WorldWideScience

Sample records for dna base substitutions

  1. Radiation-induced base substitution mutagenesis in single-stranded DNA phage M13

    International Nuclear Information System (INIS)

    Brandenburger, A.; Godson, G.N.; Glickman, B.W.; Sluis, C.A. van

    1981-01-01

    To elucidate the relative contributions of targeted and untargeted mutations to γ and UV radiation mutagenesis, the DNA sequences of 174 M13 revertant phages isolated from stocks of irradiated or unirradiated amber mutants grown in irradiated (SOS-induced) or unirradiated (non-induced) host bacteria, have been determined. Differences in the spectra of base change mutations induced in the various conditions were apparent, but no obvious specificity of mutagenesis was detected. In particular, under the present conditions, pyrimidine dimers did not seem to be the principal sites of UV-induced base substitution mutagenesis, suggesting that such mutagenesis occurs at the sites of lesions other than pyrimidine dimers, or is untargeted. (U.K.)

  2. Non-B DNA-forming sequences and WRN deficiency independently increase the frequency of base substitution in human cells

    DEFF Research Database (Denmark)

    Bacolla, Albino; Wang, Guliang; Jain, Aklank

    2011-01-01

    Although alternative DNA secondary structures (non-B DNA) can induce genomic rearrangements, their associated mutational spectra remain largely unknown. The helicase activity of WRN, which is absent in the human progeroid Werner syndrome, is thought to counteract this genomic instability. We dete...

  3. DNA barcoding of authentic and substitute samples of herb of the family Asparagaceae and Asclepiadaceae based on the ITS2 region

    Directory of Open Access Journals (Sweden)

    Padmalatha S Rai

    2012-01-01

    Full Text Available Background : Herbal drugs used to treat illness according to Ayurveda are often misidentified or adulterated with similar plant materials. Objective: To aid taxonomical identification, we used DNA barcoding to evaluate authentic and substitute samples of herb and phylogenetic relationship of four medicinal plants of family Asparagaceace and Asclepiadaceae. Materials and Methods : DNA extracted from dry root samples of two authentic and two substitutes of four specimens belonging to four species were subjected to polymerase chain reaction (PCR and DNA sequencing. Primers for nuclear DNA (nu ITS2 and plastid DNA (matK and rpoC1 were used for PCR and sequence analysis was performed by Clustal W. The intraspecific variation and interspecific divergence were calculated using MEGA V 4.0. Statistical Analysis : Kimura′s two parameter model, neighbor joining and bootstrapping methods were used in this work. Results: The result indicates the efficiency of amplification for ITS2 candidate DNA barcodes was 100% for four species tested. The average interspecific divergence is 0.12 and intraspecific variation was 0.232 in the case of two Asparagaceae species. In two Asclepiadaceae species, average interspecific divergence and intraspecific variation were 0.178 and 0.004 respectively. Conclusions: Our findings show that the ITS2 region can effectively discriminate Asparagus racemosus and Hemidesmus indicus from its substitute samples and hence can resolve species admixtures in raw samples. The ITS2 region may be used as one of the standard DNA barcodes to identify closely related species of family Asclepiadaceae but was noninformative for Asparagaceae species suggesting a need for the development of new markers for each family. More detailed studies involving more species and substitutes are warranted.

  4. Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA

    Science.gov (United States)

    Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.

    1998-01-01

    Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763

  5. Radiation-produced electron migration along 5-bromouracil-substituted DNA in cells and in solutions

    International Nuclear Information System (INIS)

    Beach, C.M.

    1981-01-01

    Results of work by other investigators support the theory of charge migration in DNA. Charge transfer between nucleotides and electron and energy migration in solid state DNA have been detected, but no previous experiments have demonstrated charge migration in aqueous solutions of DNA or in DNA inside an E. coli cell. Such experiments were performed by substituting different amounts of 5-bromouracil (BU) for thymine in E. coli DNA and assaying for the amount of bromide given off from the reaction of bromouracil with hydrated electrons produced by ionizing radiation to form uracil-5-yl radicals and free bromide. By varying the amount of BU incorporated in the DNA, the average distance between the BU bases was varied, and because the number of BU/electron reactions was monitored by the amount of bromide released, the maximum average electron migration distance along the BU-DNA was estimated. Charge migration was demonstrated, and the maximum average electron migration distance in aqueous solutions of BU-DNA was measured to be 8 to 10 base distances (assuming only intrastrand migration). Only 11 to 16% of the electrons produced attacked BU-DNA in aqueous solution, and only 1% resulted in bromide release from BU-DNA inside E. coli. Charge migration was demonstrated in BU-DNA inside E. coli, and the maximum average migration distance was measured to be 5 to 6 base distances

  6. Radiation-produced electron migration along 5-bromouracil-substituted DNA in cells and in solutions

    International Nuclear Information System (INIS)

    Beach, C.M.

    1981-01-01

    Results of work by other investigators support the theory of charge migration in DNA. Charge transfer between nucleotides and electron and energy migration in solid state DNA have been detected, but no previous experiments have demonstrated charge migration in aqueous solutions of DNA or in DNA inside an E. coli cell. Such experiments were performed by substituting different amounts of 5-bromouracil (BU) for thymine in E. coli DNA and assaying for the amount of bromide given off from the reaction of bromouracil with hydrated electrons produced by ionizing radiation to form uracil-5-yl radicals and free bromide. By varying the amount of BU incorporated in the DNA, the average distance between the BU bases was varied, and because the number of BU/electron reactions was monitored by the amount of bromide released, the maximum average electron migration distance along the BU-DNA was estimated. Hydrated electrons, e/sub aq/, were shown to react with BU in BU-DNA with the resultant release of bromide with G(-BR - ) = 0.519 +- 0.062. OH radicals were half as reactive as e/sub aq/ toward producing bromide from BU-DNA. O 2 , which has been shown to transfer charge to BU in aqueous solution, did not transfer charge to BU-DNA. The CO 2 radical was shown to cause the release of bromide from BU-DNA at least as effectively as e/sub aq/. Charge migration was demonstrated, and the maximum average electron migration distance in aqueous solutions of BU-DNA was measured to be 8 to 10 base distances (assuming only intrastrand migration). Only 11% to 16% of the electrons produced attacked BU-DNA in aqueous solution, and only 1% resulted in bromide release from BU-DNA inside E. coli. Charge migration was demonstrated in BU-DNA inside E. coli., and the maximum average migration distance was measured to be 5 to 6 base distances

  7. Mechanisms of Base Substitution Mutagenesis in Cancer Genomes

    Directory of Open Access Journals (Sweden)

    Albino Bacolla

    2014-03-01

    Full Text Available Cancer genome sequence data provide an invaluable resource for inferring the key mechanisms by which mutations arise in cancer cells, favoring their survival, proliferation and invasiveness. Here we examine recent advances in understanding the molecular mechanisms responsible for the predominant type of genetic alteration found in cancer cells, somatic single base substitutions (SBSs. Cytosine methylation, demethylation and deamination, charge transfer reactions in DNA, DNA replication timing, chromatin status and altered DNA proofreading activities are all now known to contribute to the mechanisms leading to base substitution mutagenesis. We review current hypotheses as to the major processes that give rise to SBSs and evaluate their relative relevance in the light of knowledge acquired from cancer genome sequencing projects and the study of base modifications, DNA repair and lesion bypass. Although gene expression data on APOBEC3B enzymes provide support for a role in cancer mutagenesis through U:G mismatch intermediates, the enzyme preference for single-stranded DNA may limit its activity genome-wide. For SBSs at both CG:CG and YC:GR sites, we outline evidence for a prominent role of damage by charge transfer reactions that follow interactions of the DNA with reactive oxygen species (ROS and other endogenous or exogenous electron-abstracting molecules.

  8. Mechanisms of base substitution mutagenesis in cancer genomes.

    Science.gov (United States)

    Bacolla, Albino; Cooper, David N; Vasquez, Karen M

    2014-03-05

    Cancer genome sequence data provide an invaluable resource for inferring the key mechanisms by which mutations arise in cancer cells, favoring their survival, proliferation and invasiveness. Here we examine recent advances in understanding the molecular mechanisms responsible for the predominant type of genetic alteration found in cancer cells, somatic single base substitutions (SBSs). Cytosine methylation, demethylation and deamination, charge transfer reactions in DNA, DNA replication timing, chromatin status and altered DNA proofreading activities are all now known to contribute to the mechanisms leading to base substitution mutagenesis. We review current hypotheses as to the major processes that give rise to SBSs and evaluate their relative relevance in the light of knowledge acquired from cancer genome sequencing projects and the study of base modifications, DNA repair and lesion bypass. Although gene expression data on APOBEC3B enzymes provide support for a role in cancer mutagenesis through U:G mismatch intermediates, the enzyme preference for single-stranded DNA may limit its activity genome-wide. For SBSs at both CG:CG and YC:GR sites, we outline evidence for a prominent role of damage by charge transfer reactions that follow interactions of the DNA with reactive oxygen species (ROS) and other endogenous or exogenous electron-abstracting molecules.

  9. Impact of arsenic/phosphorus substitution on the intrinsic conformational properties of the phosphodiester backbone of DNA investigated using ab initio quantum mechanical calculations.

    Science.gov (United States)

    Denning, Elizabeth J; Mackerell, Alexander D

    2011-04-20

    Deoxyribonucleic acid (DNA) is composed of five major elements carbon, hydrogen, nitrogen, oxygen, and phosphorus. The substitution of any of these elements in DNA would be anticipated to have major biological implications. However, recent studies have suggested that the substitution of arsenic into DNA (As-DNA) in bacteria may be possible. To help evaluate this possibility, ab initio quantum mechanical calculations are used to show that arsenodiester and phosphodiester linkages have similar geometric and conformational properties. Based on these results, it is suggested that the As-DNA will have similar conformational properties to phosphorus-based DNA, including the maintenance of base stacking.

  10. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  11. X-ray sensitization of chromatids with unifilarly and bifilarly substituted DNA

    International Nuclear Information System (INIS)

    Wolff, S.

    1981-01-01

    When cells are grown for two rounds of DNA replication in the presence of the thymidine analogue 5-bromodeoxyuridine, chromosomes containing one chromatid with unifilarly substituted DNA and one with bifilarly substituted DNA are found. These can be distinguished by harlequin staining techniques that stain one chromatid dark and one light. When the degree of substitution is 60% or greater, 3 times as many X-ray-induced chromatid breaks are produced as in unsubstituted chromatids. This represents maximal sensitization. The unifilarly substituted (dark) chromatid is as sensitive as its bifilarly substituted (light) sister chromatid. If cells are grown in low concentrations of 5-bromodeoxyuridine (BrdUrd), then the amount of substitution is less and the bifilarly substituted chromatic is more sensitive than the unifilarly substituted one. When large numbers of cells are grown in very low concentrations of BrdUrd, the analogue is almost completely depleted during the first round of replication leading to harlequin chromosomes containing one unsubstituted (dark) and one unifilarly substituted (light) chromatid. Under these conditions a maximal sensitization between light-staining and dark-staining chromatids can occur. This can be confused with the differential sensitivity between unifilarly and bifilarly substituted chromatids. The apparent discrepant results obtained by different investigators are most likely caused by the use of very low levels of BrdUrd in some of the experiments. (orig.)

  12. No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation

    Directory of Open Access Journals (Sweden)

    Hellberg Michael E

    2006-03-01

    Full Text Available Abstract Background The mitochondrial DNA (mtDNA of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin, by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea. Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes.

  13. Quinolone resistance-associated amino acid substitutions affect enzymatic activity of Mycobacterium leprae DNA gyrase.

    Science.gov (United States)

    Yamaguchi, Tomoyuki; Yokoyama, Kazumasa; Nakajima, Chie; Suzuki, Yasuhiko

    2017-07-01

    Quinolones are important antimicrobials for treatment of leprosy, a chronic infectious disease caused by Mycobacterium leprae. Although it is well known that mutations in DNA gyrase are responsible for quinolone resistance, the effect of those mutations on the enzymatic activity is yet to be studied in depth. Hence, we conducted in vitro assays to observe supercoiling reactions of wild type and mutated M. leprae DNA gyrases. DNA gyrase with amino acid substitution Ala91Val possessed the highest activity among the mutants. DNA gyrase with Gly89Cys showed the lowest level of activity despite being found in clinical strains, but it supercoiled DNA like the wild type does if applied at a sufficient concentration. In addition, patterns of time-dependent conversion from relaxed circular DNA into supercoiled DNA by DNA gyrases with clinically unreported Asp95Gly and Asp95Asn were observed to be distinct from those by the other DNA gyrases.

  14. DNA-binding studies of a tetraalkyl-substituted porphyrin and the mutually adaptive distortion principle.

    Science.gov (United States)

    Ghimire, Srijana; Fanwick, Phillip E; McMillin, David R

    2014-10-20

    This investigation explores DNA-binding interactions of various forms of an alkyl-substituted cationic porphyrin, H2TC3 (5,10,15,20-tetra[3-(3'-methylimidazolium-1'-yl)]porphyrin). The motivating idea is that incorporating alkyl rather than aryl substituents in the meso positions will enhance the prospects for intercalative as well as external binding to DNA hosts. The ligands may also be applicable for photodynamic and/or anticancer therapy. Methods employed include absorbance, circular dichroism, and emission spectroscopies, as well as viscometry and X-ray crystallography. By comparison with the classical H2T4 system, H2TC3 exhibits a higher molar extinction coefficient but is more prone to self-association. Findings of note include that the copper(II)-containing form Cu(TC3) is adept at internalizing into single-stranded as well as B-form DNA, regardless of the base composition. Surprisingly, however, external binding of H2TC3 occurs within domains that are rich in adenine-thymine base pairs. The difference in the deformability of H2TC3 versus Cu(TC3) probably accounts for the reactivity difference. Finally, Zn(TC3) binds externally, as the metal center remains five-coordinate.

  15. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    Science.gov (United States)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  16. Product portfolio optimization based on substitution

    DEFF Research Database (Denmark)

    Myrodia, Anna; Moseley, A.; Hvam, Lars

    2017-01-01

    The development of production capabilities has led to proliferation of the product variety offered to the customer. Yet this fact does not directly imply increase of manufacturers' profitability, nor customers' satisfaction. Consequently, recent research focuses on portfolio optimization through...... substitution and standardization techniques. However when re-defining the strategic market decisions are characterized by uncertainty due to several parameters. In this study, by using a GAMS optimization model we present a method for supporting strategic decisions on substitution, by quantifying the impact...

  17. Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

    Science.gov (United States)

    Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo

    2007-09-01

    The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

  18. complexes based on meso-substituted dipyrrins

    Indian Academy of Sciences (India)

    Keywords. Coordination polymers; meso-substituted dipyrrins; heteroleptic; acetylacetonato; ... Room temperature magnetic susceptibility measurements were ... After cooling to ambient tem- perature it ... crystals of 1 were obtained from CH2Cl2/ hexane (1. : 1) solution. .... are air-stable, crystalline solids, soluble in common.

  19. A Novel Image Stream Cipher Based On Dynamic Substitution

    OpenAIRE

    Elsharkawi, A.; El-Sagheer, R. M.; Akah, H.; Taha, H.

    2016-01-01

    Recently, many chaos-based stream cipher algorithms have been developed. Traditional chaos stream cipher is based on XORing a generated secure random number sequence based on chaotic maps (e.g. logistic map, Bernoulli Map, Tent Map etc.) with the original image to get the encrypted image, This type of stream cipher seems to be vulnerable to chosen plaintext attacks. This paper introduces a new stream cipher algorithm based on dynamic substitution box. The new algorithm uses one substitution b...

  20. Locating the uracil-5-yl radical formed upon photoirradiation of 5-bromouracil-substituted DNA

    Science.gov (United States)

    Hashiya, Fumitaka; Saha, Abhijit; Kizaki, Seiichiro; Li, Yue; Sugiyama, Hiroshi

    2014-01-01

    In a previous study, we found that 2-deoxyribonolactone is effectively generated in the specific 5-bromouracil (BrU)-substituted sequence 5′-(G/C)[A]n = 1,2BrUBrU-3′ and proposed that a formed uracil-5-yl radical mainly abstracts the C1′ hydrogen from the 5′-side of BrUBrU under 302-nm irradiation condition. In the present work, we performed photoirradiation of BrU-substituted DNA in the presence of a hydrogen donor, tetrahydrofuran, to quench the uracil-5-yl radical to uracil and then subjected the sample to uracil DNA glycosylase digestion. Slab gel sequence analysis indicated that uracil residues were formed at the hot-spot sequence of 5′-(G/C)[A]n = 1,2BrUBrU-3′ in 302-nm irradiation of BrU-substituted DNA. Furthermore, we found that the uracil residue was also formed at the reverse sequence 5′-BrUBrU[A]n = 1,2(G/C)-3′, which suggests that both 5′-(G/C)[A]n = 1,2BrUBrU-3′ and 5′-BrUBrU[A]n = 1,2(G/C)-3′ are hot-spot sequences for the formation of the uracil-5-yl radical. PMID:25398904

  1. The effect of S-substitution at the O6-guanine site on the structure and dynamics of a DNA oligomer containing a G:T mismatch.

    Directory of Open Access Journals (Sweden)

    Elaine Ann Moore

    Full Text Available The effect of S-substitution on the O6 guanine site of a 13-mer DNA duplex containing a G:T mismatch is studied using molecular dynamics. The structure, dynamic evolution and hydration of the S-substituted duplex are compared with those of a normal duplex, a duplex with S-substitution on guanine, but no mismatch and a duplex with just a G:T mismatch. The S-substituted mismatch leads to cell death rather than repair. One suggestion is that the G:T mismatch recognition protein recognises the S-substituted mismatch (GS:T as G:T. This leads to a cycle of futile repair ending in DNA breakage and cell death. We find that some structural features of the helix are similar for the duplex with the G:T mismatch and that with the S-substituted mismatch, but differ from the normal duplex, notably the helical twist. These differences arise from the change in the hydrogen-bonding pattern of the base pair. However a marked feature of the S-substituted G:T mismatch duplex is a very large opening. This showed considerable variability. It is suggested that this enlarged opening would lend support to an alternative model of cell death in which the mismatch protein attaches to thioguanine and activates downstream damage-response pathways. Attack on the sulphur by reactive oxygen species, also leading to cell death, would also be aided by the large, variable opening.

  2. Bacterial mutagenicity and mammalian cell DNA damage by several substituted anilines.

    Science.gov (United States)

    Zimmer, D; Mazurek, J; Petzold, G; Bhuyan, B K

    1980-04-01

    Several substituted alkyl- and haloanilines were tested for their ability to mutate Salmonella typhimurium and to damage the DNA of mammalian (V79) cells. These results were correlated with their reported carcinogenicity. Of 9 suspected carcinogens, 4 were bacterial mutagens and 4 (out of 7 tested) damaged DNA of V79 cells. The following compounds were weakly mutagenic (less than 150 revertants/mumole): 4-fluoroaniline, 2,3-, 2,4-, 2,5- and 3,4-dimethylaniline, and 2-methyl-4-fluoroaniline. The following compounds were strong mutagens: 2,4,5-trimethylaniline, 2-methyl-4-chloro-, and 2-methyl-4-bromo-, 4-methyl-2-chloro-, 4-methyl-2-bromo- and 2-ethyl-4-chloroaniline. The compounds which damaged DNA in V79 cells were: 2 methyl-4-chloroaniline, 2-methyl-4-bromoaniline, 2,4,5- and 2,4,6-trimethylaniline.

  3. A Web service substitution method based on service cluster nets

    Science.gov (United States)

    Du, YuYue; Gai, JunJing; Zhou, MengChu

    2017-11-01

    Service substitution is an important research topic in the fields of Web services and service-oriented computing. This work presents a novel method to analyse and substitute Web services. A new concept, called a Service Cluster Net Unit, is proposed based on Web service clusters. A service cluster is converted into a Service Cluster Net Unit. Then it is used to analyse whether the services in the cluster can satisfy some service requests. Meanwhile, the substitution methods of an atomic service and a composite service are proposed. The correctness of the proposed method is proved, and the effectiveness is shown and compared with the state-of-the-art method via an experiment. It can be readily applied to e-commerce service substitution to meet the business automation needs.

  4. Optimization of the BLASTN substitution matrix for prediction of non-specific DNA microarray hybridization

    DEFF Research Database (Denmark)

    Eklund, Aron Charles; Friis, Pia; Wernersson, Rasmus

    2010-01-01

    BLASTN accuracy by modifying the substitution matrix and gap penalties. We generated gene expression microarray data for samples in which 1 or 10% of the target mass was an exogenous spike of known sequence. We found that the 10% spike induced 2-fold intensity changes in 3% of the probes, two......-third of which were decreases in intensity likely caused by bulk-hybridization. These changes were correlated with similarity between the spike and probe sequences. Interestingly, even very weak similarities tended to induce a change in probe intensity with the 10% spike. Using this data, we optimized the BLASTN...... substitution matrix to more accurately identify probes susceptible to non-specific hybridization with the spike. Relative to the default substitution matrix, the optimized matrix features a decreased score for A–T base pairs relative to G–C base pairs, resulting in a 5–15% increase in area under the ROC curve...

  5. Principles of DNA architectonics: design of DNA-based nanoobjects

    International Nuclear Information System (INIS)

    Vinogradova, O A; Pyshnyi, D V

    2012-01-01

    The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

  6. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

    2008-01-01

    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  7. The use of ultraviolet light in the fractionation of chromatin containing unsubstituted and bromodeoxyuridine-substituted DNA

    International Nuclear Information System (INIS)

    Taichman, L.B.

    1979-01-01

    Two procedures are described for the fractionation of chromatin containing unsubstituted (LL) DNA and DNA unifilarly substituted with bromodeoxyuridine (HL). The two procedures rely upon the sensitivity of bromodeoxyuridine-containing DNA to UV light to induce either strand breakage or protein crosslinking. When a mixture of LL and HL chromatin is irradiated with UV light, the HL DNA fragments into molecules of smaller molecular weight than the LL DNA and crosslinks more chromosomal protein than the LL DNA. LL and HL chromatin can be fractionated on the basis of size by centrifuging through a neutral sucrose gradient. The HL DNA-protein adducts that are generated by the UV light have a unique buoyant density and may be isolated by isopycnic centrifugation in Cs 2 S0 4 . The ability to fractionate LL and HL chromatin permits certain studies on the structure of replicating chromatin. (author)

  8. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    Science.gov (United States)

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  9. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    Science.gov (United States)

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  10. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    Science.gov (United States)

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. DNA-based watermarks using the DNA-Crypt algorithm

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-01-01

    Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

  12. DNA-based watermarks using the DNA-Crypt algorithm

    Directory of Open Access Journals (Sweden)

    Barnekow Angelika

    2007-05-01

    Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  13. DNA-based watermarks using the DNA-Crypt algorithm.

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-05-29

    The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  14. Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutations in mammalian cells

    International Nuclear Information System (INIS)

    Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.

    1988-01-01

    The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage

  15. Amino acid-substituted gemini surfactant-based nanoparticles as safe and versatile gene delivery agents.

    Science.gov (United States)

    Singh, Jagbir; Yang, Peng; Michel, Deborah; Verrall, Ronald E; Foldvari, Marianna; Badea, Ildiko

    2011-05-01

    Gene based therapy represents an important advance in the treatment of diseases that heretofore have had either no treatment or cure. To capitalize on the true potential of gene therapy, there is a need to develop better delivery systems that can protect these therapeutic biomolecules and deliver them safely to the target sites. Recently, we have designed and developed a series of novel amino acid-substituted gemini surfactants with the general chemical formula C(12)H(25) (CH(3))(2)N(+)-(CH(2))(3)-N(AA)-(CH(2))(3)-N(+) (CH(3))(2)-C(12)H(25) (AA= glycine, lysine, glycyl-lysine and, lysyl-lysine). These compounds were synthesized and tested in rabbit epithelial cells using a model plasmid and a helper lipid. Plasmid/gemini/lipid (P/G/L) nanoparticles formulated using these novel compounds achieved higher gene expression than the nanoparticles containing the parent unsubstituted compound. In this study, we evaluated the cytotoxicity of P/G/L nanoparticles and explored the relationship between transfection efficiency/toxicity and their physicochemical characteristics (such as size, binding properties, etc.). An overall low toxicity is observed for all complexes with no significant difference among substituted and unsubstituted compounds. An interesting result revealed by the dye exclusion assay suggests a more balanced protection of the DNA by the glycine and glycyl-lysine substituted compounds. Thus, the higher transfection efficiency is attributed to the greater biocompatibility and flexibility of the amino acid/peptide-substituted gemini surfactants and demonstrates the feasibility of using amino acid-substituted gemini surfactants as gene carriers for the treatment of diseases affecting epithelial tissue.

  16. Improved chaos-based video steganography using DNA alphabets

    Directory of Open Access Journals (Sweden)

    Nirmalya Kar

    2018-03-01

    Full Text Available DNA based steganography plays a vital role in the field of privacy and secure communication. Here, we propose a DNA properties-based mechanism to send data hidden inside a video file. Initially, the video file is converted into image frames. Random frames are then selected and data is hidden in these at random locations by using the Least Significant Bit substitution method. We analyze the proposed architecture in terms of peak signal-to-noise ratio as well as mean squared error measured between the original and steganographic files averaged over all video frames. The results show minimal degradation of the steganographic video file. Keywords: Chaotic map, DNA, Linear congruential generator, Video steganography, Least significant bit

  17. Ortho-substituted triptycene-based diamines, monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Ghanem, Bader Saleh

    2017-04-13

    Described herein are ortho-dimethyl-substituted and tetramethyi-substituted triptycene-containing diamine monomers and microporous triptycene-based poiyimides and poiyamides, and methods of making the monomers and polymers.

  18. Ortho-substituted triptycene-based diamines, monomers, and polymers, methods of making and uses thereof

    KAUST Repository

    Ghanem, Bader Saleh; Pinnau, Ingo

    2017-01-01

    Described herein are ortho-dimethyl-substituted and tetramethyi-substituted triptycene-containing diamine monomers and microporous triptycene-based poiyimides and poiyamides, and methods of making the monomers and polymers.

  19. Property Model-Based Chemcal Substitution and Chemical Formulation Design

    DEFF Research Database (Denmark)

    Jhamb, Spardha Virendra; Liang, Xiaodong; Hukkerikar, Amol Shivajirao

    Chemical-based products including structured product formulations and single molecule products have proven to be a boon to mankind and have been a significant part of our economies. Our life and the changes around us cannot be imagined without the presence or involvement of chemicals. But like...... with environmentally benign chemicals. Additionally, the decisions taken during chemical product design also have an impact on the process and product performance and are influenced by company strategy, availability of market and government policies [2]. Hence, undoubtedly there is a need to develop a systematic...... [3] will also be highlighted. A set of new group contribution-based models for a number of useful properties of amino acids will be presented. Through examples on substitution of chemicals from chemical-based products from various sectors namely cosmetics and personal care, pharmaceutical and food...

  20. Processing of free radical damaged DNA bases

    International Nuclear Information System (INIS)

    Wallace, S.

    2003-01-01

    Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant

  1. A Markov chain Monte Carlo Expectation Maximization Algorithm for Statistical Analysis of DNA Sequence Evolution with Neighbor-Dependent Substitution Rates

    DEFF Research Database (Denmark)

    Hobolth, Asger

    2008-01-01

    -dimensional integrals required in the EM algorithm are estimated using MCMC sampling. The MCMC sampler requires simulation of sample paths from a continuous time Markov process, conditional on the beginning and ending states and the paths of the neighboring sites. An exact path sampling algorithm is developed......The evolution of DNA sequences can be described by discrete state continuous time Markov processes on a phylogenetic tree. We consider neighbor-dependent evolutionary models where the instantaneous rate of substitution at a site depends on the states of the neighboring sites. Neighbor......-dependent substitution models are analytically intractable and must be analyzed using either approximate or simulation-based methods. We describe statistical inference of neighbor-dependent models using a Markov chain Monte Carlo expectation maximization (MCMC-EM) algorithm. In the MCMC-EM algorithm, the high...

  2. Metallic Nanostructures Based on DNA Nanoshapes

    Directory of Open Access Journals (Sweden)

    Boxuan Shen

    2016-08-01

    Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.

  3. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  4. DNA-Based Applications in Nanobiotechnology

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2010-01-01

    Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

  5. General-base catalysed hydrolysis and nucleophilic substitution of activated amides in aqueous solutions

    NARCIS (Netherlands)

    Buurma, NJ; Blandamer, MJ; Engberts, JBFN; Buurma, Niklaas J.

    The reactivity of 1-benzoyl-3-phenyl-1,2,4-triazole (1a) was studied in the presence of a range of weak bases in aqueous solution. A change in mechanism is observed from general-base catalysed hydrolysis to nucleophilic substitution and general-base catalysed nucleophilic substitution. A slight

  6. Charge transport through DNA based electronic barriers

    Science.gov (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  7. Increased frequency of single base substitutions in a population of transcripts expressed in cancer cells

    Directory of Open Access Journals (Sweden)

    Bianchetti Laurent

    2012-11-01

    Full Text Available Abstract Background Single Base Substitutions (SBS that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. Methods We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE and Tag-seq (a combination of L-SAGE and deep sequencing, and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT, i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. Results In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP, catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST, i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC, healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. Conclusion If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic.

  8. Increased frequency of single base substitutions in a population of transcripts expressed in cancer cells

    International Nuclear Information System (INIS)

    Bianchetti, Laurent; Kieffer, David; Féderkeil, Rémi; Poch, Olivier

    2012-01-01

    Single Base Substitutions (SBS) that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE) and Tag-seq (a combination of L-SAGE and deep sequencing), and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT), i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP), catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST), i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC), healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic

  9. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  10. Recent progress on DNA based walkers.

    Science.gov (United States)

    Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun

    2015-08-01

    DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Novel water soluble morpholine substituted Zn(II) phthalocyanine: Synthesis, characterization, DNA/BSA binding, DNA photocleavage and topoisomerase I inhibition.

    Science.gov (United States)

    Barut, Burak; Demirbaş, Ümit; Özel, Arzu; Kantekin, Halit

    2017-12-01

    In this study, novel peripherally tetra 3-morpholinophenol substituted zinc(II) phthalocyanine (4) and its water soluble form quaternized zinc(II) phthalocyanine (ZnQ) were synthesized for the first time. These novel compounds were characterized by a combination of different spectroscopic techniques such as FT-IR, 1 H NMR, 13 C NMR, UV-vis and mass. The DNA binding of ZnQ was investigated using UV-vis absorption titration, competitive ethidium bromide, thermal denaturation and viscosity experiments that the ZnQ bound to CT-DNA via intercalation mode. ZnQ indicated photocleavage activity on supercoiled pBR322 plasmid DNA via formation of singlet oxygen under irradiation at 700nm. Besides, the topoisomerase I inhibitory effect experiments showed that ZnQ inhibited topoisomerase I enzyme in a concentration-dependent manner. The bovine serum albumin (BSA) binding experiments indicated that ZnQ bound to proteins through a static quenching mechanism. All of these results claim that ZnQ has potential agent for photodynamic therapy owing to its nucleic acid interactions and photobiological or photochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. DNA Based Electrochromic and Photovoltaic Cells

    Science.gov (United States)

    2012-01-01

    using deoxyribonucleic acid complex as an electron blocking layer App. Phys. Lett. 88 (2006) 171109. 23. F.H.C. Crick , J.D. Watson . The complementary...9550-09-1-0647 final 01-09-2009 ; 30-11-2011 DNA Based Electrochromic and Photovoltaic Cells FA 9550-09-1-0647 Pawlicka, Agnieszka, J. Instituto de...Available. DNA is an abundant natural product with very good biodegradation properties and can be used to obtain gel polymer electrolytes (GPEs) with high

  13. One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.

    Science.gov (United States)

    Ensslen, Philipp; Wagenknecht, Hans-Achim

    2015-10-20

    Light-harvesting complexes collect light energy and deliver it by a cascade of energy and electron transfer processes to the reaction center where charge separation leads to storage as chemical energy. The design of artificial light-harvesting assemblies faces enormous challenges because several antenna chromophores need to be kept in close proximity but self-quenching needs to be avoided. Double stranded DNA as a supramolecular scaffold plays a promising role due to its characteristic structural properties. Automated DNA synthesis allows incorporation of artificial chromophore-modified building blocks, and sequence design allows precise control of the distances and orientations between the chromophores. The helical twist between the chromophores, which is induced by the DNA framework, controls energy and electron transfer and thereby reduces the self-quenching that is typically observed in chromophore aggregates. This Account summarizes covalently multichromophore-modified DNA and describes how such multichromophore arrays were achieved by Watson-Crick-specific and DNA-templated self-assembly. The covalent DNA systems were prepared by incorporation of chromophores as DNA base substitutions (either as C-nucleosides or with acyclic linkers as substitutes for the 2'-deoxyribofuranoside) and as DNA base modifications. Studies with DNA base substitutions revealed that distances but more importantly relative orientations of the chromophores govern the energy transfer efficiencies and thereby the light-harvesting properties. With DNA base substitutions, duplex stabilization was faced and could be overcome, for instance, by zipper-like placement of the chromophores in both strands. For both principal structural approaches, DNA-based light-harvesting antenna could be realized. The major disadvantages, however, for covalent multichromophore DNA conjugates are the poor yields of synthesis and the solubility issues for oligonucleotides with more than 5-10 chromophore

  14. New dinuclear palladium(II) complexes: Studies of the nucleophilic substitution reactions, DNA/BSA interactions and cytotoxic activity.

    Science.gov (United States)

    Ćoćić, Dušan; Jovanović, Snežana; Nišavić, Marija; Baskić, Dejan; Todorović, Danijela; Popović, Suzana; Bugarčić, Živadin D; Petrović, Biljana

    2017-10-01

    Six new dinuclear Pd(II) complexes, [{Pd(2,2'-bipy)Cl} 2 (μ-pz)](ClO 4 ) 2 (Pd1), [{Pd(dach)Cl} 2 (μ-pz)](ClO 4 ) 2 (Pd2), [{Pd(en)Cl} 2 (μ-pz)](ClO 4 ) 2 (Pd3), [{Pd(2,2'-bipy)Cl} 2 (μ-4,4'-bipy)](ClO 4 ) 2 (Pd4), [{Pd(dach)Cl} 2 (μ-4,4'-bipy)](ClO 4 ) 2 (Pd5) and [{Pd(en)Cl} 2 (μ-4,4'-bipy)](ClO 4 ) 2 (Pd6) (where 2,2'-bipy=2,2'-bipyridyl, pz=pyrazine, dach=trans-(±)-1,2-diaminocyclohexane, en=ethylenediamine, 4,4'-bipy=4,4'-bipyridyl) have been synthesized and characterized by elemental microanalysis, IR, 1 H NMR and MALDI-TOF mass spectrometry. The pK a values of corresponding diaqua complexes were determined by spectrophotometric pH titration. Substitution reactions with thiourea (Tu), l-methionine (l-Met), l-cysteine (l-Cys), l-histidine (l-His) and guanosine-5'-monophosphate (5'-GMP) were studied under the pseudo-first order conditions at pH7.2. Reactions of Pd1 with Tu, l-Met and l-Cys were followed by decomposition of complexes, while structures of dinuclear complexes were preserved during the substitution with nitrogen donors. Interactions with calf-thymus DNA (CT-DNA) were followed by absorption spectroscopy and fluorescence quenching measurements. All complexes can bind to CT-DNA exhibiting high intrinsic binding constants (K b =10 4 -10 5 M -1 ). Competitive studies with ethidium bromide (EB) have shown that complexes can displace DNA-bound EB. High values of binding constants towards bovine serum albumin protein (BSA) indicate good binding affinity. Finally, all complexes showed moderate to high cytotoxic activity against HeLa (human cervical epithelial carcinoma cell lines) and MDA-MB-231 (human breast epithelial carcinoma cell lines) tumor cell lines inducing apoptotic type cell death, whereas normal fibroblasts were significantly less sensitive. The impact on cell cycle of these cells was distinctive, where Pd4, Pd5 and Pd6 showed the most prominent effect arresting MDA-MB-231 (human lung fibroblast cell lines) cell in G1/S phase of cell

  15. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  16. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  17. A Markov chain Monte Carlo Expectation Maximization Algorithm for Statistical Analysis of DNA Sequence Evolution with Neighbor-Dependent Substitution Rates

    DEFF Research Database (Denmark)

    Hobolth, Asger

    2008-01-01

    The evolution of DNA sequences can be described by discrete state continuous time Markov processes on a phylogenetic tree. We consider neighbor-dependent evolutionary models where the instantaneous rate of substitution at a site depends on the states of the neighboring sites. Neighbor...

  18. Constructing HVS-Based Optimal Substitution Matrix Using Enhanced Differential Evolution

    Directory of Open Access Journals (Sweden)

    Shu-Fen Tu

    2013-01-01

    Full Text Available Least significant bit (LSB substitution is a method of information hiding. The secret message is embedded into the last k bits of a cover-image in order to evade the notice of hackers. The security and stego-image quality are two main limitations of the LSB substitution method. Therefore, some researchers have proposed an LSB substitution matrix to address these two issues. Finding the optimal LSB substitution matrix can be conceptualized as a problem of combinatorial optimization. In this paper, we adopt a different heuristic method based on other researchers’ method, called enhanced differential evolution (EDE, to construct an optimal LSB substitution matrix. Differing from other researchers, we adopt an HVS-based measurement as a fitness function and embed the secret by modifying the pixel to a closest value rather than simply substituting the LSBs. Our scheme extracts the secret by modular operations as simple LSB substitution does. The experimental results show that the proposed embedding algorithm indeed improves imperceptibility of stego-images substantially.

  19. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  20. Base substitution spectra of nalidixylate resistant mutations induced by monochromatic soft X and 60Co γ-rays in bacillus subtilis spores

    International Nuclear Information System (INIS)

    Takahashi, Nobuhiro; Hieda, Kotaro; Morohoshi, Fumiko; Munakata, Nobuo

    1999-01-01

    Bacillus subtilis spores were exposed to three types of photons, monochromatic soft X-rays with the energy corresponding to the absorption peak of phosphorus K-shell electron (2,153 eV) and with the slightly lower energy (2,147 eV), and 60 Co γ-rays. From the irradiated spores, 233 mutants exhibiting nalidixic acid resistance were isolated, and together with 94 spontaneous mutants, the sequence changes in the 5'-terminal region of the gyrA gene coding for DNA gyrase subunit A were determined. Among eighteen alleles of the gyrA mutations, eight were single-base substitutions, nine were tandem double-base substitutions, and one was a double substitution skipping a middle base pair. About 6% of the radiation-induced mutations were tandem double-base substitutions, whereas none was observed among the spontaneous ones. Among spontaneous mutations, A:T and G:C pairs were equally subjected to mutations, whereas the substitutions from G:C pairs and those to A:T pairs predominated among those induced with soft X-rays. The peak-energy X-rays were more effective in killing and causing mutations than the low-energy X-rays, however, there seemed no base-change events uniquely attributable to phosphorus K-shell absorption. (author)

  1. Base-repair substitutions alter the site-specific mutagenicity of UV and MNNG in the SUP4-o gene of the yeast

    International Nuclear Information System (INIS)

    Kunz, B.A.; Ayre, B.G.; Downes, A.M.T.; Kohalmi, S.E.; McMaster, C.R.; Peters, M.G.

    1989-01-01

    Yeast strains carrying SUP4-ogenes that habe base-pair substitutions at hotspots for UV or MNNG mutagenesis were treated with these agents. In both cases, the induced mutation frequencies were substantially reduced. Furthermore, specific substitutions at positions in SUP4-o that had not been mutated by MNNG resulted in the recovery of MNNG-induced mutations at these sites. These results demonstrate that base-pair identity is an important factor determining the site-specific mutagenicity of UV and MNNG in yeast. For UV, our findings suggest that the type of lesion that is induced, but not flanking DNA sequences, plays a role in specifying mutability at the sites examined. In contrast, DNA sequence context seems to be an important factor for MNNG mutagenesis. (author). 19 refs.; 3 tabs

  2. Communication: Electron ionization of DNA bases

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, M. A.; Krishnakumar, E., E-mail: ekkumar@tifr.res.in

    2016-04-28

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.

  3. Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase†

    Science.gov (United States)

    Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.

    2011-01-01

    Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

  4. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  5. Mono- and Di-Alkylation Processes of DNA Bases by Nitrogen Mustard Mechlorethamine.

    Science.gov (United States)

    Larrañaga, Olatz; de Cózar, Abel; Cossío, Fernando P

    2017-12-06

    The reactivity of nitrogen mustard mechlorethamine (mec) with purine bases towards formation of mono- (G-mec and A-mec) and dialkylated (AA-mec, GG-mec and AG-mec) adducts has been studied using density functional theory (DFT). To gain a complete overview of DNA-alkylation processes, direct chloride substitution and formation through activated aziridinium species were considered as possible reaction paths for adduct formation. Our results confirm that DNA alkylation by mec occurs via aziridine intermediates instead of direct substitution. Consideration of explicit water molecules in conjunction with polarizable continuum model (PCM) was shown as an adequate computational method for a proper representation of the system. Moreover, Runge-Kutta numerical kinetic simulations including the possible bisadducts have been performed. These simulations predicted a product ratio of 83:17 of GG-mec and AG-mec diadducts, respectively. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas

    2012-06-06

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  7. Changes in DNA base sequence induced by gamma-ray mutagenesis of lambda phage and prophage

    Energy Technology Data Exchange (ETDEWEB)

    Tindall, K.R.; Stein, J.; Hutchinson, F.

    1988-04-01

    Mutations in the cI (repressor) gene were induced by gamma-ray irradiation of lambda phage and of prophage, and 121 mutations were sequenced. Two-thirds of the mutations in irradiated phage assayed in recA host cells (no induction of the SOS response) were G:C to A:T transitions; it is hypothesized that these may arise during DNA replication from adenine mispairing with a cytosine product deaminated by irradiation. For irradiated phage assayed in host cells in which the SOS response had been induced, 85% of the mutations were base substitutions, and in 40 of the 41 base changes, a preexisting base pair had been replaced by an A:T pair; these might come from damaged bases acting as AP (apurinic or apyrimidinic) sites. The remaining mutations were 1 and 2 base deletions. In irradiated prophage, base change mutations involved the substitution of both A:T and of G:C pairs for the preexisting pairs; the substitution of G:C pairs shows that some base substitution mechanism acts on the cell genome but not on the phage. In the irradiated prophage, frameshifts and a significant number of gross rearrangements were also found.

  8. Optical MSD symbolic substitution system based on a higher ordered rule

    Science.gov (United States)

    Reddy, A. K.; Mallikarjun, Tatipamula; Raina, J. P.

    1992-12-01

    The advantages provided by Photonic Computing has been well documented. An Optical arithmetic processor has to take full advantage of the massive parallelism in optical signals. Such a processor, using the Modified - Signed - Digit (MSD) number . (i) representation, has been presented here based (2) on the symbolic substitution 1ogi. The higher order symbolic substitution rules are formulated for the addition operation, which is carried out in just two steps. Based on the addition operation, the other arithmetic operations - subtraction, multiplication and division - are implemented. Finally, the usefulness of this MSD system is studied.

  9. Studies on meso-substituted free-base octamethoxyporphyrins

    Indian Academy of Sciences (India)

    Administrator

    base porphyrin. These data are discussed in terms of electronic structure calculations. Acknowledgement. The authors are thankful to the Council of Scientific and Industrial Research, New Delhi for financial support. Proc. Indian Acad. Sci.

  10. Image encryption based on permutation-substitution using chaotic map and Latin Square Image Cipher

    Science.gov (United States)

    Panduranga, H. T.; Naveen Kumar, S. K.; Kiran, HASH(0x22c8da0)

    2014-06-01

    In this paper we presented a image encryption based on permutation-substitution using chaotic map and Latin square image cipher. The proposed method consists of permutation and substitution process. In permutation process, plain image is permuted according to chaotic sequence generated using chaotic map. In substitution process, based on secrete key of 256 bit generate a Latin Square Image Cipher (LSIC) and this LSIC is used as key image and perform XOR operation between permuted image and key image. The proposed method can applied to any plain image with unequal width and height as well and also resist statistical attack, differential attack. Experiments carried out for different images of different sizes. The proposed method possesses large key space to resist brute force attack.

  11. DNA Array-Based Gene Profiling

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario

    2005-01-01

    Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987

  12. DNA-Directed alkylating agents. 7. Synthesis, DNA interaction, and antitumor activity of bis(hydroxymethyl)- and bis(carbamate)-substituted pyrrolizines and imidazoles.

    Science.gov (United States)

    Atwell, G J; Fan, J Y; Tan, K; Denny, W A

    1998-11-19

    A series of bis(hydroxymethyl)-substituted imidazoles, thioimidazoles, and pyrrolizines and related bis(carbamates), linked to either 9-anilinoacridine (intercalating) or 4-(4-quinolinylamino)benzamide (minor groove binding) carriers, were synthesized and evaluated for sequence-specific DNA alkylation and cytotoxicity. The imidazole and thioimidazole analogues were prepared by initial synthesis of [(4-aminophenyl)alkyl]imidazole-, thioimidazole-, or pyrrolizine dicarboxylates, coupling of these with the desired carrier, and reduction to give the required bis(hydroxymethyl) alkylating moiety. The pyrrolizines were the most reactive alkylators, followed by the thioimidazoles, while the imidazoles were unreactive. The pyrrolizines and some of the thioimidazoles cross-linked DNA, as measured by agarose gel electrophoresis. Strand cleavage assays showed that none of the compounds reacted at purine N7 or N3 sites in the gpt region of the plasmid gpt2Eco, but the polymerase stop assay showed patterns of G-alkylation in C-rich regions. The corresponding thioimidazole bis(carbamates) were more selective than the bis(hydroxymethyl) pyrrolizines, with high-intensity bands at 5'-NCCN, 5'-NGCN and 5'-NCGN sequences in the PCR stopping assay ( indicates block sites). The data suggest that these targeted compounds, like the known thioimidazole bis(carbamate) carmethizole, alkylate exclusively at guanine residues via the 2-amino group, with little or no alkylation at N3 and N7 guanine or adenine sites. The cytotoxicities of the compounds correlated broadly with their reactivities, with the bis(hydroxymethyl)imidazoles being the least cytotoxic (IC50s >1 microM; P388 leukemia) and with the intercalator-linked analogues being more cytotoxic than the corresponding minor-groove-targeted ones. This was true also for the more reactive thioimidazole bis(carbamates) (IC50s 0.8 and 11 microM, respectively), but both were more active than the analogous "untargeted" carmethizole (IC50 20

  13. Substituted polyfluorene-based hole transport layer with tunable solubility

    NARCIS (Netherlands)

    Craciun, N.I.; Wildeman, J.; Blom, P.W.M.

    2010-01-01

    We report on the synthesis and electrical characterization of polyfluorene-triarylamine-based hole transport layers (HTLs). The solubility of the HTL can be tuned by adjustment of the chemical structure without loss of the charge transport properties. Double-layer polymer light-emitting diodes are

  14. Excited state dynamics of DNA bases

    Czech Academy of Sciences Publication Activity Database

    Kleinermanns, K.; Nachtigallová, Dana; de Vries, M. S.

    2013-01-01

    Roč. 32, č. 2 (2013), s. 308-342 ISSN 0144-235X R&D Projects: GA ČR GAP208/12/1318 Grant - others:National Science Foundation(US) CHE-0911564; NASA (US) NNX12AG77G; Deutsche Forschungsgemeinschaft(DE) SFB 663; Deutsche Forschungsgemeinschaft(DE) KI 531-29 Institutional support: RVO:61388963 Keywords : DNA bases * nucleobases * excited state * dynamics * computations * gas phase * conical intersections Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.920, year: 2013

  15. Chemical Morphing of DNA Containing Four Noncanonical Bases.

    Science.gov (United States)

    Eremeeva, Elena; Abramov, Michail; Margamuljana, Lia; Rozenski, Jef; Pezo, Valerie; Marlière, Philippe; Herdewijn, Piet

    2016-06-20

    The ability of alternative nucleic acids, in which all four nucleobases are substituted, to replicate in vitro and to serve as genetic templates in vivo was evaluated. A nucleotide triphosphate set of 5-chloro-2'-deoxyuridine, 7-deaza-2'-deoxyadenosine, 5-fluoro-2'-deoxycytidine, and 7-deaza-2'deoxyguanosine successfully underwent polymerase chain reaction (PCR) amplification using templates of different lengths (57 or 525mer) and Taq or Vent (exo-) DNA polymerases as catalysts. Furthermore, a fully morphed gene encoding a dihydrofolate reductase was generated by PCR using these fully substituted nucleotides and was shown to transform and confer trimethoprim resistance to E. coli. These results demonstrated that fully modified templates were accurately read by the bacterial replication machinery and provide the first example of a long fully modified DNA molecule being functional in vivo. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    International Nuclear Information System (INIS)

    Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

    1990-08-01

    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  17. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Fei Chen

    2003-01-01

    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  18. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  19. The influence of inhibitors on dimer removal and repair of single-strand breaks in normal and bromodeoxyuridine substituted DNA of HeLa cells

    International Nuclear Information System (INIS)

    Cornelis, J.J.

    1978-01-01

    The elimination of cyclobutane pyrimidine dimers from the nuclear DNA of ultraviolet irradiated HeLa cells has been examined by means of chromatography and immunoautoradiography. The extent and duration of the process was similar when dimers were assayed by both methods, proving that the antisera recognized pyrimidine dimers. The rate of dimer excision did not differ through the cell cycle with the exception of mitosis during which no dimers were removed. Dimer excision is a relatively fast process which is terminated within a few hours, but it leaves many dimers in the DNA. Excision is depressed by inhibitors of semiconservative DNA synthesis that affect the DNA precursor pool or DNA polymerases. Cells whose DNA is partly substituted with bromodeoxyuridine instead of thymidine, repair single-strand breaks and remove dimers at the same rate but to different extents. On the other hand, inhibitors limit repair of breaks and removal of dimers to the same degree suggesting that the repair of the two types of lesion is coordinated. (Auth.)

  20. Orbital-selective Mott phase of Cu-substituted iron-based superconductors

    International Nuclear Information System (INIS)

    Liu, Yang; Zhao, Yang-Yang; Song, Yun

    2016-01-01

    We study the phase transition in Cu-substituted iron-based superconductors with a new developed real-space Green’s function method. We find that Cu substitution has strong effect on the orbital-selective Mott transition introduced by the Hund’s rule coupling. The redistribution of the orbital occupancy which is caused by the increase of the Hund’s rule coupling, gives rise to the Mott–Hubbard metal-insulator transition in the half-filled d xy orbital. We also find that more and more electronic states appear inside that Mott gap of the d xy orbital with the increase of Cu substitution, and the in-gap states around the Fermi level are strongly localized at some specific lattice sites. Further, a distinctive phase diagram, obtained for the Cu-substituted Fe-based superconductors, displays an orbital-selective insulating phase, as a result of the cooperative effect of the Hund’s rule coupling and the impurity-induced disorder. (paper)

  1. 24 CFR 290.21 - Computing annual number of units eligible for substitution of tenant-based assistance or...

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Computing annual number of units eligible for substitution of tenant-based assistance or alternative uses. 290.21 Section 290.21 Housing and... Multifamily Projects § 290.21 Computing annual number of units eligible for substitution of tenant-based...

  2. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    Science.gov (United States)

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  3. Feature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein Domains

    Directory of Open Access Journals (Sweden)

    Branislava Gemovic

    2013-01-01

    Full Text Available There are more than 500 amino acid substitutions in each human genome, and bioinformatics tools irreplaceably contribute to determination of their functional effects. We have developed feature-based algorithm for the detection of mutations outside conserved functional domains (CFDs and compared its classification efficacy with the most commonly used phylogeny-based tools, PolyPhen-2 and SIFT. The new algorithm is based on the informational spectrum method (ISM, a feature-based technique, and statistical analysis. Our dataset contained neutral polymorphisms and mutations associated with myeloid malignancies from epigenetic regulators ASXL1, DNMT3A, EZH2, and TET2. PolyPhen-2 and SIFT had significantly lower accuracies in predicting the effects of amino acid substitutions outside CFDs than expected, with especially low sensitivity. On the other hand, only ISM algorithm showed statistically significant classification of these sequences. It outperformed PolyPhen-2 and SIFT by 15% and 13%, respectively. These results suggest that feature-based methods, like ISM, are more suitable for the classification of amino acid substitutions outside CFDs than phylogeny-based tools.

  4. Alkyl Substitution Effect on Oxidation Stability of Sulfone-Based Electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Su, Chi-Cheung [Chemical Sciences and Engineering Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; He, Meinan [Chemical Sciences and Engineering Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; Redfern, Paul [Materials Science Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; Curtiss, Larry A. [Materials Science Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; Liao, Chen [Chemical Sciences and Engineering Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; Zhang, Lu [Chemical Sciences and Engineering Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; Burrell, Anthony K. [Chemical Sciences and Engineering Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA; Zhang, Zhengcheng [Chemical Sciences and Engineering Division, Argonne National Laboratory, 9700 S. Cass Ave. Argonne IL 60439 USA

    2016-02-16

    Organic sulfone compounds have been widely used as high-voltage electrolytes for lithium-ion batteries for decades. However, owing to the complexity of the synthesis of new sulfones, only a few commercially available sulfones have been studied. In this paper, we report the synthesis of new sulfone compounds with various substituent groups and the impact of the substituent group on the oxidation stability of sulfones. Electrochemical floating tests using a 5 V LiNi0.5Mn1.5O4 spinel cathode and density functional theory calculations showed that the cyclopentyl-substituted sulfone McPS suffered from oxidation instability, starting from 4.9 V versus Li+/Li, as observed by the large leakage currents. On the other hand, the isopropyl-substituted sulfone MiPS and tetramethylene substituted sulfone TMS showed much improved oxidation stability under identical testing conditions. The substitution structure of the sulfone plays a significant role in the determination of its oxidative stability and should first be considered for the development of new sulfone-based electrolytes for high-voltage, high-energy lithium-ion batteries.

  5. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  6. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre

    2006-01-01

    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  7. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  8. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  9. Photophysicochemical, calf thymus DNA binding and in vitro photocytotoxicity properties of tetra-morpholinoethoxy-substituted phthalocyanines and their water-soluble quaternized derivatives.

    Science.gov (United States)

    Koçan, Halit; Kaya, Kerem; Özçeşmeci, İbrahim; Sesalan, B Şebnem; Göksel, Meltem; Durmuş, Mahmut; Burat, Ayfer Kalkan

    2017-12-01

    In this study, morpholinoethoxy-substituted metal-free (3), zinc(II) (4) and indium(III) (5) phthalocyanines were synthesized. These phthalocyanines were converted to their water-soluble quaternized derivatives (3Q-5Q) using excess methyl iodide as a quaternization agent. All these phthalocyanines (Pcs) were characterized by elemental analysis and different spectroscopic methods such as FT-IR, 1 H NMR, UV-Vis and mass spectrometry. The photophysical and photochemical properties such as fluorescence and generation of singlet oxygen were investigated for determination of these phthalocyanines as photosensitizers in photodynamic therapy (PDT) applications. The binding properties of quaternized phthalocyanines (3Q-5Q) to calf thymus DNA (CT-DNA) were investigated by UV-Vis and fluorescence spectrophotometric methods. The quenching effect of all quaternized phthalocyanines on the fluorescence intensity of SYBR Green-DNA complex was determined. The mixtures of 3Q, 4Q or 5Q and DNA solutions were used to determine the change in T m of double helix DNA with thermal denaturation profile. In addition, thermodynamic parameters considering their aggregation in buffer solution, which shows the spontaneity of the reactions between DNA and quaternized Pcs were investigated. On the other hand, in vitro phototoxicity and cytotoxicity behavior of the quaternized water-soluble phthalocyanine photosensitizers (3Q-5Q) were tested against the cervical cancer cell line named HeLa for evaluation of their suitability for treatment of cancer by PDT method. Peripherally tetra-substituted neutral and quaternized metal-free and metallophthalocyanines (MPcs) (Zn, In) bearing morpholinoethoxy groups were prepared. The binding of quaternized compounds (3Q-5Q) to CT-DNA were examined using UV-Vis, fluorescence spectra, thermal denaturation profiles and K SV values. Besides, thermodynamic studies indicated that binding of 3Q-5Q to DNA was spontaneous. On the other hand, in vitro phototoxicity and

  10. Cell response of calcium phosphate based ceramics, a bone substitute material

    Directory of Open Access Journals (Sweden)

    Juliana Marchi

    2013-01-01

    Full Text Available The aim of this study was to characterize calcium phosphate ceramics with different Ca/P ratios and evaluate cell response of these materials for use as a bone substitute. Bioceramics consisting of mixtures of hydroxyapatite (HAp and β-tricalcium phosphate (β-TCP powders in different proportions were pressed and sintered. The physical and chemical properties of these bioceramics were then characterized. Characterization of the biological properties of these materials was based on analysis of cell response using cultured fibroblasts. The number of cells attached to the samples was counted from SEM images of samples exposed to cell culture solution for different periods. These data were compared by analysis of variance (ANOVA complemented by the Tukey's test. The TCP sample had higher surface roughness and lower density. The adherence and growth of FMM1 cells on samples from all groups was studied. Even though the different calcium based ceramics exhibited properties which made them suitable as bone substitutes, those with higher levels of β-TCP revealed improved cell growth on their surfaces. These observations indicated two-phase calcium phosphate based materials with a β-TCP surface layer to be a promising bone substitute.

  11. DNA sequence modeling based on context trees

    NARCIS (Netherlands)

    Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.

    2015-01-01

    Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such

  12. Electroporation-based DNA delivery technology

    DEFF Research Database (Denmark)

    Gothelf, A; Gehl, Julie

    2014-01-01

    DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....

  13. Synthesis, DNA binding ability and anticancer activity of 2-heteroaryl substituted benzimidazoles linked pyrrolo[2,1-c][1,4]benzodiazepine conjugates.

    Science.gov (United States)

    Kamal, Ahmed; Pogula, Praveen Kumar; Khan, Mohammed Naseer Ahmed; Seshadri, Bobburi Naga; Sreekanth, Kokkonda

    2013-08-01

    As a continuation of our efforts to develop the benzimidazole-PBD conjugates as potential anticancer agents, a series of heteroaryl substituted benzimidazole linked PBD conjugates has been synthesized and evaluated for their anticancer potential in 60 human cancer cell lines. Most of the compounds exhibited promising anticancer activity and interestingly, compounds 4c and 4d displayed significant activity in most of the cell lines tested. Whereas, compound 4e showed selectivity in renal cancer cells with GI50 values of <10 and 70 nM against RXF 393 and UO-31 cell lines, respectively. Further, these compounds also showed significant DNA-binding affinity by thermal denaturation study using duplex form of calf thymus (CT) DNA.

  14. Induced Polarization Influences the Fundamental Forces in DNA Base Flipping

    OpenAIRE

    Lemkul, Justin A.; Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base...

  15. Acid-base and coordination properties of Meso-substituted porphyrins in nonaqueous solutions

    Science.gov (United States)

    Pukhovskaya, S. G.; Nam, Dao Tkhe; Fien, Chan Ding; Domanina, E. N.; Ivanova, Yu. B.; Semeikin, A. S.

    2017-09-01

    Acid-base and coordination properties of alkyl and aryl meso-substituted porphyrins are studied spectrophotometrically in nonaqueous solutions. It is found that the nature of the substituent greatly affects the basicity of ligands for porphyrins characterized by a flat structure of macrocycle. The electronic effects of substituents have a much weaker influence on the kinetics of complexing. These effects could be due to the opposite orientation of some factors: an increase in the basicity and stability of the N-H bonds of porphyrin reaction centers. Dissociation constants p K b of the cationic forms of meso-substituted derivatives of porphyrin are measured. The values of p K b are in good agreement with classic concepts of the nature of substituents, particularly those indirectly included in the macrocycle through phenyl buffer rings.

  16. Influence of Element Substitution on Corrosion Behavior of Bi2Te3-Based Compounds

    Science.gov (United States)

    Kohri, Hitoshi; Yagasaki, Takayoshi

    2018-02-01

    Atmospheric water may condense on the surface of Bi2Te3-based compounds constituting the Peltier module, depending on the operating environment used. In the stage of disposal, Bi2Te3-based compounds may come into contact with water in waste disposal sites. There are very few publications about the influence of condensed water on Peltier modules. Bi2Te3-Sb2Te3 or Bi2Te3-Bi2Se3 pseudo binary system compounds are used as p-type material or n-type material, respectively. The lattice distortion will be induced in the crystal of Bi2Te3-based compounds by element substitution due to the reduction in their thermal conductivity. However, the influence of element substitution on the corrosion behavior of Bi2Te3-based compounds remains unclear. In this study, the influence of element substitution on the corrosion behavior of Bi2Te3-based compounds with practical compositions has been investigated. Bi0.5Sb1.5Te3 or Bi2Te2.85Se0.15 was prepared by the vertical Bridgman method. The electrochemical properties at room temperature were evaluated by cyclic voltammetry in a standard three-electrode cell. The working electrolyte was a naturally aerated 0.6 or 3.0 mass% NaCl solution. From the tendency for corrosion potential for all the samples, the corrosion sensitivity of ternary compounds was slightly higher than that of binary compounds. From the trend of current density, it was found that Bi0.5Sb1.5Te3 had a corrosion resistance intermediate between Bi2Te3 and Sb2Te3. On the other hand, corrosion resistance was affected despite a small amount of Se substitution, and the corrosion resistance of Bi2Te2.85Se0.15 was close to or lower than that of Bi2Se3. From the observation results of the corrosion products, the trends of morphology and composition of corrosion products for Bi0.5Sb1.5Te3 or Bi2Te2.85Se0.15 were consistent with those of Sb2Te3 or Bi2Se3, respectively. From the results of x-ray photoelectron spectroscopy for the electrolyte after testing, the possibility that a

  17. Influence of Element Substitution on Corrosion Behavior of Bi2Te3-Based Compounds

    Science.gov (United States)

    Kohri, Hitoshi; Yagasaki, Takayoshi

    2018-06-01

    Atmospheric water may condense on the surface of Bi2Te3-based compounds constituting the Peltier module, depending on the operating environment used. In the stage of disposal, Bi2Te3-based compounds may come into contact with water in waste disposal sites. There are very few publications about the influence of condensed water on Peltier modules. Bi2Te3-Sb2Te3 or Bi2Te3-Bi2Se3 pseudo binary system compounds are used as p-type material or n-type material, respectively. The lattice distortion will be induced in the crystal of Bi2Te3-based compounds by element substitution due to the reduction in their thermal conductivity. However, the influence of element substitution on the corrosion behavior of Bi2Te3-based compounds remains unclear. In this study, the influence of element substitution on the corrosion behavior of Bi2Te3-based compounds with practical compositions has been investigated. Bi0.5Sb1.5Te3 or Bi2Te2.85Se0.15 was prepared by the vertical Bridgman method. The electrochemical properties at room temperature were evaluated by cyclic voltammetry in a standard three-electrode cell. The working electrolyte was a naturally aerated 0.6 or 3.0 mass% NaCl solution. From the tendency for corrosion potential for all the samples, the corrosion sensitivity of ternary compounds was slightly higher than that of binary compounds. From the trend of current density, it was found that Bi0.5Sb1.5Te3 had a corrosion resistance intermediate between Bi2Te3 and Sb2Te3. On the other hand, corrosion resistance was affected despite a small amount of Se substitution, and the corrosion resistance of Bi2Te2.85Se0.15 was close to or lower than that of Bi2Se3. From the observation results of the corrosion products, the trends of morphology and composition of corrosion products for Bi0.5Sb1.5Te3 or Bi2Te2.85Se0.15 were consistent with those of Sb2Te3 or Bi2Se3, respectively. From the results of x-ray photoelectron spectroscopy for the electrolyte after testing, the possibility that a

  18. Peculiar properties of photoinduced hydroxylaminolysis in different bacteriorhodopsin-based media using O-substituted hydroxylamines.

    Science.gov (United States)

    Dyukova, Tatyana V; Druzhko, Anna B

    2010-01-01

    The process of photoinduced hydroxylaminolysis has been re-examined in different bacteriorhodopsin (BR)-based media using O-substituted hydroxylamines, in particular, O-(4-nitrobenzyl) hydroxylamine hydrochloride (NBHA), O-(2,3,4,5,6-pentafluorobenzyl) hydroxylamine hydrochloride (FBHA) and O-(t-butyl) hydroxylamine hydrochloride (BHA). Both wild type (WT) and D96N BR-based gelatine films and gels were studied. The expected increase in the bleaching rate of BR in gelatin films by using O-substituted hydroxylamines in place of HA was not achieved. On the other hand, it was shown that in gels HA derivatives NBHA and FBHA (as against HA itself) do provide about three- to four-fold higher bleaching rate. By contrast to that in films, D96N BR in gels demonstrates more effective bleaching as compared to WT BR. The plausible interpretation for the results is discussed in frames of reduced mobilities of large-sized molecules of O-substituted hydroxylamines in dehydrated media. FBHA- or NBHA-modified gels possess higher photosensitivity both with D96N and WT BR (as compared with that for HA-modified gels) and offer a potentiality for application as an irreversible-recording medium. As anticipated, it is specifically D96N BR gel modified with FBHA that may present a promising medium suitable for write-once recording thus extending the range of recording materials in the optical processing field. © 2010 The Authors. Journal Compilation. The American Society of Photobiology.

  19. Mononuclear zinc(II) complexes of 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols: Synthesis, structural characterization, DNA binding and cheminuclease activities

    Science.gov (United States)

    Ravichandran, J.; Gurumoorthy, P.; Karthick, C.; Kalilur Rahiman, A.

    2014-03-01

    Four new zinc(II) complexes [Zn(HL1-4)Cl2] (1-4), where HL1-4 = 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols, have been isolated and fully characterized using various spectro-analytical techniques. The X-ray crystal structure of complex 4 shows the distorted trigonal-bipyramidal coordination geometry around zinc(II) ion. The crystal packing is stabilized by intermolecular NH⋯O hydrogen bonding interaction. The complexes display no d-d electronic band in the visible region due to d10 electronic configuration of zinc(II) ion. The electrochemical properties of the synthesized ligands and their complexes exhibit similar voltammogram at reduction potential due to electrochemically innocent Zn(II) ion, which evidenced that the electron transfer is due to the nature of the ligand. Binding interaction of complexes with calf thymus DNA was studied by UV-Vis absorption titration, viscometric titration and cyclic voltammetry. All complexes bind with CT DNA by intercalation, giving the binding affinity in the order of 2 > 1 ≫ 3 > 4. The prominent cheminuclease activity of complexes on plasmid DNA (pBR322 DNA) was observed in the absence and presence of H2O2. Oxidative pathway reveals that the underlying mechanism involves hydroxyl radical.

  20. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    DIRECTOR

    2013-07-10

    Jul 10, 2013 ... Electrophoresis) buffer, 2 µl of SYBR-safe (DNA staining dye) was added to it, mixed properly, ..... tools in plant genetic resources conservation: a guide to the technologies. IPGRI. Rome ... Creating Capital. Seethalakshmi KK ...

  1. A nuclear DNA-based species determination and DNA quantification assay for common poultry species.

    Science.gov (United States)

    Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S

    2014-12-01

    DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.

  2. A New Chaos-Based Color Image Encryption Scheme with an Efficient Substitution Keystream Generation Strategy

    Directory of Open Access Journals (Sweden)

    Chong Fu

    2018-01-01

    Full Text Available This paper suggests a new chaos-based color image cipher with an efficient substitution keystream generation strategy. The hyperchaotic Lü system and logistic map are employed to generate the permutation and substitution keystream sequences for image data scrambling and mixing. In the permutation stage, the positions of colored subpixels in the input image are scrambled using a pixel-swapping mechanism, which avoids two main problems encountered when using the discretized version of area-preserving chaotic maps. In the substitution stage, we introduce an efficient keystream generation method that can extract three keystream elements from the current state of the iterative logistic map. Compared with conventional method, the total number of iterations is reduced by 3 times. To ensure the robustness of the proposed scheme against chosen-plaintext attack, the current state of the logistic map is perturbed during each iteration and the disturbance value is determined by plain-pixel values. The mechanism of associating the keystream sequence with plain-image also helps accelerate the diffusion process and increase the degree of randomness of the keystream sequence. Experimental results demonstrate that the proposed scheme has a satisfactory level of security and outperforms the conventional schemes in terms of computational efficiency.

  3. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  4. Indicator Based and Indicator - Free Electrochemical DNA Biosensors

    National Research Council Canada - National Science Library

    Kerman, Kagan

    2001-01-01

    The utility and advantages of an indicator free and MB based sequence specific DNA hybridization biosensor based on guanine and adenine oxidation signals and MB reduction signals have been demonstrated...

  5. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    Science.gov (United States)

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  7. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  8. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  9. A NOVEL ROLLING BASED DNA CRYPTOGRAPHY

    Directory of Open Access Journals (Sweden)

    Rejwana Haque

    2017-05-01

    Full Text Available DNA Cryptography can be defined as a hiding data in terms of DNA Sequence. In this paper we propose a new DNA Encryption Technique where three different types of ordering is use to make binary data into cipher text. The main stages of this encryption technique are: Key Analysis, Data and Key Arrangement, Roll in encoding, Secondary Arrangement and Shifting. Decryption process has six main steps to obtain the original binary data from the encrypted data and key. Decryption steps are: Key Analysis, Shifting, Secondary Arrangement, Key Arrangement, Roll-out decoding, Data Arrangement. Here key size is half of binary data and the key is varies from data to data so key are used as one time pad. In this paper we also discuss about the implementation from sample data and security analysis for this given method.

  10. Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases?

    Science.gov (United States)

    Lee, Andrea J; Wallace, Susan S

    2017-06-01

    The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. DNA hybridization sensor based on pentacene thin film transistor.

    Science.gov (United States)

    Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang

    2011-01-15

    A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Towards DNA-Based Programmable Matter

    Science.gov (United States)

    2012-02-28

    thiolated   ssDNA  was  first  immobilized  onto  the  gold...surface.  The  surface  was  then  passivated  with   mercaptohexanol.  Subsequently,  another  complementary   thiolated ...right).       Approach  3:  DNA-­‐mediated  interaction  between   polymer -­‐coated  surfaces   We  also  tried

  13. Electron Acceptors Based on α-Substituted Perylene Diimide (PDI) for Organic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Donglin [Department; Wu, Qinghe [Department; Cai, Zhengxu [Department; Zheng, Tianyue [Department; Chen, Wei [Materials; Institute; Lu, Jessica [Department; Yu, Luping [Department

    2016-02-02

    Perylene diimide (PDI) derivatives functionalized at the ortho-position (αPPID, αPBDT) were synthesized and used as electron acceptors in non-fullerene organic photovoltaic cells. Because of the good planarity and strong π-stacking of ortho-functionalized PDI, the αPPID and αPBDT exhibit a strong tendency to form aggregates, which endow the materials with high electron mobility. The inverted OPVs employing αPDI-based compounds as the acceptors and PBT7-Th as the donor give the highest power conversion efficiency (PCE) values: 4.92% for αPBDT-based devices and 3.61% for αPPID-based devices, which are, respectively, 39% and 4% higher than that of their β-substituted counterparts βPBDT and βPPID. Charge separation studies show more efficient exciton dissociation at interfaces between αPDI-based compounds and PTB7-Th. The results suggest that α-substituted PDI derivatives are more promising electron acceptors for organic photovoltaic (OPV) components than β-isomers.

  14. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  15. Calorimetric Measurement for Internal Conversion Efficiency of Photovoltaic Cells/Modules Based on Electrical Substitution Method

    Science.gov (United States)

    Saito, Terubumi; Tatsuta, Muneaki; Abe, Yamato; Takesawa, Minato

    2018-02-01

    We have succeeded in the direct measurement for solar cell/module internal conversion efficiency based on a calorimetric method or electrical substitution method by which the absorbed radiant power is determined by replacing the heat absorbed in the cell/module with the electrical power. The technique is advantageous in that the reflectance and transmittance measurements, which are required in the conventional methods, are not necessary. Also, the internal quantum efficiency can be derived from conversion efficiencies by using the average photon energy. Agreements of the measured data with the values estimated from the nominal values support the validity of this technique.

  16. Design of ceramic-based cements and putties for bone graft substitution

    Directory of Open Access Journals (Sweden)

    M Bohner

    2010-07-01

    Full Text Available In the last 15 years, a large number of commercial ceramic-based cements and putties have been introduced as bone graft substitutes. As a result, large efforts have been made to improve our understanding of the specific properties of these materials, such as injectability, cohesion, setting time (for cements, and in vivo properties. The aim of this manuscript is to summarize our present knowledge in the field. Instead of just looking at scientific aspects, industrial needs are also considered, including mixing and delivery, sterilization, and shelf-life.

  17. Low Base-Substitution Mutation Rate in the Germline Genome of the Ciliate Tetrahymena thermophila

    Science.gov (United States)

    2016-09-15

    Tetrahymena thermophila, a model eukaryote. PLoS Biol. 4:e286. Farlow A, et al. 2015. The spontaneous mutation rate in the fission yeast Schizosaccharomyces...spontane- ous mutations in yeast . Proc Natl Acad Sci U S A. 105:9272–9277. Lynn DH, Doerder FP. 2012. The life and times of Tetrahymena. Methods Cell...Low Base-Substitution Mutation Rate in the Germline Genome of the Ciliate Tetrahymena thermophila Hongan Long1,2,y, David J. Winter3,*,y, Allan Y.-C

  18. Appropriateness, acceptance and sensory preferences based on visual information: A web-based survey on meat substitutes in a meal context

    NARCIS (Netherlands)

    Elzerman, J.E.; Hoek, A.C.; Boekel, van T.; Luning, P.A.

    2015-01-01

    The aim of this study was to investigate the appropriateness, attractiveness, use-intention and (un)desirable sensory properties of meat substitutes in different dishes based only on visual information. A web-based survey was developed to let consumers assess the use of meat substitutes in different

  19. Mapping Base Modifications in DNA by Transverse-Current Sequencing

    Science.gov (United States)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2018-02-01

    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  20. Structure-activity studies of dicationically substituted bis-benzimidazoles against Giardia lamblia: correlation of antigiardial activity with DNA binding affinity and giardial topoisomerase II inhibition.

    Science.gov (United States)

    Bell, C A; Dykstra, C C; Naiman, N A; Cory, M; Fairley, T A; Tidwell, R R

    1993-01-01

    Nine dicationically substituted bis-benzimidazoles were examined for their in vitro activities against Giardia lamblia WB (ATCC 30957). The potential mechanisms of action of these compounds were evaluated by investigating the relationship among in vitro antigiardial activity and the affinity of the molecules for DNA and their ability to inhibit the activity of giardial topoisomerase II. Each compound demonstrated antigiardial activity, as measured by assessing the incorporation of [methyl-3H]thymidine by giardial trophozoites exposed to the test agents. Three compounds exhibited excellent in vitro antigiardial activities, with 50% inhibitory concentrations which compared very favorably with those of two currently used drugs, quinacrine HCl and metronidazole. Putative mechanisms of action for these compounds were suggested by the strong correlation observed among in vitro antigiardial activity and the affinity of the molecules for natural and synthetic DNA and their ability to inhibit the relaxation activity of giardial topoisomerase II. A strong correlation between the DNA binding affinity of these compounds and their inhibition of giardial topoisomerase II activity was also observed. Images PMID:8109934

  1. DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

    Science.gov (United States)

    Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

    2017-12-15

    The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Tactile-Sight: A Sensory Substitution Device Based on Distance-Related Vibrotactile Flow

    Directory of Open Access Journals (Sweden)

    Leandro Cancar

    2013-06-01

    Full Text Available Sensory substitution is a research field of increasing interest with regard to technical, applied and theoretical issues. Among the latter, it is of central interest to understand the form in which humans perceive the environment. Ecological psychology, among other approaches, proposes that we can detect higher-order informational variables (in the sense that they are defined over substantial spatial and temporal intervals that specify our interaction with the environment. When using a vibrotactile sensory substitution device, it is reasonable to ask if stimulation on the skin may be exploitable to detect higher-order variables. Motivated by this question, a portable vibrotactile sensory substitution device was built, using distance-based information as a source and driving a large number of vibrotactile actuators (72 in the reported version, 120 max. The portable device was designed to explore real environments, allowing natural unrestricted movement for the user while providing contingent real-time vibrotactile information. Two preliminary experiments were performed. In the first one, participants were asked to detect the time to contact of an approaching ball in a simulated (desktop environment. Reasonable performance was observed in all experimental conditions, including the one with only tactile stimulation. In the second experiment, a portable version of the device was used in a real environment, where participants were asked to hit an approaching ball. Participants were able to coordinate their arm movements with vibrotactile stimulation in appropriate timing. We conclude that vibrotactile flow can be generated by distance-based activation of the actuators and that this stimulation on the skin allows users to perceive time-to-contact related environmental properties.

  3. Effect of lupine as cheese base substitution on technological and nutritional properties of processed cheese analogue.

    Science.gov (United States)

    Awad, Rezik Azab; Salama, Wafaa Mohammed; Farahat, Azza Mahmoud

    2014-01-01

    Healthy foods have been met with marked success in the last two decades. Lupine flours, protein concentrates, and isolates can be applied as a substance for enriching different kinds of food systems such as bakery products, lupine pasta, ice cream, milk substitutes. Imitation processed cheese is made from mixtures of dairy and/or non dairy proteins and fat/oils and is variously labeled analogue, artificial, extruded, synthetic and/or filled. Processed cheese can be formulated using different types of cheese with different degree of maturation, flavorings, emulsifying, salts, and/or several ingredients of non-dairy components. Non-dairy ingredients have been used in processed cheese for many dietary and economic reasons. In this study, lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). Matured Ras cheese (3 months old) was manufactured using fresh cow milk. Soft cheese curd was manufactured using fresh buffalo skim milk. Emulsifying salts S9s and Unsalted butter were used. Lupine termis paste was prepared by soaking the seeds in tap water for week with changing the water daily, and then boiled in water for 2 hrs, cooled and peeled. The peeled seeds were minced, blended to get very fine paste and kept frozen until used. Lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). The obtained PCA were analysed when fresh and during storage up to 3 months at 5±2°C for chemical composition, physical and sensory properties. The histopathological effect of lupines on alloxan diabetic albino rats and nutritional parameters were also investigated. Incorporation of lupine paste in PCA increased the ash and protein contents while meltability and penetration values of resultant products were decreased. Adding lupine in PSA formula had relatively increased the oil index and firmness of products. Feeding rats a balanced diet containing processed cheese

  4. Single base substitution causing the fragrant phenotype and development of a type-specific marker in aromatic coconut (Cocos nucifera).

    Science.gov (United States)

    Vongvanrungruang, A; Mongkolsiriwatana, C; Boonkaew, T; Sawatdichaikul, O; Srikulnath, K; Peyachoknagul, S

    2016-09-19

    The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.

  5. Highly sensitive DNA sensors based on cerium oxide nanorods

    Science.gov (United States)

    Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh

    2018-04-01

    In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.

  6. Self-reported physical fitness of older persons : A substitute for performance-based measures of physical fitness?

    NARCIS (Netherlands)

    vanHeuvelen, MJG; Kempen, GIJM; Ormel, J; de Greef, M.H.G.

    1997-01-01

    To evaluate the validity of self-report measures of physical fitness as substitutes for performance-based tests, self-reports and performance-based tests of physical fitness were compared. Subjects were a community-based sample of older adults (N = 624) aged 57 and over. The performance-based tests

  7. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  8. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  9. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  10. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.

  11. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

    OpenAIRE

    Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

    2015-01-01

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modificati...

  12. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  13. Oxidative DNA base modifications as factors in carcinogenesis

    International Nuclear Information System (INIS)

    Olinski, R.; Jaruga, P.; Zastawny, T.H.

    1998-01-01

    Reactive oxygen species can cause extensive DNA modifications including modified bases. Some of the DNA base damage has been found to possess premutagenic properties. Therefore, if not repaired, it can contribute to carcinogenesis. We have found elevated amounts of modified bases in cancerous and precancerous tissues as compared with normal tissues. Most of the agents used in anticancer therapy are paradoxically responsible for induction of secondary malignancies and some of them may generate free radicals. The results of our experiments provide evidence that exposure of cancer patients to therapeutic doses of ionizing radiation and anticancer drugs cause base modifications in genomic DNA of lymphocytes. Some of these base damages could lead to mutagenesis in critical genes and ultimately to secondary cancers such as leukemias. This may point to an important role of oxidative base damage in cancer initiation. Alternatively, the increased level of the modified base products may contribute to genetic instability and metastatic potential of tumor cells. (author)

  14. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  15. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  16. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  17. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2012-01-01

    Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  18. A Rewritable, Random-Access DNA-Based Storage System.

    Science.gov (United States)

    Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica

    2015-09-18

    We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.

  19. A universal DNA-based protein detection system.

    Science.gov (United States)

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  20. Extended substitution-diffusion based image cipher using chaotic standard map

    Science.gov (United States)

    Kumar, Anil; Ghose, M. K.

    2011-01-01

    This paper proposes an extended substitution-diffusion based image cipher using chaotic standard map [1] and linear feedback shift register to overcome the weakness of previous technique by adding nonlinearity. The first stage consists of row and column rotation and permutation which is controlled by the pseudo-random sequences which is generated by standard chaotic map and linear feedback shift register, second stage further diffusion and confusion is obtained in the horizontal and vertical pixels by mixing the properties of the horizontally and vertically adjacent pixels, respectively, with the help of chaotic standard map. The number of rounds in both stage are controlled by combination of pseudo-random sequence and original image. The performance is evaluated from various types of analysis such as entropy analysis, difference analysis, statistical analysis, key sensitivity analysis, key space analysis and speed analysis. The experimental results illustrate that performance of this is highly secured and fast.

  1. Ultraviolet enhancement of DNA base release by bleomycin

    International Nuclear Information System (INIS)

    Kakinuma, J.; Tanabe, M.; Orii, H.

    1984-01-01

    The effect of UV irradiation on base-releasing activity of bleomycin was studied on bleomycin A 2 -DNA reaction mixture in the presence of Fe(II) and 2-mercaptoethanol. This effect was measured by the release of free bases from calf thymus DNA with high-performance liquid chromatography. UV irradiation enhanced DNA base-releasing activity of bleomycin and simultaneously caused disappearance of fluorescence emission maximum at 355 nm assigned to bithiazole rings and increase in the intensity of a peak at 400 nm. UV irradiation at 295 nm, the UV absorption maximum of bleomycin, is the most effective in releasing free bases and in changing fluorescence emission patterns. From these results, we suggest that some alterations in the bithiazole group of bleomycin molecule were initiated by UV irradiation and contributed to increased base-releasing activity of bleomycin through a yet unexplained mechanism, presumably through bleomycin dimer formation. (orig.)

  2. Dielectric and impedance study of praseodymium substituted Mg-based spinel ferrites

    Energy Technology Data Exchange (ETDEWEB)

    Farid, Hafiz Muhammad Tahir, E-mail: tahirfaridbzu@gmail.com [Department of Physics, Bahauddin Zakariya, University Multan, 60800 (Pakistan); Ahmad, Ishtiaq; Ali, Irshad [Department of Physics, Bahauddin Zakariya, University Multan, 60800 (Pakistan); Ramay, Shahid M. [College of Science, Physics and Astronomy Department, King Saud University, P.O. Box 2455, 11451 Riyadh (Saudi Arabia); Mahmood, Asif [Chemical Engineering Department, College of Engineering, King Saud University, Riyadh (Saudi Arabia); Murtaza, G. [Centre for Advanced Studies in Physics, GC University, Lahore 5400 (Pakistan)

    2017-07-15

    Highlights: • Magnesium based spinel ferrites were successfully synthesized by sol-gel method. • Dielectric constant shows the normal spinel ferrites behavior. • The dc conductivity are found to decrease with increasing temperature. • The samples with low conductivity have high values of activation energy. • The Impedance decreases with increasing frequency of applied field. - Abstract: Spinel ferrites with nominal composition MgPr{sub y}Fe{sub 2−y}O{sub 4} (y = 0.00, 0.025, 0.05, 0.075, 0.10) were prepared by sol-gel method. Temperature dependent DC electrical conductivity and drift mobility were found in good agreement with each other, reflecting semiconducting behavior. The dielectric properties of all the samples as a function of frequency (1 MHz–3 GHz) were measured at room temperature. The dielectric constant and complex dielectric constant of these samples decreased with the increase of praseodymium concentration. In the present spinel ferrite, Cole–Cole plots were used to separate the grain and grain boundary’s effects. The substitution of praseodymium ions in Mg-based spinel ferrites leads to a remarkable rise of grain boundary’s resistance as compared to the grain’s resistance. As both AC conductivity and Cole–Cole plots are the functions of concentration, they reveal the dominant contribution of grain boundaries in the conduction mechanism. AC activation energy was lower than dc activation energy. Temperature dependence normalized AC susceptibility of spinel ferrites reveals that MgFe{sub 2}O{sub 4} exhibits multi domain (MD) structure with high Curie temperature while on substitution of praseodymium, MD to SD transitions occurs. The low values of conductivity and low dielectric loss make these materials best candidate for high frequency application.

  3. DNA based random key generation and management for OTP encryption.

    Science.gov (United States)

    Zhang, Yunpeng; Liu, Xin; Sun, Manhui

    2017-09-01

    One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

  4. Application of DNA-based methods in forensic entomology.

    Science.gov (United States)

    Wells, Jeffrey D; Stevens, Jamie R

    2008-01-01

    A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.

  5. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

    Science.gov (United States)

    Giangaspero, Massimo; Harasawa, Ryô

    2007-12-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

  6. Transforming bases to bytes: Molecular computing with DNA

    Indian Academy of Sciences (India)

    Despite the popular image of silicon-based computers for computation, an embryonic field of mole- cular computation is emerging, where molecules in solution perform computational ..... [4] Mao C, Sun W, Shen Z and Seeman N C 1999. A nanomechanical device based on the B-Z transition of DNA; Nature 397 144–146.

  7. DNA based methods used for characterization and detection of food ...

    African Journals Online (AJOL)

    Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

  8. Substituent Effects on Hydrogen Bonds in DNA : A Kohn-Sham DFT Approach

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    In this Chapter, we discuss how the hydrogen bonds in Watson-Crick base pairs can be tuned both structurally and in terms of bond strength by exposing the DNA bases to different kinds of substitutions: (1) substitution in the X-H Y hydrogen bonding moiety, (2) remote substitution, i.e., introducing

  9. The current state of eukaryotic DNA base damage and repair.

    Science.gov (United States)

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-02

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Foods for Special Dietary Needs: Non-dairy Plant-based Milk Substitutes and Fermented Dairy-type Products.

    Science.gov (United States)

    Mäkinen, Outi Elina; Wanhalinna, Viivi; Zannini, Emanuele; Arendt, Elke Karin

    2016-01-01

    A growing number of consumers opt for plant-based milk substitutes for medical reasons or as a lifestyle choice. Medical reasons include lactose intolerance, with a worldwide prevalence of 75%, and cow's milk allergy. Also, in countries where mammal milk is scarce and expensive, plant milk substitutes serve as a more affordable option. However, many of these products have sensory characteristics objectionable to the mainstream western palate. Technologically, plant milk substitutes are suspensions of dissolved and disintegrated plant material in water, resembling cow's milk in appearance. They are manufactured by extracting the plant material in water, separating the liquid, and formulating the final product. Homogenization and thermal treatments are necessary to improve the suspension and microbial stabilities of commercial products that can be consumed as such or be further processed into fermented dairy-type products. The nutritional properties depend on the plant source, processing, and fortification. As some products have extremely low protein and calcium contents, consumer awareness is important when plant milk substitutes are used to replace cow's milk in the diet, e.g. in the case of dairy intolerances. If formulated into palatable and nutritionally adequate products, plant-based substitutes can offer a sustainable alternative to dairy products.

  11. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas; Castro, David; Foulds, Ian G.; Parameswaran, Ash M.; Sumanpreet, K. Chhina

    2012-01-01

    the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two

  12. Phenylalanine hydroxylase deficiency caused by a single base substitution in an exon of the human phenylalanine hydroxylase gene

    International Nuclear Information System (INIS)

    Lichter-Konecki, U.; Konecki, D.S.; DiLella, A.G.; Brayton, K.; Marvit, J.; Hahn, T.M.; Trefz, E.K.; Woo, S.L.C.

    1988-01-01

    A novel restriction fragment length polymorphism in the phenylalanine hydroxylase (PAH) locus generated by the restriction endonuclease MspI was observed in a German phenylketonuria (PKU) patient. Molecular cloning and DNA sequence analyses revealed that the MspI polymorphism was created by a T to C transition in exon 9 of the human PAH gene, which also resulted in the conversion of a leucine codon to proline codon. The effect of the amino acid substitution was investigated by creating a corresponding mutation in a full-length human PAD cDNA by site-directed mutagenesis followed by expression analysis in cultured mammalian cells. Results demonstrate that the mutation in the gene causes the synthesis of an unstable protein in the cell corresponding to a CRM - phenotype. Together with the other mutations recently reported in the PAH gene,the data support previous biochemical and clinical observations that PKU is a heterogeneous disorder at the gene level

  13. Phenylalanine hydroxylase deficiency caused by a single base substitution in an exon of the human phenylalanine hydroxylase gene

    Energy Technology Data Exchange (ETDEWEB)

    Lichter-Konecki, U.; Konecki, D.S.; DiLella, A.G.; Brayton, K.; Marvit, J.; Hahn, T.M.; Trefz, E.K.; Woo, S.L.C.

    1988-04-19

    A novel restriction fragment length polymorphism in the phenylalanine hydroxylase (PAH) locus generated by the restriction endonuclease MspI was observed in a German phenylketonuria (PKU) patient. Molecular cloning and DNA sequence analyses revealed that the MspI polymorphism was created by a T to C transition in exon 9 of the human PAH gene, which also resulted in the conversion of a leucine codon to proline codon. The effect of the amino acid substitution was investigated by creating a corresponding mutation in a full-length human PAD cDNA by site-directed mutagenesis followed by expression analysis in cultured mammalian cells. Results demonstrate that the mutation in the gene causes the synthesis of an unstable protein in the cell corresponding to a CRM/sup -/ phenotype. Together with the other mutations recently reported in the PAH gene,the data support previous biochemical and clinical observations that PKU is a heterogeneous disorder at the gene level.

  14. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  15. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Science.gov (United States)

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  16. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Directory of Open Access Journals (Sweden)

    Md. Mahbubur Rahman

    2015-02-01

    Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  17. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  18. Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of); Lee, Song Eun; Lee, Ho Won [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Kim, Young Kwan, E-mail: kimyk@wow.hongik.ac.kr [Department of Information Display, Hongik University, Seoul 121-791 (Korea, Republic of); Yoon, Seung Soo, E-mail: ssyoon@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon 440‐746 (Korea, Republic of)

    2015-09-15

    This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm{sup 2}, respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm{sup 2}, respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs.

  19. Emitting materials based on phenylanthracene-substituted naphthalene derivatives for organic light-emitting diodes

    International Nuclear Information System (INIS)

    Lee, Hyun Woo; Kim, Hye Jeong; Kim, Young Seok; Kim, Jwajin; Lee, Song Eun; Lee, Ho Won; Kim, Young Kwan; Yoon, Seung Soo

    2015-01-01

    This study reports the emitting materials based on phenylanthracene-substituted naphthalene derivatives to achieve efficient electroluminescent properties for OLED applications. An OLED device using 4,4′-bis(10-phenylanthracen-9-yl)-1,1′-binaphthalene exhibited the blue emission with the CIE coordinates of (0.19, 0.16) and efficient electroluminescent properties with the luminance, power and external quantum efficiency of 1.70 cd/A, 0.79 lm/W and 1.26% at 20 mA/cm 2 , respectively. Also, the other device using 1,4-bis(10-phenylanthracene-9-yl)naphthalene exhibited white emission with the CIE coordinates of (0.34, 0.43) at 7V, respectively. This device exhibits the luminance, power and external quantum efficiency of 2.22 cd/A, 1.13 lm/W and 0.86% at 20 mA/cm 2 , respectively. - Highlights: • We synthesized fluorescent materials based on phenylanthracene derivatives. • Electroluminescence properties of these materials depend on the molecular structures. • These blue and white materials have great potential for application in OLEDs

  20. DNA methylation based biomarkers: Practical considerations and applications

    DEFF Research Database (Denmark)

    Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg

    2012-01-01

    of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...

  1. Trial watch: Naked and vectored DNA-based anticancer vaccines.

    Science.gov (United States)

    Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

    2015-05-01

    One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

  2. Using a Fluorescent Cytosine Analogue tC[superscript o] To Probe the Effect of the Y567 to Ala Substitution on the Preinsertion Steps of dNMP Incorporation by RB69 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Beckman, Jeff; Wang, Jimin; Konigsberg, William H. (Yale)

    2012-10-10

    Residues in the nascent base pair binding pocket (NBP) of bacteriophage RB69 DNA polymerase (RB69pol) are responsible for base discrimination. Replacing Tyr567 with Ala leads to greater flexibility in the NBP, increasing the probability of misincorporation. We used the fluorescent cytosine analogue, 1,3-diaza-2-oxophenoxazine (tC{sup o}), to identify preinsertion step(s) altered by NBP flexibility. When tC{sup o} is the templating base in a wild-type (wt) RB69pol ternary complex, its fluorescence is quenched only in the presence of dGTP. However, with the RB69pol Y567A mutant, the fluorescence of tC{sup o} is also quenched in the presence of dATP. We determined the crystal structure of the dATP/tC{sup o}-containing ternary complex of the RB69pol Y567A mutant at 1.9 {angstrom} resolution and found that the incoming dATP formed two hydrogen bonds with an imino-tautomerized form of tC{sup o}. Stabilization of the dATP/tC{sup o} base pair involved movement of the tC{sup o} backbone sugar into the DNA minor groove and required tilting of the tC{sup o} tricyclic ring to prevent a steric clash with L561. This structure, together with the pre-steady-state kinetic parameters and dNTP binding affinity, estimated from equilibrium fluorescence titrations, suggested that the flexibility of the NBP, provided by the Y567 to Ala substitution, led to a more favorable forward isomerization step resulting in an increase in dNTP binding affinity.

  3. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  4. High-temperature Thermoelectric and Microstructural Characteristics of Ga Substituted on the Co-site in Cobalt-based Oxides

    DEFF Research Database (Denmark)

    Van Nong, Ngo; Yanagiya, S.; Sonne, Monica

    2011-01-01

    The effects of Ga substitution on the Co-site on the high-temperature thermoelectric properties and microstructure are investigated for the misfitlayered Ca3Co4O9 and the complex perovskite-related Sr3RECo4O10.5 (RE = rare earth) cobalt-based oxides. For both systems, substitution of Ga for Co...... results in a simultaneous increase in the Seebeck coefficient (S) and the electrical conductivity (σ), and the influence is more significant in the high temperature region. The power factor (S 2 σ) is thereby remarkably improved by Ga substitution, particularly at high temperatures. Texture factor......0.05O9 shows the best ZT value of 0.45 at 1200 K, which is about 87.5% higher than the nondoped one, a considerable improvement....

  5. DNA-based random number generation in security circuitry.

    Science.gov (United States)

    Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C

    2010-06-01

    DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.

  6. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  7. Potential to curb the environmental burdens of American beef consumption using a novel plant-based beef substitute.

    Directory of Open Access Journals (Sweden)

    Benjamin Goldstein

    Full Text Available The food demands of the United States (US impart significant environmental pressures. The high rate of consumption of beef has been shown to be the largest driver of food-borne greenhouse gas emissions, water use and land occupation in the US diet. The environmental benefits of substituting animal products with vegetal foods are well documented, but significant psychological barriers persist in reducing meat consumption. Here we use life cycle assessment to appraise the environmental performance of a novel vegetal protein source in the mean US diet where it replaces ground beef, and in vegetarian and vegan diets where it substitutes for legumes, tofu and other protein sources. We find that relative to the mean US diet, vegetarian and vegan diets significantly reduce per-capita food-borne greenhouse gas emission (32% and 67%, respectively, blue water use (70% and 75%, respectively and land occupation (70% and 79%, respectively, primarily in the form of rangeland. The substitution of 10%, 25% and 50% of ground beef with plant-based burger (PBB at the national scale results in substantial reductions in annual US dietary greenhouse gas emissions (4.55-45.42 Mt CO2 equivalents, water consumption (1.30-12.00 km3 and land occupation (22300-190100 km2. Despite PBB's elevated environmental pressures compared to other vegetal protein sources, we demonstrate that minimal risk exists for the disservices of PBB substitution in non-meat diets to outweigh the benefits of ground-beef substitution in the omnivorous American diet. Demand for plant-based oils in PBB production has the potential to increase land use pressures in biodiversity hotspots, though these could be obviated through responsible land stewardship. Although the apparent environmental benefits of the PBB are contingent on actual uptake of the product, this study demonstrates the potential for non-traditional protein substitutes to play a role in a transition towards more sustainable consumption

  8. An informatics based analysis of the impact of isotope substitution on phonon modes in graphene

    International Nuclear Information System (INIS)

    Broderick, Scott; Srinivasan, Srikant; Rajan, Krishna; Ray, Upamanyu; Balasubramanian, Ganesh

    2014-01-01

    It is shown by informatics that the high frequency short ranged modes exert a significant influence in impeding thermal transport through isotope substituted graphene nanoribbons. Using eigenvalue decomposition methods, we have extracted features in the phonon density of states spectra that reveal correlations between isotope substitution and phonon modes. This study also provides a data driven computational framework for the linking of materials chemistry and transport properties in 2D systems.

  9. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  10. DNA-based asymmetric organometallic catalysis in water

    NARCIS (Netherlands)

    Oelerich, Jens; Roelfes, Gerard

    2013-01-01

    Here, the first examples of DNA-based organometallic catalysis in water that give rise to high enantioselectivities are described. Copper complexes of strongly intercalating ligands were found to enable the asymmetric intramolecular cyclopropanation of alpha-diazo-beta-keto sulfones in water. Up to

  11. DNA/RNA-based formulations for treatment of breast cancer.

    Science.gov (United States)

    Xie, Zhaolu; Zeng, Xianghui

    2017-12-01

    To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.

  12. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  13. DNA base sequence changes induced by ultraviolet light mutagenesis of a gene on a chromosome in Chinese hamster ovary cells

    Energy Technology Data Exchange (ETDEWEB)

    Romac, S; Leong, P; Sockett, H; Hutchinson, F [Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry

    1989-09-20

    The DNA base sequence changes induced by mutagenesis with ultraviolet light have been determined in a gene on a chromosome of cultured Chinese hamster ovary (CHO) cells. The gene was the Excherichia coli gpt gene, of which a single copy was stably incorporated and expressed in the CHO cell genome. The cells were irradiated with ultraviolet light and gpt{sup -} colonies were selected by resistance to 6-thioguanine. The gpt gene was amplified from chromosomal DNA by use of the polymerase chain reaction (PCR) and the amplified DNA sequenced directly by the dideoxy method. Of the 58 sequenced mutants of independent origin 53 were base change mutations. Forty-one base substitutions were single base changes, ten had two adjacent (or tandem) base changes, and one had two base changes separated by a single base-pair. Only one mutant had a multiple base change mutation with two or more well separated base changes. In contrast much higher levels of such mutations were reported in ultraviolet mutagenesis of genes on a shuttle vector in primate cells. Two deletions of a single base-pair were observed and three deletions ranging from 6 to 37 base-pairs. The mutation spectrum in the gpt gene had similarities to the ultraviolet mutation spectra for several genes in prokaryotes, which suggests similarities in mutational mechanisms in prokaryotes and eukaryotes. (author).

  14. Dynamic Game Behavior of Retailers Considering the Quality of Substitute Products Based on Delay Decision

    Science.gov (United States)

    Bao, Binshuo; Ma, Junhai

    2017-12-01

    Motivated by the Silk Road Economic Belt and the 21st-Century Maritime Silk Road project, i.e. the Belt and Road (B&R), more goods will flow around the world. With this trading platform, people can buy products at relatively cheap prices, and it is easier for people to buy various goods. The quality and quantity of products thus attract more and more attention in the supply chains. This paper discusses the quantity decision by considering the product quality in parallel supply chains where two manufacturers produce substitute products and then sell them to their downstream retailers separately. In terms of the changing quantity, as well as the different quality, this paper establishes a dynamic game model to explore the dynamic behavior when the optimal profits of two retailers have been calculated. The dynamic behaviors of the system, such as stable region, bifurcation and chaos, strange attractors and the largest Lyapunov exponents (LLE) are analyzed. The effect of the quantity adjustment parameter on the stability of the supply chain system is investigated through numerical simulations. Furthermore, a dynamic game model is established based on the quality delay decision, to investigate the influence of the quality delay parameter on the dynamic game model and the profits. Finally, the optimal decisions are obtained and analyzed.

  15. Characterisation of β-tricalcium phosphate-based bone substitute materials by electron paramagnetic resonance spectroscopy

    Science.gov (United States)

    Matković, Ivo; Maltar-Strmečki, Nadica; Babić-Ivančić, Vesna; Dutour Sikirić, Maja; Noethig-Laslo, Vesna

    2012-10-01

    β-TCP based materials are frequently used as dental implants. Due to their resorption in the body and direct contact with tissues, in order to inactivate bacteria, fungal spores and viruses, they are usually sterilized by γ-irradiation. However, the current literature provides little information about effects of the γ-irradiation on the formation and stability of the free radicals in the bone graft materials during and after sterilization procedure. In this work five different bone graft substitution materials, composed of synthetic beta tricalcium phosphate (β-TCP) and hydroxyapatite (HAP) present in the market were characterized by electron paramagnetic resonance (EPR) spectroscopy, X-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and thermogravimetric analysis (TGA). Paramagnetic species Mn2+, Fe3+, trapped H-atoms and CO2- radicals were detected in the biphasic material (60% HAP, 40% β-TCP), while in β-TCP materials only Mn2+ andor trapped hydrogen atoms were detected. EPR analysis revealed the details of the structure of these materials at the atomic level. The results have shown that EPR spectroscopy is a method which can be used to improve the quality control of bone graft materials after syntering, processing and sterilization procedure.

  16. Dynamic Pricing Based on Strategic Consumers and Substitutes in a Duopoly Setting

    Directory of Open Access Journals (Sweden)

    Gongbing Bi

    2014-01-01

    Full Text Available Based on the rational strategic consumers, we construct a dynamic game to build a two-period dynamic pricing model for two brands of substitutes which are sold by duopoly. The solution concept of the dynamic game is Nash equilibrium. In our model, consumers have been clearly segmented into several consumption classes, according to their expected value of the products. The two competing firms enter a pricing game and finally reach the state of Nash equilibrium. In addition, decision-making process with only myopic consumers existing in the market is analyzed. To make the paper more practical and realistic, the condition, in which the myopic and strategic consumers both exist in the market, is also considered and studied. In order to help the readers understand better and make it intuitively more clearly, a numerical example is given to describe the influence of the main parameters to the optimal prices. The result indicates that, to maintain the firms’ respective optimal profits, the prices of the products should be adjusted appropriately with the changes of product differentiation coefficient.

  17. Synthesis of Phthalyl Substituted Imidazolones and Schiff Bases as Antimicrobial Agents

    Directory of Open Access Journals (Sweden)

    Pramilla Sah

    2011-01-01

    Full Text Available A new series of phthalyl substituted imidazolones (4a–g and Schiff bases (5a–d were synthesized from 2-methyl-(m-nitro-1,3-dioxo-1,3-dihydro-(2H-isoindole-2-yl-5-amino-1,3,4-thiadiazole (3a–b. Compounds (3a–b were prepared by cyclisation of 2-(m-nitro-1,3-dioxo-1,3-dihydro-(2H-isoindole-2-ylmethyl ethanoate (2 with thiosemicarbazide. 2-(m-nitro-1,3-dioxo-1,3-dihydro-(2H-isoindole-2-ylethanoic acid (1 in presence of thionyl chloride and methanol gave the ester (2 while compound (1 was synthesized by aminolysis of phthalic anhydride with glycine. The compounds were characterized by spectral techniques of IR, 1H NMR, Mass and elemental analysis. All the synthesized compounds (4a–g and (5a–d were screened for their antibacterial activity against the pathogenic strains E. coli, P. aureus, C. freundii while antifungal activity was evaluated against A. niger, A. flavus, Penicillium sp. and C. albicans.

  18. Potentiometric studies of acid-base interactions in substituted 4-nitropyridine N-oxide systems

    International Nuclear Information System (INIS)

    Gurzynski, Lukasz; Puszko, Aniela; Ostrzechowska, Agnieszka; Makowski, Mariusz; Chmurzynski, Lech

    2006-01-01

    (Acid+base) equilibrium constants, involving the acidity (pK a AC ) and cationic homoconjugation constants (in the form of lgK BHB + AC ), have been determined by the potentiometric method in 13 systems formed by substituted 4-nitropyridine N-oxides in the polar aprotic solvent, acetone (AC). The derivatives covered a wide range of proton-acceptor properties and inherent diversified tendencies towards formation of hydrogen-bonded homocomplexed cations. In addition, the constant values (expressed as pK a AN andlgK BHB + AN ) for two of the systems studied, N-oxides of 2-methylamino- and 2-ethylamino-4-nitropyridine, were determined in acetonitrile (AN). The acidity constants in the non-aqueous media studied have been found to change in line with their substituent effects and the sequence of acidity changes in water. The values of the cationic homoconjugation constants increased with increasing basicity of the N-oxides and decreased with increasing solvent basicity

  19. Potentiometric studies of acid-base interactions in substituted 4-nitropyridine N-oxide systems

    Energy Technology Data Exchange (ETDEWEB)

    Gurzynski, Lukasz [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Puszko, Aniela [Department of Organic Chemistry, School of Economics, Wroclaw (Poland); Ostrzechowska, Agnieszka [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Makowski, Mariusz [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Chmurzynski, Lech [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)]. E-mail: lech@chem.univ.gda.pl

    2006-05-15

    (Acid+base) equilibrium constants, involving the acidity (pK{sub a}{sup AC}) and cationic homoconjugation constants (in the form of lgK{sub BHB{sup +}}{sup AC}), have been determined by the potentiometric method in 13 systems formed by substituted 4-nitropyridine N-oxides in the polar aprotic solvent, acetone (AC). The derivatives covered a wide range of proton-acceptor properties and inherent diversified tendencies towards formation of hydrogen-bonded homocomplexed cations. In addition, the constant values (expressed as pK{sub a}{sup AN}andlgK{sub BHB{sup +}}{sup AN}) for two of the systems studied, N-oxides of 2-methylamino- and 2-ethylamino-4-nitropyridine, were determined in acetonitrile (AN). The acidity constants in the non-aqueous media studied have been found to change in line with their substituent effects and the sequence of acidity changes in water. The values of the cationic homoconjugation constants increased with increasing basicity of the N-oxides and decreased with increasing solvent basicity.

  20. Oil-based compositions as saliva substitutes: A pilot study to investigate in-mouth retention.

    Science.gov (United States)

    Hanning, Sara M; Medlicott, Natalie J

    2016-03-30

    This pilot study aimed to compare the in-mouth retention of an oil-based saliva substitute (emulsion, consisting of rice bran oil, soy lecithin and water) with water and a 1% w/v methylcellulose suspension (polymer) in healthy volunteers. Each formulation was tagged with 1 mmol/L lithium and participants (n=30) rinsed their mouth with one randomly assigned formulation (emulsion, polymer or water) for 30s, before expectorating into a cup. Concentration of lithium expectorated was measured and amount of each formulation remaining in the mouth was estimated. Patient acceptability was investigated using questionnaires, and Fourier-Transform Infrared spectroscopy (FTIR) was used to determine the presence of oil in expectorated samples. Immediately after rinsing, taste was rated lower in the emulsion group compared to the polymer or water groups (p>0.05), although variability was high. Mean retention was highest in the emulsion group, with a difference of 8.34 ± 2.71% (p=0.003) and 4.57 ± 2.71% (p=0.06) compared with the water and polymer groups, respectively. FTIR confirmed the presence of oil in all expectorated emulsion samples. The emulsion was not inferior to the polymer in terms of retention immediately after rinsing. The next step is to conduct larger clinical studies over longer time periods in participants with salivary hypofunction. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. DNA-Based Self-Assembly of Fluorescent Nanodiamonds.

    Science.gov (United States)

    Zhang, Tao; Neumann, Andre; Lindlau, Jessica; Wu, Yuzhou; Pramanik, Goutam; Naydenov, Boris; Jelezko, Fedor; Schüder, Florian; Huber, Sebastian; Huber, Marinus; Stehr, Florian; Högele, Alexander; Weil, Tanja; Liedl, Tim

    2015-08-12

    As a step toward deterministic and scalable assembly of ordered spin arrays we here demonstrate a bottom-up approach to position fluorescent nanodiamonds (NDs) with nanometer precision on DNA origami structures. We have realized a reliable and broadly applicable surface modification strategy that results in DNA-functionalized and perfectly dispersed NDs that were then self-assembled in predefined geometries. With optical studies we show that the fluorescence properties of the nitrogen-vacancy color centers in NDs are preserved during surface modification and DNA assembly. As this method allows the nanoscale arrangement of fluorescent NDs together with other optically active components in complex geometries, applications based on self-assembled spin lattices or plasmon-enhanced spin sensors as well as improved fluorescent labeling for bioimaging could be envisioned.

  2. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  3. Effect of Guanine to Inosine Substitution on Stability of Canonical DNA and RNA Duplexes: Molecular Dynamics Thermodynamics Integration Study

    Czech Academy of Sciences Publication Activity Database

    Krepl, Miroslav; Otyepka, M.; Banáš, Pavel; Šponer, Jiří

    2013-01-01

    Roč. 117, č. 6 (2013), s. 1872-1879 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GBP305/12/G034 Grant - others:GA ČR(CZ) GPPP301/11/P558; GA MŠk(CZ) ED1.1.00/02.0068 Program:ED Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : FREE-ENERGY CALCULATIONS * PARTICLE MESH EWALD * ACID BASE-PAIRS Subject RIV: BO - Biophysics Impact factor: 3.377, year: 2013

  4. An unusual mono-substituted Keggin anion-chain based 3D framework with 24-membered macrocycles as linker units

    International Nuclear Information System (INIS)

    Pang Haijun; Ma Huiyuan; Yu Yan; Yang Ming; Xun Ye; Liu Bo

    2012-01-01

    A new compound, [Cu I (H 2 O)(Hbpp) 2 ]⊂{[Cu I (bpp)] 2 [PW 11 Cu II O 39 ]} (1) (bpp=1,3-bis(4-pyridyl)propane), has been hydrothermally synthesized and structurally characterized by single crystal X-ray diffraction. In compound 1, the unusual –A–B–A–B– array mono-substituted Keggin anion-chains and 24-membered (Cubpp) 2 cation-macrocycles are linked together to form a (2, 4) connected 3D framework with channels of ca. 9.784×7.771 Å 2 along two directions, in which the [Cu(H 2 O)(Hbpp) 2 ] coordination fragments as guest components are trapped. The photocatalytic experiments of compound 1 were performed, which show a good catalytic activity of compound 1 for photodegradation of RhB. Furthermore, the IR, TGA and electrochemical properties of compound 1 were investigated. - Graphical abstract: An unusual example of mono-substituted Keggin anion-chain based hybrid compound that possesses a 3D structure has been synthesized, which offers a feasible route for synthesis of such compounds. Highlights: ► The first example of –A–B–A–B– array mono-substituted Keggin chain is observed. ► An unusual three dimensional structure based mono-substituted Keggin anion-chains. ► The photocatalysis and electrochemical properties of the title compound were studied.

  5. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  6. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  7. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  8. Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers

    Directory of Open Access Journals (Sweden)

    MEMEN SURAHMAN

    2010-07-01

    Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.

  9. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)

    2017-10-20

    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  10. Anticonvulsants Based on the α-Substituted Amide Group Pharmacophore Bind to and Inhibit Function of Neuronal Nicotinic Acetylcholine Receptors.

    Science.gov (United States)

    Krivoshein, Arcadius V

    2016-03-16

    Although the antiepileptic properties of α-substituted lactams, acetamides, and cyclic imides have been known for over 60 years, the mechanism by which they act remains unclear. I report here that these compounds bind to the nicotinic acetylcholine receptor (nAChR) and inhibit its function. Using transient kinetic measurements with functionally active, nondesensitized receptors, I have discovered that (i) α-substituted lactams and cyclic imides are noncompetitive inhibitors of heteromeric subtypes (such as α4β2 and α3β4) of neuronal nAChRs and (ii) the binding affinity of these compounds toward the nAChR correlates with their potency in preventing maximal electroshock (MES)-induced convulsions in mice. Based on the hypothesis that α-substituted amide group is the essential pharmacophore of these drugs, I found and tested a simple compound, 2-phenylbutyramide. This compound indeed inhibits nAChR and shows good anticonvulsant activity in mice. Molecular docking simulations suggest that α-substituted lactams, acetamides, and cyclic imides bind to the same sites on the extracellular domain of the receptor. These new findings indicate that inhibition of brain nAChRs may play an important role in the action of these antiepileptic drugs, a role that has not been previously recognized.

  11. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  12. Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.

    Science.gov (United States)

    Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei

    2016-11-01

    Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.

  13. The Influence of Hepatitis C Virus Therapy on the DNA Base Excision Repair System of Peripheral Blood Mononuclear Cells.

    Science.gov (United States)

    Czarny, Piotr; Merecz-Sadowska, Anna; Majchrzak, Kinga; Jabłkowski, Maciej; Szemraj, Janusz; Śliwiński, Tomasz; Karwowski, Bolesław

    2017-07-01

    Hepatitis C virus (HCV) can infect extrahepatic tissues, including lymphocytes, creating reservoir of the virus. Moreover, HCV proteins can interact with DNA damage response proteins of infected cells. In this article we investigated the influence of the virus infection and a new ombitasvir/paritaprevir/ritonavir ± dasabuvir ± ribavirin (OBV/PTV/r ± DSV ± RBV) anti-HCV therapy on the PBMCs (peripheral blood mononuclear cells, mainly lymphocytes) DNA base excision repair (BER) system. BER protein activity was analyzed in the nuclear and mitochondrial extracts (NE and ME) of PBMC isolated from patients before and after therapy, and from subjects without HCV, using modeled double-strand DNA, with 2'-deoxyuridine substitution as the DNA damage. The NE and ME obtained from patients before therapy demonstrated lower efficacy of 2'-deoxyuridine removal and DNA repair polymerization than those of the control group or patients after therapy. Moreover, the extracts from the patients after therapy had similar activity to those from the control group. However, the efficacy of apurinic/apyrimidinic site excision in NE did not differ between the studied groups. We postulate that infection of lymphocytes by the HCV can lead to a decrease in the activity of BER enzymes. However, the use of novel therapy results in the improvement of glycosylase activity as well as the regeneration of endonuclease and other crucial repair enzymes.

  14. Computational modeling of a carbon nanotube-based DNA nanosensor

    Energy Technology Data Exchange (ETDEWEB)

    Kalantari-Nejad, R; Bahrami, M [Mechanical Engineering Department, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Rafii-Tabar, H [Department of Medical Physics and Biomedical Engineering and Research Centre for Medical Nanotechnology and Tissue Engineering, Shahid Beheshti University of Medical Sciences, Evin, Tehran (Iran, Islamic Republic of); Rungger, I; Sanvito, S, E-mail: mbahrami@aut.ac.ir [School of Physics and CRANN, Trinity College, Dublin 2 (Ireland)

    2010-11-05

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  15. Computational modeling of a carbon nanotube-based DNA nanosensor

    International Nuclear Information System (INIS)

    Kalantari-Nejad, R; Bahrami, M; Rafii-Tabar, H; Rungger, I; Sanvito, S

    2010-01-01

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  16. A dynamic bead-based microarray for parallel DNA detection

    International Nuclear Information System (INIS)

    Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P

    2011-01-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

  17. Synthetic incorporation of Nile Blue into DNA using 2′-deoxyriboside substitutes: Representative comparison of (R- and (S-aminopropanediol as an acyclic linker

    Directory of Open Access Journals (Sweden)

    Daniel Lachmann

    2010-02-01

    Full Text Available The Nile Blue chromophore was incorporated into oligonucleotides using “click” chemistry for the postsynthetic modification of oligonucleotides. These were synthesized using DNA building block 3 bearing an alkyne group and reacted with the azide 4. (R-3-amino-1,2-propanediol was applied as the linker between the phosphodiester bridges. Two sets of DNA duplexes were prepared. One set carried the chromophore in an A-T environment, the second set in a G-C environment. Both were characterized by optical spectroscopy. Sequence-dependent fluorescence quenching was applied as a sensitive tool to compare the stacking interactions with respect to the chirality of the acyclic linker attachment. The results were compared to recent results from duplexes that carried the Nile Blue label in a sequentially and structurally identical context, except for the opposite chirality of the linker ((S-3-amino-1,2-propandiol. Only minor, negligible differences were observed. Melting temperatures, UV–vis absorption spectra together with fluorescence quenching data indicate that Nile Blue stacks perfectly between the adjacent base pairs regardless of whether it has been attached via an S- or R-configured linker. This result was supported by geometrically optimized DNA models.

  18. Pharmacological mechanisms in the cardiovascular effects of DCLHb, a hemoglobin based blood substitute

    NARCIS (Netherlands)

    A. Gulati (Anil)

    1996-01-01

    textabstractThe search for a clinically useful blood substitute has been stimulated by the inherent limitations of the homologous blood transfusion system, particularly its sufficiency, safety and costs. Blood has been described as the "most complicated fluid in animals" (Winslow, 1992). An attempt

  19. Comparative in vivo study of six hydroxyapatite-based bone graft substitutes

    NARCIS (Netherlands)

    Habibovic, Pamela; Kruyt, Moyo C.; Juhl, Maria V.; Clyens, Stuart; Martinetti, Roberta; Dolcini, Laura; Theilgaard, Naseem; van Blitterswijk, Clemens

    2008-01-01

    Improvement of synthetic bone graft substitutes as suitable alternatives to a patient's own bone graft remains a challenge in biomaterials research. Our goal was to answer the question of whether improved osteoinductivity of a material would also translate to better bone-healing orthotopically.

  20. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  2. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  3. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  4. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    Science.gov (United States)

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  6. SNP discovery in nonmodel organisms: strand bias and base-substitution errors reduce conversion rates.

    Science.gov (United States)

    Gonçalves da Silva, Anders; Barendse, William; Kijas, James W; Barris, Wes C; McWilliam, Sean; Bunch, Rowan J; McCullough, Russell; Harrison, Blair; Hoelzel, A Rus; England, Phillip R

    2015-07-01

    Single nucleotide polymorphisms (SNPs) have become the marker of choice for genetic studies in organisms of conservation, commercial or biological interest. Most SNP discovery projects in nonmodel organisms apply a strategy for identifying putative SNPs based on filtering rules that account for random sequencing errors. Here, we analyse data used to develop 4723 novel SNPs for the commercially important deep-sea fish, orange roughy (Hoplostethus atlanticus), to assess the impact of not accounting for systematic sequencing errors when filtering identified polymorphisms when discovering SNPs. We used SAMtools to identify polymorphisms in a velvet assembly of genomic DNA sequence data from seven individuals. The resulting set of polymorphisms were filtered to minimize 'bycatch'-polymorphisms caused by sequencing or assembly error. An Illumina Infinium SNP chip was used to genotype a final set of 7714 polymorphisms across 1734 individuals. Five predictors were examined for their effect on the probability of obtaining an assayable SNP: depth of coverage, number of reads that support a variant, polymorphism type (e.g. A/C), strand-bias and Illumina SNP probe design score. Our results indicate that filtering out systematic sequencing errors could substantially improve the efficiency of SNP discovery. We show that BLASTX can be used as an efficient tool to identify single-copy genomic regions in the absence of a reference genome. The results have implications for research aiming to identify assayable SNPs and build SNP genotyping assays for nonmodel organisms. © 2014 John Wiley & Sons Ltd.

  7. Electrochemical DNA biosensor based on avidin-biotin conjugation for influenza virus (type A) detection

    Science.gov (United States)

    Chung, Da-Jung; Kim, Ki-Chul; Choi, Seong-Ho

    2011-09-01

    An electrochemical DNA biosensor (E-DNA biosensor) was fabricated by avidin-biotin conjugation of a biotinylated probe DNA, 5'-biotin-ATG AGT CTT CTA ACC GAG GTC GAA-3', and an avidin-modified glassy carbon electrode (GCE) to detect the influenza virus (type A). An avidin-modified GCE was prepared by the reaction of avidin and a carboxylic acid-modified GCE, which was synthesized by the electrochemical reduction of 4-carboxyphenyl diazonium salt. The current value of the E-DNA biosensor was evaluated after hybridization of the probe DNA and target DNA using cyclic voltammetry (CV). The current value decreased after the hybridization of the probe DNA and target DNA. The DNA that was used follows: complementary target DNA, 5'-TTC GAC CTC GGT TAG AAG ACT CAT-3' and two-base mismatched DNA, 5'-TTC GAC AGC GGT TAT AAG ACT CAT-3'.

  8. Magnetophoresis of flexible DNA-based dumbbell structures

    Science.gov (United States)

    Babić, B.; Ghai, R.; Dimitrov, K.

    2008-02-01

    Controlled movement and manipulation of magnetic micro- and nanostructures using magnetic forces can give rise to important applications in biomedecine, diagnostics, and immunology. We report controlled magnetophoresis and stretching, in aqueous solution, of a DNA-based dumbbell structure containing magnetic and diamagnetic microspheres. The velocity and stretching of the dumbbell were experimentally measured and correlated with a theoretical model based on the forces acting on individual magnetic beads or the entire dumbbell structures. The results show that precise and predictable manipulation of dumbbell structures is achievable and can potentially be applied to immunomagnetic cell separators.

  9. Developing a biological dosimeter based on mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

    1996-12-31

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.

  10. Developing a biological dosimeter based on mitochondrial DNA

    International Nuclear Information System (INIS)

    Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.

    1995-01-01

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs

  11. Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Anshul Kumar; Saini, Rajan; Bedi, R. K.; Mahajan, Aman, E-mail: dramanmahajan@yahoo.co.in, E-mail: anshulsharma.phy@gmail.com [Material Science Laboratory, Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Kumar, Pankaj [Department of Applied Sciences, I.K. Gujral Punjab Technical University, Kapurthala 144601 (India)

    2016-05-06

    A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC{sub 8}/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC{sub 8} derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO{sub 2}, NO, Cl{sub 2} and NH{sub 3} at operating temperature of 150°C. It has been demonstrated that for Cl{sub 2} minimum detection limit of CuPcOC{sub 8}/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl{sub 2}.

  12. Kinetic response study in chemiresistive gas sensor based on carbon nanotube surface functionalized with substituted phthalocyanines

    Science.gov (United States)

    Sharma, Anshul Kumar; Kumar, Pankaj; Saini, Rajan; Bedi, R. K.; Mahajan, Aman

    2016-05-01

    A kind of hybrid material is prepared by functionalizing multi-wall carbon nanotubes (MWCNTs-COOH) with substituted copper phthalocyanine and the formation of CuPcOC8/MWCNTs-COOH hybrid is confirmed by scanning electron microscopy and transmission electron microscopy. The results indicated that on the surface of nanotubes substituted CuPcOC8 derivatives has been successfully anchored through π-π stacking interaction. The gas sensing application of the fabricated hybrid material is tested upon exposure to different hazardous species, specifically NO2, NO, Cl2 and NH3 at operating temperature of 150˚C. It has been demonstrated that for Cl2 minimum detection limit of CuPcOC8/MWCNTs-COOH hybrid is 100 ppb. The response of hybrid sensor is found to be increased with increase in the concentration of Cl2.

  13. B-site substituted solid solutions on the base of sodium-bismuth titanate

    Directory of Open Access Journals (Sweden)

    V. M. Ishchuk

    2016-12-01

    Full Text Available The paper presents results of studies of the formation of phases during the solid-state synthesis in the [(Na0.5Bi0.50.80Ba0.20](Ti1–yByO3 system of solid solutions with B-site substitutions. The substitutions by zirconium, tin and ion complexes (In0.5Nb0.5 and (Fe0.5Nb0.5 have been studied. It has been found that the synthesis is a multi-step process associated with the formation of a number of intermediate phases (depending on the compositions and calcination temperatures. Single-phase solid solutions have been produced at the calcination temperatures in the interval 1000–1100∘C. An increase in the substituting ions concentration leads to a linear increase of the crystal cell size. At the same time, the tolerance factor gets reduced boosting the stability of the antiferroelectric phase as compared to that of the ferroelectric phase.

  14. Enhancement of plasticity of Fe-based bulk metallic glass by Ni substitution for Fe

    Energy Technology Data Exchange (ETDEWEB)

    Guo, S.F. [State Key Laboratory of Material Processing and Die and Mould Technology, Huazhong University of Science and Technology, 430074 Wuhan (China); State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Beijing 100083 (China); Li, N.; Zhang, C. [State Key Laboratory of Material Processing and Die and Mould Technology, Huazhong University of Science and Technology, 430074 Wuhan (China); Liu, L., E-mail: sfguo2005@163.co [State Key Laboratory of Material Processing and Die and Mould Technology, Huazhong University of Science and Technology, 430074 Wuhan (China)

    2010-08-15

    Bulk metallic glasses (BMGs) (Fe{sub 1-x}Ni{sub x}){sub 71}Mo{sub 5}P{sub 12}C{sub 10}B{sub 2} (x = 0, 0.1 and 0.2) with a diameter of 3 mm were synthesized by copper mold casting. The effect of Ni substitution for Fe on the structure, thermal and mechanical properties has been studied by X-ray diffraction (XRD), differential scanning calorimetry (DSC) and compressive testing. It was found that the substitution of Ni for Fe enhances the glass forming ability, and improves the plasticity of Fe{sub 71}Mo{sub 5}P{sub 12}C{sub 10}B{sub 2} BMG as indicated by the increase in the plastic strain from 3.1% (x = 0) to 5.2% (x = 0.2). The improvement of the plasticity is discussed in term of the reduction of glass transition temperature and the supercooled liquid region due to the substitution of Ni for Fe.

  15. Electrochemical DNA biosensor based on the BDD nanograss array electrode.

    Science.gov (United States)

    Jin, Huali; Wei, Min; Wang, Jinshui

    2013-04-10

    The development of DNA biosensor has attracted considerable attention due to their potential applications, including gene analysis, clinical diagnostics, forensic study and more medical applications. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry in this study. Electrochemical DNA biosensor was developed based on the BDD film electrode (fBDD) and BDD nanograss array electrode (nBDD). In comparison with fBDD and AuNPs/CA/fBDD electrode, the lower semicircle diameter of electrochemical impedance spectroscopy obtained on nBDD and AuNPs/CA/nBDD electrode indicated that the presence of nanograss array improved the reactive site, reduced the interfacial resistance, and made the electron transfer easier. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry. The experimental results demonstrated that the prepared AuNPs/CA/nBDD electrode was suitable for DNA hybridization with favorable performance of faster response, higher sensitivity, lower detection limit and satisfactory selectivity, reproducibility and stability.

  16. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Substitutional analysis

    CERN Document Server

    Rutherford, Daniel Edwin

    2013-01-01

    Classic monograph, suitable for advanced undergraduates and graduate students. Topics include calculus of permutations and tableaux, semi-normal representation, orthogonal and natural representations, group characters, and substitutional equations. 1968 edition.

  18. A Colour Image Encryption Scheme Using Permutation-Substitution Based on Chaos

    Directory of Open Access Journals (Sweden)

    Xing-Yuan Wang

    2015-06-01

    Full Text Available An encryption scheme for colour images using a spatiotemporal chaotic system is proposed. Initially, we use the R, G and B components of a colour plain-image to form a matrix. Then the matrix is permutated by using zigzag path scrambling. The resultant matrix is then passed through a substitution process. Finally, the ciphered colour image is obtained from the confused matrix. Theoretical analysis and experimental results indicate that the proposed scheme is both secure and practical, which make it suitable for encrypting colour images of any size.

  19. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  20. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva

    2016-06-10

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  1. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva; Borja, Á ngel; Irigoien, Xabier; Rodrí guez-Ezpeleta, Naiara

    2016-01-01

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  2. Nanostructured silicate substituted calcium phosphate (NanoSiCaPs) nanoparticles — Efficient calcium phosphate based non-viral gene delivery systems

    Energy Technology Data Exchange (ETDEWEB)

    Shekhar, Sudhanshu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States); McGowan Institute of Regenerative Medicine, University of Pittsburgh, PA 15261 (United States); Roy, Abhijit; Hong, Daeho [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Chemical Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Mechanical Engineering and Materials Science, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States); McGowan Institute of Regenerative Medicine, University of Pittsburgh, PA 15261 (United States)

    2016-12-01

    Nanostructured ceramic particles, particularly, nanoparticles of calcium phosphate (CaP) remain an attractive option among the various types of non-viral gene delivery vectors studied because of their safety, biocompatibility, biodegradability, and ease of handling as well as their adsorptive capacity for DNA. We have accordingly developed an enhanced version of nanostructured calcium phosphates (NanoCaPs), by substituting known amounts of silicate for phosphate in the hydroxyapatite (HA) lattice (NanoSiCaPs). Results indicate that in addition to the excellent transfection levels exhibited by un-substituted NanoCaPs alone in vitro, an additional 20–50% increase in transfection is observed for NanoCaPs containing 8.3–50 mol% silicate aptly called NanoSiCaPs, owing to its rapid dissolution properties enabling nanoparticles escaping the lysosomal degradation. However, high silicate substitution (> 50 mol%) resulted in a drastic decline in transfection as the synthesized NanoCaPs deviated far from the characteristic hydroxyapatite phase formed as evidenced by the materials characterization results. - Highlights: • Successful demonstration of nanostructured NanoSiCaPs formation • Demonstration of superior transfection of NanoSiCaPs contrasted to NanoCaPs • Silicate substitution leads to smaller aggregates of nanoparticle complexes. • Enhanced dissolution of NanoSiCaPs demonstrated • Faster NanoSiCaPs dissolution leads to escape of pDNA from lysosomal degradation.

  3. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  4. Novel organic dyes based on phenyl-substituted benzimidazole for dye sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Saltan, Gözde Murat [Department of Chemistry, Faculty of Arts and Science, Celal Bayar University, Yunus Emre, 45140 Manisa (Turkey); Dinçalp, Haluk, E-mail: haluk.dincalp@cbu.edu.tr [Department of Chemistry, Faculty of Arts and Science, Celal Bayar University, Yunus Emre, 45140 Manisa (Turkey); Kıran, Merve; Zafer, Ceylan [Solar Energy Institute, Ege University, Bornova, 35100 Izmir (Turkey); Erbaş, Seçil Çelik [Celal Bayar University, Materials Engineering Department, Faculty of Engineering, Yunus Emre, 45140 Manisa (Turkey)

    2015-08-01

    Two new sensitizers derived from benzimidazole core for dye-sensitized solar cell (DSSC) applications were designed and synthesized as D–π–A structures, in which two phenyl-substituted benzimidazole group, a phenyl ring and a cyanoacrylic acid were used as the electron donor, π-conjugated linkage and the electron acceptor, respectively. Effect of methoxy- and N,N-dimetylamino- moieties attached to the phenyl groups of benzimidazole were investigated by means of optical and photovoltaic measurements. The compounds exhibit broad absorption maximum at 387 nm with the tail extending up to 500 nm on TiO{sub 2}-coated thin film. The longer wavelength absorption band around 360 nm and the much longer decay components could be attributed to the existence of charge transfer state of the dyes in solutions. DSSC device fabricated by using methoxy substituted dye (BI5a) as a sensitizer shows much better incident photon-to-current conversion efficiency (IPCE) of 64% giving cell efficiency of 2.68%. - Graphical abstract: Display Omitted - Highlights: • Long decay times suggest the delayed fluorescence caused by the existence of ICT. • The best solar energy conversion efficiency was obtained for BI5a dye (2.68%). • More fluorescent BI5a dye gives higher photocurrent generation.

  5. An evaluation of Substitute natural gas production from different coal gasification processes based on modeling

    International Nuclear Information System (INIS)

    Karellas, S.; Panopoulos, K.D.; Panousis, G.; Rigas, A.; Karl, J.; Kakaras, E.

    2012-01-01

    Coal and lignite will play a significant role in the future energy production. However, the technical options for the reduction of CO 2 emissions will define the extent of their share in the future energy mix. The production of synthetic or substitute natural gas (SNG) from solid fossil fuels seems to be a very attractive process: coal and lignite can be upgraded into a methane rich gas which can be transported and further used in high efficient power systems coupled with CO 2 sequestration technologies. The aim of this paper is to present a modeling analysis comparison between substitute natural gas production from coal by means of allothermal steam gasification and autothermal oxygen gasification. In order to produce SNG from syngas several unit operations are required such as syngas cooling, cleaning, potential compression and, of course, methanation reactors. Finally the gas which is produced has to be conditioned i.e. removal of unwanted species, such as CO 2 etc. The heat recovered from the overall process is utilized by a steam cycle, producing power. These processes were modeled with the computer software IPSEpro™. An energetic and exergetic analysis of the coal to SNG processes have been realized and compared. -- Highlights: ► The production of SNG from coal is examined. ► The components of the process were simulated for integrated autothermal or allothermal coal gasification to SNG. ► The energetic and exergetic evaluation of the two processes is presented.

  6. Manganese(I-Based CORMs with 5-Substituted 3-(2-PyridylPyrazole Ligands

    Directory of Open Access Journals (Sweden)

    Ralf Mede

    2017-01-01

    Full Text Available The reaction of [(OC5MnBr] with substituted 3-(2-pyridylpyrazoles 2-PyPzRH (1a-l in methanol or diethyl ether yields the yellow to orange manganese(I complexes [(OC3Mn(Br(2-PyPzRH] (2a-l, the substituents R being phenyl (a, 1-naphthyl (b, 2-anthracenyl (c, 1-pyrenyl (d, 4-bromophenyl (e, 3-bromophenyl (f, duryl (g, 2-pyridyl (h, 2-furanyl (i, 2-thienyl (j, ferrocenyl (k, and 1-adamantyl (l. The carbonyl ligands are arranged facially, leading to three chemically different CO ligands due to different trans-positioned Lewis donors. The diversity of the substituent R demonstrates that this photoCORM backbone can easily be varied with a negligible influence on the central (OC3MnBr fragment, because the structural parameters and the spectroscopic data of this unit are very similar for all these derivatives. Even the ferrocenyl complex 2k shows a redox potential for the ferrocenyl subunit which is identical to the value of the free 5-ferrocenyl-3-(2-pyridylpyrazole (1k. The ease of variation of the starting 5-substituted 3-(2-pyridylpyrazoles offers a modular system to attach diverse substituents at the periphery of the photoCORM complex.

  7. Thermoelectric properties of In-substituted Ge-based clathrates prepared by HPHT

    Directory of Open Access Journals (Sweden)

    Binwu Liu

    2018-03-01

    Full Text Available Bulk materials Ba8Ga16InxGe30-x (x = 0.5, 1.0, 1.5 were prepared by High-Pressure and High-Temperature (HPHT method and the crystal structure has been confirmed by X-ray diffraction and cell refinement. The actual In composition was much lower than the starting composition, and lattice constants increased with the increase of substitution. As the temperature increased, the Seebeck coefficient and electrical resistivity increased first and then decreased, while the thermal conductivity was the opposite, which leads to significant enhancement on thermoelectric properties of the clathrates. The substitution of indium elements decreased the seebeck coefficient and electrical resistivity, and also changed the microstructure of the compounds. A minimum thermal conductivity of 0.84 Wm−1K−1 was obtained, and a good ZT value of 0.52 was achieved. The grain boundaries and lattice defects generated by high pressure can effectively scatter phonons of different frequencies, which reduce the lattice thermal conductivity.

  8. Novel organic dyes based on phenyl-substituted benzimidazole for dye sensitized solar cells

    International Nuclear Information System (INIS)

    Saltan, Gözde Murat; Dinçalp, Haluk; Kıran, Merve; Zafer, Ceylan; Erbaş, Seçil Çelik

    2015-01-01

    Two new sensitizers derived from benzimidazole core for dye-sensitized solar cell (DSSC) applications were designed and synthesized as D–π–A structures, in which two phenyl-substituted benzimidazole group, a phenyl ring and a cyanoacrylic acid were used as the electron donor, π-conjugated linkage and the electron acceptor, respectively. Effect of methoxy- and N,N-dimetylamino- moieties attached to the phenyl groups of benzimidazole were investigated by means of optical and photovoltaic measurements. The compounds exhibit broad absorption maximum at 387 nm with the tail extending up to 500 nm on TiO 2 -coated thin film. The longer wavelength absorption band around 360 nm and the much longer decay components could be attributed to the existence of charge transfer state of the dyes in solutions. DSSC device fabricated by using methoxy substituted dye (BI5a) as a sensitizer shows much better incident photon-to-current conversion efficiency (IPCE) of 64% giving cell efficiency of 2.68%. - Graphical abstract: Display Omitted - Highlights: • Long decay times suggest the delayed fluorescence caused by the existence of ICT. • The best solar energy conversion efficiency was obtained for BI5a dye (2.68%). • More fluorescent BI5a dye gives higher photocurrent generation

  9. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  10. Cloud-based adaptive exon prediction for DNA analysis.

    Science.gov (United States)

    Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen

    2018-02-01

    Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.

  11. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  12. DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis

    Science.gov (United States)

    Lucena-Aguilar, Gema; Sánchez-López, Ana María; Barberán-Aceituno, Cristina; Carrillo-Ávila, José Antonio; López-Guerrero, José Antonio

    2016-01-01

    High-quality human DNA samples and associated information of individuals are necessary for biomedical research. Biobanks act as a support infrastructure for the scientific community by providing a large number of high-quality biological samples for specific downstream applications. For this purpose, biobank methods for sample preparation must ensure the usefulness and long-term functionality of the products obtained. Quality indicators are the tool to measure these parameters, the purity and integrity determination being those specifically used for DNA. This study analyzes the quality indicators in DNA samples derived from 118 frozen human tissues in optimal cutting temperature (OCT) reactive, 68 formalin-fixed paraffin-embedded (FFPE) tissues, 119 frozen blood samples, and 26 saliva samples. The results obtained for DNA quality are discussed in association with the usefulness for downstream applications and availability of the DNA source in the target study. In brief, if any material is valid, blood is the most approachable option of prospective collection of samples providing high-quality DNA. However, if diseased tissue is a requisite or samples are available, the recommended source of DNA would be frozen tissue. These conclusions will determine the best source of DNA, according to the planned downstream application. Furthermore our results support the conclusion that a complete procedure of DNA quantification and qualification is necessary to guarantee the appropriate management of the samples, avoiding low confidence results, high costs, and a waste of samples. PMID:27158753

  13. Structural and physico-chemical analysis of calcium/strontium substituted, near-invert phosphate based glasses for biomedical applications.

    Science.gov (United States)

    Patel, U; Moss, R M; Hossain, K M Z; Kennedy, A R; Barney, E R; Ahmed, I; Hannon, A C

    2017-09-15

    Neutron diffraction, 23 Na and 31 P NMR, and FTIR spectroscopy have been used to investigate the structural effects of substituting CaO with SrO in a 40P 2 O 5 ·(16-x)CaO·20Na 2 O·24MgO·xSrO glass, where x is 0, 4, 8, 12 and 16mol%. The 31 P solid-state NMR results showed similar amounts of Q 1 and Q 2 units for all of the multicomponent glasses investigated, showing that the substitution of Sr for Ca has no effect on the phosphate network. The M-O coordinations (M=Mg, Ca, Sr, Na) were determined for binary alkali and alkaline earth metaphosphates using neutron diffraction and broad asymmetric distributions of bond length were observed, with coordination numbers that were smaller and bond lengths that were shorter than in corresponding crystals. The Mg-O coordination number was determined most reliably as 5.0(2). The neutron diffraction results for the multicomponent glasses are consistent with a structural model in which the coordination of Ca, Sr and Na is the same as in the binary metaphosphate glass, whereas there is a definite shift of Mg-O bonds to longer distance. There is also a small but consistent increase in the Mg-O coordination number and the width of the distribution of Mg-O bond lengths, as Sr substitutes for Ca. Functional properties, including glass transition temperatures, thermal processing windows, dissolution rates and ion release profiles were also investigated. Dissolution studies showed a decrease in dissolution rate with initial addition of 4mol% SrO, but further addition of SrO showed little change. The ion release profiles followed a similar trend to the observed dissolution rates. The limited changes in structure and dissolution rates observed for substitution of Ca with Sr in these fixed 40mol% P 2 O 5 glasses were attributed to their similarities in terms of ionic size and charge. Phosphate based glasses are extremely well suited for the delivery of therapeutic ions in biomedical applications, and in particular strontium plays an

  14. DNA based identification of medicinal materials in Chinese patent medicines

    Science.gov (United States)

    Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo

    2012-12-01

    Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.

  15. Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization

    International Nuclear Information System (INIS)

    Liu, P.; Hun, X.; Qing, H.

    2011-01-01

    We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)

  16. Prediction of the enthalpies of vaporization for room-temperature ionic liquids: Correlations and a substitution-based additive scheme

    International Nuclear Information System (INIS)

    Kabo, Gennady J.; Paulechka, Yauheni U.; Zaitsau, Dzmitry H.; Firaha, Alena S.

    2015-01-01

    Highlights: • The available literature data on Δ l g H for ionic liquids were analyzed. • Correlation equations for Δ l g H were derived using symbolic regression. • A substitution-based incremental scheme for Δ l g H was developed. • The proposed scheme has an advantage over the existing predictive procedures. - Abstract: The literature data on the enthalpies of vaporization for aprotic ionic liquids (ILs) published by the end of May 2014 were analyzed and the most reliable Δ l g H m values were derived for 68 ILs. The selected enthalpies of vaporization were correlated with density and surface tension using symbolic regression and a number of effective correlation equations were proposed. The substitution-based incremental scheme for prediction of the enthalpies of vaporization of imidazolium, pyridinium and pyrrolidinium ILs was developed. The standard error of the regression for the developed scheme is significantly lower than that for the atom-based group-contribution schemes proposed earlier

  17. Refractive shifts in four selected artificial vitreous substitutes based on Gullstrand-Emsley and Liou-Brennan schematic eyes.

    Science.gov (United States)

    Gao, Qianying; Chen, Xiang; Ge, Jian; Liu, Yongji; Jiang, Zhaoxin; Lin, Zhi; Liu, Yaqin

    2009-07-01

    To determine and compare the refractive shifts based on Gullstrand-Emsley and Liou-Brennan schematic eyes after filling them with four selected artificial vitreous substitutes: silicone oil, heavy silicone oil, hydrogels, and encapsuled balanced salt solution. The optical constants of artificial vitreous body-filled eyes were calculated based on Gullstrand-Emsley and Liou-Brennan schematic eyes with accommodation relaxed. The theoretical refractive shifts in these two models were compared in pars plana vitrectomy (PPV), PPV plus lensectomized and PPV plus intraocular lens (IOL) eyes after four artificial vitreous tamponades. The Gullstrand-Emsley schematic eye shows refractive shifts of +8.710, -4.544, +1.136, and -0.338 D in PPV eyes; +11.044, +20.332, +16.351, and +17.413 D in PPV plus lensectomized eyes; and the need for IOL powers of +22.195, +22.366, +22.292, and +22.312 D in PPV plus IOL eyes in silicone oil, heavy silicone oil, hydrogels, and encapsuled balanced salt solution tamponade eyes, respectively. Similarly, the Liou-Brennan schematic eye induced shifts of +6.260, -3.266, +0.817, and -0.272 D in PPV eyes; +13.181, +20.654, +17.451, and +18.305 D in PPV plus lensectomized eyes; and the need IOL powers of +13.522, +23.767, +19.389, and +20.558 D in PPV plus IOL eyes, respectively. The Gullstrand-Emsley schematic eye is a convenient and accurate model for predicting refractive shifts for hydrogels and encapsuled balanced salt solution substitutes in PPV eyes. The Liou-Brennan schematic eye is recommended for silicone oil and heavy silicone oil in PPV eyes and for all four substitutes in PPV plus lensectomized eyes and PPV plus IOL eyes. In addition, the encapsuled balanced salt solution changes the refraction little in either schematic eye.

  18. Tuning glass formation and brittle behaviors by similar solvent element substitution in (Mn,Fe)-based bulk metallic glasses

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Tao [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Li, Ran, E-mail: liran@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Xiao, Ruijuan [Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Liu, Gang [State Key Laboratory for Mechanical Behavior of Materials, School of Materials Science and Engineering, Xi' an Jiaotong University, Xi' an 710049 (China); Wang, Jianfeng [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001 (China); Zhang, Tao, E-mail: zhangtao@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China)

    2015-02-25

    A family of Mn-rich bulk metallic glasses (BMGs) was developed through the similar solvent elements (SSE) substitution of Mn for Fe in (Mn{sub x}Fe{sub 80−x})P{sub 10}B{sub 7}C{sub 3} alloys. The effect of the SSE substitution on glass formation, thermal stability, elastic constants, mechanical properties, fracture morphologies, Weibull modulus and indentation fracture toughness was discussed. A thermodynamics analysis provided by Battezzati et al. (L. Battezzati, E. Garrone, Z. Metallkd. 75 (1984) 305–310) was adopted to explain the compositional dependence of the glass-forming ability (GFA). The elastic moduli follow roughly linear correlations with the substitution concentration of Mn in (Mn{sub x}Fe{sub 80−x})P{sub 10}B{sub 7}C{sub 3} BMGs. The introduction of Mn to replace Fe significantly decreases the plasticity of the resulting BMGs and the Weibull modulus of the fracture strength. A super-brittle Mn-based BMGs of (Mn{sub 55}Fe{sub 25})P{sub 10}B{sub 7}C{sub 3} BMGs were found with the indentation fracture toughness (K{sub c}) of 1.91±0.04 MPa m{sup 1/2}, the lowest value among all kinds of BMGs so far. The atomic and electronic structure of the selected BMGs were simulated by the first principles molecular dynamics calculations based on density functional theory, which provided a possible understanding of the brittleness caused by the similar chemical element replacement of Mn for Fe.

  19. Yttrium-substituted nanocrystalline TiO 2 photoanodes for perovskite based heterojunction solar cells

    KAUST Repository

    Qin, Peng; Domanski, Anna L.; Chandiran, Aravind Kumar; Berger, Rü diger; Butt, Hans-Jü rgen; Dar, M. Ibrahim; Moehl, Thomas; Tetreault, Nicolas; Gao, Peng; Ahmad, Shahzada; Nazeeruddin, Mohammad K.; Grä tzel, Michael

    2014-01-01

    We report the use of Y3+-substituted TiO2 (0.5%Y-TiO2) in solid-state mesoscopic solar cells, consisting of CH3NH3PbI3 as the light harvester and spiro-OMeTAD as the hole transport material. A power conversion efficiency of 11.2% under simulated AM 1.5 full sun illumination was measured. A 15% improvement in the short-circuit current density was obtained compared with pure TiO2, due to the effect of Y3+ on the dimensions of perovskite nanoparticles formed on the semiconductor surface, showing that the surface modification of the semiconductor is an effective way to improve the light harvesters' morphology and electron transfer properties in the solid-state mesoscopic solar cells. © 2013 The Royal Society of Chemistry.

  20. Carbon-centered radicals in γ-irradiated bone substituting biomaterials based on hydroxyapatite.

    Science.gov (United States)

    Sadlo, Jaroslaw; Strzelczak, Grazyna; Lewandowska-Szumiel, Malgorzata; Sterniczuk, Marcin; Pajchel, Lukasz; Michalik, Jacek

    2012-09-01

    Gamma irradiated synthetic hydroxyapatite, bone substituting materials NanoBone(®) and HA Biocer were examined using EPR spectroscopy and compared with powdered human compact bone. In every case, radiation-induced carbon centered radicals were recorded, but their molecular structures and concentrations differed. In compact bone and synthetic hydroxyapatite the main signal assigned to the CO(2) (-) anion radical was stable, whereas the signal due to the CO(3) (3-) radical dominated in NanoBone(®) and HA Biocer just after irradiation. However, after a few days of storage of these samples, also a CO(2) (-) signal was recorded. The EPR study of irradiated compact bone and the synthetic graft materials suggest that their microscopic structures are different. In FT-IR spectra of NanoBone(®), HA Biocer and synthetic hydroxyapatite the HPO(4) (2-) and CO(3) (2-) in B-site groups are detected, whereas in compact bone signals due to collagen dominate.

  1. Yttrium-substituted nanocrystalline TiO 2 photoanodes for perovskite based heterojunction solar cells

    KAUST Repository

    Qin, Peng

    2014-01-01

    We report the use of Y3+-substituted TiO2 (0.5%Y-TiO2) in solid-state mesoscopic solar cells, consisting of CH3NH3PbI3 as the light harvester and spiro-OMeTAD as the hole transport material. A power conversion efficiency of 11.2% under simulated AM 1.5 full sun illumination was measured. A 15% improvement in the short-circuit current density was obtained compared with pure TiO2, due to the effect of Y3+ on the dimensions of perovskite nanoparticles formed on the semiconductor surface, showing that the surface modification of the semiconductor is an effective way to improve the light harvesters\\' morphology and electron transfer properties in the solid-state mesoscopic solar cells. © 2013 The Royal Society of Chemistry.

  2. A DNA-based nanomechanical device with three robust states

    OpenAIRE

    Chakraborty, Banani; Sha, Ruojie; Seeman, Nadrian C.

    2008-01-01

    DNA has been used to build a variety of devices, ranging from those that are controlled by DNA structural transitions to those that are controlled by the addition of specific DNA strands. These sequence-dependent devices fulfill the promise of DNA in nanotechnology because a variety of devices in the same physical environment can be controlled individually. Many such devices have been reported, but most of them contain one or two structurally robust end states, in addition to a floppy interme...

  3. Statistical length of DNA based on AFM image measured by a computer

    International Nuclear Information System (INIS)

    Chen Xinqing; Qiu Xijun; Zhang Yi; Hu Jun; Wu Shiying; Huang Yibo; Ai Xiaobai; Li Minqian

    2001-01-01

    Taking advantage of image processing technology, the contour length of DNA molecule was measured automatically by a computer. Based on the AFM image of DNA, the topography of DNA was simulated into a curve. Then the DNA length was measured automatically by inserting mode. It was shown that the experimental length of a naturally deposited DNA (180.4 +- 16.4 nm) was well consistent with the theoretical length (185.0 nm). Comparing to other methods, the present approach had advantages of precision and automatism. The stretched DNA was also measured. It present approach had advantages of precision and automatism. The stretched DNA was also measured. It was shown that the experimental length (343.6 +- 20.7 nm) was much longer than the theoretical length (307.0 nm). This result indicated that the stretching process had a distinct effect on the DNA length. However, the method provided here avoided the DNA-stretching effect

  4. Design and specificity of long ssDNA donors for CRISPR-based knock-in

    OpenAIRE

    Leonetti, Manuel; Li, Han; Beckman, Kyle; Pessino, Veronica; Huang, Bo; Weissman, Jonathan

    2017-01-01

    CRISPR/Cas technologies have transformed our ability to manipulate genomes for research and gene-based therapy. In particular, homology-directed repair after genomic cleavage allows for precise modification of genes using exogenous donor sequences as templates. While both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) forms of donors have been used as repair templates, a systematic comparison of the performance and specificity of repair using ssDNA versus dsDNA donors is still la...

  5. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  6. Electrochemical DNA biosensor based on MNAzyme-mediated signal amplification

    International Nuclear Information System (INIS)

    Diao, Wei; Tang, Min; Ding, Xiaojuan; Zhang, Ye; Yang, Jianru; Cheng, Wenbin; Mo, Fei; Wen, Bo; Xu, Lulu; Yan, Yurong

    2016-01-01

    The authors describe an electrochemical sensing strategy for highly sensitive and specific detection of target (analyte) DNA based on an amplification scheme mediated by a multicomponent nucleic acid enzyme (MNAzyme). MNAzymes were formed by multicomponent complexes which produce amplified “output” signals in response to specific “input” signal. In the presence of target nucleic acid, multiple partial enzymes (partzymes) oligonucleotides are assembled to form active MNAzymes. These can cleave H0 substrate into two pieces, thereby releasing the activated MNAzyme to undergo an additional cycle of amplification. Here, the two pieces contain a biotin-tagged sequence and a byproduct. The biotin-tagged sequences are specifically captured by the detection probes immobilized on the gold electrode. By employing streptavidinylated alkaline phosphatase as an enzyme label, an electrochemical signal is obtained. The electrode, if operated at a working potential of 0.25 V (vs. Ag/AgCl) in solution of pH 7.5, covers the 100 pM to 0.25 μM DNA concentration range, with a 79 pM detection limit. In our perception, the strategy introduced here has a wider potential in that it may be applied to molecular diagnostics and pathogen detection. (author)

  7. Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

    Science.gov (United States)

    Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

    2017-11-01

    The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

  8. A history of the DNA repair and mutagenesis field: The discovery of base excision repair.

    Science.gov (United States)

    Friedberg, Errol C

    2016-01-01

    This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.

  9. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  11. PCR-based detection of a rare linear DNA in cell culture.

    Science.gov (United States)

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  12. Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

    Science.gov (United States)

    Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

    2011-02-01

    RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity

    NARCIS (Netherlands)

    Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard

    2008-01-01

    This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to

  14. Operator substitution

    NARCIS (Netherlands)

    Hautus, M.L.J.

    1994-01-01

    Substitution of an operator into an operator-valued map is defined and studied. A Bezout-type remainder theorem is used to derive a number of results. The tensor map is used to formulate solvability conditions for linear matrix equations. Some applications to system theory are given, in particular

  15. Solvent substitution

    International Nuclear Information System (INIS)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general ''Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated

  16. Tonemic Substitution

    African Journals Online (AJOL)

    Ezenwafor

    grammatical constructions. The choice of substitutable tonemes as observed from the analyzed data is highly. Ezenwafordependent on the intuitive judgement of the native speaker. This work shows with adequate data, that regular tonemic changes are not always meaningful in Ekwulobia lect. Such tonemic alternations are ...

  17. Solvent substitution

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated.

  18. Ab initio study of effect of Co substitution on the magnetic properties of Ni and Pt-based Heusler alloys

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Tufan, E-mail: tufanroyburdwan@gmail.com [Theory and Simulations Lab, HRDS, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India); Homi Bhabha National Institute, Training School Complex, Anushaktinagar, Mumbai 400094 (India); Chakrabarti, Aparna [Theory and Simulations Lab, HRDS, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India); Homi Bhabha National Institute, Training School Complex, Anushaktinagar, Mumbai 400094 (India)

    2017-04-25

    Using density functional theory based calculations, we have carried out in-depth studies of effect of Co substitution on the magnetic properties of Ni and Pt-based shape memory alloys. We show the systematic variation of the total magnetic moment, as a function of Co doping. A detailed analysis of evolution of Heisenberg exchange coupling parameters as a function of Co doping has been presented here. The strength of RKKY type of exchange interaction is found to decay with the increase of Co doping. We calculate and show the trend, how the Curie temperature of the systems vary with the Co doping. - Highlights: • We discuss the effects of Co doping on magnetic properties of Ni/Pt based Heusler alloys. • Indirect RKKY interaction is maximum for shape memory alloy like systems. • We predict Pt{sub 2}MnSn as a probable ferromagnetic shape memory alloy.

  19. Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

    Science.gov (United States)

    Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

    2018-01-01

    Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

  20. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Science.gov (United States)

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. DNA methylation-based classification of central nervous system tumours

    DEFF Research Database (Denmark)

    Capper, David; Jones, David T.W.; Sill, Martin

    2018-01-01

    Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging - with substantial inter-observer variabil......Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging - with substantial inter......-observer variability in the histopathological diagnosis of many tumour types. Here we present a comprehensive approach for the DNA methylation-based classification of central nervous system tumours across all entities and age groups, and demonstrate its application in a routine diagnostic setting. We show...

  2. A sequence-dependent rigid-base model of DNA

    Science.gov (United States)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

    2013-02-01

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  3. A sequence-dependent rigid-base model of DNA.

    Science.gov (United States)

    Gonzalez, O; Petkevičiūtė, D; Maddocks, J H

    2013-02-07

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  4. DNA microarray-based PCR ribotyping of Clostridium difficile.

    Science.gov (United States)

    Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian

    2015-02-01

    This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Potentiometric investigation of acid dissociation and anionic homoconjugation equilibria of substituted phenols in dimethyl sulfoxide[Substituted phenols; Acid-base equilibria; Dimethyl sulfoxide (DMSO); Potentiometry

    Energy Technology Data Exchange (ETDEWEB)

    Czaja, Malgorzata; Kozak, Anna; Makowski, Mariusz; Chmurzynski, Lech. E-mail: lech@chemik.chem.univ.gda.pl

    2003-10-01

    Standard acidity constants, K{sub a}{sup DMSO} (HA), expressed as pK{sub a}{sup DMSO} (HA) values, and anionic homoconjugation constants, K{sup DMSO}{sub AHA{sup -}}, (in the form of lg K{sup DMSO}{sub AHA{sup -}} values) have been determined for 11 substituted phenol-phenolate systems a polar protophilic aprotic solvent, dimethyl sulfoxide (DMSO) with a potentiometric titration. A linear relationship has been determined between lg K{sup DMSO}{sub AHA{sup -}} and pK{sub a}{sup DMSO} (HA). The tendency towards anionic homoconjugation in these systems increases with increasing pK{sub a}{sup DMSO} (HA) that is with declining phenol acidity. The pK{sub a}{sup DMSO} (HA) are correlated with both pK{sub a}{sup W} (HA) water and other polar non-aqeous solvents.

  6. Spectral and holographic characterization of new photochromic compounds based on substituted spiropyrans

    Science.gov (United States)

    Ciapurin, Igor V.; Robu, Stephan V.; Vlad, Lyudmila A.; Lessard, Roger A.; Tork, Amir; Lafond, Christophe; Bolte, Michel

    2001-06-01

    We report a new photochromic composite polymer consisting of poly-N-epoxypropylcarbazole (PEPC) polymeric matrix with a nitro-brome-substituted spiropyran (BNSP) photochromic dye. The PEPC + BNSP films can be considered as negative photochromic recording media. They are colored in the initial state and bleached upon irradiation within the visible spectra. When we placed the bleached samples to the darkness, they slowly revert to the colored form. This process has strong temperature dependence, so one can either 'freeze'' or accelerate changing of the current coloration state in the PEPC + BNSP. The experimental measurements are evaluated in conjunction with its potential applications for optical holographic recording in the visible spectral range. The real-time holographic recording procedure in PEPC + BNSP films was studied. The diffraction efficiency values reached the maximum of 23 percent at spatial frequency of 1600 line pairs per mm, during direct hologram recording with the 532 nm Coherent VERDI laser irradiation. Light exposures were ranged from 70 to 280 mJ/cm2. The investigated compounds have good perspectives for use in holography, two-photon optical data storage, electro-optics, and optical-limiting applications due to coupling of some unique properties such as high optical non-linearity, well charge transport, short response times, no-limiting resolution ability, etc.

  7. Blindness enhances auditory obstacle circumvention: Assessing echolocation, sensory substitution, and visual-based navigation.

    Science.gov (United States)

    Kolarik, Andrew J; Scarfe, Amy C; Moore, Brian C J; Pardhan, Shahina

    2017-01-01

    Performance for an obstacle circumvention task was assessed under conditions of visual, auditory only (using echolocation) and tactile (using a sensory substitution device, SSD) guidance. A Vicon motion capture system was used to measure human movement kinematics objectively. Ten normally sighted participants, 8 blind non-echolocators, and 1 blind expert echolocator navigated around a 0.6 x 2 m obstacle that was varied in position across trials, at the midline of the participant or 25 cm to the right or left. Although visual guidance was the most effective, participants successfully circumvented the obstacle in the majority of trials under auditory or SSD guidance. Using audition, blind non-echolocators navigated more effectively than blindfolded sighted individuals with fewer collisions, lower movement times, fewer velocity corrections and greater obstacle detection ranges. The blind expert echolocator displayed performance similar to or better than that for the other groups using audition, but was comparable to that for the other groups using the SSD. The generally better performance of blind than of sighted participants is consistent with the perceptual enhancement hypothesis that individuals with severe visual deficits develop improved auditory abilities to compensate for visual loss, here shown by faster, more fluid, and more accurate navigation around obstacles using sound.

  8. Blindness enhances auditory obstacle circumvention: Assessing echolocation, sensory substitution, and visual-based navigation.

    Directory of Open Access Journals (Sweden)

    Andrew J Kolarik

    Full Text Available Performance for an obstacle circumvention task was assessed under conditions of visual, auditory only (using echolocation and tactile (using a sensory substitution device, SSD guidance. A Vicon motion capture system was used to measure human movement kinematics objectively. Ten normally sighted participants, 8 blind non-echolocators, and 1 blind expert echolocator navigated around a 0.6 x 2 m obstacle that was varied in position across trials, at the midline of the participant or 25 cm to the right or left. Although visual guidance was the most effective, participants successfully circumvented the obstacle in the majority of trials under auditory or SSD guidance. Using audition, blind non-echolocators navigated more effectively than blindfolded sighted individuals with fewer collisions, lower movement times, fewer velocity corrections and greater obstacle detection ranges. The blind expert echolocator displayed performance similar to or better than that for the other groups using audition, but was comparable to that for the other groups using the SSD. The generally better performance of blind than of sighted participants is consistent with the perceptual enhancement hypothesis that individuals with severe visual deficits develop improved auditory abilities to compensate for visual loss, here shown by faster, more fluid, and more accurate navigation around obstacles using sound.

  9. Development of selective colorimetric probes for hydrogen sulfide based on nucleophilic aromatic substitution.

    Science.gov (United States)

    Montoya, Leticia A; Pearce, Taylor F; Hansen, Ryan J; Zakharov, Lev N; Pluth, Michael D

    2013-07-05

    Hydrogen sulfide is an important biological signaling molecule and an important environmental target for detection. A major challenge in developing H2S detection methods is separating the often similar reactivity of thiols and other nucleophiles from H2S. To address this need, the nucleophilic aromatic substitution (SNAr) reaction of H2S with electron-poor aromatic electrophiles was developed as a strategy to separate H2S and thiol reactivity. Treatment of aqueous solutions of nitrobenzofurazan (7-nitro-1,2,3-benzoxadiazole, NBD) thioethers with H2S resulted in thiol extrusion and formation of nitrobenzofurazan thiol (λmax = 534 nm). This reactivity allows for unwanted thioether products to be converted to the desired nitrobenzofurazan thiol upon reaction with H2S. The scope of the reaction was investigated using a Hammett linear free energy relationship study, and the determined ρ = +0.34 is consistent with the proposed SN2Ar reaction mechanism. The efficacy of the developed probes was demonstrated in buffer and in serum with associated submicromolar detection limits as low as 190 nM (buffer) and 380 nM (serum). Furthermore, the sigmoidal response of nitrobenzofurazan electrophiles with H2S can be fit to accurately quantify H2S. The developed detection strategy offers a manifold for H2S detection that we foresee being applied in various future applications.

  10. Ionic liquid electrolytes based on multi-methoxyethyl substituted ammoniums and perfluorinated sulfonimides: Preparation, characterization, and properties

    International Nuclear Information System (INIS)

    Han Hongbo; Liu Kai; Feng Shaowei; Zhou Sisi; Feng Wenfang; Nie Jin; Li Hong; Huang Xuejie; Matsumoto, Hajime; Armand, Michel; Zhou Zhibin

    2010-01-01

    Graphical abstract: New functionalized ionic liquids based on multi-methoxyethyl substituted quaternary ammonium cations and perfluorinated sulfonimide anions are introduced. -- Abstract: New functionalized ionic liquids (ILs), comprised of multi-methoxyethyl substituted quaternary ammonium cations (i.e. [N(CH 2 CH 2 OCH 3 ) 4-n (R) n ] + ; n = 1, R = CH 3 OCH 2 CH 2 ; n = 1, R = CH 3 , CH 2 CH 3 ; n = 2, R = CH 3 CH 2 ), and two representative perfluorinated sulfonimide anions (i.e. bis(fluorosulfonyl)imide (FSI - ) and bis(trifluoromethanesulfonyl)imide (TFSI - )), were prepared. Their fundamental properties, including phase transition, thermal stability, viscosity, density, specific conductivity and electrochemical window, were extensively characterized. These multi-ether functionalized ionic liquids exhibit good capability of dissolving lithium salts. Their binary electrolytes containing high concentration of the corresponding lithium salt ([Li + ] >1.6 mol kg -1 ) show Li + ion transference number (t Li + ) as high as 0.6-0.7. Their electrochemical stability allows Li deposition/stripping realized at room temperature. The desired properties of these multi-ether functionalized ionic liquids make them potential electrolytes for Li (or Li-ion) batteries.

  11. Slow elimination of injured liver DNA bases of γ-irradiated old mice

    International Nuclear Information System (INIS)

    Gaziev, A.I.; Malakhov, L.V.; Fomenko, L.A.

    1982-01-01

    The paper presents a study of the elimination of injured bases from the liver DNA of old and young mice after their exposure to γ rays. The presented data show that if DNA from the liver of irradiated mice is treated with incision enzymes, its priming activity is increased. In the case of enzymatic treatment of DNA isolated 5 h after irradiation we find a great difference between the priming activity of the liver DNA of old and young mice. The reason for this difference is that the liver DNA of 20-month old mice 5 h after irradiation still has many unrepaired injured bases. These data indicated that the rate of incision of γ-injured DNA bases in the liver of old mice is lower than in the liver of young mice. In the liver of mice of different age the rate of restitution of DNA, single-strand breaks induced by γ rays in doses up to 100 Gy is the same. At the same time, the level of induced reparative synthesis of DNA in cells of an old organism is lower than in cells of a young organism. The obtained data suggest that reduction of the rate of elimination of modified bases from the cell DNA of 20-month old mice is due to reduction of the activity of the DNA repair enzymes or to restrictions in the chromatin in the access of these enzymes to the injured regions of DNA in the cells of old animals

  12. Fundamental study of the radiation monitoring system based on evaluation of DNA lesions

    International Nuclear Information System (INIS)

    Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.

    2011-01-01

    The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)

  13. Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.

    Science.gov (United States)

    Gryson, Nicolas

    2010-03-01

    The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.

  14. Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor

    Science.gov (United States)

    Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh

    2017-09-01

    The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.

  15. DNA Base Excision Repair (BER) and Cancer Gene Therapy: Use of the Human N-mythlpurien DNA Glycosylase (MPG) to Sensitize Breast Cancer Cells to Low Dose Chemotherapy

    National Research Council Canada - National Science Library

    Harvey, Tia

    2003-01-01

    The DNA Base Excision Repair (PER) pathway is responsible for the repair of alkylation and oxidative DNA damage resulting in protection against the deleterious effects of endogenous and exogenous agents encountered on a daily basis...

  16. The use of gold nanoparticle aggregation for DNA computing and logic-based biomolecular detection

    International Nuclear Information System (INIS)

    Lee, In-Hee; Yang, Kyung-Ae; Zhang, Byoung-Tak; Lee, Ji-Hoon; Park, Ji-Yoon; Chai, Young Gyu; Lee, Jae-Hoon

    2008-01-01

    The use of DNA molecules as a physical computational material has attracted much interest, especially in the area of DNA computing. DNAs are also useful for logical control and analysis of biological systems if efficient visualization methods are available. Here we present a quick and simple visualization technique that displays the results of the DNA computing process based on a colorimetric change induced by gold nanoparticle aggregation, and we apply it to the logic-based detection of biomolecules. Our results demonstrate its effectiveness in both DNA-based logical computation and logic-based biomolecular detection

  17. Phylogeny of the Serrasalmidae (Characiformes based on mitochondrial DNA sequences

    Directory of Open Access Journals (Sweden)

    Guillermo Ortí

    2008-01-01

    Full Text Available Previous studies based on DNA sequences of mitochondrial (mt rRNA genes showed three main groups within the subfamily Serrasalminae: (1 a "pacu" clade of herbivores (Colossoma, Mylossoma, Piaractus; (2 the "Myleus" clade (Myleus, Mylesinus, Tometes, Ossubtus; and (3 the "piranha" clade (Serrasalmus, Pygocentrus, Pygopristis, Pristobrycon, Catoprion, Metynnis. The genus Acnodon was placed as the sister taxon of clade (2+3. However, poor resolution within each clade was obtained due to low levels of variation among rRNA gene sequences. Complete sequences of the hypervariable mtDNA control region for a total of 45 taxa, and additional sequences of 12S and 16S rRNA from a total of 74 taxa representing all genera in the family are now presented to address intragroup relationships. Control region sequences of several serrasalmid species exhibit tandem repeats of short motifs (12 to 33 bp in the 3' end of this region, accounting for substantial length variation. Bayesian inference and maximum parsimony analyses of these sequences identify the same groupings as before and provide further evidence to support the following observations: (a Serrasalmus gouldingi and species of Pristobrycon (non-striolatus form a monophyletic group that is the sister group to other species of Serrasalmus and Pygocentrus; (b Catoprion, Pygopristis, and Pristobrycon striolatus form a well supported clade, sister to the group described above; (c some taxa assigned to the genus Myloplus (M. asterias, M tiete, M ternetzi, and M rubripinnis form a well supported group whereas other Myloplus species remain with uncertain affinities (d Mylesinus, Tometes and Myleus setiger form a monophyletic group.

  18. 2-Substituted dATP Derivatives as Building Blocks for Polymerase-Catalyzed Synthesis of DNA Modified in the Minor Groove

    Czech Academy of Sciences Publication Activity Database

    Matyašovský, Ján; Perlíková, Pavla; Malnuit, Vincent; Pohl, Radek; Hocek, Michal

    2016-01-01

    Roč. 55, č. 51 (2016), s. 15856-15859 ISSN 1433-7851 R&D Projects: GA ČR GA14-04289S EU Projects: European Commission(XE) 642023 - ClickGene Institutional support: RVO:61388963 Keywords : bioconjugation * DNA modification * DNA polymerase * nucleotides * fluorescent labelling Subject RIV: CC - Organic Chemistry Impact factor: 11.994, year: 2016 http://onlinelibrary.wiley.com/doi/10.1002/anie.201609007/full

  19. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  20. Recognition of base J in duplex DNA by J-binding protein

    NARCIS (Netherlands)

    Sabatini, Robert; Meeuwenoord, Nico; van Boom, Jacques H.; Borst, Piet

    2002-01-01

    beta-d-Glucosylhydroxymethyluracil, also called base J, is an unusual modified DNA base conserved among Kinetoplastida. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes. We have previously found a J-binding

  1. Isothermal amplification of environmental DNA (eDNA for direct field-based monitoring and laboratory confirmation of Dreissena sp.

    Directory of Open Access Journals (Sweden)

    Maggie R Williams

    Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a

  2. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. DNA methylation-based classification of central nervous system tumours.

    Science.gov (United States)

    Capper, David; Jones, David T W; Sill, Martin; Hovestadt, Volker; Schrimpf, Daniel; Sturm, Dominik; Koelsche, Christian; Sahm, Felix; Chavez, Lukas; Reuss, David E; Kratz, Annekathrin; Wefers, Annika K; Huang, Kristin; Pajtler, Kristian W; Schweizer, Leonille; Stichel, Damian; Olar, Adriana; Engel, Nils W; Lindenberg, Kerstin; Harter, Patrick N; Braczynski, Anne K; Plate, Karl H; Dohmen, Hildegard; Garvalov, Boyan K; Coras, Roland; Hölsken, Annett; Hewer, Ekkehard; Bewerunge-Hudler, Melanie; Schick, Matthias; Fischer, Roger; Beschorner, Rudi; Schittenhelm, Jens; Staszewski, Ori; Wani, Khalida; Varlet, Pascale; Pages, Melanie; Temming, Petra; Lohmann, Dietmar; Selt, Florian; Witt, Hendrik; Milde, Till; Witt, Olaf; Aronica, Eleonora; Giangaspero, Felice; Rushing, Elisabeth; Scheurlen, Wolfram; Geisenberger, Christoph; Rodriguez, Fausto J; Becker, Albert; Preusser, Matthias; Haberler, Christine; Bjerkvig, Rolf; Cryan, Jane; Farrell, Michael; Deckert, Martina; Hench, Jürgen; Frank, Stephan; Serrano, Jonathan; Kannan, Kasthuri; Tsirigos, Aristotelis; Brück, Wolfgang; Hofer, Silvia; Brehmer, Stefanie; Seiz-Rosenhagen, Marcel; Hänggi, Daniel; Hans, Volkmar; Rozsnoki, Stephanie; Hansford, Jordan R; Kohlhof, Patricia; Kristensen, Bjarne W; Lechner, Matt; Lopes, Beatriz; Mawrin, Christian; Ketter, Ralf; Kulozik, Andreas; Khatib, Ziad; Heppner, Frank; Koch, Arend; Jouvet, Anne; Keohane, Catherine; Mühleisen, Helmut; Mueller, Wolf; Pohl, Ute; Prinz, Marco; Benner, Axel; Zapatka, Marc; Gottardo, Nicholas G; Driever, Pablo Hernáiz; Kramm, Christof M; Müller, Hermann L; Rutkowski, Stefan; von Hoff, Katja; Frühwald, Michael C; Gnekow, Astrid; Fleischhack, Gudrun; Tippelt, Stephan; Calaminus, Gabriele; Monoranu, Camelia-Maria; Perry, Arie; Jones, Chris; Jacques, Thomas S; Radlwimmer, Bernhard; Gessi, Marco; Pietsch, Torsten; Schramm, Johannes; Schackert, Gabriele; Westphal, Manfred; Reifenberger, Guido; Wesseling, Pieter; Weller, Michael; Collins, Vincent Peter; Blümcke, Ingmar; Bendszus, Martin; Debus, Jürgen; Huang, Annie; Jabado, Nada; Northcott, Paul A; Paulus, Werner; Gajjar, Amar; Robinson, Giles W; Taylor, Michael D; Jaunmuktane, Zane; Ryzhova, Marina; Platten, Michael; Unterberg, Andreas; Wick, Wolfgang; Karajannis, Matthias A; Mittelbronn, Michel; Acker, Till; Hartmann, Christian; Aldape, Kenneth; Schüller, Ulrich; Buslei, Rolf; Lichter, Peter; Kool, Marcel; Herold-Mende, Christel; Ellison, David W; Hasselblatt, Martin; Snuderl, Matija; Brandner, Sebastian; Korshunov, Andrey; von Deimling, Andreas; Pfister, Stefan M

    2018-03-22

    Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging-with substantial inter-observer variability in the histopathological diagnosis of many tumour types. Here we present a comprehensive approach for the DNA methylation-based classification of central nervous system tumours across all entities and age groups, and demonstrate its application in a routine diagnostic setting. We show that the availability of this method may have a substantial impact on diagnostic precision compared to standard methods, resulting in a change of diagnosis in up to 12% of prospective cases. For broader accessibility, we have designed a free online classifier tool, the use of which does not require any additional onsite data processing. Our results provide a blueprint for the generation of machine-learning-based tumour classifiers across other cancer entities, with the potential to fundamentally transform tumour pathology.

  4. Exciplex electroluminescence and photoluminescence spectra of the new organic materials based on zinc complexes of sulphanylamino-substituted ligands.

    Science.gov (United States)

    Kaplunov, Mikhail G; Krasnikova, Svetlana S; Nikitenko, Sergey L; Sermakasheva, Natalia L; Yakushchenko, Igor K

    2012-04-03

    We have investigated the electroluminescence spectra of the electroluminescent devices based on the new zinc complexes of amino-substituted benzothiazoles and quinolines containing the C-N-M-N chains in their chelate cycles. The spectra exhibit strong exciplex bands in the green to yellow region 540 to 590 nm due to interaction of the excited states of zinc complexes and triaryl molecules of the hole-transporting layer. For some devices, the intrinsic luminescence band of 460 nm in the blue region is also observed along with the exciplex band giving rise to an almost white color of the device emission. The exciplex band can be eliminated if the material of the hole-transporting layer is not a triarylamine derivative. We have also found the exciplex emission in the photoluminescence spectra of the films containing blends of zinc complex and triphenylamine material.

  5. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de

    2006-01-01

    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....

  6. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  7. Repairability during G1 of the inductor leisure of exchanges in the sister chromatid induced by alkylating agents in DNA substituted and no substituted with BUDR, in cells of the salivary gland of mouse In vivo

    International Nuclear Information System (INIS)

    Gonzalez B, F.

    2004-01-01

    In this work you determines the repair of the lesions inductoras of Sister chromatid exchange (ICHs) generated in the cells of the salivary gland of mouse, for the treatment with the N-Methyl-N-Nitrosourea (MNU), the N-Ethyl-N-Nitrosourea (ENU), the Methyl methanesulfonate (MMS) and the Ethyl methanesulfonate (EMS) in early and slow G1 of the first one and the second cellular division, that is to say before and after the cells incorporate 5-bromine-2 -Desoxyuridine (BrdU) in the DNA. Groups witness non treaties were included with mutagen. The cells of the salivary gland repaired the generated lesions partially by the MNU, the MMS and the EMS in the 1st division, and only the lesions induced by the ENU and MMS were repaired partially in the 2nd division. The ENU generates injure that they were not repaired in the 1st division and those taken place by the EMS were little repaired in the 2nd division. The methylating agents generated but ICHs that the ethylating. One observes that the BrdU makes to the molecule of the DNA but susceptible to the damage generated by the alkylating agents that induce the formation of the ICHs. This susceptibility was incremented around 150% for the treatment with the MNU, the ENU and the MMS, on the other hand for the EMS it was 3 times minor. It is proposed that the one electronegative atom of this analog of the timine would to work as a nucleophyllic center with which the electrophyllic compounds react. (Author)

  8. Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

  9. Potential for DNA-based identification of Great Lakes fauna: Match and mismatch between taxa inventories and DNA barcode libraries

    Science.gov (United States)

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However, the abi...

  10. Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

    Science.gov (United States)

    Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

    2010-03-01

    Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

  11. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  12. Involvement of specialized DNA polymerases Pol II, Pol IV and DnaE2 in DNA replication in the absence of Pol I in Pseudomonas putida

    International Nuclear Information System (INIS)

    Sidorenko, Julia; Jatsenko, Tatjana; Saumaa, Signe; Teras, Riho; Tark-Dame, Mariliis; Horak, Rita; Kivisaar, Maia

    2011-01-01

    The majority of bacteria possess a different set of specialized DNA polymerases than those identified in the most common model organism Escherichia coli. Here, we have studied the ability of specialized DNA polymerases to substitute Pol I in DNA replication in Pseudomonas putida. Our results revealed that P. putida Pol I-deficient cells have severe growth defects in LB medium, which is accompanied by filamentous cell morphology. However, growth of Pol I-deficient bacteria on solid rich medium can be restored by reduction of reactive oxygen species in cells. Also, mutants with improved growth emerge rapidly. Similarly to the initial Pol I-deficient P. putida, its adapted derivatives express a moderate mutator phenotype, which indicates that DNA replication carried out in the absence of Pol I is erroneous both in the original Pol I-deficient bacteria and the adapted derivatives. Analysis of the spectra of spontaneous Rif r mutations in P. putida strains lacking different DNA polymerases revealed that the presence of specialized DNA polymerases Pol II and Pol IV influences the frequency of certain base substitutions in Pol I-proficient and Pol I-deficient backgrounds in opposite ways. Involvement of another specialized DNA polymerase DnaE2 in DNA replication in Pol I-deficient bacteria is stimulated by UV irradiation of bacteria, implying that DnaE2-provided translesion synthesis partially substitutes the absence of Pol I in cells containing heavily damaged DNA.

  13. Quantum mechanical design of efficient second-order nonlinear optical materials based on heteroaromatic imido-substituted hexamolybdates: first theoretical framework of POM-based heterocyclic aromatic rings.

    Science.gov (United States)

    Janjua, Muhammad Ramzan Saeed Ashraf

    2012-11-05

    This work was inspired by a previous report (Janjua et al. J. Phys. Chem. A 2009, 113, 3576-3587) in which the nonlinear-optical (NLO) response strikingly improved with an increase in the conjugation path of the ligand and the nature of hexamolybdates (polyoxometalates, POMs) was changed into a donor by altering the direction of charge transfer with a second aromatic ring. Herein, the first theoretical framework of POM-based heteroaromatic rings is found to be another class of excellent NLO materials having double heteroaromatic rings. First hyperpolarizabilities of a large number of push-pull-substituted conjugated systems with heteroaromatic rings have been calculated. The β components were computed at the density functional theory (DFT) level (BP86 geometry optimizations and LB94 time-dependent DFT). The largest β values are obtained with a donor (hexamolybdates) on the benzene ring and an acceptor (-NO(2)) on pyrrole, thiophene, and furan rings. The pyrrole imido-substituted hexamolybdate (system 1c) has a considerably large first hyperpolarizability, 339.00 × 10(-30) esu, and it is larger than that of (arylimido)hexamolybdate, calculated as 0.302 × 10(-30) esu (reference system 1), because of the double aromatic rings in the heteroaromatic imido-substituted hexamolybdates. The heteroaromatic rings act as a conjugation bridge between the electron acceptor (-NO(2)) and donor (polyanion). The introduction of an electron donor into heteroaromatic rings significantly enhances the first hyperpolarizabilities because the electron-donating ability is substantially enhanced when the electron donor is attached to the heterocyclic aromatic rings. Interposing five-membered auxiliary fragments between strong donor (polyanion) or acceptor (-NO(2)) groups results in a large computed second-order NLO response. The present investigation provides important insight into the NLO properties of (heteroaromatic) imido-substituted hexamolybdate derivatives because these compounds

  14. Novel DNA sequence detection method based on fluorescence energy transfer

    International Nuclear Information System (INIS)

    Kobayashi, S.; Tamiya, E.; Karube, I.

    1987-01-01

    Recently the detection of specific DNA sequence, DNA analysis, has been becoming more important for diagnosis of viral genomes causing infections disease and human sequences related to inherited disorders. These methods typically involve electrophoresis, the immobilization of DNA on a solid support, hybridization to a complementary probe, the detection using labeled with /sup 32/P or nonisotopically with a biotin-avidin-enzyme system, and so on. These techniques are highly effective, but they are very time-consuming and expensive. A principle of fluorescene energy transfer is that the light energy from an excited donor (fluorophore) is transferred to an acceptor (fluorophore), if the acceptor exists in the vicinity of the donor and the excitation spectrum of donor overlaps the emission spectrum of acceptor. In this study, the fluorescence energy transfer was applied to the detection of specific DNA sequence using the hybridization method. The analyte, single-stranded DNA labeled with the donor fluorophore is hybridized to a probe DNA labeled with the acceptor. Because of the complementary DNA duplex formation, two fluorophores became to be closed to each other, and the fluorescence energy transfer was occurred

  15. Deuterium isotope fractionation between ortho-alkyl substituted phenols and t-butylthiol in oxygen bases

    International Nuclear Information System (INIS)

    Wawer, A.; Jelenska-Kazimierczuk, M.; Szydlowski, J.

    1998-01-01

    Equilibrium isotope effect in the exchange reaction of deuterium between phenol(P), 2-isopropyl phenol (IPP), 2,6-diisopropyl phenol (DIPP), 2,6-diterbutyl phenol (DTBP) and tertbutylthiol (TBT) has been studied in 296 K. The fractionation factors (α) have been measured in cyclohexane and carbon tetrachloride solutions and in a few oxygen bases: acetone, 1,4-dioxane, ethyl formate, ethyl ether, tetrahydrofurane, N,N-dimethylformamide, dimethylsulfoxide and hexamethylphosphoramide. Using chemical shifts of phenol OH protons, the thermodynamic parameters of complex formation with the oxygen bases have been determined. The experimental data show that lnα correlates with the formation enthalpy of the phenol-oxygen base complex in DIPP-TBT-base system but there is no simple correlation in IPP-TBT-base system. Furthermore, it was found that in DTBT-TBT-base system lnα depends linearly on the basicity of the solvent (DN parameters). On the other hand, lnα correlates with acidic parameters of the solvents (AN) in IPP-TBT-base and P-TBT-base systems. All above correlations are explained by taking into account two competition processes: self association of phenol molecules and their solvation by oxygen bases. (author)

  16. Microcantilver-based DNA hybridization sensors for Salmonella identification

    Directory of Open Access Journals (Sweden)

    Carlo Ricciardi

    2012-02-01

    Full Text Available The detection of pathogenic microorganisms in foods remains a challenging since the safety of foodstuffs has to be ensured by the food producing companies. Conventional methods for the detection and identification of bacteria mainly rely on specific microbiological and biochemical identification. Biomolecular methods, are commonly used as a support for traditional techniques, thanks to their high sensitivity, specificity and not excessive costs. However, new methods like biosensors for example, can be an exciting alternative to the more traditional tecniques for the detection of pathogens in food. In this study we report Salmonella enterica serotype Enteritidis DNA detection through a novel class of label-free biosensors: microcantilevers (MCs. In general, MCs can operate as a microbalance and is used to detect the mass of the entities anchored to the cantilever surface using the decrease in the resonant frequency. We use DNA hybridization as model reaction system and for this reason, specific single stranded probe DNA of the pathogen and three different DNA targets (single-stranded complementary DNA, PCR product and serial dilutions of DNA extracted from S. Enteritidis strains were applied. Two protocols were reported in order to allow the probe immobilization on cantilever surface: i MC surface was functionalized with 3-aminopropyltriethoxysilane and glutaraldehyde and an amino-modified DNA probe was used; ii gold-coated sensors and thiolated DNA probes were used in order to generate a covalent bonding (Th-Au. For the first one, measures after hybridization with the PCR product showed related frequency shift 10 times higher than hybridization with complementary probe and detectable signals were obtained at the concentrations of 103 and 106 cfu/mL after hybridization with bacterial DNA. There are currently optimizations of the second protocol, where preliminary results have shown to be more uniform and therefore more precise within each of the

  17. DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.

    Science.gov (United States)

    Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao

    2016-01-13

    Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.

  18. EVOLUTIONARY RELATIONSHIPS BETWEEN 4 SPECIES OF CLADOPHORA (CLADOPHORALES, CHLOROPHYTA) BASED ON DNA-DNA HYBRIDIZATION

    NARCIS (Netherlands)

    BOT, PVM; BRUSSAARD, CPD; STAM, WT; VANDENHOEK, C

    1991-01-01

    Analysis of the reassociation kinetics of the DNA from Cladophora pellucida (Huds.) Kutz. indicates that the genome of this benthic alga is comprised of approximately 75% repetitive sequences. Single-copy sequences reassociated with a rate constant of 1.8 x 10(-3) M-1.s-1, which corresponds to a

  19. The Study of Substitution and Elimination Reactions Using Gas Chromatography: An Examination of the Effects of Alkane and Base Structure on Product Distributions

    Science.gov (United States)

    Wharry, Donald L.

    2011-01-01

    An experiment that compares product distribution obtained by either substitution or elimination utilizing alkyl bromides and methoxide, ethoxide, or t-butoxide as the base (or nucleophile) is described. The change in product distribution caused by steric effects of the base and substrate are readily apparent. Prior work on this experiment focused…

  20. Electron accommodation dynamics in the DNA base thymine

    Science.gov (United States)

    King, Sarah B.; Stephansen, Anne B.; Yokoi, Yuki; Yandell, Margaret A.; Kunin, Alice; Takayanagi, Toshiyuki; Neumark, Daniel M.

    2015-07-01

    The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I-T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from -120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I-T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I-T VDE, which suggests that if the dipole-bound anion acts as a "doorway" to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.

  1. Electron accommodation dynamics in the DNA base thymine

    Energy Technology Data Exchange (ETDEWEB)

    King, Sarah B.; Yandell, Margaret A.; Kunin, Alice [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Stephansen, Anne B. [Department of Chemistry, University of Copenhagen, Universitetsparken 5, DK-2100 København Ø (Denmark); Yokoi, Yuki; Takayanagi, Toshiyuki [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Neumark, Daniel M., E-mail: dneumark@berkeley.edu [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2015-07-14

    The dynamics of electron attachment to the DNA base thymine are investigated using femtosecond time-resolved photoelectron imaging of the gas phase iodide-thymine (I{sup −}T) complex. An ultraviolet pump pulse ejects an electron from the iodide and prepares an iodine-thymine temporary negative ion that is photodetached with a near-IR probe pulse. The resulting photoelectrons are analyzed with velocity-map imaging. At excitation energies ranging from −120 meV to +90 meV with respect to the vertical detachment energy (VDE) of 4.05 eV for I{sup −}T, both the dipole-bound and valence-bound negative ions of thymine are observed. A slightly longer rise time for the valence-bound state than the dipole-bound state suggests that some of the dipole-bound anions convert to valence-bound species. No evidence is seen for a dipole-bound anion of thymine at higher excitation energies, in the range of 0.6 eV above the I{sup −}T VDE, which suggests that if the dipole-bound anion acts as a “doorway” to the valence-bound anion, it only does so at excitation energies near the VDE of the complex.

  2. Memory-Based Simple Heuristics as Attribute Substitution: Competitive Tests of Binary Choice Inference Models

    Science.gov (United States)

    Honda, Hidehito; Matsuka, Toshihiko; Ueda, Kazuhiro

    2017-01-01

    Some researchers on binary choice inference have argued that people make inferences based on simple heuristics, such as recognition, fluency, or familiarity. Others have argued that people make inferences based on available knowledge. To examine the boundary between heuristic and knowledge usage, we examine binary choice inference processes in…

  3. DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging

    Directory of Open Access Journals (Sweden)

    Ricardo Gredilla

    2011-01-01

    Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.

  4. Oxidatively-induced DNA damage and base excision repair in euthymic patients with bipolar disorder.

    Science.gov (United States)

    Ceylan, Deniz; Tuna, Gamze; Kirkali, Güldal; Tunca, Zeliha; Can, Güneş; Arat, Hidayet Ece; Kant, Melis; Dizdaroglu, Miral; Özerdem, Ayşegül

    2018-05-01

    Oxidatively-induced DNA damage has previously been associated with bipolar disorder. More recently, impairments in DNA repair mechanisms have also been reported. We aimed to investigate oxidatively-induced DNA lesions and expression of DNA glycosylases involved in base excision repair in euthymic patients with bipolar disorder compared to healthy individuals. DNA base lesions including both base and nucleoside modifications were measured using gas chromatography-tandem mass spectrometry and liquid chromatography-tandem mass spectrometry with isotope-dilution in DNA samples isolated from leukocytes of euthymic patients with bipolar disorder (n = 32) and healthy individuals (n = 51). The expression of DNA repair enzymes OGG1 and NEIL1 were measured using quantitative real-time polymerase chain reaction. The levels of malondialdehyde were measured using high performance liquid chromatography. Seven DNA base lesions in DNA of leukocytes of patients and healthy individuals were identified and quantified. Three of them had significantly elevated levels in bipolar patients when compared to healthy individuals. No elevation of lipid peroxidation marker malondialdehyde was observed. The level of OGG1 expression was significantly reduced in bipolar patients compared to healthy individuals, whereas the two groups exhibited similar levels of NEIL1 expression. Our results suggest that oxidatively-induced DNA damage occurs and base excision repair capacity may be decreased in bipolar patients when compared to healthy individuals. Measurement of oxidatively-induced DNA base lesions and the expression of DNA repair enzymes may be of great importance for large scale basic research and clinical studies of bipolar disorder. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  6. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    DEFF Research Database (Denmark)

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong

    2011-01-01

    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...

  7. Electrochemical DNA biosensor based on grafting-to mode of terminal deoxynucleoside transferase-mediated extension.

    Science.gov (United States)

    Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua

    2017-12-15

    Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Loss of BRCA1 or BRCA2 markedly increases the rate of base substitution mutagenesis and has distinct effects on genomic deletions

    DEFF Research Database (Denmark)

    Zamborszky, J.; Szikriszt, B.; Gervai, J. Z.

    2017-01-01

    -genome sequencing of multiple isogenic chicken DT40 cell clones to precisely determine the consequences of BRCA1/2 loss on all types of genomic mutagenesis. Spontaneous base substitution mutation rates increased sevenfold upon the disruption of either BRCA1 or BRCA2, and the arising mutation spectra showed strong...... of stalled replication forks as the cause of increased mutagenesis. The high rate of base substitution mutagenesis demonstrated by our experiments is likely to significantly contribute to the oncogenic effect of the inactivation of BRCA1 or BRCA2....

  9. Review: Potential Strength of Fly Ash-Based Geopolymer Paste with Substitution of Local Waste Materials with High-Temperature Effect

    Science.gov (United States)

    Subekti, S.; Bayuaji, R.; Darmawan, M. S.; Husin, N. A.; Wibowo, B.; Anugraha, B.; Irawan, S.; Dibiantara, D.

    2017-11-01

    This research provided an overview of the potential fly ash based geopolymer paste for application in building construction. Geopolymer paste with various variations of fly ash substitution with local waste material and high-temperature influence exploited with the fresh and hardened condition. The local waste material which utilized for this study were sandblasting waste, carbide waste, shell powder, bagasse ash, rice husk and bottom ash. The findings of this study indicated that fly-based geopolymer paste with local waste material substitution which had high-temperature influence ash showed a similar nature of OPC binders potentially used in civil engineering applications.

  10. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-09-01

    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. comparison between dna-based, pomological and chemical ...

    African Journals Online (AJOL)

    2015-09-01

    Sep 1, 2015 ... of extra virgin olive oil and consequently for better marketing. Habitually, the ... Several molecular marker techniques such as random amplified .... negatively correlated to the rate of unsaponifiable matter. .... DNA Extraction.

  12. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  13. DNA hydrogel-based supercapacitors operating in physiological fluids

    OpenAIRE

    Hur, Jaehyun; Im, Kyuhyun; Hwang, Sekyu; Choi, ByoungLyong; Kim, Sungjee; Hwang, Sungwoo; Park, Nokyoung; Kim, Kinam

    2013-01-01

    DNA nanostructures have been attractive due to their structural properties resulting in many important breakthroughs especially in controlled assemblies and many biological applications. Here, we report a unique energy storage device which is a supercapacitor that uses nanostructured DNA hydrogel (Dgel) as a template and layer-by-layer (LBL)-deposited polyelectrolyte multilayers (PEMs) as conductors. Our device, named as PEM-Dgel supercapacitor, showed excellent performance in direct contact ...

  14. Slow elimination of DNA damaged bases in the liver of old gamma-irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Gaziev, A I; Malakhova, L V; Fomenko, L A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki

    1981-01-01

    Elimination of the DNA damaged bases in the liver of old and young mice after their gamma-irradiation is studied. It is established that the incision rate of DNA gamma-damaged bases in the liver of old mice is lower than in the liver of the young ones. It is supposed to be connected with the decrease of the activity of DNA reparation ferments or with the presence of limitations in chromatin for the access of these ferments to the damaged parts of DNA in the cells of old animals.

  15. DNA origami-based standards for quantitative fluorescence microscopy.

    Science.gov (United States)

    Schmied, Jürgen J; Raab, Mario; Forthmann, Carsten; Pibiri, Enrico; Wünsch, Bettina; Dammeyer, Thorben; Tinnefeld, Philip

    2014-01-01

    Validating and testing a fluorescence microscope or a microscopy method requires defined samples that can be used as standards. DNA origami is a new tool that provides a framework to place defined numbers of small molecules such as fluorescent dyes or proteins in a programmed geometry with nanometer precision. The flexibility and versatility in the design of DNA origami microscopy standards makes them ideally suited for the broad variety of emerging super-resolution microscopy methods. As DNA origami structures are durable and portable, they can become a universally available specimen to check the everyday functionality of a microscope. The standards are immobilized on a glass slide, and they can be imaged without further preparation and can be stored for up to 6 months. We describe a detailed protocol for the design, production and use of DNA origami microscopy standards, and we introduce a DNA origami rectangle, bundles and a nanopillar as fluorescent nanoscopic rulers. The protocol provides procedures for the design and realization of fluorescent marks on DNA origami structures, their production and purification, quality control, handling, immobilization, measurement and data analysis. The procedure can be completed in 1-2 d.

  16. A DNA-based nanomechanical device with three robust states.

    Science.gov (United States)

    Chakraborty, Banani; Sha, Ruojie; Seeman, Nadrian C

    2008-11-11

    DNA has been used to build a variety of devices, ranging from those that are controlled by DNA structural transitions to those that are controlled by the addition of specific DNA strands. These sequence-dependent devices fulfill the promise of DNA in nanotechnology because a variety of devices in the same physical environment can be controlled individually. Many such devices have been reported, but most of them contain one or two structurally robust end states, in addition to a floppy intermediate or even a floppy end state. We describe a system in which three different structurally robust end states can be obtained, all resulting from the addition of different set strands to a single floppy intermediate. This system is an extension of the PX-JX(2) DNA device. The three states are related to each other by three different motions, a twofold rotation, a translation of approximately 2.1-2.5 nm, and a twofold screw rotation, which combines these two motions. We demonstrate the transitions by gel electrophoresis, by fluorescence resonance energy transfer, and by atomic force microscopy. The control of this system by DNA strands opens the door to trinary logic and to systems containing N devices that are able to attain 3(N) structural states.

  17. Applicability of DNA-based methods for food authentication

    OpenAIRE

    Mafra, Isabel; Amaral, J.S.; Costa, Joana; Soares, Sónia; Oliveira, M.B.P.P.

    2014-01-01

    Authenticity evaluation of foods encompasses many issues, including the entire or partial fraudulent substitution of higher commercial value constituents by others with lower value and the presence of undeclared ingredients. To address the referred food authenticity problems, several! Analytical methodologies have been developed at REQ.UIMTE during the last years. Due to its fastness, sensitivity and high specificity, the application of molecular biology techniques has proved to be an effe...

  18. Bone substitute biomaterials

    CERN Document Server

    Mallick, K

    2014-01-01

    Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...

  19. Aryl substitution of pentacenes

    Directory of Open Access Journals (Sweden)

    Andreas R. Waterloo

    2014-07-01

    Full Text Available A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films, thermoanalytical methods (DSC and TGA, cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives. X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices.

  20. Aryl substitution of pentacenes

    Science.gov (United States)

    Waterloo, Andreas R; Sale, Anna-Chiara; Lehnherr, Dan; Hampel, Frank

    2014-01-01

    Summary A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films), thermoanalytical methods (DSC and TGA), cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives). X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices. PMID:25161729

  1. DENA: A Configurable Microarchitecture and Design Flow for Biomedical DNA-Based Logic Design.

    Science.gov (United States)

    Beiki, Zohre; Jahanian, Ali

    2017-10-01

    DNA is known as the building block for storing the life codes and transferring the genetic features through the generations. However, it is found that DNA strands can be used for a new type of computation that opens fascinating horizons in computational medicine. Significant contributions are addressed on design of DNA-based logic gates for medical and computational applications but there are serious challenges for designing the medium and large-scale DNA circuits. In this paper, a new microarchitecture and corresponding design flow is proposed to facilitate the design of multistage large-scale DNA logic systems. Feasibility and efficiency of the proposed microarchitecture are evaluated by implementing a full adder and, then, its cascadability is determined by implementing a multistage 8-bit adder. Simulation results show the highlight features of the proposed design style and microarchitecture in terms of the scalability, implementation cost, and signal integrity of the DNA-based logic system compared to the traditional approaches.

  2. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    Science.gov (United States)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  3. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    Science.gov (United States)

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Fixed vs. random proportions demand models for the assortment planning problem under stockout-based substitution

    NARCIS (Netherlands)

    Honhon, D.B.L.P.; Seshardi, S.

    2013-01-01

    We consider the problem of determining the optimal assortment of products to offer in a given product category when each customer is characterized by a type, which is a list of products he is willing to buy in decreasing order of preference. We assume consumer-driven, dynamic, stockout-based

  5. Kinetics of thermal decomposition and kinetics of substitution reaction of nano uranyl Schiff base complexes

    Czech Academy of Sciences Publication Activity Database

    Asadi, Z.; Zeinali, A.; Dušek, Michal; Eigner, Václav

    2014-01-01

    Roč. 46, č. 12 (2014), s. 718-729 ISSN 0538-8066 R&D Projects: GA ČR(CZ) GAP204/11/0809 Institutional support: RVO:68378271 Keywords : uranyl * Schiff base * kinetics * anticancer activity Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.517, year: 2014

  6. All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model

    Science.gov (United States)

    Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978

  7. Investigation of the charge effect on the electrochemical transduction in a quinone-based DNA sensor

    DEFF Research Database (Denmark)

    Reisberg, S.; Piro, B.; Noel, V.

    2008-01-01

    To elucidate the mechanism involved in the electrochemical transduction process of a conducting polymer-based DNA sensor, peptide nucleic acids (PNA) were used. PNA are DNA analogues having similar hybridization properties but are neutral. This allows to discriminate the electrostatic effect of D...... strands from the steric hindrance generated on the bioelectrode upon hybridization. It can be concluded that DNA conformational changes are determinant in the transduction process and that the electrostatic effect is negligible....

  8. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  9. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid–base catalysis

    Science.gov (United States)

    Schultz, Eric P.; Vasquez, Ernesto E.; Scott, William G.

    2014-01-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid–base catalysis. Whether it does so by general acid–base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid–base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK a of the substituted purine; in both cases inosine, which is similar to G in pK a and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the

  10. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

    Science.gov (United States)

    Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

    2014-09-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

  11. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-01

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  12. Prediction of CT Substitutes from MR Images Based on Local Diffeomorphic Mapping for Brain PET Attenuation Correction.

    Science.gov (United States)

    Wu, Yao; Yang, Wei; Lu, Lijun; Lu, Zhentai; Zhong, Liming; Huang, Meiyan; Feng, Yanqiu; Feng, Qianjin; Chen, Wufan

    2016-10-01

    Attenuation correction is important for PET reconstruction. In PET/MR, MR intensities are not directly related to attenuation coefficients that are needed in PET imaging. The attenuation coefficient map can be derived from CT images. Therefore, prediction of CT substitutes from MR images is desired for attenuation correction in PET/MR. This study presents a patch-based method for CT prediction from MR images, generating attenuation maps for PET reconstruction. Because no global relation exists between MR and CT intensities, we propose local diffeomorphic mapping (LDM) for CT prediction. In LDM, we assume that MR and CT patches are located on 2 nonlinear manifolds, and the mapping from the MR manifold to the CT manifold approximates a diffeomorphism under a local constraint. Locality is important in LDM and is constrained by the following techniques. The first is local dictionary construction, wherein, for each patch in the testing MR image, a local search window is used to extract patches from training MR/CT pairs to construct MR and CT dictionaries. The k-nearest neighbors and an outlier detection strategy are then used to constrain the locality in MR and CT dictionaries. Second is local linear representation, wherein, local anchor embedding is used to solve MR dictionary coefficients when representing the MR testing sample. Under these local constraints, dictionary coefficients are linearly transferred from the MR manifold to the CT manifold and used to combine CT training samples to generate CT predictions. Our dataset contains 13 healthy subjects, each with T1- and T2-weighted MR and CT brain images. This method provides CT predictions with a mean absolute error of 110.1 Hounsfield units, Pearson linear correlation of 0.82, peak signal-to-noise ratio of 24.81 dB, and Dice in bone regions of 0.84 as compared with real CTs. CT substitute-based PET reconstruction has a regression slope of 1.0084 and R 2 of 0.9903 compared with real CT-based PET. In this method, no

  13. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

    1991-01-01

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  14. Compatibility of selected plant-based shortening as lard substitute: microstructure, polymorphic forms and textural properties

    Directory of Open Access Journals (Sweden)

    N. A.M. Yanty

    2017-03-01

    Full Text Available A study was carried out to determine the compatibility of three plant-based shortening mixtures to lard shortening (LD in terms of microstructure, polymorphic forms, and textural properties. The shortenings of binary, ternary, and quaternary fat mixtures were prepared according to a standard procedure by blending mee fat (MF with palm stearin (PS in a 99:1 (w/w ratio; avocado fat (Avo with PS and cocoa butter (CB in a 84:7:9 (w/w ratio; palm oil (PO with PS, soybean oil (SBO and CB in a 38:5:52:5 (w/w ratio, respectively. The triacylglycerol composition, polymorphic forms, crystal morphology, and textural properties of the shortening were evaluated. This study found that all three plant-based shortenings and LD shortening were similar with respect to their consistency, hardness and compression and adhesiveness values. However, all plant-based shortening was found to be dissimilar to LD shortening with respect to microstructure.

  15. Compatibility of selected plant-based shortening as lard substitute: microstructure, polymorphic forms and textural properties

    International Nuclear Information System (INIS)

    Yanty, N.A.M.; Marikkar, J.M.N.; Miskandar, M.S.; Bockstaele, F. Van; Dewettinck, K.; Nusantoro, B.P.

    2017-01-01

    A study was carried out to determine the compatibility of three plant-based shortening mixtures to lard shortening (LD) in terms of microstructure, polymorphic forms, and textural properties. The shortenings of binary, ternary, and quaternary fat mixtures were prepared according to a standard procedure by blending mee fat (MF) with palm stearin (PS) in a 99:1 (w/w) ratio; avocado fat (Avo) with PS and cocoa butter (CB) in a 84:7:9 (w/w) ratio; palm oil (PO) with PS, soybean oil (SBO) and CB in a 38:5:52:5 (w/w) ratio, respectively. The triacylglycerol composition, polymorphic forms, crystal morphology, and textural properties of the shortening were evaluated. This study found that all three plant-based shortenings and LD shortening were similar with respect to their consistency, hardness and compression and adhesiveness values. However, all plant-based shortening was found to be dissimilar to LD shortening with respect to microstructure. [es

  16. In Vitro Investigation of Self-Assembled Nanoparticles Based on Hyaluronic Acid-Deoxycholic Acid Conjugates for Controlled Release Doxorubicin: Effect of Degree of Substitution of Deoxycholic Acid

    Directory of Open Access Journals (Sweden)

    Wen-Hao Wei

    2015-03-01

    Full Text Available Self-assembled nanoparticles based on a hyaluronic acid-deoxycholic acid (HD chemical conjugate with different degree of substitution (DS of deoxycholic acid (DOCA were prepared. The degree of substitution (DS was determined by titration method. The nanoparticles were loaded with doxorubicin (DOX as the model drug. The human cervical cancer (HeLa cell line was utilized for in vitro studies and cell cytotoxicity of DOX incorporated in the HD nanoparticles was accessed by the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. In addition, cellular uptake of fluorescently labeled nanoparticles was also investigated. An increase in the degree of deoxycholic acid substitution reduced the size of the nanoparticles and also enhanced their drug encapsulation efficiency (EE, which increased with the increase of DS. A higher degree of deoxycholic acid substitution also lead to a lower release rate and an initial burst release of doxorubicin from the nanoparticles. In summary, the degree of substitution allows the modulation of the particle size, drug encapsulation efficiency, drug release rate, and cell uptake efficiency of the nanoparticles. The herein developed hyaluronic acid-deoxycholic acid conjugates are a good candidate for drug delivery and could potentiate therapeutic formulations for doxorubicin–mediated cancer therapy.

  17. ArrayPitope: Automated Analysis of Amino Acid Substitutions for Peptide Microarray-Based Antibody Epitope Mapping

    DEFF Research Database (Denmark)

    Hansen, Christian Skjødt; Østerbye, Thomas; Marcatili, Paolo

    2017-01-01

    and characterization of linear B cell epitopes. Using exhaustive amino acid substitution analysis of peptides originating from target antigens, these microarrays can be used to address the specificity of polyclonal antibodies raised against such antigens containing hundreds of epitopes. However, the interpretation....... The application takes as input quantitative peptide data of fully or partially substituted overlapping peptides from a given antigen sequence and identifies epitope residues (residues that are significantly affected by substitutions) and visualize the selectivity towards each residue by sequence logo plots...

  18. Difluorobenzothiadiazole based two-dimensional conjugated polymers with triphenylamine substituted moieties as pendants for bulk heterojunction solar cells

    Directory of Open Access Journals (Sweden)

    W. H. Lee

    2017-11-01

    Full Text Available Three donor/acceptor (D/A-type two-dimensional polythiophenes (PTs; PBTFA13, PBTFA12, PBTFA11 featuring difluorobenzothiadiazole (DFBT derivatives as the conjugated (acceptor units in the polymer backbone and tertbutyl–substituted triphenylamine (tTPA-containing moieties as (donor pendants have been synthesized and characterized. These PTs exhibited good thermal stabilities, broad absorption spectra, and narrow optical band gaps. The cutoff wavelength of the UV–Vis absorption band was red-shifted upon increasing the content of the DFBT units in the PTs. Bulk heterojunction solar cells having an active layer comprising blends of the PTs and fullerene derivatives [6,6] phenyl-C61/71-butyric acid methyl ester (PC61BM/PC71BM were fabricated; their photovoltaic performance was strongly dependent on the content of the DFBT derivative in the PT. Incorporating a suitable content of the DFBT derivative in the polymer backbone enhanced the solar absorption ability and conjugation length of the PTs. The photovoltaic properties of the PBTFA13-based solar cells were superior to those of the PBTFA11- and PBTFA12-based solar cells.

  19. Evaluation of Osteoconductive and Osteogenic Potential of a Dentin-Based Bone Substitute Using a Calvarial Defect Model

    Directory of Open Access Journals (Sweden)

    Ibrahim Hussain

    2012-01-01

    Full Text Available The aim of this study was to assess the osteoconductive and osteogenic properties of processed bovine dentin using a robust rabbit calvarial defect model. In total, 16 New Zealand White rabbits were operated to create three circular defects in the calvaria. One defect was left unfilled, one filled with collected autogenous bone, and the third defect was filled with the dentin-based bone substitute. Following surgery and after a healing period of either 1 or 6 weeks, a CT scan was obtained. Following sacrificing, the tissues were processed for histological examination. The CT data showed the density in the area grafted with the dentin-based material was higher than the surrounding bone and the areas grafted with autologous bone after 1 week and 6 weeks of healing. The area left unfilled remained an empty defect after 1 week and 6 weeks. Histological examination of the defects filled with the dentin product after 6 weeks showed soft tissue encapsulation around the dentin particles. It can be concluded that the rabbit calvarial model used in this study is a robust model for the assessment of bone materials. Bovine dentin is a biostable material; however, it may not be suitable for repairing large 4-wall defects.

  20. Electrochemical DNA biosensors based on platinum nanoparticles combined carbon nanotubes

    International Nuclear Information System (INIS)

    Zhu Ningning; Chang Zhu; He Pingang; Fang Yuzhi

    2005-01-01

    Platinum nanoparticles were used in combination with multi-walled carbon nanotubes (MWCNTs) for fabricating sensitivity-enhanced electrochemical DNA biosensor. Multi-walled carbon nanotubes and platinum nanoparticles were dispersed in Nafion, which were used to fabricate the modification of the glassy carbon electrode (GCE) surface. Oligonucleotides with amino groups at the 5' end were covalently linked onto carboxylic groups of MWCNTs on the electrode. The hybridization events were monitored by differential pulse voltammetry (DPV) measurement of the intercalated daunomycin. Due to the ability of carbon nanotubes to promote electron-transfer reactions, the high catalytic activities of platinum nanoparticles for chemical reactions, the sensitivity of presented electrochemical DNA biosensors was remarkably improved. The detection limit of the method for target DNA was 1.0 x 10 -11 mol l -1

  1. DNA origami-based nanoribbons: assembly, length distribution, and twist

    Energy Technology Data Exchange (ETDEWEB)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C [Lehrstuhl fuer Bioelektronik, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany); Castro, Carlos E, E-mail: simmel@ph.tum.de [Labor fuer Biomolekulare Nanotechnologie, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany)

    2011-07-08

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  2. DNA origami-based nanoribbons: assembly, length distribution, and twist

    International Nuclear Information System (INIS)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C; Castro, Carlos E

    2011-01-01

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  3. Spreadsheet-based program for alignment of overlapping DNA sequences.

    Science.gov (United States)

    Anbazhagan, R; Gabrielson, E

    1999-06-01

    Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

  4. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  5. Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.

    Science.gov (United States)

    Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P

    2017-09-01

    Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

  6. 3D printing of mineral-polymer bone substitutes based on sodium alginate and calcium phosphate.

    Science.gov (United States)

    Egorov, Aleksey A; Fedotov, Alexander Yu; Mironov, Anton V; Komlev, Vladimir S; Popov, Vladimir K; Zobkov, Yury V

    2016-01-01

    We demonstrate a relatively simple route for three-dimensional (3D) printing of complex-shaped biocompatible structures based on sodium alginate and calcium phosphate (CP) for bone tissue engineering. The fabrication of 3D composite structures was performed through the synthesis of inorganic particles within a biopolymer macromolecular network during 3D printing process. The formation of a new CP phase was studied through X-ray diffraction, Fourier transform infrared spectroscopy and scanning electron microscopy. Both the phase composition and the diameter of the CP particles depend on the concentration of a liquid component (i.e., the "ink"). The 3D printed structures were fabricated and found to have large interconnected porous systems (mean diameter ≈800 μm) and were found to possess compressive strengths from 0.45 to 1.0 MPa. This new approach can be effectively applied for fabrication of biocompatible scaffolds for bone tissue engineering constructions.

  7. 3D printing of mineral–polymer bone substitutes based on sodium alginate and calcium phosphate

    Directory of Open Access Journals (Sweden)

    Aleksey A. Egorov

    2016-11-01

    Full Text Available We demonstrate a relatively simple route for three-dimensional (3D printing of complex-shaped biocompatible structures based on sodium alginate and calcium phosphate (CP for bone tissue engineering. The fabrication of 3D composite structures was performed through the synthesis of inorganic particles within a biopolymer macromolecular network during 3D printing process. The formation of a new CP phase was studied through X-ray diffraction, Fourier transform infrared spectroscopy and scanning electron microscopy. Both the phase composition and the diameter of the CP particles depend on the concentration of a liquid component (i.e., the “ink”. The 3D printed structures were fabricated and found to have large interconnected porous systems (mean diameter ≈800 μm and were found to possess compressive strengths from 0.45 to 1.0 MPa. This new approach can be effectively applied for fabrication of biocompatible scaffolds for bone tissue engineering constructions.

  8. Studies on (acid + base) equilibria in substituted (phenol + n-butylamine) systems in acetonitrile

    Energy Technology Data Exchange (ETDEWEB)

    Kozak, A. [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Czaja, M. [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Chmurzynski, L. [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)]. E-mail: lech@chem.univ.gda.pl

    2005-08-15

    (Acid + base) equilibria, including molecular heteroconjugation ones, between n-butylamine and one of the following phenols: 2-nitrophenol, 3-nitrophenol, 4-nitrophenol, 2,4-dinitrophenol, 2,5-dinitrophenol, 3-chlorophenol, 4-chlorophenol, 2,3,4,5,6-pentachlorophenol and 2,4,6-tribromophenol have been studied potentiometrically in a protophobic polar aprotic solvent, acetonitrile. Among the phenols studied, 2,5-dinitrophenol exhibited the strongest tendency towards formation of asymmetric hydrogen bonds with n-butylamine, whereas a weakest complex was formed with 2-nitrophenol. In the (n-butylamine + 2,3,4,5,6-pentachlorophenol) and (n-butylamine + 2,4-dinitrophenol) systems proton transfer reactions occurred.

  9. A membrane based process for the upgrading of biogas to substituted natural gas (SNG) and recovery of carbondioxide for industrial use

    DEFF Research Database (Denmark)

    Norddahl, Birgir; dePreez, Jan

    2007-01-01

    A low pressure carbon molecular sieve (CMS) membrane based process to upgrade biogas from anaerobic digestion of agricultural waste to a substitute natural gas (SNG) has been tested on a pilot scale. The data extracted from the pilot plant was used to estimate membrane permeance and ideal selecti...

  10. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  11. Feasibility of using DNA-immobilized nanocellulose-based immunoadsorbent for systemic lupus erythematosus plasmapheresis.

    Science.gov (United States)

    Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert

    2016-07-01

    The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  13. MitBASE : a comprehensive and integrated mitochondrial DNA database. The present status

    NARCIS (Netherlands)

    Attimonelli, M.; Altamura, N.; Benne, R.; Brennicke, A.; Cooper, J. M.; D'Elia, D.; Montalvo, A.; Pinto, B.; de Robertis, M.; Golik, P.; Knoop, V.; Lanave, C.; Lazowska, J.; Licciulli, F.; Malladi, B. S.; Memeo, F.; Monnerot, M.; Pasimeni, R.; Pilbout, S.; Schapira, A. H.; Sloof, P.; Saccone, C.

    2000-01-01

    MitBASE is an integrated and comprehensive database of mitochondrial DNA data which collects, under a single interface, databases for Plant, Vertebrate, Invertebrate, Human, Protist and Fungal mtDNA and a Pilot database on nuclear genes involved in mitochondrial biogenesis in Saccharomyces

  14. Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

    Science.gov (United States)

    Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

    2013-12-15

    We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.

    Science.gov (United States)

    Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil

    2017-10-01

    Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.

  16. pH-dependence of the optical bio-sensor based on DNA-carbon nanotube

    International Nuclear Information System (INIS)

    Vu Thuy Huong; Quach Kha Quang; Tran Thanh Thuy; Phan Duc Anh; Ngo Van Thanh; Nguyen Ai Viet

    2010-01-01

    In 2006, Daniel A. Heller et al. [1] demonstrated that carbon nanotubes (CNNTs) wrapped with DNA can be placed inside living cells and detect trace amounts of harmful contaminants using near infrared light. This discovery could lead to new types of optical sensors and biomarkers at the sub cellular level. The working principle of this optical bio-sensor from DNA and CNNTs can be explained by a simple theoretical model which was introduced in [3]. In this paper, the pH-dependence of DNA and the pH-dependence of solution around CNNTs are shown by using data analysis method. By substituting them into the same model, the pH-dependence of DNA-wrapped CNNTs was elicited in this paper. The range of parameters for workable conditions of this bio-sensor was indicated that the solution should have pH from 6 to 9 and the concentration of ions should be more than a critical value. These results are according to the experimental data and the deduction about pH and salt concentration in solution. They are very useful as using such a new bio-sensor like this in living environment. (author)

  17. Preliminary investigation of novel bone graft substitutes based on strontium-calcium-zinc-silicate glasses.

    Science.gov (United States)

    Boyd, D; Carroll, G; Towler, M R; Freeman, C; Farthing, P; Brook, I M

    2009-01-01

    Bone graft procedures typically require surgeons to harvest bone from a second site on a given patient (Autograft) before repairing a bone defect. However, this results in increased surgical time, excessive blood loss and a significant increase in pain. In this context a synthetic bone graft with excellent histocompatibility, built in antibacterial efficacy and the ability to regenerate healthy tissue in place of diseased tissue would be a significant step forward relative to current state of the art philosophies. We developed a range of calcium-strontium-zinc-silicate glass based bone grafts and characterised their structure and physical properties, then evaluated their in vitro cytotoxicity and in vivo biocompatibility using standardised models from the literature. A graft (designated BT109) of composition 0.28SrO/0.32ZnO/0.40 SiO(2) (mol fraction) was the best performing formulation in vitro shown to induce extremely mild cytopathic effects (cell viability up to 95%) in comparison with the commercially available bone graft Novabone (cell viability of up to 72%). Supplementary to this, the grafts were examined using the standard rat femur healing model on healthy Wister rats. All grafts were shown to be equally well tolerated in bone tissue and new bone was seen in close apposition to implanted particles with no evidence of an inflammatory response within bone. Complimentary to this BT109 was implanted into the femurs of ovariectomized rats to monitor the response of osteoporotic tissue to the bone grafts. The results from this experiment indicate that the novel grafts perform equally well in osteoporotic tissue as in healthy tissue, which is encouraging given that bone response to implants is usually diminished in ovariectomized rats. In conclusion these materials exhibit significant potential as synthetic bone grafts to warrant further investigation and optimisation.

  18. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  19. Docking studies on a new human immunodeficiency virus integrase-Mg-DNA complex: phenyl ring exploration and synthesis of 1H-benzylindole derivatives through fluorine substitutions.

    Science.gov (United States)

    Ferro, Stefania; De Luca, Laura; Barreca, Maria Letizia; Iraci, Nunzio; De Grazia, Sara; Christ, Frauke; Witvrouw, Myriam; Debyser, Zeger; Chimirri, Alba

    2009-01-22

    A new model of HIV-1 integrase-Mg-DNA complex that is useful for docking experiments has been built. It was used to study the binding mode of integrase strand transfer inhibitor 1 (CHI-1043) and other fluorine analogues. Molecular modeling results prompted us to synthesize the designed derivatives which showed potent enzymatic inhibition at nanomolar concentration, high antiviral activity, and low toxicity. Microwave assisted organic synthesis (MAOS) was employed in several steps of the synthetic pathway, thus reducing reaction times and improving yields.

  20. Random amplified polymorphic DNA (RAPD) based assessment of ...

    African Journals Online (AJOL)

    SAM

    2014-05-07

    May 7, 2014 ... Knowledge of genetic distances between genotypes is important for efficient organization and conservation of ... after maize, wheat, and pearl millet (FAO, 2006). Sor- ... properties, which tend to reduce the nutritional quality of sorghum .... extraction. The DNA extraction buffer was modified from Jhingan.

  1. DNA fingerprinting based on simple sequence repeat (SSR ...

    African Journals Online (AJOL)

    New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

  2. SSR marker based DNA fingerprinting and diversity study in rice ...

    African Journals Online (AJOL)

    The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

  3. Alkyltransferase-like proteins: brokers dealing with alkylated DNA bases.

    Science.gov (United States)

    Schärer, Orlando D

    2012-07-13

    A new pathway for the repair of DNA alkylation damage is described in this issue of Molecular Cell (Latypov et al., 2012). Alkyltransferase-like enzymes mark O(6)-alkylguanine lesions and, depending on adduct size, channel them into global genome or transcription-coupled nucleotide excision repair pathways. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Effect of the substitutional groups on the electrochemistry, kinetic of thermal decomposition and kinetic of substitution of some uranyl Schiff base complexes

    Czech Academy of Sciences Publication Activity Database

    Asadi, Z.; Nasrollahi, R.; Dušek, Michal; Fejfarová, Karla; Ranjkeshshorkaei, M.; Firuzabadi, F.D.

    2016-01-01

    Roč. 13, č. 5 (2016), 913-924 ISSN 1735-207X R&D Projects: GA ČR(CZ) GA14-03276S Institutional support: RVO:68378271 Keywords : Schiff base complex * kinetic study * anticancer activity Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.407, year: 2016

  5. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  6. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  7. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  8. Nanostructured ZnO-based biosensor: DNA immobilization and hybridization

    Directory of Open Access Journals (Sweden)

    Ahmed Mishaal Mohammed

    2017-09-01

    Full Text Available An electrochemical DNA biosensor was successfully fabricated by using (3-aminopropyl triethoxysilane (APTES with zinc oxide (ZnO nanorods synthesized using microwave-assisted chemical bath deposition method on thermally oxidized SiO2 thin films. The structural quality and morphology of the ZnO nanorods were determined by employing scanning electron microscopy (SEM and X-ray diffraction (XRD, which show a hexagonal wurtzite structure with a preferred orientation along the (101 direction. The surface of the SiO2 thin films was chemically modified with ZnO. Label-free detection DNA immobilization and hybridization were performed using potassium hexacyanoferrate with cyclic voltammetry (CV measurements. The capacitance, permittivity, and conductivity profiles of the fabricated sensor clearly indicate DNA immobilization and hybridization. Results show that the capacitance values of bare, ZnO- modified surface immobilization, and target DNA hybridization were 46×10−12F, 47×10−8F, 27μF, and 17μF, respectively, at 1Hz. The permittivity measurement increased from 3.94×103 to 251×103 and 165×103 at the frequency range of approximately 200 to 1Hz for bare and DNA immobilization and hybridization, respectively. The measured conductivity values for the bare, ZnO, immobilized, and hybridization device were 2.4×10−9, 10×10−8, 1.6×10−7, and 1.3×10−7Scm−1, respectively. Keywords: Zinc oxide, Biosensor, Capacitance, Permittivity, Conductivity

  9. High impact of uranyl ions on carrying-releasing oxygen capability of hemoglobin-based blood substitutes

    Energy Technology Data Exchange (ETDEWEB)

    Duan, Li; Du, Lili; Liu, Wenyuan; Liu, Zhichao [Northwest Institute of Nuclear Technology, Xi' an, Shaanxi (China); Jia, Yi; Li, Junbai [Beijing National Laboratory for Molecular Sciences, CAS Key Laboratory of Colloid Interface and Chemical Thermodynamics, Institute of Chemistry, Chinese Academy of Sciences, Beijing (China)

    2015-01-07

    The effect of radioactive UO{sub 2}{sup 2+} on the oxygen-transporting capability of hemoglobin-based oxygen carriers has been investigated in vitro. The hemoglobin (Hb) microspheres fabricated by the porous template covalent layer-by-layer (LbL) assembly were utilized as artificial oxygen carriers and blood substitutes. Magnetic nanoparticles of iron oxide (Fe{sub 3}O{sub 4}) were loaded in porous CaCO{sub 3} particles for magnetically assisted chemical separation (MACS). Through the adsorption spectrum of magnetic Hb microspheres after adsorbing UO{sub 2}{sup 2+}, it was found that UO{sub 2}{sup 2+} was highly loaded in the magnetic Hb microspheres, and it shows that the presence of UO{sub 2}{sup 2+} in vivo destroys the structure and oxygen-transporting capability of Hb microspheres. In view of the high adsorption capacity of UO{sub 2}{sup 2+}, the as-assembled magnetic Hb microspheres can be considered as a novel, highly effective adsorbent for removing metal toxins from radiation-contaminated bodies, or from nuclear-power reactor effluent before discharge into the environment. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. Fluorescent water-Soluble Probes Based on Ammonium Cation Peg Substituted Perylenepisimides: Synthesis, Photophysical Properties, and Live Cell Images

    Science.gov (United States)

    Yang, Wei; Cai, Jiaxuan; Zhang, Shuchen; Yi, Xuegang; Gao, Baoxiang

    2018-01-01

    To synthesize perylenbisimides (PBI) fluorescent probes that will improve the water-soluble ability and the cytocompatibility, the synthesis and properties of fluorescent water-soluble probes based on dendritic ammonium cation polyethylene glycol (PEG) substituted perylenebisimides(GPDIs) are presented. As we expected, with increased ammonium cation PEG, the aggregation of the PBI in an aqueous solution is completely suppressed by the hydrophilic ammonium cation PEG groups. And the fluorescence quantum yield increases from 25% for GPDI-1 to 62% for GPDI-2. When incubated with Hela cells for 48 h, the viabilities are 71% (for GPDI-1) and 76% (for GPDI-2). Live cell imaging shows that these probes are efficiently internalized by HeLa cells. The study of the photophysical properties indicated increasing the ammonium cation PEG generation can increase the fluorescence quantum yield. Live cell imaging shows that with the ammonium cation PEG chains of perylenebisimides has high biocompatibility. The exceptionally low cytotoxicity is ascribed to the ammonium cation PEG chains, which protect the dyes from nonspecifically interacting with the extracellular proteins. Live cell imaging shows that ammonium cations PEG chains can promote the internalization of these probes.

  11. Achieving Adherence to Evidence-Based Practices: Are Health IT and Hospital-Physician Integration Complementary or Substitutive Strategies?

    Science.gov (United States)

    Everson, Jordan; Lee, Shoou-Yih Daniel; Adler-Milstein, Julia

    2016-12-01

    In response to evolving policies and conditions, hospitals have increased health information technology (HIT) adoption and strived to improve hospital-physician integration. While evidence suggests that both HIT and integration confer independent benefits, when combined, they may provide complementary means to achieve high performance or overlap to offset each other's contribution. We explore this relationship in the context of hospital adherence to evidence-based practices (EBPs). Using the American Hospital Association's Annual and IT Supplement surveys, and Centers for Medicare and Medicaid Services's Hospital Compare, we estimate the independent relationships and interactions between HIT and hospital-physician integration with respect to EBP adherence. HIT adoption and tight (but not loose) integration are independently associated with greater adherence to EBPs. The interaction between HIT adoption and tight integration is negative, consistent with an offsetting association between HIT adoption and integration in their relationship to EBP adherence. This finding reveals the need to be aware of potential substitutive effects from simultaneous pursuit of multiple approaches to performance improvement. © The Author(s) 2016.

  12. UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.

    Science.gov (United States)

    Baldock, Brandi L; Hutchison, James E

    2016-12-20

    DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.

  13. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    Science.gov (United States)

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  14. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    Science.gov (United States)

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  15. Optimization of DNA Sensor Model Based Nanostructured Graphene Using Particle Swarm Optimization Technique

    Directory of Open Access Journals (Sweden)

    Hediyeh Karimi

    2013-01-01

    Full Text Available It has been predicted that the nanomaterials of graphene will be among the candidate materials for postsilicon electronics due to their astonishing properties such as high carrier mobility, thermal conductivity, and biocompatibility. Graphene is a semimetal zero gap nanomaterial with demonstrated ability to be employed as an excellent candidate for DNA sensing. Graphene-based DNA sensors have been used to detect the DNA adsorption to examine a DNA concentration in an analyte solution. In particular, there is an essential need for developing the cost-effective DNA sensors holding the fact that it is suitable for the diagnosis of genetic or pathogenic diseases. In this paper, particle swarm optimization technique is employed to optimize the analytical model of a graphene-based DNA sensor which is used for electrical detection of DNA molecules. The results are reported for 5 different concentrations, covering a range from 0.01 nM to 500 nM. The comparison of the optimized model with the experimental data shows an accuracy of more than 95% which verifies that the optimized model is reliable for being used in any application of the graphene-based DNA sensor.

  16. Discovery of melanocortin ligands via a double simultaneous substitution strategy based on the Ac-His-DPhe-Arg-Trp-NH2 template.

    Science.gov (United States)

    Todorovic, Aleksandar; Lensing, Cody J; Holder, Jerry Ryan; Scott, Joseph W; Sorensen, Nicholas B; Haskell-Luevano, Carrie

    2018-05-21

    The melanocortin system regulates an array of diverse physiological functions including pigmentation, feeding behavior, energy homeostasis, cardiovascular regulation, sexual function, and steroidogenesis. Endogenous melanocortin agonist ligands all possess the minimal messaging tetrapeptide sequence His-Phe-Arg-Trp. Based on this endogenous sequence, the Ac-His1-DPhe2-Arg3-Trp4-NH 2 tetrapeptide has previously been shown to be a useful scaffold when utilizing traditional positional scanning approaches to modify activity at the various melanocortin receptors (MC1-5R). The study reported herein was undertaken to evaluate a double simultaneous substitution strategy as an approach to further diversify the Ac-His1-DPhe2-Arg3-Trp4-NH 2 tetrapeptide with concurrent introduction of natural and unnatural amino acids at positions 1, 2, or 4 as well as an octanoyl residue at the N-terminus. The designed library includes the following combinations: (A) double simultaneous substitution at capping group position (Ac) together with position 1, 2, or 4, (B) double simultaneous substitution at position 1 and 2, (C) double simultaneous substitution at position 1 and 4, and (D) double simultaneous substitution at position 2 and 4. Several lead ligands with unique pharmacologies were discovered in the current study including antagonists targeting the neuronal mMC3R with minimal agonist activity and ligands with selective profiles for the various melanocortin subtypes. The results suggest that the double simultaneous substitution strategy is a suitable approach in altering melanocortin receptor potency, selectivity, or converting agonists into antagonists and vice versa.

  17. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  18. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    Science.gov (United States)

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

    2012-01-01

    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  19. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. A new model for ancient DNA decay based on paleogenomic meta-analysis.

    Science.gov (United States)

    Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G

    2017-06-20

    The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

    Science.gov (United States)

    Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

    2013-01-01

    To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

  2. Effect of the substitutional groups on the electrochemistry, kinetic of thermal decomposition and kinetic of substitution of some uranyl Schiff base complexes

    Energy Technology Data Exchange (ETDEWEB)

    Asadi, Zahra; Nasrollahi, Rahele; Ranjkeshshorkaei, Mohammad; Firuzabadi, Fahimeh Dehghani [Shiraz Univ. (Iran, Islamic Republic of). Chemistry Dept.; Dusek, Michal; Fejfarova, Karla [ASCR, Prague (Czech Republic). Inst. of Physics

    2016-05-15

    Uranyl(VI) complexes, [UO{sub 2}(X-saloph)(solvent)], where saloph denotes N,N{sup '}-bis(salicylidene)-1,2-phenylenediamine and X = NO{sub 2}, Cl, Me, H; were synthesized and characterized by 61H NMR, IR, UV-Vis spectroscopy, thermal gravimetry (TG), cyclic voltammetry, elemental analysis (C.H.N) and X-ray crystallography. X-ray crystallography of [UO{sub 2}(4-nitro-saloph)(DMF)] revealed coordination of the uranyl by the tetradentate Schiff base ligand and one solvent molecule, resulting in seven-coordinated uranium. The complex of [UO{sub 2}(4-nitro-saloph)(DMF)] was also synthesized in nano form. Transmission electron microscopy image showed nano-particles with sizes between 30 and 35 nm. The TG method and analysis of Coats-Redfern plots revealed that the kinetics of thermal decomposition of the complexes is of the first-order in all stages. The kinetics and mechanism of the exchange reaction of the coordinated solvent with tributylphosphine was investigated by spectrophotometric method. The second-order rate constants at four temperatures and the activation parameters showed an associative mechanism for all corresponding complexes with the following trend: 4-Nitro > 4-Cl > H > 4-Me. It was concluded that the steric and electronic properties of the complexes were important for the reaction rate. For analysis of anticancer properties of uranyl Schiff base complexes, cell culture and MTT assay was carried out. These results showed a reduction of jurkat cell line concentration across the complexes.

  3. DNA hydrogel-based supercapacitors operating in physiological fluids

    Science.gov (United States)

    Hur, Jaehyun; Im, Kyuhyun; Hwang, Sekyu; Choi, ByoungLyong; Kim, Sungjee; Hwang, Sungwoo; Park, Nokyoung; Kim, Kinam

    2013-01-01

    DNA nanostructures have been attractive due to their structural properties resulting in many important breakthroughs especially in controlled assemblies and many biological applications. Here, we report a unique energy storage device which is a supercapacitor that uses nanostructured DNA hydrogel (Dgel) as a template and layer-by-layer (LBL)-deposited polyelectrolyte multilayers (PEMs) as conductors. Our device, named as PEM-Dgel supercapacitor, showed excellent performance in direct contact with physiological fluids such as artificial urine and phosphate buffered saline without any need of additional electrolytes, and exhibited almost no cytotoxicity during cycling tests in cell culture medium. Moreover, we demonstrated that the PEM-Dgel supercapacitor has greater charge-discharge cycling stability in physiological fluids than highly concentrated acid electrolyte solution which is normally used for supercapacitor operation. These conceptually new supercapacitors have the potential to be a platform technology for the creation of implantable energy storage devices for packageless applications directly utilizing biofluids. PMID:23412432

  4. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    Science.gov (United States)

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat

    2018-03-01

    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  5. Opto-electronic DNA chip-based integrated card for clinical diagnostics.

    Science.gov (United States)

    Marchand, Gilles; Broyer, Patrick; Lanet, Véronique; Delattre, Cyril; Foucault, Frédéric; Menou, Lionel; Calvas, Bernard; Roller, Denis; Ginot, Frédéric; Campagnolo, Raymond; Mallard, Frédéric

    2008-02-01

    Clinical diagnostics is one of the most promising applications for microfluidic lab-on-a-chip or lab-on-card systems. DNA chips, which provide multiparametric data, are privileged tools for genomic analysis. However, automation of molecular biology protocol and use of these DNA chips in fully integrated systems remains a great challenge. Simplicity of chip and/or card/instrument interfaces is amongst the most critical issues to be addressed. Indeed, current detection systems for DNA chip reading are often complex, expensive, bulky and even limited in terms of sensitivity or accuracy. Furthermore, for liquid handling in the lab-on-cards, many devices use complex and bulky systems, either to directly manipulate fluids, or to ensure pneumatic or mechanical control of integrated valves. All these drawbacks prevent or limit the use of DNA-chip-based integrated systems, for point-of-care testing or as a routine diagnostics tool. We present here a DNA-chip-based protocol integration on a plastic card for clinical diagnostics applications including: (1) an opto-electronic DNA-chip, (2) fluid handling using electrically activated embedded pyrotechnic microvalves with closing/opening functions. We demonstrate both fluidic and electric packaging of the optoelectronic DNA chip without major alteration of its electronical and biological functionalities, and fluid control using novel electrically activable pyrotechnic microvalves. Finally, we suggest a complete design of a card dedicated to automation of a complex biological protocol with a fully electrical fluid handling and DNA chip reading.

  6. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Science.gov (United States)

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  7. High-Throughput Array Instrument for DNA-Based Breast Cancer Diagnostics

    National Research Council Canada - National Science Library

    Swerdlow, Harold

    2000-01-01

    ...) for breast-cancer diagnostics. These methods are based upon large numbers of discrete DNA spots placed on glass microscope slides typically, and hybridized to a probe derived from a tIssue or blood sample...

  8. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage

    Science.gov (United States)

    Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.

    1999-01-01

    DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315

  9. The essential component in DNA-based information storage system: robust error-tolerating module

    Directory of Open Access Journals (Sweden)

    Aldrin Kay-Yuen eYim

    2014-11-01

    Full Text Available The size of digital data is ever increasing and is expected to grow to 40,000EB by 2020, yet the estimated global information storage capacity in 2011 is less than 300EB, indicating that most of the data are transient. DNA, as a very stable nano-molecule, is an ideal massive storage device for long-term data archive. The two most notable illustrations are from Church et al. and Goldman et al., whose approaches are well-optimized for most sequencing platforms – short synthesized DNA fragments without homopolymer. Here we suggested improvements on error handling methodology that could enable the integration of DNA-based computational process, e.g. algorithms based on self-assembly of DNA. As a proof of concept, a picture of size 438 bytes was encoded to DNA with Low-Density Parity-Check error-correction code. We salvaged a significant portion of sequencing reads with mutations generated during DNA synthesis and sequencing and successfully reconstructed the entire picture. A modular-based programming framework - DNAcodec with a XML-based data format was also introduced. Our experiments demonstrated the practicability of long DNA message recovery with high error-tolerance, which opens the field to biocomputing and synthetic biology.

  10. Radiation chemistry of the base components of DNA and related substances

    International Nuclear Information System (INIS)

    Teoule, R.

    1979-01-01

    The loss of UV absorption may be considered as a useful index to evaluate the extent of base destruction. The variations observed reflect the sum of different phenomena: the modification of base stacking, hydrogen bond rupture between DNA bases and the saturation of conjugated double bonds of heterocycles. Another way to measure the base degradation is by formic acid hydrolysis. Radiation products are very sensitive to the formic acid hydrolysis performed at 180 deg C. In aerated solutions, an important event responsible for the degradation of pyrimidine bases is the formation of hydroperoxide. This review consists of the following subheadings: identification of the DNA base damages; thymine fragment in aerated solutions and in deaerated solutions; adenine fragment; and cytosine fragment. The review concludes with the remarks: one has to be very cautious in the extrapolation of the results obtained by the gamma irradiation of free bases in solution to DNA. Free bases are liberated but no nucleoside during irradiation. (Yamashita, S.)

  11. Droplet-based microscale colorimetric biosensor for multiplexed DNA analysis via a graphene nanoprobe

    International Nuclear Information System (INIS)

    Xiang Xia; Luo Ming; Shi Liyang; Ji Xinghu; He Zhike

    2012-01-01

    Graphical abstract: With a microvalve manipulate technique combined with droplet platform, a microscale fluorescence-based colorimetric sensor for multiplexed DNA analysis is developed via a graphene nanoprobe. Highlights: ► A quantitative detection for multiplexed DNA is first realized on droplet platform. ► The DNA detection is relied on a simple fluorescence-based colorimetric method. ► GO is served as a quencher for two different DNA fluorescent probes. ► This present work provides a rapid, sensitive, visual and convenient detection tool for droplet biosensor. - Abstract: The development of simple and inexpensive DNA detection strategy is very significant for droplet-based microfluidic system. Here, a droplet-based biosensor for multiplexed DNA analysis is developed with a common imaging device by using fluorescence-based colorimetric method and a graphene nanoprobe. With the aid of droplet manipulation technique, droplet size adjustment, droplet fusion and droplet trap are realized accurately and precisely. Due to the high quenching efficiency of graphene oxide (GO), in the absence of target DNAs, the droplet containing two single-stranded DNA probes and GO shows dark color, in which the DNA probes are labeled carboxy fluorescein (FAM) and 6-carboxy-X-rhodamine (ROX), respectively. The droplet changes from dark to bright color when the DNA probes form double helix with the specific target DNAs leading to the dyes far away from GO. This colorimetric droplet biosensor exhibits a quantitative capability for simultaneous detection of two different target DNAs with the detection limits of 9.46 and 9.67 × 10 −8 M, respectively. It is also demonstrated that this biosensor platform can become a promising detection tool in high throughput applications with low consumption of reagents. Moreover, the incorporation of graphene nanoprobe and droplet technique can drive the biosensor field one more step to some extent.

  12. Simple, heart-smart substitutions

    Science.gov (United States)

    Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...

  13. The effect of Al substitution on thermal and mechanical properties of Fe-based bulk metallic glass

    International Nuclear Information System (INIS)

    Ma, R.D.; Zhang, H.F.; Yu, H.S.; Hu, Z.Q.

    2008-01-01

    In this paper, a systematic investigation about the effect of Al substitution on properties of Fe-Cr-Mo-Er-C-B amorphous material, including glass-forming ability (GFA), thermal properties, and mechanical properties was presented. It was found out by X-ray diffraction (XRD) that the glass-forming ability decreased with the increase of Al, when Al reached 7 at%, fully amorphous specimen was not obtained. With regard to thermal parameters, such as glass transition temperature T g , crystallization temperature T x , supercooled liquid region ΔT x , and reduced glass temperature T rg were checked by differential scanning calorimeter. A rather wide supercooled liquid region more than 40 K was found. During compression test, results showed Al substitution slightly improved the fracture strength from 3.4 to 3.7 GPa. The fracture morphology was observed by scanning electron microscopy. Micrographs showed the same cleavage-like fracture in spite of different Al substitution

  14. A flexible fluorescence correlation spectroscopy based method for quantification of the DNA double labeling efficiency with precision control

    International Nuclear Information System (INIS)

    Hou, Sen; Tabaka, Marcin; Sun, Lili; Trochimczyk, Piotr; Kaminski, Tomasz S; Kalwarczyk, Tomasz; Zhang, Xuzhu; Holyst, Robert

    2014-01-01

    We developed a laser-based method to quantify the double labeling efficiency of double-stranded DNA (dsDNA) in a fluorescent dsDNA pool with fluorescence correlation spectroscopy (FCS). Though, for quantitative biochemistry, accurate measurement of this parameter is of critical importance, before our work it was almost impossible to quantify what percentage of DNA is doubly labeled with the same dye. The dsDNA is produced by annealing complementary single-stranded DNA (ssDNA) labeled with the same dye at 5′ end. Due to imperfect ssDNA labeling, the resulting dsDNA is a mixture of doubly labeled dsDNA, singly labeled dsDNA and unlabeled dsDNA. Our method allows the percentage of doubly labeled dsDNA in the total fluorescent dsDNA pool to be measured. In this method, we excite the imperfectly labeled dsDNA sample in a focal volume of <1 fL with a laser beam and correlate the fluctuations of the fluorescence signal to get the FCS autocorrelation curves; we express the amplitudes of the autocorrelation function as a function of the DNA labeling efficiency; we perform a comparative analysis of a dsDNA sample and a reference dsDNA sample, which is prepared by increasing the total dsDNA concentration c (c > 1) times by adding unlabeled ssDNA during the annealing process. The method is flexible in that it allows for the selection of the reference sample and the c value can be adjusted as needed for a specific study. We express the precision of the method as a function of the ssDNA labeling efficiency or the dsDNA double labeling efficiency. The measurement precision can be controlled by changing the c value. (letter)

  15. A set of lacZ mutations in Escherichia coli that allow rapid detection of each of the six base substitutions

    International Nuclear Information System (INIS)

    Cupples, C.G.; Miller, J.H.

    1989-01-01

    We describe the construction of six strains of Escherichia coli with different mutations at the same coding position in the lacZ gene, which specifies the active site glutamic acid residue at position 461 in beta'-galactosidase. Each strain is Lac- and reverts to Lac+ only by restoring the glutamic acid codon. The strains have been designed so that each reverts via one of the six base substitutions. The set of strains allows detection of each transition and transversion simply by monitoring the Lac- to Lac+ frequency, as demonstrated here with characterized mutagens and mutator alleles. These strains are useful for rapidly determining the mutagenic specificity of mutagens at a single site, for detecting low levels of stimulation of certain base substitutions, for monitoring specific base changes in response to various experimental conditions or strain backgrounds, and for isolating new mutator strains

  16. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  17. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    Science.gov (United States)

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  18. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  19. Mutations of different molecular origins exhibit contrasting patterns of regional substitution rate variation.

    Directory of Open Access Journals (Sweden)

    Navin Elango

    2008-02-01

    Full Text Available Transitions at CpG dinucleotides, referred to as "CpG substitutions", are a major mutational input into vertebrate genomes and a leading cause of human genetic disease. The prevalence of CpG substitutions is due to their mutational origin, which is dependent on DNA methylation. In comparison, other single nucleotide substitutions (for example those occurring at GpC dinucleotides mainly arise from errors during DNA replication. Here we analyzed high quality BAC-based data from human, chimpanzee, and baboon to investigate regional variation of CpG substitution rates. We show that CpG substitutions occur approximately 15 times more frequently than other single nucleotide substitutions in primate genomes, and that they exhibit substantial regional variation. Patterns of CpG rate variation are consistent with differences in methylation level and susceptibility to subsequent deamination. In particular, we propose a "distance-decaying" hypothesis, positing that due to the molecular mechanism of a CpG substitution, rates are correlated with the stability of double-stranded DNA surrounding each CpG dinucleotide, and the effect of local DNA stability may decrease with distance from the CpG dinucleotide.Consistent with our "distance-decaying" hypothesis, rates of CpG substitution are strongly (negatively correlated with regional G+C content. The influence of G+C content decays as the distance from the target CpG site increases. We estimate that the influence of local G+C content extends up to 1,500 approximately 2,000 bps centered on each CpG site. We also show that the distance-decaying relationship persisted when we controlled for the effect of long-range homogeneity of nucleotide composition. GpC sites, in contrast, do not exhibit such "distance-decaying" relationship. Our results highlight an example of the distinctive properties of methylation-dependent substitutions versus substitutions mostly arising from errors during DNA replication. Furthermore

  20. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  1. Synthesis and Characterization of a Heterometallic Extended Architecture Based on a Manganese(II-Substituted Sandwich-Type Polyoxotungstate

    Directory of Open Access Journals (Sweden)

    Masooma Ibrahim

    2018-01-01

    Full Text Available The reaction of [α-P2W15O56]12− with MnII and DyIII in an aqueous basic solution led to the isolation of an all inorganic heterometallic aggregate Na10(OH242[{Dy(H2O6}2Mn4P4W30O112(H2O2]·17H2O (Dy2Mn4-P2W15. Single-crystal X-ray diffraction revealed that Dy2Mn4-P2W15 crystallizes in the triclinic system with space group P 1 ¯ , and consists of a tetranuclear manganese(II-substituted sandwich-type phosphotungstate [Mn4(H2O2(P2W15O562]16− (Mn4-P2W15, Na, and DyIII cations. Compound Dy2Mn4-P2W15 exhibits a 1D ladder-like chain structure based on sandwich-type segments and dysprosium cations as linkers, which are further connected into a three-dimensional open framework by sodium cations. The title compound was structurally and compositionally characterized in solid state by single-crystal XRD, powder X-ray diffraction (PXRD, Fourier-transform infrared spectroscopy (FTIR, thermogravimetric (TGA, and elemental analyses. Further, the absorption and emission electronic spectra in aqueous solutions of Dy2Mn4-P2W15 and Mn4-P2W15 were studied. Also, magnetic properties were studied and compared with the magnetic behavior of [Mn4(H2O2(P2W15O562]16−.

  2. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  4. Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.

    Science.gov (United States)

    Xiao, Lu; Xiang, Yu

    2016-06-01

    The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    Science.gov (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Influence of uvrB and pKM101 on the spectrum of spontaneous, UV- and gamma-ray-induced base substitutions that revert hisG46 in Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Eisenstadt, E; Kahng, L -S; Miller, J K; Barnes, W M

    1989-01-01

    Oligonucleotide probes were used to identify base substitutions in 1089 revertants of hisG46 in Salmonella typhimurium that arose spontaneously or following irradiation with UV- or ..gamma..-rays. The hisG46 allele, carrying a mutant CCC codon (Pro) in place of the wild-type codon CTC (Leu69) reverted via 6 distinguishable mutational events: C to T transitions at codon sites 1 or 2, C to A or C to G transversions at codon site 1, C to A at codon site 2, and an extragenic suppressor mutation. The distribution of hisG46 revertants differed among treatments and was influenced by the DNA-repair capacity of the bacteria. Plasmid pKM101 enhanced the frequencies of both spontaneous adn induced mutations; transversion events were enhanced more efficiently by pKM101 than were transition events. Compared to Uvr/sup +/ bacteria, Uvr/sup -/ bacteria had higher frequencies of spontaneous and induced mutations; transition mutations were enhanced more efficiently than were transversion mutations. The inflence of DNA-repair activiteis on the mutational spectra provides some insights on the origins of spontaneous and UV-induced mutations. (author). 75 refs.; 4 figs.; 4 tabs.

  7. Characterization of polymer, DNA-based, and silk thin film resistivities and of DNA-based films prepared for enhanced electrical conductivity

    Science.gov (United States)

    Yaney, Perry P.; Ouchen, Fahima; Grote, James G.

    2009-08-01

    DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.

  8. Anhydrous crystals of DNA bases are wide gap semiconductors.

    Science.gov (United States)

    Maia, F F; Freire, V N; Caetano, E W S; Azevedo, D L; Sales, F A M; Albuquerque, E L

    2011-05-07

    We present the structural, electronic, and optical properties of anhydrous crystals of DNA nucleobases (guanine, adenine, cytosine, and thymine) found after DFT (Density Functional Theory) calculations within the local density approximation, as well as experimental measurements of optical absorption for powders of these crystals. Guanine and cytosine (adenine and thymine) anhydrous crystals are predicted from the DFT simulations to be direct (indirect) band gap semiconductors, with values 2.68 eV and 3.30 eV (2.83 eV and 3.22 eV), respectively, while the experimentally estimated band gaps we have measured are 3.83 eV and 3.84 eV (3.89 eV and 4.07 eV), in the same order. The electronic effective masses we have obtained at band extremes show that, at low temperatures, these crystals behave like wide gap semiconductors for electrons moving along the nucleobases stacking direction, while the hole transport are somewhat limited. Lastly, the calculated electronic dielectric functions of DNA nucleobases crystals in the parallel and perpendicular directions to the stacking planes exhibit a high degree of anisotropy (except cytosine), in agreement with published experimental results.

  9. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification.

    Science.gov (United States)

    Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng

    2014-06-15

    Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Temperature and electrolyte optimization of the α-hemolysin latch sensing zone for detection of base modification in double-stranded DNA.

    Science.gov (United States)

    Johnson, Robert P; Fleming, Aaron M; Jin, Qian; Burrows, Cynthia J; White, Henry S

    2014-08-19

    The latch region of the wild-type protein pore α-hemolysin (α-HL) constitutes a sensing zone for individual abasic sites (and furan analogs) in double-stranded DNA (dsDNA). The presence of an abasic site or furan within a DNA duplex, electrophoretically captured in the α-HL vestibule and positioned at the latch region, can be detected based on the current blockage prior to duplex unzipping. We investigated variations in blockage current as a function of temperature (12-35°C) and KCl concentration (0.15-1.0 M) to understand the origin of the current signature and to optimize conditions for identifying the base modification. In 1 M KCl solution, substitution of a furan for a cytosine base in the latch region results in an ∼ 8 kJ mol(-1) decrease in the activation energy for ion transport through the protein pore. This corresponds to a readily measured ∼ 2 pA increase in current at room temperature. Optimal resolution for detecting the presence of a furan in the latch region is achieved at lower KCl concentrations, where the noise in the measured blockage current is significantly lower. The noise associated with the blockage current also depends on the stability of the duplex (as measured from the melting temperature), where a greater noise in the measured blockage current is observed for less stable duplexes. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  11. Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

    Science.gov (United States)

    Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

    2018-06-01

    Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

  12. Sealing ability of a new calcium silicate based material as a dentin substitute in class II sandwich restorations: An in vitro study

    Directory of Open Access Journals (Sweden)

    Raji Viola Solomon

    2014-01-01

    Full Text Available Background: Class ll sandwich restorations are routinely performed where conventional Glass ionomer cement (GIC or Resin-modified GIC (RMGIC is used as a base or dentin substitute and a light curing composite resin restorative material is used as an enamel substitute. Various authors have evaluated the microleakage of composite resin restorations where glass ionomer cement has been used as a base in class II sandwich restorations, but a literature survey reveals limited studies on the microleakage analysis of similar restorations with biodentine as a dentin substitute, as an alternative to glass ionomer cement. The aim of this study is: To evaluate the marginal sealing efficacy of a new calcium-silicate-based material (Biodentine as a dentin substitute, at the cervical margins, in posterior class II sandwich restorations.To compare and evaluate the microleakage at the biodentine/composite interface with the microleakage at the resin-modified GIC/composite interface, in posterior class II open sandwich restorations. To compare the efficacy between a water-based etch and rinse adhesive (Scotch bond multipurpose and an acetone-based etch and rinse adhesive (Prime and bond NT, when bonding biodentine to the composite. To evaluate the enamel, dentin, and interfacial microleakage at the composite and biodentine/RMGIC interfaces. Materials and Methods: Fifty class II cavities were prepared on the mesial and distal surfaces of 25 extracted human maxillary third molars, which were randomly divided into five groups of ten cavities each: (G1 Biodentine group, (G2 Fuji II LC GIC group, (G3 Biodentine as a base + prime and bond NT + Tetric N-Ceram composite, (G4 Biodentine + scotchbond multi-purpose + Tetric N-Ceram composite, (G5 Fuji II LC as a base + prime and bond NT+ Tetric-N Ceram composite. The samples were then subjected to thermocycling, 2500× (5°C to 55°C, followed by the dye penetration test. Scores are given from 0 to 3 based on the depth of

  13. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  14. A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis

    Science.gov (United States)

    Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan

    2009-01-01

    DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301

  15. DNA-based stable isotope probing: a link between community structure and function

    International Nuclear Information System (INIS)

    Uhlik, Ondrej; Jecna, Katerina; Leigh, Mary Beth; Mackova, Martina; Macek, Tomas

    2009-01-01

    DNA-based molecular techniques permit the comprehensive determination of microbial diversity but generally do not reveal the relationship between the identity and the function of microorganisms. The first direct molecular technique to enable the linkage of phylogeny with function is DNA-based stable isotope probing (DNA-SIP). Applying this method first helped describe the utilization of simple compounds, such as methane, methanol or glucose and has since been used to detect microbial communities active in the utilization of a wide variety of compounds, including various xenobiotics. The principle of the method lies in providing 13C-labeled substrate to a microbial community and subsequent analyses of the 13C-DNA isolated from the community. Isopycnic centrifugation permits separating 13C-labeled DNA of organisms that utilized the substrate from 12C-DNA of the inactive majority. As the whole metagenome of active populations is isolated, its follow-up analysis provides successful taxonomic identification as well as the potential for functional gene analyses. Because of its power, DNA-SIP has become one of the leading techniques of microbial ecology research. But from other point of view, it is a labor-intensive method that requires careful attention to detail during each experimental step in order to avoid misinterpretation of results.

  16. Designing thermal diode and heat pump based on DNA nanowire: Multifractal approach

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@iaurmia.ac.ir; Panahinia, R.

    2017-07-12

    The management of heat flow in DNA nano wire was considered. Thermal diode effect in DNA and the domain of its appearance dependent to system parameters have been detected. The appearance of directed thermal flow in thermodynamic sizes proposes the possibility of designing the macroscopic thermal rectifier. By applying driven force, pumping effect has been also observed. The resonance frequency of DNA and threshold amplitudes of driving force for attaining permanent pumping effect have been detected. Forasmuch as detecting negative differential thermal resistance (NDTR) phenomenon, DNA can act as a thermal transistor. By using an analytical parallel investigation based on Rényi spectrum analysis, threshold values to transition to NDTR and pumping regimes have been detected. - Highlights: • The control and management of heat current in DNA have been investigated. • Directed thermal flow and NDTR in DNA have been identified. • By increasing the system size, the reversed thermal rectification appeared. So, it is proposed the possibility of designing the macroscopic thermal rectifier. • Pumping effect accompanied with detection of resonance frequency of DNA has been observed. • To verify the results, we did a parallel analysis based on multifractal concept to detect threshold values for transition to pumping state and NDTR regime.

  17. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting

    Science.gov (United States)

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai

    2009-01-01

    SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241

  18. Substituted 2,1,3-Benzothiadiazole- And Thiophene-Based Polymers for Solar Cells - Introducing a New Thermocleavable Precursor

    DEFF Research Database (Denmark)

    Petersen, Martin Helgesen; Gevorgyan, Suren; Krebs, Frederik C

    2009-01-01

    Alkoxysubstituted and unsubstituted 2,1,3-benzothiadiazoles were prepared and copolymerized with substituted and unsubstituted thiophenes using both Stille and Yamamoto cross-coupling reactions. One class of the materials bore thermally labile ester groups. The materials were all found to have...

  19. Acid-Base Equilibria of Some N-Substituted Thiophene-2-Carboxamidoximes in Non-Aqueous Media

    OpenAIRE

    DÜRÜST, Nedime

    2002-01-01

    The protonation constants of the amino nitrogens of some N-substituted thiophene-2-carboxamidoximes have been determined in acetic acid by means of potentiometric titration with perchloric acid. pKa values of the title compounds were interpreted on the basis of structural effects due to the substituents and the main skeleton.

  20. Potential to curb the environmental burdens of American beef consumption using a novel plant-based beef substitute

    DEFF Research Database (Denmark)

    Goldstein, Benjamin Paul; Moses, Rebekah; Sammons, Norman

    2017-01-01

    and vegan diets where it substitutes for legumes, tofu and other protein sources. We find that relative to the mean US diet, vegetarian and vegan diets significantly reduce per-capita food-borne greenhouse gas emission (32% and 67%, respectively), blue water use (70% and 75%, respectively) and land...

  1. Abuse of Dextromethorphan-Based Cough Syrup as a Substitute for Licit and Illicit Drugs: A Theoretical Framework.

    Science.gov (United States)

    Darboe, Momodou N.

    1996-01-01

    Discusses the emergence of new types of abused drugs in the United States. Notes that young persons often search for substitutes for better-known substances. It is unclear, however, what factors determine the choice of drug or substance for experimentation, considering the wide range of choices. This paper attempts to delineate the factors that…

  2. Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

    KAUST Repository

    Fornander, Louise H

    2013-12-03

    The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

  3. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  4. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Eiko E Kuramae

    Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.

  5. Diaminoethane adsorption and water substitution on hydrated TiO2: a thermochemical study based on first-principles calculations.

    Science.gov (United States)

    Hémeryck, Anne; Motta, Alessandro; Swiatowska, Jolanta; Pereira-Nabais, Catarina; Marcus, Philippe; Costa, Dominique

    2013-07-14

    Epoxy-amines are used as structural adhesives deposited on Ti. The amine adhesion to a Ti surface depends highly on the surface state (oxidation, hydroxylation). Amines may adsorb above preadsorbed water molecules or substitute them to bind directly to surface Ti(4+) Lewis acid sites. The adsorption of a model amine molecule, diaminoethane (DAE), on a model surface, hydrated TiO2-anatase (101) surface, is investigated using Density Functional Theory including Dispersive forces (DFT-D) calculations. DAE adsorption and water substitution by DAE are exothermic processes and turn nearly isoenergetic at high coverage with adsorption-substitution energies around -0.3 eV (including dispersion forces and ZPE). Complementary ab initio molecular dynamics studies also suggest that the formation of an amine-water interaction induces water desorption from the surface at room temperature, a preliminary step towards the amine-Ti bond formation. An atomistic thermodynamic approach is developed to evaluate the interfacial free energy balance of both processes (adsorption and substitution). The main contributions to the energetic balance are dispersive interactions between molecules and the surface on the exergonic side, translational and rotational entropic contributions on the endergonic one. The substitution process is stabilized by 0.55 eV versus the adsorption one when free solvation, rotational and vibrational energies are considered. The main contribution to this free energy gain is due to water solvation. The calculations suggest that in toluene solvent with a water concentration of 10(-4) M or less, a full DAE layer replaces a preadsorbed water layer for a threshold concentration of DAE ≥ 0.1 M.

  6. Characteristics of Eastern Canadian cultivated Sphagnum and potential use as a substitute for perlite and vermiculite in peat-based horticultural substrates

    OpenAIRE

    M. Aubé; M. Quenum; L.L. Ranasinghe

    2015-01-01

    Sphagnum cultivation on harvested peatlands to meet wetland restoration objectives could be an economically feasible activity since cultivated Sphagnum has potential horticultural applications. We compared the characteristics of cultivated Sphagnum from Shippagan (Canada) with those of non-cultivated Sphagnum products from Chile, New Zealand and Canada, and assessed its potential as a perlite and vermiculite substitute in horticultural peat-based substrates. Shippagan cultivated Sphagnum was ...

  7. p-TSA/Base-Promoted Propargylation/Cyclization of β-Ketothioamides for the Regioselective Synthesis of Highly Substituted (Hydro)thiophenes.

    Science.gov (United States)

    Nandi, Ganesh Chandra; Singh, Maya Shankar

    2016-07-15

    Metal-free, p-toluenesulfonic acid (p-TSA)-mediated, straightforward propargylation of β-ketothioamides with aryl propargyl alcohol has been achieved at room temperature. In addition, the reaction also provided thiazole rings as byproducts. Furthermore, the propargylated thioamides undergo intramolecular 1,5-cyclization to afford fully substituted (hydro)thiophenes in the presence of base. Notably, the approach is pot, atom, and step economical (PASE).

  8. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  9. The radiation chemistry of the purine bases within DNA and related model compounds

    International Nuclear Information System (INIS)

    Cadet, J.; Berger, M.; Shaw, A.

    1986-01-01

    Both the direct and indirect effects of ionizing radiations are believed to contribute to the chemical changes induced in cellular DNA. Relevant information on the possible degradation pathways has been provided by studies using DNA model compounds, the major proportion of which have focused on pyrimidine components and sugar derivatives. With the development of powerful analytical tools such as high performance liquid chromatography and soft ionization mass spectrometry techniques, progress has recently been made in the elucidation of the nature of the radiation-induced chemical modifications of purine bases in DNA and related nucleosides and nucleotides. This short review details recent aspects of the radiation-induced degradation of adenine and guanine bases in DNA and its model compounds as the result of both direct and indirect effects. 11 refs., 2 figs., 1 tab

  10. Physically transient photonics: random versus distributed feedback lasing based on nanoimprinted DNA.

    Science.gov (United States)

    Camposeo, Andrea; Del Carro, Pompilio; Persano, Luana; Cyprych, Konrad; Szukalski, Adam; Sznitko, Lech; Mysliwiec, Jaroslaw; Pisignano, Dario

    2014-10-28

    Room-temperature nanoimprinted, DNA-based distributed feedback (DFB) laser operation at 605 nm is reported. The laser is made of a pure DNA host matrix doped with gain dyes. At high excitation densities, the emission of the untextured dye-doped DNA films is characterized by a broad emission peak with an overall line width of 12 nm and superimposed narrow peaks, characteristic of random lasing. Moreover, direct patterning of the DNA films is demonstrated with a resolution down to 100 nm, enabling the realization of both surface-emitting and edge-emitting DFB lasers with a typical line width of <0.3 nm. The resulting emission is polarized, with a ratio between the TE- and TM-polarized intensities exceeding 30. In addition, the nanopatterned devices dissolve in water within less than 2 min. These results demonstrate the possibility of realizing various physically transient nanophotonics and laser architectures, including random lasing and nanoimprinted devices, based on natural biopolymers.

  11. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  12. Design and Test of an Oscillation-based System Architecture for DNA Sensor Arrays

    NARCIS (Netherlands)

    Liu, Hongyuan; Kerkhoff, Hans G.; Richardson, Andrew; Zhang, X.; Nouet, Pascal; Azais, Florence

    2005-01-01

    A DfT strategy for MEMS-based DNA sensors is investigated in this paper. Based on a fault-free and defect model developed for a single sensing element and the VHDL-AMS simulation results, it is implied that an oscillation-based interface might be a potential solution for both testing and read out of

  13. Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

    International Nuclear Information System (INIS)

    Shamim, S.; Murtaza, S.; Nazar, M.F.

    2016-01-01

    A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

  14. Phylogeny and evolution of the auks (subfamily Alcinae) based on mitochondrial DNA sequences

    Science.gov (United States)

    Moum, Truls; Johansen, Steinar; Erikstad, Kjell Einar; Piatt, John F.

    1994-01-01

    The genetic divergence and phylogeny of the auks was assessed by mitochondrial DNA sequence comparisons in a study using 19 of the 22 auk species and two outgroup representatives. We compared more than 500 nucleotides from each of two mitochondrial genes encoding 12S rRNA and the NADH dehydrogenase subunit 6. Divergence times were estimated from transversional substitutions. The dovekie (Alle alle) is related to the razorbill (Alca torda) and the murres (Uria spp). Furthermore, the Xantus's murrelet (Synthliboramphus hypoleucus) and the ancient (Synthliboramphus antiquus) and Japanese murrelets (Synthliboramphus wumizusume) are genetically distinct members of the same main lineage, whereas brachyramphine and synthliboramphine murrelets are not closely related. An early adaptive radiation of six main species groups of auks seems to trace back to Middle Miocene. Later speciation probably involved ecological differentiations and geographical isolations.

  15. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  16. Synthesis and DNA interaction of a Sm(III) complex of a Schiff base ...

    African Journals Online (AJOL)

    The interaction between the Sm(III) complex of an ionic Schiff base [HL]-, derived from vanillin and L-tryptophan, and herring sperm DNA at physiological pH (7.40) has been studied by UV-Vis absorption, fluorescence and viscosity methods. The binding ratios nSm(III) : nK[HL] = 1:1 and nSm(III)L: nDNA =5:1 were confirmed ...

  17. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  18. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    OpenAIRE

    Ann-Charlotte Wallenhammar; Albin Gunnarson; Fredrik Hansson; Anders Jonsson

    2016-01-01

    Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to plantin...

  19. Feasibility study of molecular memory device based on DNA using methylation to store information

    International Nuclear Information System (INIS)

    Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

    2016-01-01

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  20. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    International Nuclear Information System (INIS)

    Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.

    2015-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor

  1. Feasibility study of molecular memory device based on DNA using methylation to store information

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

    2016-07-14

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  2. Highly Sensitive DNA Sensor Based on Upconversion Nanoparticles and Graphene Oxide.

    Science.gov (United States)

    Alonso-Cristobal, P; Vilela, P; El-Sagheer, A; Lopez-Cabarcos, E; Brown, T; Muskens, O L; Rubio-Retama, J; Kanaras, A G

    2015-06-17

    In this work we demonstrate a DNA biosensor based on fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er nanoparticles and graphene oxide (GO). Monodisperse NaYF4:Yb,Er nanoparticles with a mean diameter of 29.1 ± 2.2 nm were synthesized and coated with a SiO2 shell of 11 nm, which allowed the attachment of single strands of DNA. When these DNA-functionalized NaYF4:Yb,Er@SiO2 nanoparticles were in the proximity of the GO surface, the π-π stacking interaction between the nucleobases of the DNA and the sp(2) carbons of the GO induced a FRET fluorescence quenching due to the overlap of the fluorescence emission of the NaYF4:Yb,Er@SiO2 and the absorption spectrum of GO. By contrast, in the presence of the complementary DNA strands, the hybridization leads to double-stranded DNA that does not interact with the GO surface, and thus the NaYF4:Yb,Er@SiO2 nanoparticles remain unquenched and fluorescent. The high sensitivity and specificity of this sensor introduces a new method for the detection of DNA with a detection limit of 5 pM.

  3. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    Science.gov (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  4. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  5. Identification of Neoceratitis asiatica (Becker) (Diptera: Tephritidae) based on morphological characteristics and DNA barcode.

    Science.gov (United States)

    Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong

    2017-12-12

    Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.

  6. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Science.gov (United States)

    Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E

    2014-01-01

    Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  7. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Directory of Open Access Journals (Sweden)

    Katja Limmer

    Full Text Available Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA, parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  8. Differential Genetic Associations for Systemic Lupus Erythematosus Based on Anti–dsDNA Autoantibody Production

    Science.gov (United States)

    Chung, Sharon A.; Taylor, Kimberly E.; Graham, Robert R.; Nititham, Joanne; Lee, Annette T.; Ortmann, Ward A.; Jacob, Chaim O.; Alarcón-Riquelme, Marta E.; Tsao, Betty P.; Harley, John B.; Gaffney, Patrick M.; Moser, Kathy L.; Petri, Michelle; Demirci, F. Yesim; Kamboh, M. Ilyas; Manzi, Susan; Gregersen, Peter K.; Langefeld, Carl D.; Behrens, Timothy W.; Criswell, Lindsey A.

    2011-01-01

    Systemic lupus erythematosus (SLE) is a clinically heterogeneous, systemic autoimmune disease characterized by autoantibody formation. Previously published genome-wide association studies (GWAS) have investigated SLE as a single phenotype. Therefore, we conducted a GWAS to identify genetic factors associated with anti–dsDNA autoantibody production, a SLE–related autoantibody with diagnostic and clinical importance. Using two independent datasets, over 400,000 single nucleotide polymorphisms (SNPs) were studied in a total of 1,717 SLE cases and 4,813 healthy controls. Anti–dsDNA autoantibody positive (anti–dsDNA +, n = 811) and anti–dsDNA autoantibody negative (anti–dsDNA –, n = 906) SLE cases were compared to healthy controls and to each other to identify SNPs associated specifically with these SLE subtypes. SNPs in the previously identified SLE susceptibility loci STAT4, IRF5, ITGAM, and the major histocompatibility complex were strongly associated with anti–dsDNA + SLE. Far fewer and weaker associations were observed for anti–dsDNA – SLE. For example, rs7574865 in STAT4 had an OR for anti–dsDNA + SLE of 1.77 (95% CI 1.57–1.99, p = 2.0E-20) compared to an OR for anti–dsDNA – SLE of 1.26 (95% CI 1.12–1.41, p = 2.4E-04), with pheterogeneity<0.0005. SNPs in the SLE susceptibility loci BANK1, KIAA1542, and UBE2L3 showed evidence of association with anti–dsDNA + SLE and were not associated with anti–dsDNA – SLE. In conclusion, we identified differential genetic associations with SLE based on anti–dsDNA autoantibody production. Many previously identified SLE susceptibility loci may confer disease risk through their role in autoantibody production and be more accurately described as autoantibody propensity loci. Lack of strong SNP associations may suggest that other types of genetic variation or non-genetic factors such as environmental exposures have a greater impact on susceptibility to anti–dsDNA – SLE. PMID

  9. Differential genetic associations for systemic lupus erythematosus based on anti-dsDNA autoantibody production.

    Directory of Open Access Journals (Sweden)

    Sharon A Chung

    2011-03-01

    Full Text Available Systemic lupus erythematosus (SLE is a clinically heterogeneous, systemic autoimmune disease characterized by autoantibody formation. Previously published genome-wide association studies (GWAS have investigated SLE as a single phenotype. Therefore, we conducted a GWAS to identify genetic factors associated with anti-dsDNA autoantibody production, a SLE-related autoantibody with diagnostic and clinical importance. Using two independent datasets, over 400,000 single nucleotide polymorphisms (SNPs were studied in a total of 1,717 SLE cases and 4,813 healthy controls. Anti-dsDNA autoantibody positive (anti-dsDNA +, n = 811 and anti-dsDNA autoantibody negative (anti-dsDNA -, n = 906 SLE cases were compared to healthy controls and to each other to identify SNPs associated specifically with these SLE subtypes. SNPs in the previously identified SLE susceptibility loci STAT4, IRF5, ITGAM, and the major histocompatibility complex were strongly associated with anti-dsDNA + SLE. Far fewer and weaker associations were observed for anti-dsDNA - SLE. For example, rs7574865 in STAT4 had an OR for anti-dsDNA + SLE of 1.77 (95% CI 1.57-1.99, p = 2.0E-20 compared to an OR for anti-dsDNA - SLE of 1.26 (95% CI 1.12-1.41, p = 2.4E-04, with p(heterogeneity<0.0005. SNPs in the SLE susceptibility loci BANK1, KIAA1542, and UBE2L3 showed evidence of association with anti-dsDNA + SLE and were not associated with anti-dsDNA - SLE. In conclusion, we identified differential genetic associations with SLE based on anti-dsDNA autoantibody production. Many previously identified SLE susceptibility loci may confer disease risk through their role in autoantibody production and be more accurately described as autoantibody propensity loci. Lack of strong SNP associations may suggest that other types of genetic variation or non-genetic factors such as environmental exposures have a greater impact on susceptibility to anti-dsDNA - SLE.

  10. Ultrasensitive Electrochemical Detection of Clostridium perfringens DNA Based Morphology-Dependent DNA Adsorption Properties of CeO2 Nanorods in Dairy Products

    Directory of Open Access Journals (Sweden)

    Xingcan Qian

    2018-06-01

    Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.

  11. A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43% in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97 and lower for avian species (0.70. PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

  12. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Science.gov (United States)

    Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

    2013-01-01

    Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  13. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  14. Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

    Science.gov (United States)

    Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

    2012-02-01

    We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

  15. Application and comparison of large-scale solution-based DNA capture-enrichment methods on ancient DNA

    DEFF Research Database (Denmark)

    Avila Arcos, Maria del Carmen; Cappellini, Enrico; Romero-Navarro, J. Alberto

    2011-01-01

    The development of second-generation sequencing technologies has greatly benefitted the field of ancient DNA (aDNA). Its application can be further exploited by the use of targeted capture-enrichment methods to overcome restrictions posed by low endogenous and contaminating DNA in ancient samples...

  16. A novel type of banana liquid crystals based on 1-substituted naphtalene-2,7-diol cores

    Czech Academy of Sciences Publication Activity Database

    Svoboda, J.; Novotná, Vladimíra; Kozmík, V.; Glogarová, Milada; Weissflog, W.; Diele, S.; Pelzl, G.

    2003-01-01

    Roč. 13, - (2003), s. 2104-2110 ISSN 0959-9428 R&D Projects: GA ČR(CZ) GA202/02/0840 Grant - others:COST(XE) D14 WG 00015 Institutional research plan: CEZ:AV0Z1010914 Keywords : liquid crystals * banana -shaped mesogens * substituted naphthalene diols Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.659, year: 2003

  17. Financial mechanisms and social safety-oriented model of development of the Russian economy (based on import substitution and innovation

    Directory of Open Access Journals (Sweden)

    T. I. Ovchinnikova

    2016-01-01

    Full Text Available In article features of import substitution in the socially oriented model determined as economy with the high level of the state income redistribution of subjects of managing and developed on this basis of system of social protection are considered. Import substitution is considered from the traditional point of view – creation of new productions and technologies which are implemented at the expense of own and borrowed funds of investors. The financial mechanisms for implementation of innovations promoting import substitution are offered: industry plans and road maps as availability of reference points for creation of rational amounts of the budget payments and financial resources of the entities necessary for upgrade of productions, and also the directions of financial resources for implementation of specific most important national priorities and innovative investment projects. The volume of investment into the fixed capital correlated to its cost considerably grew from 3.5% in 2003 to 11.6% in 2009, but value of this indicator isn't enough as degree of depreciation of fixed assets in economy of the region constituted 44.9% in 2009. Direct foreign investments prevail: in Krasnoyarsk Krai their share constituted in 2009 – 45.4%, Krasnodar Region – 40.5%, the Nizhny Novgorod Region – 84.5%. In the Voronezh region such entities as KBHA, Federal State Unitary Enterprise State Research and Production Space Center branch of M. V. Khrunichev the Voronezh Mechanical Plant, JSC Sozvezdiye Concern having the high technologies making safety of the country and especially needing investments function. In plans of urgent strategy of social and economic development of the Voronezh region it is supposed to increase specific weight of innovative products of such entities and to increase the level of innovative activity till 2020. The socially oriented model considering import substitution domestic technologies and products needs strengthening of the

  18. Immunological detection of modified DNA bases in irradiated food

    International Nuclear Information System (INIS)

    Williams, J.H.H.; Tyreman, A.L.; Deeble, D.J.; Jones, M.; Smith, C.J.; Christiansen, J.F.; Beaumont, P.C.

    1996-01-01

    Ionising radiation is fatal to all known life forms given sufficient exposure in terms of dose and duration. This property has been used beneficially to sterilise a range of materials, particularly medical products where the removal of all contaminating organisms is deemed essential. Irradiation has long been used to sterilise food for consumption by certain categories of patients. The method is attractive because all potentially contaminating organisms can be removed by one simple treatment. Irradiation also slows down or stops certain processes such as sprouting. There are, however, disadvantages to irradiating food. It is not only DNA that is affected as alterations in lipid and protein components of the food may lead to a loss of quality. Although irradiation will kill bacteria it will probably not affect any toxin produced by those bacteria prior to treatment. Irradiation achieves its effects by damaging molecules, particularly nucleic acids. Consequently, if any of the damage to nucleic acids could be shown to by by a process unique to irradiation, and the products of this unique process could be measured, then there is the basis for a detection system. Furthermore, if the damage could be shown to be proportional to the dose of radiation received then the dose could also be quantified. Legislation, therefore, requires that assays be developed for use in different countries, those which totally ban irradiated food, those which require irradiated food to be labelled and those which have selective laws relating to specific foods and specific levels of irradiation. (author)

  19. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    Science.gov (United States)

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2017-06-15

    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  20. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    Science.gov (United States)

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  1. Cell cycle regulation of DNA polymerase beta in rotenone-based Parkinson's disease models.

    Directory of Open Access Journals (Sweden)

    Hongcai Wang

    Full Text Available In Parkinson's disease (PD, neuronal cells undergo mitotic catastrophe and endoreduplication prior to cell death; however, the regulatory mechanisms remain to be defined. In this study, we investigated cell cycle regulation of DNA polymerase β (poly β in rotenone-based dopaminergic cellular and animal models. Incubation with a low concentration (0.25 µM of rotenone for 1.5 to 7 days resulted in a flattened cell body and decreased DNA replication during S phase, whereas a high concentration (2 µM of rotenone exposure resulted in enlarged, multi-nucleated cells and converted the mitotic cycle into endoreduplication. Consistently, DNA poly β, which is mainly involved in DNA repair synthesis, was upregulated to a high level following exposure to 2 µM rotenone. The abrogation of DNA poly β by siRNA transfection or dideoxycytidine (DDC treatment attenuated the rotenone-induced endoreduplication. The cell cycle was reactivated in cyclin D-expressing dopaminergic neurons from the substantia nigra (SN of rats following stereotactic (ST infusion of rotenone. Increased DNA poly β expression was observed in the substantia nigra pars compacta (SNc and the substantia nigra pars reticulate (SNr of rotenone-treated rats. Collectively, in the in vitro model of rotenone-induced mitotic catastrophe, the overexpression of DNA poly β promotes endoreduplication; in the in vivo model, the upregulation of DNA poly β and cell cycle reentry were also observed in the adult rat substantia nigra. Therefore, the cell cycle regulation of DNA poly β may be involved in the pathological processes of PD, which results in the induction of endoreduplication.

  2. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  3. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  4. Implantation of silicon dioxide-based nanocrystalline hydroxyapatite and pure phase beta-tricalciumphosphate bone substitute granules in caprine muscle tissue does not induce new bone formation

    Directory of Open Access Journals (Sweden)

    Ghanaati Shahram

    2013-01-01

    Full Text Available Abstract Background Osteoinductive bone substitutes are defined by their ability to induce new bone formation even at heterotopic implantation sites. The present study was designed to analyze the potential osteoinductivity of two different bone substitute materials in caprine muscle tissue. Materials and methods One gram each of either a porous beta-tricalcium phosphate (β-TCP or an hydroxyapatite/silicon dioxide (HA/SiO2-based nanocrystalline bone substitute material was implanted in several muscle pouches of goats. The biomaterials were explanted at 29, 91 and 181 days after implantation. Conventional histology and special histochemical stains were performed to detect osteoblast precursor cells as well as mineralized and unmineralized bone matrix. Results Both materials underwent cellular degradation in which tartrate-resistant acid phosphatase (TRAP-positive osteoclast-like cells and TRAP-negative multinucleated giant cells were involved. The ß-TCP was completely resorbed within the observation period, whereas some granules of the HA-groups were still detectable after 180 days. Neither osteoblasts, osteoblast precursor cells nor extracellular bone matrix were found within the implantation bed of any of the analyzed biomaterials at any of the observed time points. Conclusions This study showed that ß-TCP underwent a faster degradation than the HA-based material. The lack of osteoinductivity for both materials might be due to their granular shape, as osteoinductivity in goat muscle has been mainly attributed to cylindrical or disc-shaped bone substitute materials. This hypothesis however requires further investigation to systematically analyze various materials with comparable characteristics in the same experimental setting.

  5. A novel input-parasitic compensation technique for a nanopore-based CMOS DNA detection sensor

    Science.gov (United States)

    Kim, Jungsuk

    2016-12-01

    This paper presents a novel input-parasitic compensation (IPC) technique for a nanopore-based complementary metal-oxide-semiconductor (CMOS) DNA detection sensor. A resistive-feedback transimpedance amplifier is typically adopted as the headstage of a DNA detection sensor to amplify the minute ionic currents generated from a nanopore and convert them to a readable voltage range for digitization. But, parasitic capacitances arising from the headstage input and the nanopore often cause headstage saturation during nanopore sensing, thereby resulting in significant DNA data loss. To compensate for the unwanted saturation, in this work, we propose an area-efficient and automated IPC technique, customized for a low-noise DNA detection sensor, fabricated using a 0.35- μm CMOS process; we demonstrated this prototype in a benchtop test using an α-hemolysin ( α-HL) protein nanopore.

  6. Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe

    Science.gov (United States)

    He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing

    2011-11-01

    The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.

  7. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. DNA-based construction at the nanoscale: emerging trends and applications

    Science.gov (United States)

    Lourdu Xavier, P.; Chandrasekaran, Arun Richard

    2018-02-01

    The field of structural DNA nanotechnology has evolved remarkably—from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes—in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.

  9. Synthesis, structure, DNA/BSA binding and antibacterial studies of NNO tridentate Schiff base metal complexes

    Science.gov (United States)

    Sakthi, Marimuthu; Ramu, Andy

    2017-12-01

    A new salicylaldehyde derived 2,4-diiodo-6-((2-phenylaminoethylimino)methyl)phenol Schiff base(L) and its transition metal complexes of the type MLCl where, M = Cu(II), Ni(II), Co(II), Mn(II) and Zn(II) have been synthesized. The coordination mode of Schiff base holding NNO donor atoms with metal ions was well investigated by elemental analysis, ESI-mass as well as IR, UV-vis, CV and NMR spectral studies. The binding efficiency and mode of these complexes with biological macromolecules viz., herring sperm DNA (HS- DNA) and bovine serum albumin (BSA) have been explored through various spectroscopic techniques. The characteristic changes in absorption, emission and, circular dichroism spectra of the complexes with DNA indicate the noticeable interaction between them. From the all spectral information complexes could interact with DNA via non-intercalation mode of binding. The hyperchromisim in absorption band and hypochromisim in emission intensity of BSA with different complex concentrations shown significant information, and the binding affinity value has been predicted from Stern-Volmer plots. Further, all the complexes could cleave the circular plasmid pUC19 DNA efficiently by using an activator H2O2. The ligand and all metal(II) complexes showed good antibacterial activities. The molecular docking studies of the complexes with DNA were performed in order to make a comparison and conclusion with spectral technic results.

  10. Chloroplast DNA variation in European white oaks phylogeography and patterns of diversity based on data from over 2600 populations

    NARCIS (Netherlands)

    Petit, R.J.; Csaikl, U.M.; Bordács, S.; Burg, K.; Coart, E.; Cottrell, J.; Dam, van B.C.; Deans, J.D.; Dumolin-LapOgue, S.; Fineschi, S.; Finkeldey, R.; Gillies, A.; Glaz, I.; Goicoechea, P.G.; Jensen, J.S.; König, A.O.; Lowe, A.J.; Madsen, S.F.; Mátyás, G.; Munro, R.C.; Olalde, M.; Pemonge, M.H.; Popescu, F.; Slade, D.; Tabbener, H.; Taurchini, D.; Vries, de S.G.M.; Ziegenhagen, B.; Kremer, A.

    2002-01-01

    A consortium of 16 laboratories have studied chloroplast DNA (cpDNA) variation in European white oaks. A common strategy for molecular screening, based on restriction analysis of four PCR-amplified cpDNA fragments, was used to allow comparison among the different laboratories. A total of 2613 oak

  11. Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand.

    Science.gov (United States)

    Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes

    2012-01-01

    Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.

  12. DNA minor groove targeted alkylating agents based on bisbenzimidazole carriers: synthesis, cytotoxicity and sequence-specificity of DNA alkylation.

    Science.gov (United States)

    Smaill, J B; Fan, J Y; Denny, W A

    1998-12-01

    A series of bisbenzimidazoles bearing a variety of alkylating agents [ortho- and meta-mustards, imidazolebis(hydroxymethyl), imidazolebis(methylcarbamate) and pyrrolebis(hydroxymethyl)], appended by a propyl linker chain, were prepared and investigated for sequence-specificity of DNA alkylation and their cytotoxicity. Previous work has shown that, for para-aniline mustards, a propyl linker is optimal for cytotoxicity. Alkaline cleavage assays using a variety of different labelled oligonucleotides showed that the preferred sequences for adenine alkylation were 5'-TTTANANAANN and 5'-ATTANANAANN (underlined bases show the drug alkylation sites), with AT-rich sequences required on both the 5' and 3' sides of the alkylated adenine. The different aniline mustards showed little variation in alkylation pattern and similar efficiencies of DNA cross-link formation despite the changes in orientation and positioning of the mustard, suggesting that the propyl linker has some flexibility. The imidazole- and pyrrolebis(hydroxymethyl) alkylators showed no DNA strand cleavage following base treatment, indicating that no guanine or adenine N3 or N7 adducts were formed. Using the PCR-based polymerase stop assay, these alkylators showed PCR blocks at 5'-C*G sites (the * nucleotide indicates the blocked site), particularly at 5'-TAC*GA 5'-AGC*GGA, and 5'-AGCC*GGT sequences, caused by guanine 2-NH2 lesions on the opposite strand. Only the (more reactive) imidazolebis(methylcarbamoyl) and pyrrolebis(hydroxymethyl) alkylators demonstrated interstrand cross-linking ability. All of the bifunctional mustards showed large (approximately 100-fold) increases in cytotoxicity over chlorambucil, with the corresponding monofunctional mustards being 20- to 60-fold less cytotoxic. These results suggest that in the mustards the propyl linker provides sufficient flexibility to achieve delivery of the alkylator to favoured (adenine N3) sites in the minor groove, regardless of its exact geometry with

  13. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Science.gov (United States)

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  14. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  15. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier

    2014-01-01

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL −1 and 50 μg mL −1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  16. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  17. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  18. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  19. A DNA-based semantic fusion model for remote sensing data.

    Directory of Open Access Journals (Sweden)

    Heng Sun

    Full Text Available Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  20. A DNA-based semantic fusion model for remote sensing data.

    Science.gov (United States)

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  1. A Quantitative Tool for Producing DNA-Based Diagnostic Arrays

    Energy Technology Data Exchange (ETDEWEB)

    Tom J. Whitaker

    2008-07-11

    The purpose of this project was to develop a precise, quantitative method to analyze oligodeoxynucleotides (ODNs) on an array to enable a systematic approach to quality control issues affecting DNA microarrays. Two types of ODN's were tested; ODN's formed by photolithography and ODN's printed onto microarrays. Initial work in Phase I, performed in conjunction with Affymetrix, Inc. who has a patent on a photolithographic in situ technique for creating DNA arrays, was very promising but did seem to indicate that the atomization process was not complete. Soon after Phase II work was under way, Affymetrix had further developed fluorescent methods and indicated they were no longer interested in our resonance ionization technique. This was communicated to the program manager and it was decided that the project would continue and be focused on printed ODNs. The method being tested is called SIRIS, Sputter-Initiated Resonance Ionization Spectroscopy. SIRIS has been shown to be a highly sensitive, selective, and quantitative tool for atomic species. This project was aimed at determining if an ODN could be labeled in such a way that SIRIS could be used to measure the label and thus provide quantitative measurements of the ODN on an array. One of the largest problems in this study has been developing a method that allows us to know the amount of an ODN on a surface independent of the SIRIS measurement. Even though we could accurately determine the amount of ODN deposited on a surface, the amount that actually attached to the surface is very difficult to measure (hence the need for a quantitative tool). A double-labeling procedure was developed in which 33P and Pt were both used to label ODNs. The radioactive 33P could be measured by a proportional counter that maps the counts in one dimension. This gave a good measurement of the amount of ODN remaining on a surface after immobilization and washing. A second label, Pt, was attached to guanine nucleotides in the

  2. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    Science.gov (United States)

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

    2018-02-12

    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

    Science.gov (United States)

    Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

    2012-06-01

    Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

  4. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  5. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Science.gov (United States)

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  7. Biosensor for label-free DNA quantification based on functionalized LPGs.

    Science.gov (United States)

    Gonçalves, Helena M R; Moreira, Luis; Pereira, Leonor; Jorge, Pedro; Gouveia, Carlos; Martins-Lopes, Paula; Fernandes, José R A

    2016-10-15

    A label-free fiber optic biosensor based on a long period grating (LPG) and a basic optical interrogation scheme using off the shelf components is used for the detection of in-situ DNA hybridization. A new methodology is proposed for the determination of the spectral position of the LPG mode resonance. The experimental limit of detection obtained for the DNA was 62±2nM and the limit of quantification was 209±7nM. The sample specificity was experimentally demonstrated using DNA targets with different base mismatches relatively to the probe and was found that the system has a single base mismatch selectivity. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Multiway study of hybridization in nanoscale semiconductor labeled DNA based on fluorescence resonance energy transfer

    DEFF Research Database (Denmark)

    Gholami, Somayeh; Kompany Zare, Mohsen

    2013-01-01

    donor-QD acceptor) upon hybridization with a label free target was monitored by two-dimensional photoluminescence excitation spectroscopy (2D-PLE). Detection of a target oligonucleotide strand, using sandwiched nanoassembly in a separation-free format, was performed with the appearance of a new feature...... and model based analysis of 2D-PLE data was implemented by means of PAR-AFAC and hard trilinear decomposition (HTD), allowing to fit a proper model for FRET-based sandwich DNA hybridization systems. This study is the first successful application of a multiway chemometric technique to consider FRET based DNA...... hybridization in sandwiched nanoassemblies. A multi-equilibria model was properly fitted to the data and confirmed there is a competition between ternary and binary complex formation. Equilibrium constants of DNA hybridization in sandwiched nanoassemblies were estimated for the first time. Equilibrium constants...

  9. Human mitochondrial DNA (mtDNA) types in Malaysia

    International Nuclear Information System (INIS)

    Lian, L.H.; Koh, C.L.; Lim, M.E.

    2000-01-01

    Each human cell contains hundreds of mitochondria and thousands of double-stranded circular mtDNA. The delineation of human mtDNA variation and genetics over the past decade has provided unique and often startling insights into human evolution, degenerative diseases, and aging. Each mtDNA of 16,569 base pairs, encodes 13 polypeptides essential to the enzymes of the mitochondrial energy generating pathway, plus the necessary tRNAs and rRNAs. The highly polymorphic noncoding D-(displacement) loop region, also called the control region, is approximately 1.2 kb long. It contains two well-characterized hypervariable (HV-) regions, HV1 and HV2. MtDNA identification is usually based on these sequence differences. According to the TWTGDAM (Technical Working Group for DNA Analysis Methods), the minimum requirement for a mtDNA database for HV1 is from positions 16024 to 16365 and for HV2, from positions 00073 to 00340. The targeted Malaysian population subgroups for this study were mainly the Malays, Chinese, Indians, and indigenous Ibans, Bidayuhs, Kadazan-Dusuns, and Bajaus. Research methodologies undertaken included DNA extraction of samples from unrelated individuals, amplification of the specific regions via the polymerase chain reaction (PCR), and preparation of template DNA for sequencing by using an automated DNA sequencer. Sufficient nucleotide sequence data were generated from the mtDNA analysis. When the sequences were analyzed, sequence variations were found to be caused by nucleotide substitutions, insertions, and deletions. Of the three causes of the sequence variations, nucleotide substitutions (86.1%) accounted for the vast majority of polymorphism. It is noted that transitions (83.5%) were predominant when compared to the significantly lower frequencies of transversions (2.6%). Insertions (0.9%) and deletions (13.0%) were rather rare and found only in HV2. The data generated will also form the basis of a Malaysian DNA sequence database of mtDNA D

  10. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  11. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  12. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  13. Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

    Science.gov (United States)

    Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

    2018-09-15

    Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.

    Science.gov (United States)

    Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike

    2018-05-01

    We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.

  15. High-speed DNA-based rolling motors powered by RNase H

    Science.gov (United States)

    Yehl, Kevin; Mugler, Andrew; Vivek, Skanda; Liu, Yang; Zhang, Yun; Fan, Mengzhen; Weeks, Eric R.

    2016-01-01

    DNA-based machines that walk by converting chemical energy into controlled motion could be of use in applications such as next generation sensors, drug delivery platforms, and biological computing. Despite their exquisite programmability, DNA-based walkers are, however, challenging to work with due to their low fidelity and slow rates (~1 nm/min). Here, we report DNA-based machines that roll rather than walk, and consequently have a maximum speed and processivity that is three-orders of magnitude greater than conventional DNA motors. The motors are made from DNA-coated spherical particles that hybridise to a surface modified with complementary RNA; motion is achieved through the addition of RNase H, which selectively hydrolyses hybridised RNA. Spherical motors move in a self-avoiding manner, whereas anisotropic particles, such as dimerised particles or rod-shaped particles travel linearly without a track or external force. Finally, we demonstrate detection of single nucleotide polymorphism by measuring particle displacement using a smartphone camera. PMID:26619152

  16. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    Science.gov (United States)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  17. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  18. DNA base-calling from a nanopore using a Viterbi algorithm.

    Science.gov (United States)

    Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-05-16

    Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  19. A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative

    Directory of Open Access Journals (Sweden)

    Md. Monirul Islam

    2015-06-01

    Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.

  20. A CCD-based system for the detection of DNA in electrophoresis gels by UV absorption

    International Nuclear Information System (INIS)

    Mahon, A.R.; MacDonald, J.H.; Mainwood, A.; Ott, R.J.

    1999-01-01

    A method and apparatus for the detection and quantification of large fragments of unlabelled nucleic acids in agarose gels is presented. The technique is based on ultraviolet (UV) absorption by nucleotides. A deuterium source illuminates individual sample lanes of an electrophoresis gel via an array of optical fibres. As DNA bands pass through the illuminated region of the gel the amount of UV light transmitted is reduced because of absorption by the DNA. During electrophoresis the regions of DNA are detected on-line using a UV-sensitive charge coupled device (CCD). As the absorption coefficient is proportional to the mass of DNA the technique is inherently quantitative. The mass of DNA in a region of the gel is approximately proportional to the integrated signal in the corresponding section of the CCD image. This system currently has a detection limit of less than 1.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. In addition the DNA sample remains in its native state. The removal of the carcinogenic dye from the detection procedure greatly reduces associated biological hazards. (author)