be completed in 1-2 d.

  3. Flavor-enhancing properties of mushrooms in meat-based dishes in which sodium has been reduced and meat has been partially substituted with mushrooms.

    Science.gov (United States)

    Myrdal Miller, A; Mills, K; Wong, T; Drescher, G; Lee, S M; Sirimuangmoon, C; Schaefer, S; Langstaff, S; Minor, B; Guinard, J-X

    2014-09-01

    The effects of beef substitution with crimini or white mushrooms (Agaricus bisporus) on the flavor profiles of carne asada and beef taco blends were measured with a descriptive analysis panel. Sensory mitigation of sodium reduction through the incorporation of mushrooms was also investigated in the taco blends. The substitution of beef with mushrooms in the carne asada did not alter the overall flavor strength of the dish, but the incorporation of 50% or 80% ground mushroom in the beef taco blend did enhance its overall flavor as well as mushroom, veggie, onion, garlic and earthy flavors, and umami and sweet tastes. Overall flavor intensity of the 25% reduced-salt version of the 80% mushroom taco blend matched that of the full-salt versions of the 100% and 50% beef formulations, thus indicating that the substitution of 80% of the meat with mushrooms did mitigate the 25% sodium reduction in terms of the overall flavor impact of the dish, even if it did not quite compensate for the reduction in salty taste. This proof-of-concept study for the Healthy Flavors Research Initiative indicates that because of their flavor-enhancing umami principles, mushrooms can be used as a healthy substitute for meat and a mitigating agent for sodium reduction in meat-based dishes without loss of overall flavor. © 2014 Institute of Food Technologists®

  4. Effect of stoichiometry and Cu-substitution on the phase structure and hydrogen storage properties of Ml-Mg-Ni-based alloys

    Institute of Scientific and Technical Information of China (English)

    Yuan Li; Yang Tao; Quan Huo

    2015-01-01

    To improve the electrochemical properties of rare-earth–Mg–Ni-based hydrogen storage alloys, the effects of stoichiometry and Cu-substitution on the phase structure and thermodynamic properties of the alloys were studied. Nonsubstituted Ml0.80Mg0.20(Ni2.90Co0.50-Mn0.30Al0.30)x (x=0.68, 0.70, 0.72, 0.74, 0.76) alloys and Cu-substituted Ml0.80Mg0.20(Ni2.90Co0.50–yCuyMn0.30Al0.30)0.70 (y=0, 0.10, 0.30, 0.50) alloys were prepared by induction melting. Phase structure analysis shows that the nonsubstituted alloys consist of a LaNi5 phase, a LaNi3 phase, and a minor La2Ni7 phase;in addition, in the case of Cu-substitution, the Nd2Ni7 phase appears and the LaNi3 phase vanishes. Ther-modynamic tests show that the enthalpy change in the dehydriding process decreases, indicating that hydride stability decreases with in-creasing stoichiometry and increasing Cu content. The maximum discharge capacity, kinetic properties, and cycling stability of the alloy electrodes all increase and then decrease with increasing stoichiometry or increasing Cu content. Furthermore, Cu substitution for Co ame-liorates the discharge capacity, kinetics, and cycling stability of the alloy electrodes.

  5. Bio-nanoplatforms based on carbon dots conjugating with F-substituted nano-hydroxyapatite for cellular imaging

    Science.gov (United States)

    Zhao, Yafei; Shi, Liyi; Fang, Jianhui; Feng, Xin

    2015-11-01

    Carbon dots (CDs) have shown great promise in a wide range of bioapplications due to their tunable optical properties and noncytotoxicity. For the first time, a rational strategy was designed to construct new bio-nanoplatforms based on carboxylic acid terminated CDs (CDs-COOH) conjugating with amino terminated F-substituted nano-hydroxyapatite (NFAp) via EDC/NHS coupling chemistry. The monodisperse NFAp nanorods were functionalized with o-phosphoethanolamine (PEA) to provide them with amino groups and render them hydrophilic with respect to the ligand exchange process. The CDs-COOH@PEA-NFAp conjugates exhibits bright blue fluorescence under UV illumination, excellent photostability and colloidal stability. Due to their low cytotoxicity and good biocompatibility as determined by methyl thiazolyl tetrazolium (MTT) assay, the CDs-COOH@PEA-NFAp conjugates were successfully applied as bio-nanoplatforms to MCF-7 breast cancer cells for cellular imaging in vitro. More importantly, the functional CDs conjugated to NFAp provide an extended and general approach to construct different water-soluble NFAp bio-nanoplatforms for other easily functionalised luminescent materials. Therefore, these green nanoplatforms may be a prospective candidate for applications in bioimaging or targeted biological therapy and drug delivery.Carbon dots (CDs) have shown great promise in a wide range of bioapplications due to their tunable optical properties and noncytotoxicity. For the first time, a rational strategy was designed to construct new bio-nanoplatforms based on carboxylic acid terminated CDs (CDs-COOH) conjugating with amino terminated F-substituted nano-hydroxyapatite (NFAp) via EDC/NHS coupling chemistry. The monodisperse NFAp nanorods were functionalized with o-phosphoethanolamine (PEA) to provide them with amino groups and render them hydrophilic with respect to the ligand exchange process. The CDs-COOH@PEA-NFAp conjugates exhibits bright blue fluorescence under UV illumination

  6. Simple, heart-smart substitutions

    Science.gov (United States)

    Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...

  7. Cellular models for mitochondrial DNA-based diseases: lymphoblastoid cell lines and transmitochondrial cybrids.

    Science.gov (United States)

    Jiji, Sun; Xiaoxu, Zhao; Lihua, Qiao; Shuang, Mei; Zhipeng, Nie; Qinghai, Zhang; Yanchun, Ji; Pingping, Jiang; Min-Xin, Guan

    2016-07-20

    Mitochondrial DNA (mtDNA) mutations cause a variety of mitochondrial DNA-based diseases which have been studied using Lymphoblastoid cell lines (LCLs) and transmitochondrial cybrids. Individual genetic information is preserved permanently in LCLs while the development of transmitochondrial cybrids provide ex-vivo cellular platform to study molecular mechanism of mitochondrial DNA-based diseases. The cytoplasmic donor cells for previous transmitochondrial cybrids come from patient's tissue or platelet directly. Here, we depicted in details the principle, methods and techniques to establish LCLs from frozen peripheral bloods harboring mitochondrial 4401G > A mutation by infection of Epstein Barr virus, and then to generate cybrids using ρ(0) 206 and LCLs. The process of establishing these two cellular models was summarized into four steps as follows: (1) Generation of LCLs; (2) Transformation; (3) Selection; (4) Verification. To faithfully represent the function of mtDNA mutation, we analyzed and identified the sites of mtDNA mutations and copy numbers of each cellular models as well as the karyotype of transmitochondrial cybrids. Those clones with consistent parameters were selected for preservation and future analysis of the function of point mutations of mtDNA. Although these two cellular models play important roles in understanding molecular mechanism of mitochondrial DNA-based diseases on the cellular level, their limitations should be considered when elucidating the character of tissue specificity of mitochondrial DNA-based diseases.

  8. Sequence-specific DNA interactions with calixarene-based langmuir monolayers.

    Science.gov (United States)

    Rullaud, Vanessa; Moridi, Negar; Shahgaldian, Patrick

    2014-07-29

    The interactions of an amphiphilic calixarene, namely p-guanidino-dodecyloxy-calix[4]arene, 1, self-assembled as Langmuir monolayers, with short double stranded DNA, were investigated by surface pressure-area (π-A) isotherms, surface ellipsometry and Brewster angle microscopy (BAM). Three DNA 30mers were used as models, poly(AT), poly(GC) and a random DNA sequence with 50% of G:C base pairs. The interactions of these model DNA duplexes with 1-based Langmuir monolayers were studied by measuring compression isotherms using increasing DNA concentrations (10(-6), 10(-5), 10(-4), and 5 × 10(-4) g L(-1)) in the aqueous subphase. The isotherms of 1 showed an expansion of the monolayer with, interestingly, significant differences depending on the duplex DNA sequence studied. Indeed, the interactions of 1-based monolayers with poly(AT) led to an expansion of the monolayer that was significantly more pronounced that for monolayers on subphases of poly(GC) and the random DNA sequence. The structure and thickness of 1-based Langmuir monolayers were investigated by BAM and surface ellipsometry that showed differences in thickness and structure between a monolayer formed on pure water or on a DNA subphase, with here again relevant dissimilarities depending on the DNA composition.

  9. A review of blood substitutes: examining the history, clinical trial results, and ethics of hemoglobin-based oxygen carriers

    Directory of Open Access Journals (Sweden)

    Jiin-Yu Chen

    2009-01-01

    Full Text Available The complications associated with acquiring and storing whole blood for transfusions have launched substantial efforts to develop a blood substitute. The history of these efforts involves a complicated mixture of science, ethics, and business. This review focuses on clinical trials of the three hemoglobin-based oxygen carriers (HBOC that have progressed to Phase II or III clinical trials: HemAssist (Baxter; Deerfield, IL, US, PolyHeme (Northfield; Evanston, IL, US, and Hemopure (Biopure; Cambridge, MA, US. Published animal studies and clinical trials carried out in a perioperative setting have demonstrated that these products successfully transport and deliver oxygen, but all may induce hypertension and lead to unexpectedly low cardiac outputs. Overall, these studies suggest that HBOCs resulted in only modest blood saving during and after surgery, no improvement in mortality and an increased incidence of adverse reactions. To date, the results from these perioperative studies have not led to regulatory approval. All three companies instead chose to focus their efforts on large trials of trauma patients in the pre-hospital setting. Baxter abandoned the development of HemAssist after a trial in the U.S. was prematurely halted when the first 100 patients showed significantly increased mortality rates as compared to patients treated with blood products. Northfield's PolyHeme trial demonstrated a non-significant trend towards increased mortality and a very modest reduction in the subsequent need for blood. The testing of Biopure's Hemopure for trauma patients has been halted for several years because of FDA concerns over trial design and study justification. Ethical concerns have also been raised regarding the design and implementation of all HBOC clinical trials. Thus, the available evidence suggests that HemAssist, Polyheme, and Hemopure are associated with a significant level of cardiovascular dysfunction. The next generation of HBOCs remains

  10. Combination multinitrogen with good oxygen balance: molecule and synthesis design of polynitro-substituted tetrazolotriazine-based energetic compounds.

    Science.gov (United States)

    He, Piao; Zhang, Jian-Guo; Wang, Kun; Yin, Xin; Zhang, Tong-Lai

    2015-06-01

    We investigated 5,8-dinitro-5,6,7,8-tetrahydrotetrazolo[1,5-b][1,2,4]triazine (short for DNTzTr (1)) using various ab initio quantum chemistry methods. We proposed an additional three novel polynitro-substituted tetrazolotriazine-based compounds with exceptional performance, including 5,8-dinitro-5,6-dioxotetrazolo[1,5-b][1,2,4]triazine, DNOTzTr (2), 4,5,9,10-tetranitro[1,2,4,5]tetrazolo[3,4-b][1,2,4,5]tetrazolo[3',4':5,6]triazino[2,3-e]triazine, TNTzTr (3), and 4,5,6,10,11,12-hexanitro-bis[1,2,4,5]tetrazolo[3',4':5,6]triazino[2,3-b:2',3'-e]triazine, HNBTzTr (4). The optimized structure, electronic density, natural bond orbital (NBO) charges and HOMO-LUMO orbitals, electrostatic potential on surface of molecule, IR- and NMR-predicted spectra, as well as thermochemical parameters were calculated with the B3LYP/6-311+G(2d) level of theory. Critical parameters such as density, enthalpy of formation (EOF), and detonation performance have also been predicted. Characters with positive EOF (1386.00 and 1625.31 kJ/mol), high density (over 2.00 g/cm(3)), outstanding detonation properties (D = 9.82 km/s, P = 45.45 GPa; D = 9.94 km/s, P = 47.30 GPa), the perfect oxygen balance set to zero, and acceptable impact sensitivity led novel compounds 3 and 4 to be very promising energetic materials. This work provides the theoretical molecule design and a reasonable synthesis path for further experimental synthesis and testing.

  11. Linearly programmed DNA-based molecular computer operated on magnetic particle surface in test-tube

    Institute of Scientific and Technical Information of China (English)

    ZHAO Jian; ZHANG Zhizhou; SHI Yongyong; Li Xiuxia; HE Lin

    2004-01-01

    The postgenomic era has seen an emergence of new applications of DNA manipulation technologies, including DNA-based molecular computing. Surface DNA computing has already been reported in a number of studies that, however, all employ different mechanisms other than automaton functions. Here we describe a programmable DNA surface-computing device as a Turing machine-like finite automaton. The laboratory automaton is primarily composed of DNA (inputs, output-detectors, transition molecules as software), DNA manipulating enzymes and buffer system that solve artificial computational problems autonomously. When fluoresceins were labeled in the 5′ end of (-) strand of the input molecule, direct observation of all reaction intermediates along the time scale was made so that the dynamic process of DNA computing could be conveniently visualized. The features of this study are: (i) achievement of finite automaton functions by linearly programmed DNA computer operated on magnetic particle surface and (ii) direct detection of all DNA computing intermediates by capillary electrophoresis. Since DNA computing has the massive parallelism and feasibility for automation, this achievement sets a basis for large-scale implications of DNA computing for functional genomics in the near future.

  12. A superstructure-based electrochemical assay for signal-amplified detection of DNA methyltransferase activity.

    Science.gov (United States)

    Zhang, Hui; Yang, Yin; Dong, Huilei; Cai, Chenxin

    2016-12-15

    DNA methyltransferase (MTase) activity is highly correlated with the occurrence and development of cancer. This work reports a superstructure-based electrochemical assay for signal-amplified detection of DNA MTase activity using M.SssI as an example. First, low-density coverage of DNA duplexes on the surface of the gold electrode was achieved by immobilized mercaptohexanol, followed by immobilization of DNA duplexes. The duplex can be cleaved by BstUI endonuclease in the absence of DNA superstructures. However, the cleavage is blocked after the DNA is methylated by M.SssI. The DNA superstructures are formed with the addition of helper DNA. By using an electroactive complex, RuHex, which can bind to DNA double strands, the activity of M.SssI can be quantitatively detected by differential pulse voltammetry. Due to the high site-specific cleavage by BstUI and signal amplification by the DNA superstructure, the biosensor can achieve ultrasensitive detection of DNA MTase activity down to 0.025U/mL. The method can be used for evaluation and screening of the inhibitors of MTase, and thus has potential in the discovery of methylation-related anticancer drugs.

  13. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    Science.gov (United States)

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA.

  14. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    Science.gov (United States)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  15. The new base excision repair pathway in mammals mediated by tyrosyl-DNA-phosphodiesterase 1

    Directory of Open Access Journals (Sweden)

    Lavrik O. I.

    2012-06-01

    Full Text Available Human tyrosyl-DNA phosphodiesterase 1 (Tdp1 hydrolyzes the phosphodiester bond at a DNA 3' end linked to a tyrosyl moiety and has been implicated in the repair of Topoisomerase I (TopI-DNA covalent complexes. Tdp1 can also hydrolyze other 3' end DNA alterations including 3' phosphoglycolate and 3' abasic (AP sites, and exhibits the 3' nucleosidase activity indicating that it may function as a general 3' end-processing DNA repair enzyme. Recently we have shown a new Tdp1 activity generating DNA strand break with the 3' phosphate termini from the AP site. AP sites are formed spontaneously and are inevitable intermediates during base excision repair of DNA base damages. AP sites are both mutagenic and cytotoxic, and key enzymes for their removal are AP endonucleases. However, AP endonuclease independent repair, initiated by DNA glycosylases performing beta, delta-elimination cleavage of the AP sites, has been described in mammalian cells. Here, we describe another AP endonuclease independent repair pathway for removal of AP sites that is initiated by tyrosyl phosphodiesterase Tdp1. We propose that repair is completed by the action of a polynucleotide kinase, a DNA polymerase and finally a DNA ligase to seal the gap.

  16. Luminescent Iridium(III) Complex Labeled DNA for Graphene Oxide-Based Biosensors.

    Science.gov (United States)

    Zhao, Qingcheng; Zhou, Yuyang; Li, Yingying; Gu, Wei; Zhang, Qi; Liu, Jian

    2016-02-02

    There has been growing interest in utilizing highly photostable iridium(III) complexes as new luminescent probes for biotechnology and life science. Herein, iridium(III) complex with carboxyl group was synthesized and activated with N-hydroxysuccinimide, followed by tagging to the amino terminate of single-stranded DNA (ssDNA). The Ir-ssDNA probe was further combined with graphene oxide (GO) nanosheets to develop a GO-based biosensor for target ssDNA detection. The quenching efficiency of GO, and the photostability of iridium(III) complex and GO-Ir-ssDNA biosensor, were also investigated. On the basis of the high luminescence quenching efficiency of GO toward iridium(III) complex, the GO-Ir-ssDNA biosensor exhibited minimal background signals, while strong emission was observed when Ir-ssDNA desorbed from GO nanosheets and formed a double helix with the specific target, leading to a high signal-to-background ratio. Moreover, it was found that luminescent intensities of iridium(III) complex and GO-Ir-ssDNA biosensor were around 15 and 3 times higher than those of the traditional carboxyl fluorescein (FAM) dye and the GO-FAM-ssDNA biosensor after UV irradiation, respectively. Our study suggested the sensitive and selective Ir-ssDNA probe was suitable for the development of highly photostable GO-based detection platforms, showing promise for application beyond the OLED (organic light emitting diode) area.

  17. CUPRAC colorimetric and electroanalytical methods determining antioxidant activity based on prevention of oxidative DNA damage.

    Science.gov (United States)

    Uzunboy, Seda; Çekiç, Sema Demirci; Eksin, Ece; Erdem, Arzum; Apak, Reşat

    2017-02-01

    An unbalanced excess of oxygen/nitrogen species (ROS/RNS) can give oxidative hazard to DNA and other biomacromolecules under oxidative stress conditions. While the 'comet' assay for measuring DNA damage is neither specific nor practical, monitoring oxidative changes on individual DNA bases and other oxidation products needs highly specialized equipment and operators. Thus, we developed a modified CUPRAC (cupric ion reducing antioxidant capacity) colorimetric method to determine the average total damage on DNA produced by Fenton oxidation, taking advantage of the fact that the degradation products of DNA but not the original macromolecule is CUPRAC-responsive. The DNA-protective effects of water-soluble antioxidants were used to devise a novel antioxidant activity assay, considered to be physiologically more realistic than those using artificial probes. Our method, based on the measurement of DNA oxidative products with CUPRAC colorimetry proved to be 2 orders-of-magnitude more sensitive than the widely used TBARS (thiobarbituric acid-reactive substances) colorimetric assay used as reference. Additionally, the DNA damage was electrochemically investigated using pencil graphite electrodes (PGEs) as DNA sensor platform in combination with differential pulse voltammetry (DPV). The interaction of the radical species with DNA in the absence/presence of antioxidants was detected according to the changes in guanine oxidation signal.

  18. DNA quantification based on FRET realized by combination with surfactant CPB.

    Science.gov (United States)

    Liu, Chunxia; Wang, Lei; Jiang, Wei

    2010-04-15

    In this work, we developed a novel DNA quantitative analysis based on fluorescence resonance energy transfer (FRET) realized by combination with a surfactant CPB. The approach was capable of detecting long-stranded DNA in a separation-free format. A sandwich-type FAM-c-DNA-t-DNA-r-DNA-TAMRA conjugate was first formed by the capture probe tagged with FAM, the reporter probe tagged with TAMRA and the target DNA through hybridization. The donor (FAM) and the acceptor (TAMRA) were bridged to afford a FRET system. Subsequently, an addition of the cationic surfactant CPB to the system resulted in a substantial change of the microenvironment and an effective condensation of DNA strands. Consequently, without altering the component of the double strands, an enhanced acceptor fluorescence signal from FRET was achieved and a quantification of the target DNA containing 30 bases was enabled. Under the optimal experimental conditions, an excellent linear relationship between the increase of acceptor fluorescent peak area and the target DNA concentration was obtained over the range from 1.0 x 10(-7) to 3.0 x 10(-9) mol L(-1). The proposed approach offered adequate sensitivity for the detection of the target DNA at 1.0 x 10(-9) mol L(-1).

  19. Predicting DNA-binding sites of proteins based on sequential and 3D structural information.

    Science.gov (United States)

    Li, Bi-Qing; Feng, Kai-Yan; Ding, Juan; Cai, Yu-Dong

    2014-06-01

    Protein-DNA interactions play important roles in many biological processes. To understand the molecular mechanisms of protein-DNA interaction, it is necessary to identify the DNA-binding sites in DNA-binding proteins. In the last decade, computational approaches have been developed to predict protein-DNA-binding sites based solely on protein sequences. In this study, we developed a novel predictor based on support vector machine algorithm coupled with the maximum relevance minimum redundancy method followed by incremental feature selection. We incorporated not only features of physicochemical/biochemical properties, sequence conservation, residual disorder, secondary structure, solvent accessibility, but also five three-dimensional (3D) structural features calculated from PDB data to predict the protein-DNA interaction sites. Feature analysis showed that 3D structural features indeed contributed to the prediction of DNA-binding site and it was demonstrated that the prediction performance was better with 3D structural features than without them. It was also shown via analysis of features from each site that the features of DNA-binding site itself contribute the most to the prediction. Our prediction method may become a useful tool for identifying the DNA-binding sites and the feature analysis described in this paper may provide useful insights for in-depth investigations into the mechanisms of protein-DNA interaction.

  20. Transgenerational inheritance: Models and mechanisms of non-DNA sequence-based inheritance.

    Science.gov (United States)

    Miska, Eric A; Ferguson-Smith, Anne C

    2016-10-07

    Heritability has traditionally been thought to be a characteristic feature of the genetic material of an organism-notably, its DNA. However, it is now clear that inheritance not based on DNA sequence exists in multiple organisms, with examples found in microbes, plants, and invertebrate and vertebrate animals. In mammals, the molecular mechanisms have been challenging to elucidate, in part due to difficulties in designing robust models and approaches. Here we review some of the evidence, concepts, and potential mechanisms of non-DNA sequence-based transgenerational inheritance. We highlight model systems and discuss whether phenotypes are replicated or reconstructed over successive generations, as well as whether mechanisms operate at transcriptional and/or posttranscriptional levels. Finally, we explore the short- and long-term implications of non-DNA sequence-based inheritance. Understanding the effects of non-DNA sequence-based mechanisms is key to a full appreciation of heritability in health and disease.

  1. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  2. Sample processing for DNA chip array-based analysis of enterohemorrhagic Escherichia coli (EHEC)

    OpenAIRE

    Enfors Sven-Olof; Wegrzyn Grzegorz; Basselet Pascal; Gabig-Ciminska Magdalena

    2008-01-01

    Abstract Background Exploitation of DNA-based analyses of microbial pathogens, and especially simultaneous typing of several virulence-related genes in bacteria is becoming an important objective of public health these days. Results A procedure for sample processing for a confirmative analysis of enterohemorrhagic Escherichia coli (EHEC) on a single colony with DNA chip array was developed and is reported here. The protocol includes application of fragmented genomic DNA from ultrasonicated co...

  3. Sealing ability of a new calcium silicate based material as a dentin substitute in class II sandwich restorations: An in vitro study

    Directory of Open Access Journals (Sweden)

    Raji Viola Solomon

    2014-01-01

    Full Text Available Background: Class ll sandwich restorations are routinely performed where conventional Glass ionomer cement (GIC or Resin-modified GIC (RMGIC is used as a base or dentin substitute and a light curing composite resin restorative material is used as an enamel substitute. Various authors have evaluated the microleakage of composite resin restorations where glass ionomer cement has been used as a base in class II sandwich restorations, but a literature survey reveals limited studies on the microleakage analysis of similar restorations with biodentine as a dentin substitute, as an alternative to glass ionomer cement. The aim of this study is: To evaluate the marginal sealing efficacy of a new calcium-silicate-based material (Biodentine as a dentin substitute, at the cervical margins, in posterior class II sandwich restorations.To compare and evaluate the microleakage at the biodentine/composite interface with the microleakage at the resin-modified GIC/composite interface, in posterior class II open sandwich restorations. To compare the efficacy between a water-based etch and rinse adhesive (Scotch bond multipurpose and an acetone-based etch and rinse adhesive (Prime and bond NT, when bonding biodentine to the composite. To evaluate the enamel, dentin, and interfacial microleakage at the composite and biodentine/RMGIC interfaces. Materials and Methods: Fifty class II cavities were prepared on the mesial and distal surfaces of 25 extracted human maxillary third molars, which were randomly divided into five groups of ten cavities each: (G1 Biodentine group, (G2 Fuji II LC GIC group, (G3 Biodentine as a base + prime and bond NT + Tetric N-Ceram composite, (G4 Biodentine + scotchbond multi-purpose + Tetric N-Ceram composite, (G5 Fuji II LC as a base + prime and bond NT+ Tetric-N Ceram composite. The samples were then subjected to thermocycling, 2500× (5°C to 55°C, followed by the dye penetration test. Scores are given from 0 to 3 based on the depth of

  4. Synthesis, spectral characterization and biological activity of zinc(II) complexes with 3-substituted phenyl-4-amino-5-hydrazino-1, 2, 4-triazole Schiff bases.

    Science.gov (United States)

    Singh, A K; Pandey, O P; Sengupta, S K

    2012-01-01

    New Zn(II) complexes have been synthesized by the reactions of zinc(II) acetate with Schiff bases derived from 3-substituted phenyl-4-amino-5-hydrazino-1, 2, 4-triazole and benzaldehyde, 2-hydroxyacetophenone or indoline-2,3-dione. All these complexes are soluble in DMF and DMSO; low molar conductance values indicate that they are non-electrolytes. Elemental analyses suggest that the complexes have 1:1 stoichiometry of the type [ZnL(H(2)O)(2)], [ZnL'(OAc)(2)(H(2)O)(2)] (L=dianionic Schiff bases derived from 3-(substituted phenyl)-4-amino-5-hydrazino-1, 2, 4-triazole and 2-hydroxyacetophenone or indoline-2,3-dione; L'=neutral Schiff bases derived from 3-(substituted phenyl)-4-amino-5-hydrazino-1, 2, 4-triazole and benzaldehyde) and they were characterized by FT-IR, (1)H NMR, (13)C NMR and FAB mass. All these Schiff bases and their complexes have also been screened for their antibacterial activities against Bacillus subtilis, Escherichia coli and antifungal activities against Colletotrichum falcatum, Aspergillus niger, Fusarium oxysporium and Carvularia pallescence by petriplates methods.

  5. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  6. In vitro measurement of DNA base excision repair in isolated mitochondria.

    Science.gov (United States)

    Page, Melissa M; Stuart, Jeffrey A

    2009-01-01

    Mitochondrial DNA (mtDNA) is in relatively close proximity to reactive oxygen species (ROS) arising from spontaneous superoxide formation during respiration. As a result, it sustains oxidative damage that may include base modifications, base loss, and strand breaks. mtDNA replication past sites of oxidative damage can result in the introduction of mutations. mtDNA mutations are associated with various human diseases and can manifest as loss of bioenergetic function. DNA repair processes exist in mitochondria from apparently all metazoans. A fully functional DNA base excision repair (BER) pathway is present in mitochondria of vertebrates. This pathway is catalyzed by a number of DNA glycosylases, an AP endonuclease, polymerase gamma, and a DNA ligase. This chapter outlines the step-by-step protocols for isolating mitochondrial fractions, from a number of different model organisms, of sufficient purity to allow mtDNA repair activities to be measured. It details in vitro assays for the measurement of BER enzyme activities in lysates prepared from isolated mitochondria.

  7. Advancing DNA-based Nanotechnology Capabilities and Applications

    Science.gov (United States)

    Marchi, Alexandria N.

    Biological systems have inspired interest in developing artificial molecular self-assembly techniques that imitate nature's ability to harness chemical forces to specifically position atoms within intricate assemblies. Of the biomolecules used to mimic nature's abilities, nucleic acids have gained special attention. Specifically, deoxyribonucleic acid is a stable molecule with a readily accessible code that exhibits predictable and programmable intermolecular interactions. These properties are exploited in the revolutionary structural DNA nanotechnology method known as scaffolded DNA origami. For DNA origami to establish itself as a widely used method for creating self-assembling, complex, functional materials, current limitations need to be overcome and new methods need to be established to move forward with developing structures for diverse applications in many fields. The limitations discussed in this dissertation include 1) pushing the scale of well-formed, fully-addressable origami to two and seven times the size of conventional origami, 2) testing cost-effective staple strand synthesis methods for producing pools of oligos for a specified origami, and 3) engineering mechanical properties using non-natural nucleotides in DNA assemblies. After accomplishing the above, we're able to design complex DNA origami structures that incorporate many of the current developments in the field into a useful material with applicability in wide-ranging fields, namely cell biology and photonics.

  8. Protein sequence for clustering DNA based on Artificial Neural Networks

    Directory of Open Access Journals (Sweden)

    Gamal. F. Elhadi

    2012-01-01

    Full Text Available DNA is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms and some viruses. Clustering is a process that groups a set of objects into clusters so that the similarity among objects in the same cluster is high, while that among the objects in different clusters is low. In this paper, we proposed an approach for clustering DNA sequences using Self-Organizing Map (SOM algorithm and Protein Sequence. The main objective is to analyze biological data and to bunch DNA to many clusters more easily and efficiently. We use the proposed approach to analyze both large and small amount of input DNA sequences. The results show that the similarity of the sequences does not depend on the amount of input sequences. Our approach depends on evaluating the degree of the DNA sequences similarity using the hierarchal representation Dendrogram. Representing large amount of data using hierarchal tree gives the ability to compare large sequences efficiently

  9. Bioactive glass incorporation in calcium phosphate cement-based injectable bone substitute for improved in vitro biocompatibility and in vivo bone regeneration.

    Science.gov (United States)

    Sadiasa, Alexander; Sarkar, Swapan Kumar; Franco, Rose Ann; Min, Young Ki; Lee, Byong Taek

    2014-01-01

    In this work, we fabricated injectable bone substitutes modified with the addition of bioactive glass powders synthesized via ultrasonic energy-assisted hydrothermal method to the calcium phosphate-based bone cement to improve its biocompatibility. The injectable bone substitutes was initially composed of a powder component (tetracalcium phosphate, dicalcium phosphate dihydrate and calcium sulfate dehydrate) and a liquid component (citric acid, chitosan and hydroxyl-propyl-methyl-cellulose) upon which various concentrations of bioactive glass were added: 0%, 10%, 20% and 30%. Setting time and compressive strength of the injectable bone substitutes were evaluated and observed to improve with the increase of bioactive glass content. Surface morphologies were observed via scanning electron microscope before and after submersion of the samples to simulated body fluid and increase in apatite formation was detected using x-ray diffraction machine. In vitro biocompatibility of the injectable bone substitutes was observed to improve with the addition of bioactive glass as the proliferation/adhesion behavior of cells on the material increased. Human gene markers were successfully expressed using real time-polymerase chain reaction and the samples were found to promote cell viability and be more biocompatible as the concentration of bioactive glass increases. In vivo biocompatibility of the samples containing 0% and 30% bioactive glass were evaluated using Micro-CT and histological staining after 3 months of implantation in male rabbits' femurs. No inflammatory reaction was observed and significant bone formation was promoted by the addition of bioactive glass to the injectable bone substitute system.

  10. Use of a Polylactide-based Copolymer as a Temporary Skin Substitute for a Patient With Moist Desquamation Due to Radiation.

    Science.gov (United States)

    Rothenberger, Jens; Constantinescu, Mihai A; Held, Manuel; Aebersold, Daniel M; Stolz, Anja; Tschumi, Christian; Olariu, Radu

    2016-07-01

    Skin reactions are known adverse effects of radiation therapy. Despite advances in skin care products, there is still a demand for optimal skin care products to improve the therapy of these lesions. The authors report the use of a polylactide-based copolymer (Suprathel, PolyMedics Innovations GmbH, Denkendorf, Germany) as a temporary skin substitute for covering the skin defects of a patient with moist desquamation due to radiation.

  11. Amino acid-bile acid based molecules: extremely narrow surfactant nanotubes formed by a phenylalanine-substituted cholic acid.

    Science.gov (United States)

    Travaglini, Leana; D'Annibale, Andrea; Schillén, Karin; Olsson, Ulf; Sennato, Simona; Pavel, Nicolae V; Galantini, Luciano

    2012-12-21

    An amino acid-substituted bile acid forms tubular aggregates with inner and outer diameters of about 3 and 6 nm. The diameters are unusually small for surfactant self-assembled tubes. The results enhance the spectrum of applications of supramolecular tubules and open up possibilities for investigating a novel class of biological amphiphiles.

  12. DNA origami-based nanoribbons: assembly, length distribution, and twist

    Energy Technology Data Exchange (ETDEWEB)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C [Lehrstuhl fuer Bioelektronik, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany); Castro, Carlos E, E-mail: simmel@ph.tum.de [Labor fuer Biomolekulare Nanotechnologie, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany)

    2011-07-08

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  13. DNA cleavage, structural elucidation and anti-microbial studies of three novel mixed ligand Schiff base complexes of copper(II

    Directory of Open Access Journals (Sweden)

    N. RAMAN

    2007-10-01

    Full Text Available Three new copper complexes of mixed ligands derived from Schiff bases (condensation of p-aminoacetanilide and substituted benzaldehydes with 1,10-phenanthroline have been synthesized and characterized by elemental analysis, IR, UV–Vis, magnetic moments, conductivity and electrochemical measurements. The spectral techniques suggest that all the copper complexes exhibit octahedral geometry. The low electrical conductance of the complexes supports their neutral nature. The monomeric nature of the complexes was assessed from their magnetic susceptibility values. The in vitro biological screening effects of the investigated compounds were tested against the bacteria Escherichia coli, Staphylococcus aureus, and Salmonella typhi and the fungi Rhizopus stolonifer and Candida albicans by the serial dilution method. A comparative study of the MIC values of the Schiff bases and their copper complexes indicates that the metal complexes exhibited higher antibacterial activity than the free ligands. The DNA cleavage ability of the complexes was monitored by the gel electrophoresis technique. It was found that electron withdrawing group substituted copper complex had higher DNA cleavage activity than the other copper complexes.

  14. Mutations of different molecular origins exhibit contrasting patterns of regional substitution rate variation.

    Directory of Open Access Journals (Sweden)

    Navin Elango

    2008-02-01

    Full Text Available Transitions at CpG dinucleotides, referred to as "CpG substitutions", are a major mutational input into vertebrate genomes and a leading cause of human genetic disease. The prevalence of CpG substitutions is due to their mutational origin, which is dependent on DNA methylation. In comparison, other single nucleotide substitutions (for example those occurring at GpC dinucleotides mainly arise from errors during DNA replication. Here we analyzed high quality BAC-based data from human, chimpanzee, and baboon to investigate regional variation of CpG substitution rates. We show that CpG substitutions occur approximately 15 times more frequently than other single nucleotide substitutions in primate genomes, and that they exhibit substantial regional variation. Patterns of CpG rate variation are consistent with differences in methylation level and susceptibility to subsequent deamination. In particular, we propose a "distance-decaying" hypothesis, positing that due to the molecular mechanism of a CpG substitution, rates are correlated with the stability of double-stranded DNA surrounding each CpG dinucleotide, and the effect of local DNA stability may decrease with distance from the CpG dinucleotide.Consistent with our "distance-decaying" hypothesis, rates of CpG substitution are strongly (negatively correlated with regional G+C content. The influence of G+C content decays as the distance from the target CpG site increases. We estimate that the influence of local G+C content extends up to 1,500 approximately 2,000 bps centered on each CpG site. We also show that the distance-decaying relationship persisted when we controlled for the effect of long-range homogeneity of nucleotide composition. GpC sites, in contrast, do not exhibit such "distance-decaying" relationship. Our results highlight an example of the distinctive properties of methylation-dependent substitutions versus substitutions mostly arising from errors during DNA replication. Furthermore

  15. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-01

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  16. Exponential quadruplex priming amplification for DNA-based isothermal diagnostics.

    Science.gov (United States)

    Partskhaladze, Tamar; Taylor, Adam; Lomidze, Levan; Gvarjaladze, David; Kankia, Besik

    2015-02-01

    Polymerase chain reaction (PCR) is a method of choice for molecular diagnostics. However, PCR relies on thermal cycling, which is not compatible with the goals of point-of-care diagnostics. A simple strategy to turn PCR into an isothermal method would be to use specific primers, which upon polymerase elongation can self-dissociate from the primer-binding sites. We recently demonstrated that a monomolecular DNA quadruplex, GGGTGGGTGGGTGGG, meets these requirements, which led to the development of the linear versions of quadruplex priming amplification (QPA). Here we demonstrate exponential version of isothermal QPA, which allows an unprecedented 10(10)-fold amplification of DNA signal in less than 40 min.

  17. Binding of copper(II) polypyridyl complexes to DNA and consequences for DNA-based asymmetric catalysis.

    Science.gov (United States)

    Draksharapu, Apparao; Boersma, Arnold J; Leising, Miriam; Meetsma, Auke; Browne, Wesley R; Roelfes, Gerard

    2015-02-28

    The interaction between salmon testes DNA (st-DNA) and a series of Cu(II) polypyridyl complexes, i.e. [Cu(dmbpy)(NO3)2] (1) (dmbpy = 4,4'-dimethyl-2,2'-bipyridine), [Cu(bpy)(NO3)2] (2) (bpy = 2,2'-bipyridine), [Cu(phen)(NO3)2] (3) (phen = phenanthroline), [Cu(terpy)(NO3)2]·H2O (4) (terpy = 2,2':6',2″-terpyridine), [Cu(dpq)(NO3)2] (5) (dpq = dipyrido-[3,2-d:2',3'-f]-quinoxaline) and [Cu(dppz)(NO3)2] (6) (dppz = dipyrido[3,2-a:2',3'-c]phenazine) was studied by UV/Vis absorption, Circular Dichroism, Linear Dichroism, EPR, Raman and (UV and vis) resonance Raman spectroscopies and viscometry. These complexes catalyse enantioselective C-C bond forming reactions in water with DNA as the source of chirality. Complex 1 crystallizes as an inorganic polymer with nitrate ligands bridging the copper ions, which adopt essentially a distorted square pyramidal structure with a fifth bridging nitrate ligand at the axial position. Raman spectroscopy indicates that in solution the nitrate ligands in 1, 2, 3 and 4 are displaced by solvent (H2O). For complex 1, multiple supramolecular species are observed in the presence of st-DNA in contrast to the other complexes, which appear to interact relatively uniformly as a single species predominantly, when st-DNA is present. Overall the data suggest that complexes 1 and 2 engage primarily through groove binding with st-DNA while 5 and 6 undergo intercalation. For complexes 3 and 4 the data indicates that both groove binding and intercalation takes place, albeit primarily intercalation. Although it is tempting to conclude that the groove binders give highest ee and rate acceleration, it is proposed that the flexibility and dynamics in binding of Cu(II) complexes to DNA are key parameters that determine the outcome of the reaction. These findings provide insight into the complex supramolecular structure of these DNA-based catalysts.

  18. A surface-based DNA algorithm for the minimal vertex cover problem

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    DNA computing was proposed for solving a class of intractable computational problems, of which the computing time will grow exponentially with the problem size. Up to now, many achievements have been made to improve its performance and increase its reliability. It has been shown many times that the surface-based DNA computing technique has very low error rate, but the technique has not been widely used in the DNA computing algorithms design. In this paper, a surface-based DNA computing algorithm for minimal vertex cover problem, a problem well-known for its exponential difficulty, is introduced. This work provides further evidence for the ability of surface-based DNA computing in solving NP-complete problems.

  19. Branched DNA-based Alu quantitative assay for cell-free plasma DNA levels in patients with sepsis or systemic inflammatory response syndrome.

    Science.gov (United States)

    Hou, Yan-Qiang; Liang, Dong-Yu; Lou, Xiao-Li; Zhang, Mei; Zhang, Zhen-huan; Zhang, Lu-rong

    2016-02-01

    Cell-free circulating DNA (cf-DNA) can be detected by various of laboratory techniques. We described a branched DNA-based Alu assay for measuring cf-DNA in septic patients. Compared to healthy controls and systemic inflammatory response syndrome (SIRS) patients, serum cf-DNA levels were significantly higher in septic patients (1426.54 ± 863.79 vs 692.02 ± 703.06 and 69.66 ± 24.66 ng/mL). The areas under the receiver operating characteristic curve of cf-DNA for normal vs sepsis and SIRS vs sepsis were 0.955 (0.884-1.025), and 0.856 (0.749-0.929), respectively. There was a positive correlation between cf-DNA and interleukin 6 or procalcitonin or Acute Physiology and Chronic Health Evaluation II. The cf-DNA concentration was higher in intensive care unit nonsurviving patients compared to surviving patients (2183.33 ± 615.26 vs 972.46 ± 648.36 ng/mL; P DNA-based Alu assays are feasible and useful to quantify serum cf-DNA levels. Increased cf-DNA levels in septic patients might complement C-reactive protein and procalcitonin in a multiple marker format. Cell-free circulating DNA might be a new marker in discrimination of sepsis and SIRS.

  20. Single-strand DNA detection using a planar photonic-crystal-waveguide-based sensor.

    Science.gov (United States)

    Toccafondo, V; García-Rupérez, J; Bañuls, M J; Griol, A; Castelló, J G; Peransi-Llopis, S; Maquieira, A

    2010-11-01

    We report an experimental demonstration of single-strand DNA (ssDNA) detection at room temperature using a photonic-crystal-waveguide-based optical sensor. The sensor surface was previously biofunctionalized with ssDNA probes to be used as specific target receptors. Our experiments showed that it is possible to detect these hybridization events using planar photonic-crystal structures, reaching an estimated detection limit as low as 19.8 nM for the detection of the complementary DNA strand.

  1. A high-throughput fluorescence resonance energy transfer-based assay for DNA ligase.

    Science.gov (United States)

    Shapiro, Adam B; Eakin, Ann E; Walkup, Grant K; Rivin, Olga

    2011-06-01

    DNA ligase is the enzyme that catalyzes the formation of the backbone phosphodiester bond between the 5'-PO(4) and 3'-OH of adjacent DNA nucleotides at single-stranded nicks. These nicks occur between Okazaki fragments during replication of the lagging strand of the DNA as well as during DNA repair and recombination. As essential enzymes for DNA replication, the NAD(+)-dependent DNA ligases of pathogenic bacteria are potential targets for the development of antibacterial drugs. For the purposes of drug discovery, a high-throughput assay for DNA ligase activity is invaluable. This article describes a straightforward, fluorescence resonance energy transfer-based DNA ligase assay that is well suited for high-throughput screening for DNA ligase inhibitors as well as for use in enzyme kinetics studies. Its use is demonstrated for measurement of the steady-state kinetic constants of Haemophilus influenzae NAD(+)-dependent DNA ligase and for measurement of the potency of an inhibitor of this enzyme.

  2. Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features

    Science.gov (United States)

    Vernon, Matthew Martin

    Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.

  3. Base-resolution DNA methylation landscape of zebrafish brain and liver

    Directory of Open Access Journals (Sweden)

    Aniruddha Chatterjee

    2014-12-01

    To our knowledge, these datasets are the only RRBS datasets and base-resolution DNA methylation data available at this time for zebrafish brain and liver. These datasets could serve as a resource for future studies to document the functional role of DNA methylation in zebrafish. In addition, these datasets could be used as controls while performing analysis on treated samples.

  4. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing

    NARCIS (Netherlands)

    Yu, S.C.; Chan, K.C.; Zheng, Y.W.; Jiang, P.; Liao, G.J.; Sun, H; Akolekar, R.; Leung, T.Y.; Go, A.T.; Vugt, J.M.G. van; Minekawa, R.; Oudejans, C.B.; Nicolaides, K.H.; Chiu, R.W.; Lo, Y.M.

    2014-01-01

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach th

  5. Investigation of the charge effect on the electrochemical transduction in a quinone-based DNA sensor

    DEFF Research Database (Denmark)

    Reisberg, S.; Piro, B.; Noel, V.

    2008-01-01

    To elucidate the mechanism involved in the electrochemical transduction process of a conducting polymer-based DNA sensor, peptide nucleic acids (PNA) were used. PNA are DNA analogues having similar hybridization properties but are neutral. This allows to discriminate the electrostatic effect of D...

  6. Quantum dot based DNA nanosensors for amplification-free detection of human topoisomerase I

    DEFF Research Database (Denmark)

    Jepsen, Morten Leth; Ottaviani, Alessio; Knudsen, Birgitta R.;

    2014-01-01

    We develop a quantum dot based DNA nanosensor specifically targeting the cleavage–religation activity of an essential DNA-modifying enzyme, human topoisomerase I. The assay has shown great promise in biological crude samples and thus is expected to contribute to clinical diagnostics and anti...

  7. DBD2BS: connecting a DNA-binding protein with its binding sites

    OpenAIRE

    2012-01-01

    By binding to short and highly conserved DNA sequences in genomes, DNA-binding proteins initiate, enhance or repress biological processes. Accurately identifying such binding sites, often represented by position weight matrices (PWMs), is an important step in understanding the control mechanisms of cells. When given coordinates of a DNA-binding domain (DBD) bound with DNA, a potential function can be used to estimate the change of binding affinity after base substitutions, where the changes c...

  8. Chimeric RNA/DNA oligonucleotide-based site-specific modification of the tobacco acetolactate syntase gene.

    Science.gov (United States)

    Kochevenko, Andrej; Willmitzer, Lothar

    2003-05-01

    Single amino acid substitutions at either of two crucial positions in acetolactate synthase (ALS) result in a chlorsulfuron-insensitive form of this enzyme and, as a consequence, a herbicide-resistant phenotype. Here, we describe the successful in vivo targeting of endogenous tobacco (Nicotiana tabacum) ALS genes using chimeric RNA/DNA and all-DNA oligonucleotides at two different locations. Similar number of conversion events with two different chimeras indicates the absence of restricting influence of genomic target sequence on the gene repair in tobacco. Chlorsulfuron-resistant plants were regenerated from calli after mesophyll protoplast electroporation or leaf tissue particle bombardment with these specifically constructed chimeras. Sequence analysis and enzyme assays proved the resulting alterations to ALS at both DNA and protein levels. Furthermore, foliar application of chlorsulfuron confirmed the development of resistant phenotypes. Lines with proline-196-alanine, threonine, glutamine, or serine substitutions or with tryptophan-573-leucine substitutions were highly resistant at both cellular and whole plant levels, whereas lines with proline-196-leucine substitutions were less resistant. The stability of these modifications was demonstrated by the continuous growth of calli on chlorsulfuron-containing medium and by the transmission of herbicide resistance to progeny in a Mendelian manner. Ability of haploid state to promote chimera-mediated conversions is discussed.

  9. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing.

    Science.gov (United States)

    Yu, Stephanie C Y; Chan, K C Allen; Zheng, Yama W L; Jiang, Peiyong; Liao, Gary J W; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y; Go, Attie T J I; van Vugt, John M G; Minekawa, Ryoko; Oudejans, Cees B M; Nicolaides, Kypros H; Chiu, Rossa W K; Lo, Y M Dennis

    2014-06-10

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring.

  10. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  11. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...... in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......-Cloroform-Isoamyl alcohol, NucliSENS® magnetic extraction kit, and DNeasy® Blood & Tissue kit. Integrity, purity, and amount of amplifiable DNA were evaluated. The results show that the DNeasy® Blood & Tissue kit is the best extraction method evaluated because it provided the most pure, intact, and amplifiable DNA. However...

  12. Feasibility of using DNA-immobilized nanocellulose-based immunoadsorbent for systemic lupus erythematosus plasmapheresis.

    Science.gov (United States)

    Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert

    2016-07-01

    The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies.

  13. A New Revised DNA Cramp Tool Based Approach of Chopping DNA Repetitive and Non-Repetitive Genome Sequences

    Directory of Open Access Journals (Sweden)

    V.Hari Prasad

    2012-11-01

    Full Text Available In vogue tremendous amount of data generated day by day by the living organism of genetic sequences and its accumulation in database, their size is growing in an exponential manner. Due to excessive storage of DNA sequences in public databases like NCBI, EMBL and DDBJ archival maintenance is tedious task. Transmission of information from one place to another place in network management systems is also a critical task. So To improve the efficiency and to reduce the overhead of the database need of compression arises in database optimization. In this connection different techniques were bloomed, but achieved results are not bountiful. Many classical algorithms are fails to compress genetic sequences due to the specificity of text encoded in dna and few of the existing techniques achieved positive results. DNA is repetitive and non repetitive in nature. Our proposed technique DNACRAMP is applicable on repetitive and non repetitive sequences of dna and it yields better compression ratio in terms of bits per bases. This is compared with existing techniques and observed that our one is the optimum technique and compression results are on par with existing techniques.

  14. Adsorption of DNA on colloidal Ag nanoparticles: effects of nanoparticle surface charge, base content and length of DNA.

    Science.gov (United States)

    Abbasian, Sara; Moshaii, Ahmad; Nikkhah, Maryam; Farkhari, Nahid

    2014-04-01

    The adsorption of single and double stranded DNA on colloidal silver nanoparticles has been studied to investigate the effects of surface charge of the nanoparticles, the composition of the oligonucleotide and its length on the adsorption characteristics. The results explain that the nanoparticle surface charge is a key parameter determining the propensity of oligonucleotides to adsorb on nanoparticles. The adsorption also depends on the length and composition of oligonucleotide. The protective effects of both single and double stranded DNA against salt-induced aggregation dramatically increase as the DNA length increases. In contrast to other available reports, we observed that long oligonucleotides (single-stranded and double stranded) can well be adsorbed on the nanoparticles as the short ones leading to almost complete protection of nanoparticles against salt induced aggregation and hence are not suitable for the sensing applications. Finally, the light scattering from the Ag nanoparticles has been simulated and the results compared with the experiments. Our understanding should improve development of colorimetric assays for DNA detection based on aggregation of unmodified metallic nanoparticles.

  15. A chiroptical switch based on DNA/layered double hydroxide ultrathin films.

    Science.gov (United States)

    Shi, Wenying; Jia, Yankun; Xu, Simin; Li, Zhixiong; Fu, Yi; Wei, Min; Shi, Shuxian

    2014-11-04

    A highly oriented film was fabricated by layer-by-layer self-assembly of DNA and MgAl-layered double hydroxide nanosheets, and its application in chiroptical switch was demonstrated via intercalation and deintercalation of an achiral molecule into the DNA cavity. DNA molecules are prone to forming an ordered and dispersive state in the interlayer region of rigid layered double hydroxide (LDH) nanosheets as confirmed by scanning electron microscopy and atomic force microscopy. The induced chiroptical ultrathin film (UTF) is achieved via the intercalation of an achiral chromophore [5,10,15,20-tetrakis(4-N-methylpyridyl)porphine tetra(p-toluenesulfonate) (TMPyP)] into the spiral cavity of DNA stabilized in the LDH matrix [denoted as TMPyP-(DNA/LDH)20]. Fluorescence and circular dichroism spectroscopy are utilized to testify the intercalation of TMPyP into (DNA/LDH)20 UTF that involves two steps: the electrostatic binding of TMPyP onto the surface of (DNA/LDH)20 followed by intercalation into base pairs of DNA. In addition, the TMPyP-(DNA/LDH)20 UTF exhibits good reversibility and repeatability in induced optical chirality, based on the intercalation and deintercalation of TMPyP by alternate exposure to HCl and NH3/H2O vapor, which can be potentially used as a chiroptical switch in data storage.

  16. [DNA-based diagnosis of hereditary tumour predisposition

    NARCIS (Netherlands)

    Menko, F.H.; Ligtenberg, M.J.L.; Brouwer, T.; Hahn, D.E.; Ausems, M.G.E.M.

    2007-01-01

    Of all forms of cancer, approximately 5% are caused by factors leading to a strong genetic predisposition. DNA diagnosis is currently used in families with hereditary tumour syndromes, such as familial adenomatous polyposis, hereditary non-polyposis colorectal carcinoma (Lynch syndrome), and heredit

  17. Practical aspects of DNA-based forensic studies in dentistry.

    Science.gov (United States)

    Muruganandhan, J; Sivakumar, G

    2011-01-01

    Forensic dentistry as a science has evolved from simple methods of age estimation and bite-mark analysis, to a new era of genetic and serological investigations. DNA analysis in forensic science requires a sample or source from either an individual (living or dead) or a crime/incident site. The orofacial region is a good source of such material, due to the fact that certain oral tissues are relatively resistant to environmental degradation and destruction by thermal, electrical, and mechanical insult. Dentists may be called upon to provide samples and expert analysis in many such situations. Sources include soft and hard tissues of teeth and jaws, saliva, biopsy material, and mucosal swabs. Tissue samples should be handled with care, and correct protocol in collection and preparation has to be followed. This ensures a high yield of the required DNA. Hard tissues like teeth require specialized procedures to extract the genetic material. Research has shown that there is a wide variation in the quality and quantity of DNA extracted from different individuals from the same site even under similar conditions. This necessitates calibration of the various methods to achieve best results. DNA analysis can provide highly accurate identification if used correctly. Here a description of the various sources in the oral region has been provided from which samples could be forwarded to the forensic laboratory. Most commonly employed techniques of collection and handling for laboratory procedures have been outlined.

  18. Practical aspects of DNA-based forensic studies in dentistry

    Science.gov (United States)

    Muruganandhan, J; Sivakumar, G

    2011-01-01

    Forensic dentistry as a science has evolved from simple methods of age estimation and bite-mark analysis, to a new era of genetic and serological investigations. DNA analysis in forensic science requires a sample or source from either an individual (living or dead) or a crime/incident site. The orofacial region is a good source of such material, due to the fact that certain oral tissues are relatively resistant to environmental degradation and destruction by thermal, electrical, and mechanical insult. Dentists may be called upon to provide samples and expert analysis in many such situations. Sources include soft and hard tissues of teeth and jaws, saliva, biopsy material, and mucosal swabs. Tissue samples should be handled with care, and correct protocol in collection and preparation has to be followed. This ensures a high yield of the required DNA. Hard tissues like teeth require specialized procedures to extract the genetic material. Research has shown that there is a wide variation in the quality and quantity of DNA extracted from different individuals from the same site even under similar conditions. This necessitates calibration of the various methods to achieve best results. DNA analysis can provide highly accurate identification if used correctly. Here a description of the various sources in the oral region has been provided from which samples could be forwarded to the forensic laboratory. Most commonly employed techniques of collection and handling for laboratory procedures have been outlined. PMID:22022138

  19. An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres

    Directory of Open Access Journals (Sweden)

    Sharina Abu Hanifah

    2012-04-01

    Full Text Available An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 ´ 10−8 M with a lower limit of detection (LOD of 9.46 ´ 10−17 M (R2 = 0.97. This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation (n = 3. Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices.

  20. Reversibly locked thionucleobase pairs in DNA to study base flipping enzymes

    Directory of Open Access Journals (Sweden)

    Christine Beuck

    2014-10-01

    Full Text Available Covalently interstrand cross-linked DNA is an interesting tool to study DNA binding proteins that locally open up the DNA duplex by flipping single bases out of the DNA helix or melting whole stretches of base pairs to perform their function. The ideal DNA cross-link to study protein–DNA interactions should be specific and easy to synthesize, be stable during protein binding experiments, have a short covalent linker to avoid steric hindrance of protein binding, and should be available as a mimic for both A/T and G/C base pairs to cover all possible binding specificities. Several covalent interstrand cross-links have been described in the literature, but most of them fall short of at least one of the above criteria. We developed an efficient method to site-specifically and reversibly cross-link thionucleoside base pairs in synthetic duplex oligodeoxynucleotides by bisalkylation with 1,2-diiodoethane resulting in an ethylene-bridged base pair. Both linked A/T and G/C base pair analogs can conveniently be prepared which allows studying any base pair-opening enzyme regardless of its sequence specificity. The cross-link is stable in the absence of reducing agents but the linker can be quickly and tracelessly removed by the addition of thiol reagents like dithiothreitol. This property makes the cross-linking reaction fully reversible and allows for a switching of the linked base pair from locked to unlocked during biochemical experiments. Using the DNA methyltransferase from Thermus aquaticus (M.TaqI as example, we demonstrate that the presented cross-linked DNA with an ethylene-linked A/T base pair analog at the target position is a useful tool to determine the base-flipping equilibrium constant of a base-flipping enzyme which lies mostly on the extrahelical side for M.TaqI.