Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
Directory of Open Access Journals (Sweden)
Mudasir Mudasir
2010-06-01
Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+ most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA Keywords: DNA Binding, mixed-ligand complexes
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Metalophillic attraction in the consecutive T-HgII-T DNA base pairs
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír
2012-01-01
Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
International Nuclear Information System (INIS)
Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo
2012-01-01
Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Leszczynski, J.
2001-01-01
Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs
International Nuclear Information System (INIS)
Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie
2015-01-01
Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.
Directory of Open Access Journals (Sweden)
Alexandra Peacock-Villada
Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.
Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam
2017-11-02
In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...
Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA
International Nuclear Information System (INIS)
Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.
2003-01-01
Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-05-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA
Czech Academy of Sciences Publication Activity Database
Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.
2002-01-01
Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt
1998-01-01
This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668
Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs
Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.
2018-02-01
For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.
Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs
Directory of Open Access Journals (Sweden)
Ol'ha O. Brovarets'
2018-02-01
Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.
Directory of Open Access Journals (Sweden)
Aleksandra Delplanque
Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.
Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek
2015-01-01
Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.
Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo
2009-01-01
We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
A novel pseudo-complementary PNA G-C base pair
DEFF Research Database (Denmark)
Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn
2011-01-01
Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Directory of Open Access Journals (Sweden)
Hsin-Ming Liu
2012-08-01
Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Charge transport through DNA based electronic barriers
Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj
2018-05-01
We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.
Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang
2012-02-01
The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.
Energy Technology Data Exchange (ETDEWEB)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)
2016-04-19
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
Mondal Roy, Sutapa
2018-08-01
The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.
A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition
Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.
2003-01-01
A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209
International Nuclear Information System (INIS)
Straehle, U.; Klock, G.; Schuetz, G.
1987-01-01
To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same
Srivastava, Ruby
2018-03-01
We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.
International Nuclear Information System (INIS)
Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.
2007-01-01
M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka
2009-01-01
We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells
Wong, Ka-Chun; Li, Yue; Peng, Chengbin
2015-01-01
Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.
Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells
Wong, Ka-Chun
2015-09-27
Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.
Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components
Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik
2015-03-01
We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
Directory of Open Access Journals (Sweden)
Camila Ximenes
2014-12-01
Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos
2018-01-01
Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486
Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K
2005-01-01
Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the
Photochemical selectivity in guanine-cytosine base-pair structures
Czech Academy of Sciences Publication Activity Database
Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.
2005-01-01
Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis
2014-01-25
Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .
A universal DNA-based protein detection system.
Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan
2013-09-25
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.
Studies of base pair sequence effects on DNA solvation based on all
Indian Academy of Sciences (India)
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.
Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.
Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L
2015-12-01
Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt
2000-01-01
This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-01
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.
International Nuclear Information System (INIS)
Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.
1991-01-01
Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Gorodetsky, Alon A.; Buzzeo, Marisa C.
2009-01-01
The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370
Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien
2017-04-03
During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs
Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.
2012-01-01
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...
DNA nanostructure-based drug delivery nanosystems in cancer therapy.
Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei
2017-11-25
DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
Energy Technology Data Exchange (ETDEWEB)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)
2016-02-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
International Nuclear Information System (INIS)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.
2016-01-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes
A Constant Rate of Spontaneous Mutation in DNA-Based Microbes
Drake, John W.
1991-08-01
In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Directory of Open Access Journals (Sweden)
Michael F Sloma
2017-11-01
Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Sloma, Michael F; Mathews, David H
2017-11-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
International Nuclear Information System (INIS)
Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1988-01-01
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met
Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf
2014-10-01
Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit.
Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R.; Jauch, Ralf
2014-01-01
Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6–DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939
Electronic properties and assambly of DNA-based molecules on gold surfaces
DEFF Research Database (Denmark)
Salvatore, Princia
, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....
Frank, Natia L.; Meade, Thomas J.
2003-01-01
Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
How stable are the mutagenic tautomers of DNA bases?
Directory of Open Access Journals (Sweden)
Brovarets’ O. O.
2010-02-01
Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability
NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex
International Nuclear Information System (INIS)
Li, Ying; Wilson, W.D.; Zon, G.
1991-01-01
1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted
Verboven, N.; Mateman, A.C.
1997-01-01
Multilocus DNA fingerprinting was used to estimate the frequency of extra-pair fertilizations in a low density, island population of Great Tits Parus major. A total of 69 pairs and 516 offspring from 82 breeding attempts were examined. Only 18 offspring (3.5%) in seven different nests were not
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
DNA based methods used for characterization and detection of food ...
African Journals Online (AJOL)
Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...
Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M
2011-08-01
The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E
2012-12-04
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.
Directory of Open Access Journals (Sweden)
Masaru Tsunoda
2010-01-01
Full Text Available Hydroxyl radicals are potent mutagens that attack DNA to form various base and ribose derivatives. One of the major damaged thymine derivatives is 5-formyluracil (fU, which induces pyrimidine transition during replication. In order to establish the structural basis for such mutagenesis, the crystal structures of two kinds of DNA d(CGCGRATfUCGCG with R = A/G have been determined by X-ray crystallography. The fU residues form a Watson-Crick-type pair with A and two types of pairs (wobble and reversed wobble with G, the latter being a new type of base pair between ionized thymine base and guanine base. In silico structural modeling suggests that the DNA polymerase can accept the reversed wobble pair with G, as well as the Watson-Crick pair with A.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Processing of free radical damaged DNA bases
International Nuclear Information System (INIS)
Wallace, S.
2003-01-01
Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Triple-helix molecular switch-based aptasensors and DNA sensors.
Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad
2018-07-15
Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Radiation-induced electron migration along DNA
International Nuclear Information System (INIS)
Fuciarelli, A.F.; Sisk, E.C.; Miller, J.H.; Zimbrick, J.D.
1994-04-01
Radiation-induced electron migration along DNA is a mechanism by which randomly produced stochastic energy deposition events can lead to nonrandom types of damage along DNA manifested distal to the sites of the initial energy deposition. Electron migration along DNA is significantly influenced by the DNA base sequence and DNA conformation. Migration along 7 base pairs in oligonucleotides containing guanine bases was observed for oligonucleotides irradiated in solution which compares to average migration distances of 6 to 10 bases for Escherichia coli DNA irradiated in solution and 5.5 base pairs for Escherichia coli DNA irradiated in cells. Evidence also suggests that electron migration can occur preferentially in the 5' to 3' direction along DNA. Our continued efforts will provide information regarding the contribution of electron transfer along DNA to formation of locally multiply damaged sites created in DNA by exposure to ionizing radiation
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
Radical-pair based avian magnetoreception
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
DEFF Research Database (Denmark)
Astakhova, I Kira; Santhosh Kumar, T; Campbell, Meghan A
2013-01-01
Novel pyrene-perylene α-l-LNA FRET pairs described herein effectively detect assembly of 2- and 3-way branched DNA nanostructures prepared by postsynthetic microwave-assisted CuAAC click chemistry. The fluorescent signalling of assembly by internally positioned FRET pairs is achieved with low...
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis
DEFF Research Database (Denmark)
Svendsen, Anders J; Gervin, Kristina; Lyle, Robert
2016-01-01
: Smoking was significantly associated with hypomethylation of a DMR overlapping the promoter region of the RNF5 and the AGPAT1, which are implicated in inflammation and autoimmunity, whereas DMARD treatment induced hypermethylation of the same region. Additionally, the promotor region of both S100A6......OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J
2012-09-12
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer
Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.
2006-03-01
Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.
Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.
Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris
2016-07-15
A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin
2012-06-18
In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8) m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7) M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence
Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin
2015-10-01
Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.
Robertson, Carol
2016-01-01
Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…
Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation
Moktan, Hem; Pezza, Roberto; Zhou, Donghua
2015-03-01
The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.
International Nuclear Information System (INIS)
Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi
2010-01-01
2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.
Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage
Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan
2012-01-01
ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.
2012-01-01
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Directory of Open Access Journals (Sweden)
Wilson Zoe A
2010-02-01
Full Text Available Abstract Background ChIP-Seq, which combines chromatin immunoprecipitation (ChIP with high-throughput massively parallel sequencing, is increasingly being used for identification of protein-DNA interactions in vivo in the genome. However, to maximize the effectiveness of data analysis of such sequences requires the development of new algorithms that are able to accurately predict DNA-protein binding sites. Results Here, we present SIPeS (Site Identification from Paired-end Sequencing, a novel algorithm for precise identification of binding sites from short reads generated by paired-end solexa ChIP-Seq technology. In this paper we used ChIP-Seq data from the Arabidopsis basic helix-loop-helix transcription factor ABORTED MICROSPORES (AMS, which is expressed within the anther during pollen development, the results show that SIPeS has better resolution for binding site identification compared to two existing ChIP-Seq peak detection algorithms, Cisgenome and MACS. Conclusions When compared to Cisgenome and MACS, SIPeS shows better resolution for binding site discovery. Moreover, SIPeS is designed to calculate the mappable genome length accurately with the fragment length based on the paired-end reads. Dynamic baselines are also employed to effectively discriminate closely adjacent binding sites, for effective binding sites discovery, which is of particular value when working with high-density genomes.
High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds
Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.
2003-01-01
We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985
Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis
International Nuclear Information System (INIS)
Lau How Mooi
1998-01-01
Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured
A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs
International Nuclear Information System (INIS)
Yang, Mengsi; Jin, Jianhua; Xu, Guiqing; Cui, Fengling; Luo, Hongxia
2014-01-01
Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Hopton, Suzanne R; Thompson, Andrew S
2011-05-17
Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.
Directory of Open Access Journals (Sweden)
Rie Kawai
2012-03-01
Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.
Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul
2017-01-01
The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
International Nuclear Information System (INIS)
Cortini, Ruggero; Cheng, Xiaolin
2017-01-01
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order of 1k B T. Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.
Quantum entanglement and quantum information in biological systems (DNA)
Hubač, Ivan; Švec, Miloslav; Wilson, Stephen
2017-12-01
Recent studies of DNA show that the hydrogen bonds between given base pairs can be treated as diabatic systems with spin-orbit coupling. For solid state systems strong diabaticity and spin-orbit coupling the possibility of forming Majorana fermions has been discussed. We analyze the hydrogen bonds in the base pairs in DNA from this perspective. Our analysis is based on a quasiparticle supersymmetric transformation which couples electronic and vibrational motion and includes normal coordinates and the corresponding momenta. We define qubits formed by Majorana fermions in the hydrogen bonds and also discuss the entangled states in base pairs. Quantum information and quantum entropy are introduced. In addition to the well-known classical information connected with the DNA base pairs, we also consider quantum information and show that the classical and quantum information are closely connected.
International Nuclear Information System (INIS)
Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B
2007-01-01
This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection
Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase
International Nuclear Information System (INIS)
Heller, E.P.; Goldthwait, D.A.
1983-01-01
Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair
Ten helical twist angles of B-DNA
Energy Technology Data Exchange (ETDEWEB)
Kabsch, W; Sander, C; Trifonov, E N
1982-01-01
On the assumption that the twist angles between adjacent base-pairs in the DNA molecule are additive a linear system of 40 equations was derived from experimental measurements of the total twist angles for different pieces of DNA of known sequences. This system of equations is found to be statistically consistent providing a solution for all ten possible twist angles of B-DNA by a least squares fitting procedure. Four of the calculated twist angles were not known before. The other six twist angles calculated are very close to the experimentally measured ones. The data used were obtained by the electrophoretic band-shift method, crystallography and nuclease digestion of DNA adsorbed to mica or Ca-phosphate surface. The validity of the principle of additivity of the twist angles implies that the angle between any particular two base-pairs is a function of only these base-pairs, independent of nearest neighbors.
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.
Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui
2014-10-15
An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
A dynamic bead-based microarray for parallel DNA detection
International Nuclear Information System (INIS)
Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P
2011-01-01
A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening
Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo
2013-02-12
We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.
One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.
Ensslen, Philipp; Wagenknecht, Hans-Achim
2015-10-20
modifications in a row. A logical alternative approach is to leave out the phosphodiester bridges between the chromophores and let chromophore-nucleoside conjugates self-assemble specifically along single stranded DNA as template. The self-organization of chromophores along the DNA template based on canonical base pairing would be advantageous because sequence selective base pairing could provide a structural basis for programmed complexity within the chromophore assembly. The self-assembly is governed by two interactions. The chromophore-nucleoside conjugates as guest molecules are recognized via hydrogen bonds to the corresponding counter bases in the single stranded DNA template. Moreover, the π-π interactions between the stacked chromophores stabilize these self-assembled constructs with increasing length. Longer DNA templates are more attractive for self-assembled antenna. The helicity in the stack of porphyrins as guest molecules assembled on the DNA template can be switched by environmental changes, such as pH variations. DNA-templated stacks of ethynyl pyrene and nile red exhibit left-handed chirality, which stands in contrast to similar covalent multichromophore-DNA conjugates with enforced right-handed helicity. With ethynyl nile red, it is possible to occupy every available binding site on the templates. Mixed assemblies of ethynyl pyrene and nile red show energy transfer and thereby provide a proof-of-principle that simple light-harvesting antennae can be obtained in a noncovalent and self-assembled fashion. With respect to the next important step, chemical storage of the absorbed light energy, future research has to focus on the coupling of sophisticated DNA-based light-harvesting antenna to reaction centers.
Solution-based targeted genomic enrichment for precious DNA samples
Directory of Open Access Journals (Sweden)
Shearer Aiden
2012-05-01
Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.
Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan
2016-03-15
In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.
Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
Theoretical analysis of noncanonical base pairing interactions in ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.
Energy Technology Data Exchange (ETDEWEB)
Romac, S; Leong, P; Sockett, H; Hutchinson, F [Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry
1989-09-20
The DNA base sequence changes induced by mutagenesis with ultraviolet light have been determined in a gene on a chromosome of cultured Chinese hamster ovary (CHO) cells. The gene was the Excherichia coli gpt gene, of which a single copy was stably incorporated and expressed in the CHO cell genome. The cells were irradiated with ultraviolet light and gpt{sup -} colonies were selected by resistance to 6-thioguanine. The gpt gene was amplified from chromosomal DNA by use of the polymerase chain reaction (PCR) and the amplified DNA sequenced directly by the dideoxy method. Of the 58 sequenced mutants of independent origin 53 were base change mutations. Forty-one base substitutions were single base changes, ten had two adjacent (or tandem) base changes, and one had two base changes separated by a single base-pair. Only one mutant had a multiple base change mutation with two or more well separated base changes. In contrast much higher levels of such mutations were reported in ultraviolet mutagenesis of genes on a shuttle vector in primate cells. Two deletions of a single base-pair were observed and three deletions ranging from 6 to 37 base-pairs. The mutation spectrum in the gpt gene had similarities to the ultraviolet mutation spectra for several genes in prokaryotes, which suggests similarities in mutational mechanisms in prokaryotes and eukaryotes. (author).
Structure of a stacked anthraquinone–DNA complex
De Luchi, Daniela; Usón, Isabel; Wright, Glenford; Gouyette, Catherine; Subirana, Juan A.
2010-01-01
The crystal structure of the telomeric sequence d(UBrAGG) interacting with an anthraquinone derivative has been solved by MAD. In all previously studied complexes of intercalating drugs, the drug is usually sandwiched between two DNA base pairs. Instead, the present structure looks like a crystal of stacked anthraquinone molecules in which isolated base pairs are intercalated. Unusual base pairs are present in the structure, such as G·G and A·UBr reverse Watson–Crick base pairs. PMID:20823516
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
Directory of Open Access Journals (Sweden)
Marx Kenneth A
2006-03-01
Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also
Changes in DNA base sequence induced by gamma-ray mutagenesis of lambda phage and prophage
Energy Technology Data Exchange (ETDEWEB)
Tindall, K.R.; Stein, J.; Hutchinson, F.
1988-04-01
Mutations in the cI (repressor) gene were induced by gamma-ray irradiation of lambda phage and of prophage, and 121 mutations were sequenced. Two-thirds of the mutations in irradiated phage assayed in recA host cells (no induction of the SOS response) were G:C to A:T transitions; it is hypothesized that these may arise during DNA replication from adenine mispairing with a cytosine product deaminated by irradiation. For irradiated phage assayed in host cells in which the SOS response had been induced, 85% of the mutations were base substitutions, and in 40 of the 41 base changes, a preexisting base pair had been replaced by an A:T pair; these might come from damaged bases acting as AP (apurinic or apyrimidinic) sites. The remaining mutations were 1 and 2 base deletions. In irradiated prophage, base change mutations involved the substitution of both A:T and of G:C pairs for the preexisting pairs; the substitution of G:C pairs shows that some base substitution mechanism acts on the cell genome but not on the phage. In the irradiated prophage, frameshifts and a significant number of gross rearrangements were also found.
Noll, W W; Collins, M
1987-01-01
Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...
Crystallographic study of one turn of G/C-rich B-DNA.
Heinemann, U; Alings, C
1989-11-20
The DNA decamer d(CCAGGCCTGG) has been studied by X-ray crystallography. At a nominal resolution of 1.6 A, the structure was refined to R = 16.9% using stereochemical restraints. The oligodeoxyribonucleotide forms a straight B-DNA double helix with crystallographic dyad symmetry and ten base-pairs per turn. In the crystal lattice, DNA fragments stack end-to-end along the c-axis to form continuous double helices. The overall helical structure and, notably, the groove dimensions of the decamer are more similar to standard, fiber diffraction-determined B-DNA than A-tract DNA. A unique stacking geometry is observed at the CA/TG base-pair step, where an increased rotation about the helix axis and a sliding motion of the base-pairs along their long axes leads to a superposition of the base rings with neighboring carbonyl and amino functions. Three-center (bifurcated) hydrogen bonds are possible at the CC/GG base-pair steps of the decamer. In their common sequence elements, d(CCAGGCCTGG) and the related G.A mismatch decamer d(CCAAGATTGG) show very similar three-dimensional structures, except that d(CCAGGCCTGG) appears to have a less regularly hydrated minor groove. The paucity of minor groove hydration in the center of the decamer may be a general feature of G/C-rich DNA and explain its relative instability in the B-form of DNA.
International Nuclear Information System (INIS)
Noll, W.W.; Collins, M.
1987-01-01
Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases
Pairing of heterochromatin in response to cellular stress
International Nuclear Information System (INIS)
Abdel-Halim, H.I.; Mullenders, L.H.F.; Boei, J.J.W.A.
2006-01-01
We previously reported that exposure of human cells to DNA-damaging agents (X-rays and mitomycin C (MMC)) induces pairing of the homologous paracentromeric heterochromatin of chromosome 9 (9q12-13). Here, we show that UV irradiation and also heat shock treatment of human cells lead to similar effects. Since the various agents induce very different types and frequencies of damage to cellular constituents, the data suggest a general stress response as the underlying mechanism. Moreover, local UV irradiation experiments revealed that pairing of heterochromatin is an event that can be triggered without induction of DNA damage in the heterochromatic sequences. The repair deficient xeroderma pigmentosum cells (group F) previously shown to fail pairing after MMC displayed elevated pairing after heat shock treatment but not after UV exposure. Taken together, the present results indicate that pairing of heterochromatin following exposure to DNA-damaging agents is initiated by a general stress response and that the sensing of stress or the maintenance of the paired status of the heterochromatin might be dependent on DNA repair
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
International Nuclear Information System (INIS)
Santosh, Mogurampelly; Maiti, Prabal K
2009-01-01
When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to this highly overstretched form of DNA is very cooperative. Applying a force perpendicular to the DNA axis (unzipping), double-strand DNA can also be separated into two single-stranded DNA, this being a fundamental process in DNA replication. We study the DNA overstretching and unzipping transition using fully atomistic molecular dynamics (MD) simulations and argue that the conformational changes of double-strand DNA associated with either of the above mentioned processes can be viewed as force induced DNA melting. As the force at one end of the DNA is increased the DNA starts melting abruptly/smoothly above a critical force depending on the pulling direction. The critical force f m , at which DNA melts completely decreases as the temperature of the system is increased. The melting force in the case of unzipping is smaller compared to the melting force when the DNA is pulled along the helical axis. In the case of melting through unzipping, the double-strand separation has jumps which correspond to the different energy minima arising due to sequence of different base pairs. The fraction of Watson-Crick base pair hydrogen bond breaking as a function of force does not show smooth and continuous behavior and consists of plateaus followed by sharp jumps.
Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.
Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J
2015-05-26
DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin
2015-01-01
Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes. © 2014 Wiley Periodicals, Inc.
Czech Academy of Sciences Publication Activity Database
Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír
2016-01-01
Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016
Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.
2014-01-01
Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596
Simulation of 125I-induced DNA strand breaks in a CAP-DNA complex
International Nuclear Information System (INIS)
Li, W.; Friedland, W.; Jacob, P.
2000-01-01
DNA strand breakage induced by decay of 125 I incorporated into the pyrimidine of a small piece of DNA with a specific base pair sequence has been investigated theoretically and experimentally (Lobachevsky and Martin 2000a, 2000b; Nikjoo et al., 1996; Pomplun and Terrissol, 1994; Charlton and Humm, 1988). Recently an attempt was made to analyse the DNA kinks in a CAP-DNA complex with 125 I induced DNA strand breakage (Karamychev et al., 1999). This method could be used as a so called radioprobing for such DNa distortions like other chemical and biological assays, provided that it has been tested and confirmed in a corresponding theoretical simulation. In the measurement, the distribution of the first breaks on the DNA strands starting from their labeled end can be determined. Based on such first breakage distributions, the simulation calculation could then be used to derive information on the structure of a given DNA-protein complex. The biophysical model PARTRAC has been applied successfully in simulating DNA damage induced by irradiation (Friedland et al., 1998; 1999). In the present study PARTRAC is adapted to a DNA-protein complex in which a specific sequence of 30 base pairs of DNA is connected with the catabolite gene activator protein (CAP). This report presents the first step of the analysis in which the CAP-DNA model used in NIH is overlaid with electron track structures in liquid water and the strand breaks due to direct ionization and due to radical attack are simulated. The second step will be to take into account the neutralization of the heavily charged tellurium and the protective effect of the CAP protein against radical attack. (orig.)
Jun, S; Wallen, R V; Goriely, A; Kalionis, B; Desplan, C
1998-11-10
Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix-turn-helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes.
NMR studies of DNA oligomers and their interactions with minor groove binding ligands
Energy Technology Data Exchange (ETDEWEB)
Fagan, Patricia A. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry
1996-05-01
The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1 ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.
Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.
Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard
2018-02-28
Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.
Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms
2009-05-01
base pair) Watson ‐ Crick strand pairs that bind perfectly within pairs, but poorly across pairs. A variety of DNA strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE
Structure of DNA damaged by UV and psoralen
International Nuclear Information System (INIS)
Sung-hou Kim; Tomic, M.T.; Wemmer, D.E.; Pearlman, D.; Holbrook, S.
1988-01-01
The authors have used NMR methods to determine a three-dimensional model of an 8 base-pair DNA fragment cross-linked with psoralen. The duplex form of the self-complementary deoxyribonucleotide d-GGGTACCC, contains a psoralen cross-linkable site at the center of the duplex. The cross-link was formed by UV irradiation of a mixture of the purified DNA octamer and 4'-(aminomethyl)-4,5',8-trimethylpsoralen (AMT). Structural information was obtained using one and two-dimensional NMR techniques. Two-dimensional NOE experiments were used to assign the spectrum and estimate distances for many pairs of protons in the cross-linked DNA. Structural parameters obtained are qualitatively consistent with a previously proposed model for kinked and unwound cross-linked B-form DNA derived from crystallography and molecular modeling. The NMR derived model has a 53 degree bend into the major groove occuring primarily at the site of drug addition, and a 56 degree unwinding spanning the 8 base pair duplex. (author)
DNA Nanotechnology for Cancer Therapy
Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio
2016-01-01
DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418
DNA-based watermarks using the DNA-Crypt algorithm
Directory of Open Access Journals (Sweden)
Barnekow Angelika
2007-05-01
Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.
DNA-based watermarks using the DNA-Crypt algorithm.
Heider, Dominik; Barnekow, Angelika
2007-05-29
The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.
DNA-based watermarks using the DNA-Crypt algorithm
Heider, Dominik; Barnekow, Angelika
2007-01-01
Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434
Sequence analysis of Leukemia DNA
Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa
2018-03-01
Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.
High performance of a new PCR-based urine assay for HPV-DNA detection and genotyping.
Tanzi, Elisabetta; Bianchi, Silvia; Fasolo, Maria Michela; Frati, Elena R; Mazza, Francesca; Martinelli, Marianna; Colzani, Daniela; Beretta, Rosangela; Zappa, Alessandra; Orlando, Giovanna
2013-01-01
Human papillomavirus (HPV) testing has been proposed as a means of replacing or supporting conventional cervical screening (Pap test). However, both methods require the collection of cervical samples. Urine sample is easier and more acceptable to collect and could be helpful in facilitating cervical cancer screening. The aim of this study was to evaluate the sensitivity and specificity of urine testing compared to conventional cervical smear testing using a PCR-based method with a new, designed specifically primer set. Paired cervical and first voided urine samples collected from 107 women infected with HIV were subjected to HPV-DNA detection and genotyping using a PCR-based assay and a restriction fragment length polymorphism method. Sensitivity, specificity, Positive Predictive Value (PPV), and Negative Predictive Value (NPV) were calculated using the McNemar's test for differences. Concordance between tests was assessed using the Cohen's unweighted Kappa (k). HPV DNA was detected in 64.5% (95% CI: 55.1-73.1%) of both cytobrush and urine samples. High concordance rates of HPV-DNA detection (k = 0.96; 95% CI: 0.90-1.0) and of high risk-clade and low-risk genotyping in paired samples (k = 0.80; 95% CI: 0.67-0.92 and k = 0.74; 95% CI: 0.60-0.88, respectively) were observed. HPV-DNA detection in urine versus cervix testing revealed a sensitivity of 98.6% (95% CI: 93.1-99.9%) and a specificity of 97.4% (95% CI: 87.7-99.9%), with a very high NPV (97.4%; 95% CI: 87.7-99.9%). The PCR-based assay utilized in this study proved highly sensitive and specific for HPV-DNA detection and genotyping in urine samples. These data suggest that a urine-based assay would be a suitable and effective tool for epidemiological surveillance and, most of all, screening programs. Copyright © 2012 Wiley Periodicals, Inc.
Learning preferences from paired opposite-based semantics
DEFF Research Database (Denmark)
Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier
2017-01-01
Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...
Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick
2017-01-01
Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
Dynamic investigation of DNA bending and wrapping by type II topoisomerases
Shao, Qing; Finzi, Laura; Dunlap, David
2009-11-01
Type II topoisomerases catalyze DNA decatenation and unwinding which is crucial for cell division, and therefore type II topoisomerases are some of the main targets of anti-cancer drugs. A recent crystal structure shows that, during the catalytic cycle, a yeast type II topoimerase can bend a 10 base pair DNA segment by up to 150 degrees. Bacterial gyrase, another type II topoisomerase, can wrap DNA into a tight 180 degree turn. Bending a stiff polymer like DNA requires considerable energy and could represent the rate limiting step in the catalytic (topological) cycle. Using modified deoxyribonucleotides in PCR reactions, stiffer DNA fragments have been produced and used as substrates for topoisomerase II-mediated relaxation of plectonemes introduced in single molecules using magnetic tweezers. The wrapping ability of gyrase decreases for diamino-purine-substituted DNA in which every base pair has three hydrogen-bonds. The overall rate of relaxation of plectonemes by recombinant human topoisomerase II alpha also decreases. These results reveal the dynamic properties of DNA bending and wrapping by type II topisomerases and suggest that A:T base pair melting is a rate determining step for bending and wrapping.
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (SSRs; for example, microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains three analysis modules along with a fourth control module that can be used to automate analyses of large volumes of data. The modules are used to (1) identify the subset of paired-end sequences that pass quality standards, (2) align paired-end reads into a single composite DNA sequence, and (3) identify sequences that possess microsatellites conforming to user specified parameters. Each of the three separate analysis modules also can be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc). All modules are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, Windows). The program suite relies on a compiled Python extension module to perform paired-end alignments. Instructions for compiling the extension from source code are provided in the documentation. Users who do not have Python installed on their computers or who do not have the ability to compile software also may choose to download packaged executable files. These files include all Python scripts, a copy of the compiled extension module, and a minimal installation of Python in a single binary executable. See program documentation for more information.
Twist-stretch profiles of DNA chains
Zoli, Marco
2017-06-01
Helical molecules change their twist number under the effect of a mechanical load. We study the twist-stretch relation for a set of short DNA molecules modeled by a mesoscopic Hamiltonian. Finite temperature path integral techniques are applied to generate a large ensemble of possible configurations for the base pairs of the sequence. The model also accounts for the bending and twisting fluctuations between adjacent base pairs along the molecules stack. Simulating a broad range of twisting conformation, we compute the helix structural parameters by averaging over the ensemble of base pairs configurations. The method selects, for any applied force, the average twist angle which minimizes the molecule’s free energy. It is found that the chains generally over-twist under an applied stretching and the over-twisting is physically associated to the contraction of the average helix diameter, i.e. to the damping of the base pair fluctuations. Instead, assuming that the maximum amplitude of the bending fluctuations may decrease against the external load, the DNA molecule first over-twists for weak applied forces and then untwists above a characteristic force value. Our results are discussed in relation to available experimental information albeit for kilo-base long molecules.
Wang, Fuan; Willner, Bilha; Willner, Itamar
2014-01-01
The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.
cGAS senses long and HMGB/TFAM-bound U-turn DNA by forming protein-DNA ladders.
Andreeva, Liudmila; Hiller, Björn; Kostrewa, Dirk; Lässig, Charlotte; de Oliveira Mann, Carina C; Jan Drexler, David; Maiser, Andreas; Gaidt, Moritz; Leonhardt, Heinrich; Hornung, Veit; Hopfner, Karl-Peter
2017-09-21
Cytosolic DNA arising from intracellular pathogens triggers a powerful innate immune response. It is sensed by cyclic GMP-AMP synthase (cGAS), which elicits the production of type I interferons by generating the second messenger 2'3'-cyclic-GMP-AMP (cGAMP). Endogenous nuclear or mitochondrial DNA can also be sensed by cGAS under certain conditions, resulting in sterile inflammation. The cGAS dimer binds two DNA ligands shorter than 20 base pairs side-by-side, but 20-base-pair DNA fails to activate cGAS in vivo and is a poor activator in vitro. Here we show that cGAS is activated in a strongly DNA length-dependent manner both in vitro and in human cells. We also show that cGAS dimers form ladder-like networks with DNA, leading to cooperative sensing of DNA length: assembly of the pioneering cGAS dimer between two DNA molecules is ineffective; but, once formed, it prearranges the flanking DNA to promote binding of subsequent cGAS dimers. Remarkably, bacterial and mitochondrial nucleoid proteins HU and mitochondrial transcription factor A (TFAM), as well as high-mobility group box 1 protein (HMGB1), can strongly stimulate long DNA sensing by cGAS. U-turns and bends in DNA induced by these proteins pre-structure DNA to nucleate cGAS dimers. Our results suggest a nucleation-cooperativity-based mechanism for sensitive detection of mitochondrial DNA and pathogen genomes, and identify HMGB/TFAM proteins as DNA-structuring host factors. They provide an explanation for the peculiar cGAS dimer structure and suggest that cGAS preferentially binds incomplete nucleoid-like structures or bent DNA.
Master equation approach to DNA breathing in heteropolymer DNA
DEFF Research Database (Denmark)
Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A
2007-01-01
After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...
International Nuclear Information System (INIS)
Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz
2007-01-01
The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc
2017-03-17
Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Integrating DNA strand-displacement circuitry with DNA tile self-assembly
Zhang, David Yu; Hariadi, Rizal F.; Choi, Harry M.T.; Winfree, Erik
2013-01-01
DNA nanotechnology has emerged as a reliable and programmable way of controlling matter at the nanoscale through the specificity of Watson–Crick base pairing, allowing both complex self-assembled structures with nanometer precision and complex reaction networks implementing digital and analog behaviors. Here we show how two well-developed frameworks, DNA tile self-assembly and DNA strand-displacement circuits, can be systematically integrated to provide programmable kinetic control of self-assembly. We demonstrate the triggered and catalytic isothermal self-assembly of DNA nanotubes over 10 μm long from precursor DNA double-crossover tiles activated by an upstream DNA catalyst network. Integrating more sophisticated control circuits and tile systems could enable precise spatial and temporal organization of dynamic molecular structures. PMID:23756381
NMR studies on the structure and dynamics of lac operator DNA
International Nuclear Information System (INIS)
Lee, S.C.
1985-01-01
Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with a maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43% in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97 and lower for avian species (0.70. PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)
2017-03-08
DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.
Directory of Open Access Journals (Sweden)
Mansour Aliabadian
Full Text Available DNA barcoding based on the mitochondrial cytochrome oxidase subunit I gene (cox1 or COI has been successful in species identification across a wide array of taxa but in some cases failed to delimit the species boundaries of closely allied allopatric species or of hybridising sister species.In this study we extend the sample size of prior studies in birds for cox1 (2776 sequences, 756 species and target especially species that are known to occur parapatrically, and/or are known to hybridise, on a Holarctic scale. In order to obtain a larger set of taxa (altogether 2719 species, we include also DNA sequences of two other mitochondrial genes: cytochrome b (cob (4614 sequences, 2087 species and 16S (708 sequences, 498 species. Our results confirm the existence of a wide gap between intra- and interspecies divergences for both cox1 and cob, and indicate that distance-based DNA barcoding provides sufficient information to identify and delineate bird species in 98% of all possible pairwise comparisons. This DNA barcoding gap was not statistically influenced by the number of individuals sequenced per species. However, most of the hybridising parapatric species pairs have average divergences intermediate between intraspecific and interspecific distances for both cox1 and cob.DNA barcoding, if used as a tool for species discovery, would thus fail to identify hybridising parapatric species pairs. However, most of them can probably still assigned to known species by character-based approaches, although development of complementary nuclear markers will be necessary to account for mitochondrial introgression in hybridising species.
Charge transport in DNA oligonucleotides with various base-pairing patterns
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan
2010-01-01
Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010
Strobel, Sebastian; Sperling, Ralph A; Fenk, Bernhard; Parak, Wolfgang J; Tornow, Marc
2011-06-07
We report on the successful dielectrophoretic trapping and electrical characterization of DNA-coated gold nanoparticles on vertical nanogap devices (VNDs). The nanogap devices with an electrode distance of 13 nm were fabricated from Silicon-on-Insulator (SOI) material using a combination of anisotropic reactive ion etching (RIE), selective wet chemical etching and metal thin-film deposition. Au nanoparticles (diameter 40 nm) coated with a monolayer of dithiolated 8 base pairs double stranded DNA were dielectrophoretically trapped into the nanogap from electrolyte buffer solution at MHz frequencies as verified by scanning and transmission electron microscopy (SEM/TEM) analysis. First electrical transport measurements through the formed DNA-Au-DNA junctions partially revealed an approximately linear current-voltage characteristic with resistance in the range of 2-4 GΩ when measured in solution. Our findings point to the importance of strong covalent bonding to the electrodes in order to observe DNA conductance, both in solution and in the dry state. We propose our setup for novel applications in biosensing, addressing the direct interaction of biomolecular species with DNA in aqueous electrolyte media.
Principles of DNA architectonics: design of DNA-based nanoobjects
International Nuclear Information System (INIS)
Vinogradova, O A; Pyshnyi, D V
2012-01-01
The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.
Breather trapping and breather transmission in a DNA model with an interface
DEFF Research Database (Denmark)
Alvarez, A.; Romero, F.R.; Archilla, J.F.R.
2006-01-01
We study the dynamics of moving discrete breathers in an interfaced piecewise DNA molecule. This is a DNA chain in which all the base pairs are identical and there exists an interface such that the base pairs dipole moments at each side are oriented in opposite directions. The Hamiltonian...... of the Peyrard-Bishop model is augmented with a term that includes the dipole-dipole coupling between base pairs. Numerical simulations show the existence of two dynamical regimes. If the translational kinetic energy of a moving breather launched towards the interface is below a critical value, it is trapped...
Mechanisms for radiation damadge in DNA
International Nuclear Information System (INIS)
Sevilla, M.D.
1994-11-01
A comprehensive report is provided of the author's research since 1986 on radiolysis of DNA as well as current state of knowledge in this area. In particular study areas such as the influence of hydration on the absolute yield of primary ionic free radicals in irradiated DNA at 77K, Ab Initio molecular orbital calculations of DNA base pairs and their radical ions, and radiation-induced DNA damage as a function of hydration are discussed
HLA class I sequence-based typing using DNA recovered from frozen plasma.
Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L
2012-08-31
We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.
Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso
2015-07-01
In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.
The Effect of Basepair Mismatch on DNA Strand Displacement
Broadwater, D.?W.?Bo; Kim, Harold?D.
2016-01-01
DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied si...
The mechanism of the emergence of distinct overstretched DNA states
Energy Technology Data Exchange (ETDEWEB)
Zhu, You-Liang; Sun, Zhao-Yan, E-mail: zysun@ciac.ac.cn [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Lu, Zhong-Yuan [State Key Laboratory of Supramolecular Structure and Materials, Institute of Theoretical Chemistry, Jilin University, Changchun 130023 (China)
2016-01-14
Although multiple overstretched DNA states were identified in experiments, the mechanism of the emergence of distinct states is still unclear. Molecular dynamics simulation is an ideal tool to clarify the mechanism, but the force loading rates in stretching achieved by conventional all-atom DNA models are much faster, which essentially affect overstretching states. We employed a modified coarse-grained DNA model with an unprecedented low loading rate in simulations to study the overstretching transitions of end-opened double-stranded DNA. We observed two-strand peeling off for DNA with low stability and the S-DNA with high stability under tension. By introducing a melting-forbidden model which prevents base-pair breaking, we still observed the overstretching transition induced by the formation of S-DNA due to the change of dihedral angle. Hence, we confirmed that the competition between the two strain-softening manners, i.e., base-pair breaking and dihedral angle variation, results in the emergence of distinct overstretched DNA states.
Czech Academy of Sciences Publication Activity Database
Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.
2014-01-01
Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Intrinsic flexibility of B-DNA: the experimental TRX scale.
Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2010-01-01
B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.
Directory of Open Access Journals (Sweden)
Geoffrey R Bennett
Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.
Directory of Open Access Journals (Sweden)
Pornchai Rojsitthisak
Full Text Available Mechlorethamine [ClCH(2CH(2N(CH(3CH(2CH(2Cl], a nitrogen mustard alkylating agent, has been proven to form a DNA interstrand crosslink at a cytosine-cytosine (C-C mismatch pair using gel electrophoresis. However, the atomic connectivity of this unusual crosslink is unknown.HPLC-UV, MALDI-TOF-MS, and ESI-MS/MS were used to determine the atomic connectivity of the DNA C-C crosslink formed by mechlorethamine, MALDI-TOF-MS of the HPLC-purified reaction product of mechlorethamine with the DNA duplex d[CTCACACCGTGGTTC]•d[GAACCACCGTGTGAG] (underlined bases are a C-C mismatch pair indicated formation of an interstrand crosslink at m/z 9222.088 [M-2H+Na](+. Following enzymatic digestion of the crosslinked duplex by snake venom phosphodiesterase and calf intestinal phosphatase, ESI-MS/MS indicated the presence of dC-mech-dC [mech = CH(2CH(2N(CH(3CH(2CH(2] at m/z 269.2 [M](2+ (expected m/z 269.6, exact mass 539.27 and its hydrolytic product dC-mech-OH at m/z 329.6 [M](+ (expected m/z 329.2. Fragmentation of dC-mech-dC gave product ions at m/z 294.3 and 236.9 [M](+, which are both due to loss of the 4-amino group of cytosine (as ammonia, in addition to dC and dC+HN(CH(3CH = CH(2, respectively. The presence of m/z 269.2 [M](2+ and loss of ammonia exclude crosslink formation at cytosine N(4 or O(2 and indicate crosslinking through cytosine N(3 with formation of two quaternary ammonium ions.Our results provide an important addition to the literature, as the first example of the use of HPLC and MS for analysis of a DNA adduct at the N(3 position of cytosine.
DNA nanotechnology: a future perspective
2013-01-01
In addition to its genetic function, DNA is one of the most distinct and smart self-assembling nanomaterials. DNA nanotechnology exploits the predictable self-assembly of DNA oligonucleotides to design and assemble innovative and highly discrete nanostructures. Highly ordered DNA motifs are capable of providing an ultra-fine framework for the next generation of nanofabrications. The majority of these applications are based upon the complementarity of DNA base pairing: adenine with thymine, and guanine with cytosine. DNA provides an intelligent route for the creation of nanoarchitectures with programmable and predictable patterns. DNA strands twist along one helix for a number of bases before switching to the other helix by passing through a crossover junction. The association of two crossovers keeps the helices parallel and holds them tightly together, allowing the assembly of bigger structures. Because of the DNA molecule's unique and novel characteristics, it can easily be applied in a vast variety of multidisciplinary research areas like biomedicine, computer science, nano/optoelectronics, and bionanotechnology. PMID:23497147
Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase
Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2015-01-01
1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169
Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage
Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.
1999-01-01
DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315
Modeling the mechanical properties of DNA nanostructures.
Arbona, Jean Michel; Aimé, Jean-Pierre; Elezgaray, Juan
2012-11-01
We discuss generalizations of a previously published coarse-grained description [Mergell et al., Phys. Rev. E 68, 021911 (2003)] of double stranded DNA (dsDNA). The model is defined at the base-pair level and includes the electrostatic repulsion between neighbor helices. We show that the model reproduces mechanical and elastic properties of several DNA nanostructures (DNA origamis). We also show that electrostatic interactions are necessary to reproduce atomic force microscopy measurements on planar DNA origamis.
International Nuclear Information System (INIS)
Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.
1988-01-01
Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease
Energy Technology Data Exchange (ETDEWEB)
X Qiu; D Rau; V Parsegian; L Fang; C Knobler; W Gelbart
2011-12-31
Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In the commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.
Heegaard, Erik D; Petersen, Bodil Laub; Heilmann, Carsten J; Hornsleth, Allan
2002-03-01
Parvovirus B19 (hereafter referred to as B19) exhibits a marked tropism to human bone marrow (BM), and infection may lead to erythema infectiosum, arthropathy, hydrops fetalis, and various hematologic disorders. Recently, a distinct parvovirus isolate termed V9 with an unknown clinical spectrum was discovered. In contrast to the many studies of B19 serology and viremia, valid information on the frequency of B19 or V9 DNA in the BM of healthy individuals is limited. To develop a reference value, paired BM and serum samples from healthy subjects were tested for the presence of B19 and V9 DNA and specific antibodies. Immunoglobulin M (IgM) was not found in any of the serum samples. The prevalence of IgG showed a gradual and steady increase from 37% in children aged 1 to 5 years to 87% in people aged >50 years. When 190 well-characterized subjects were examined, B19 DNA was detected in the BM of 4 individuals (2.1%; 95% confidence interval, 0.58 to 5.3%) while none of the paired serum samples showed evidence of circulating viral DNA. V9 DNA was not found in any of the BM or serum samples. The finding of B19 DNA probably indicated a primary infection in one 7-year-old individual and reinfection or reactivation of persistent infection in the remaining three persons, aged 47 to 58 years. Serving as a benchmark for future studies, these findings are useful when interpreting epidemiologic data, performing BM transplantation, or considering clinical implications of parvovirus infection.
Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study
Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad
2018-06-01
Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.
Energy Technology Data Exchange (ETDEWEB)
Lu, Liping, E-mail: lipinglu@bjut.edu.cn; Xu, Laihui; Kang, Tianfang; Cheng, Shuiyuan
2013-11-01
DNA damage induced from perfluorooctane sulfonate (PFOS) was further developed on a nano-porous bionic interface. The interface was formed by assembling DNA on nano-gold particles which were embedded in a nano-porous overoxidized polypyrrole film (OPPy). Atomic force microscopy, scanning electron microscope and electrochemical investigations indicate that OPPy can be treated to form nano-pore structures. DNA damage due to PFOS was proved using electrochemistry and X-ray photoelectron spectroscopy (XPS) and was investigated by detecting differential pulse voltammetry (DPV) response of methylene blue (MB) which was used as electro-active indicator in the system. The current of MB attenuates obviously after incubation of DNA in PFOS. Moreover, electrochemical impedance spectroscopy (EIS) demonstrates that PFOS weakens DNA charge transport. The tentative binding ratio of PFOS: DNA base pair was obtained by analyzing XPS data of this system.
Whole genome DNA methylation: beyond genes silencing
Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati
2016-01-01
The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...
International Nuclear Information System (INIS)
Waye, J.S.; Willard, H.F.
1989-01-01
The authors describe a class of human repetitive DNA, called β satellite, that, at a most fundamental level, exists as tandem arrays of diverged ∼68-base-pair monomer repeat units. The monomer units are organized as distinct subsets, each characterized by a multimeric higher-order repeat unit that is tandemly reiterated and represents a recent unit of amplification. They have cloned, characterized, and determined the sequence of two β satellite higher-order repeat units: one located on chromosome 9, the other on the acrocentric chromosomes (13, 14, 15, 21, and 22) and perhaps other sites in the genome. Analysis by pulsed-field gel electrophoresis reveals that these tandem arrays are localized in large domains that are marked by restriction fragment length polymorphisms. In total, β-satellite sequences comprise several million base pairs of DNA in the human genome. Analysis of this DNA family should permit insights into the nature of chromosome-specific and nonspecific modes of satellite DNA evolution and provide useful tools for probing the molecular organization and concerted evolution of the acrocentric chromosomes
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
Structure of human DNA polymerase iota and the mechanism of DNA synthesis.
Makarova, A V; Kulbachinskiy, A V
2012-06-01
Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.
DEFF Research Database (Denmark)
Salvatore, Princia; Nazmutdinov, Renat R.; Ulstrup, Jens
2015-01-01
Among the low-index single-crystal gold surfaces, the Au(110) surface is the most active toward molecular adsorption and the one with fewest electrochemical adsorption data reported. Cyclic voltammetry (CV), electrochemically controlled scanning tunneling microscopy (EC-STM), and density functional......, accompanied by a pair of strong voltammetry peaks in the double-layer region in acid solutions. Adsorption of the DNA bases gives featureless voltammograms with lower double-layer capacitance, suggesting that all the bases are chemisorbed on the Au(110) surface. Further investigation of the surface structures...... of the adlayers of the four DNA bases by EC-STM disclosed lifting of the Au(110) reconstruction, specific molecular packing in dense monolayers, and pH dependence of the A and G adsorption. DFT computations based on a cluster model for the Au(110) surface were performed to investigate the adsorption energy...
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick
2014-02-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition
Czech Academy of Sciences Publication Activity Database
Yamaguchi, H.; Šebera, Jakub; Kondo, J.; Oda, S.; Komuro, T.; Kawamura, T.; Dairaku, T.; Kondo, Y.; Okamoto, I.; Ono, A.; Burda, J. V.; Kojima, C.; Sychrovský, Vladimír; Tanaka, Y.
2014-01-01
Roč. 42, č. 6 (2014), s. 4094-4099 ISSN 0305-1048 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR structures * mercury * metalation * metal- DNA binding * DFT Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/6/4094.full
Twist–radial normal mode analysis in double-stranded DNA chains
International Nuclear Information System (INIS)
Torrellas, Germán; Maciá, Enrique
2012-01-01
We study the normal modes of a duplex DNA chain at low temperatures. We consider the coupling between the hydrogen-bond radial oscillations and the twisting motion of each base pair within the Peyrard–Bishop–Dauxois model. The coupling is mediated by the stacking interaction between adjacent base pairs along the helix. We explicitly consider different mass values for different nucleotides, extending previous works. We disclose several resonance conditions of interest, determined by the fine-tuning of certain model parameters. The role of these dynamical effects on the DNA chain charge transport properties is discussed.
DNA-Based Applications in Nanobiotechnology
Directory of Open Access Journals (Sweden)
Khalid M. Abu-Salah
2010-01-01
Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.
Izsvák, Zsuzsanna; Khare, Dheeraj; Behlke, Joachim; Heinemann, Udo; Plasterk, Ronald H; Ivics, Zoltán
2002-09-13
Sleeping Beauty (SB) is the most active Tc1/mariner-like transposon in vertebrate species. Each of the terminal inverted repeats (IRs) of SB contains two transposase-binding sites (DRs). This feature, termed the IR/DR structure, is conserved in a group of Tc1-like transposons. The DNA-binding region of SB transposase, similar to the paired domain of Pax proteins, consists of two helix-turn-helix subdomains (PAI + RED = PAIRED). The N-terminal PAI subdomain was found to play a dominant role in contacting the DRs. Transposase was able to bind to mutant sites retaining the 3' part of the DRs; thus, primary DNA binding is not sufficient to determine the specificity of the transposition reaction. The PAI subdomain was also found to bind to a transpositional enhancer-like sequence within the left IR of SB, and to mediate protein-protein interactions between transposase subunits. A tetrameric form of the transposase was detected in solution, consistent with an interaction between the IR/DR structure and a transposase tetramer. We propose a model in which the transpositional enhancer and the PAI subdomain stabilize complexes formed by a transposase tetramer bound at the IR/DR. These interactions may result in enhanced stability of synaptic complexes, which might explain the efficient transposition of Sleeping Beauty in vertebrate cells.
DNA Polymerase Fidelity: Beyond Right and Wrong.
Washington, M Todd
2016-11-01
Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Arab, K; Pedersen, Marie; Nair, J
2009-01-01
The impact of DNA damage commonly thought to be involved in chronic degenerative disease causation is particularly detrimental during fetal development. Within a multicenter study, we analyzed 77 white blood cell (WBC) samples from mother-newborn child pairs to see if imprinting of DNA damage...... in mother and newborn shows a similar pattern. Two adducts 1,N(6)-ethenodeoxyadenosine (epsilondA) and 3,N(4)-ethenodeoxycytidine (epsilondC) were measured by our ultrasensitive immunoaffinity (32)P-post-labeling method. These miscoding etheno-DNA adducts are generated by the reaction of lipid peroxidation...... arising from endogenous reactive aldehydes in WBC of both mother and newborn can be reliably assessed by epsilondA and epsilondC as biomarkers. The high correlation of etheno adduct levels in mother and child WBC suggests that a typical signature of DNA damage is induced similarly in fetus and mother...
DNA functionalization by dynamic chemistry
Directory of Open Access Journals (Sweden)
Zeynep Kanlidere
2016-10-01
Full Text Available Dynamic combinatorial chemistry (DCC is an attractive method to efficiently generate libraries of molecules from simpler building blocks by reversible reactions under thermodynamic control. Here we focus on the chemical modification of DNA oligonucleotides with acyclic diol linkers and demonstrate their potential for the deoxyribonucleic acid functionalization and generation of libraries of reversibly interconverting building blocks. The syntheses of phosphoramidite building blocks derived from D-threoninol are presented in two variants with protected amino or thiol groups. The threoninol building blocks were successfully incorporated via automated solid-phase synthesis into 13mer oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was obtained, whereas, the highest selectivity (over 80% was found for the guanine aldehyde templated by the complementary cytosine containing DNA. The elevated occurrence of mismatches can be explained by increased backbone plasticity derived from the linear threoninol building block as a cyclic deoxyribose analogue.
Force fluctuations assist nanopore unzipping of DNA
International Nuclear Information System (INIS)
Viasnoff, V; Chiaruttini, N; Muzard, J; Bockelmann, U
2010-01-01
We experimentally study the statistical distributions and the voltage dependence of the unzipping time of 45 base-pair-long double-stranded DNA through a nanopore. We then propose a quantitative theoretical description considering the nanopore unzipping process as a random walk of the opening fork through the DNA sequence energy landscape biased by a time-fluctuating force. To achieve quantitative agreement fluctuations need to be correlated over the millisecond range and have an amplitude of order k B T/bp. Significantly slower or faster fluctuations are not appropriate, suggesting that the unzipping process is efficiently enhanced by noise in the kHz range. We further show that the unzipping time of short 15 base-pair hairpins does not always increase with the global stability of the double helix and we theoretically study the role of DNA elasticity on the conversion of the electrical bias into a mechanical unzipping force.
Directory of Open Access Journals (Sweden)
Fei Yao
Full Text Available Structural variations (SVs contribute significantly to the variability of the human genome and extensive genomic rearrangements are a hallmark of cancer. While genomic DNA paired-end-tag (DNA-PET sequencing is an attractive approach to identify genomic SVs, the current application of PET sequencing with short insert size DNA can be insufficient for the comprehensive mapping of SVs in low complexity and repeat-rich genomic regions. We employed a recently developed procedure to generate PET sequencing data using large DNA inserts of 10-20 kb and compared their characteristics with short insert (1 kb libraries for their ability to identify SVs. Our results suggest that although short insert libraries bear an advantage in identifying small deletions, they do not provide significantly better breakpoint resolution. In contrast, large inserts are superior to short inserts in providing higher physical genome coverage for the same sequencing cost and achieve greater sensitivity, in practice, for the identification of several classes of SVs, such as copy number neutral and complex events. Furthermore, our results confirm that large insert libraries allow for the identification of SVs within repetitive sequences, which cannot be spanned by short inserts. This provides a key advantage in studying rearrangements in cancer, and we show how it can be used in a fusion-point-guided-concatenation algorithm to study focally amplified regions in cancer.
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
Brain cDNA clone for human cholinesterase
International Nuclear Information System (INIS)
McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.
1987-01-01
A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase
Quasiparticle properties of DNA bases from GW calculations in a Wannier basis
Qian, Xiaofeng; Marzari, Nicola; Umari, Paolo
2009-03-01
The quasiparticle GW-Wannier (GWW) approach [1] has been recently developed to overcome the size limitations of conventional planewave GW calculations. By taking advantage of the localization properties of the maximally-localized Wannier functions and choosing a small set of polarization basis we reduce the number of Bloch wavefunctions products required for the evaluation of dynamical polarizabilities, and in turn greatly reduce memory requirements and computational efficiency. We apply GWW to study quasiparticle properties of different DNA bases and base-pairs, and solvation effects on the energy gap, demonstrating in the process the key advantages of this approach. [1] P. Umari,G. Stenuit, and S. Baroni, cond-mat/0811.1453
Homologous subfamilies of human alphoid repetitive DNA on different nucleolus organizing chromosomes
International Nuclear Information System (INIS)
Joergensen, A.L.; Bostock, C.J.; Bak, A.L.
1987-01-01
The organization of alphoid repeated sequences on human nucleolus-organizing (NOR) chromosomes 13, 21, and 22 has been investigated. Analysis of hybridization of alphoid DNA probes to Southern transfers of restriction enzyme-digested DNA fragments from hybrid cells containing single human chromosomes shows that chromosomes 13 and 21 share one subfamily of alphoid repeats, whereas a different subfamily may be held in common by chromosomes 13 and 22. The sequences of cloned 680-base-pair EcoRI fragments of the alphoid DNA from chromosomes 13 and 21 show that the basic unit of this subfamily is indistinguishable on each chromosome. The sequence of cloned 1020-base-pair Xba I fragments from chromosome 22 is related to, but distinguishable from, that of the 680-base-pair EcoRI alphoid subfamily of chromosomes 13 and 21. These results suggest that, at some point after they originated and were homogenized, different subfamilies of alphoid sequences must have exchanged between chromosomes 13 and 21 and separately between chromosomes 13 and 22
DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects
Energy Technology Data Exchange (ETDEWEB)
Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)
2014-02-01
The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular
Sequence periodicity in nucleosomal DNA and intrinsic curvature.
Nair, T Murlidharan
2010-05-17
Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.
Metallic Nanostructures Based on DNA Nanoshapes
Directory of Open Access Journals (Sweden)
Boxuan Shen
2016-08-01
Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.
Mallajosyula, Sairam S; Pati, Swapan K
2007-10-11
Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.
Lee, Andrea J; Wallace, Susan S
2017-06-01
The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.
[Quality of DNA from archival pathological samples of gallbladder cancer].
Roa, Iván; de Toro, Gonzalo; Sánchez, Tamara; Slater, Jeannie; Ziegler, Anne Marie; Game, Anakaren; Arellano, Leonardo; Schalper, Kurt; de Aretxabala, Xabier
2013-12-01
The quality of the archival samples stored at pathology services could be a limiting factor for molecular biology studies. To determine the quality of DNA extracted from gallbladder cancer samples at different institutions. One hundred ninety four samples coming from five medical centers in Chile, were analyzed. DNA extraction was quantified determining genomic DNA concentration. The integrity of DNA was determined by polymerase chain reaction amplification of different length fragments of a constitutive gene (β-globin products of 110, 268 and 501 base pairs). The mean DNA concentration obtained in 194 gallbladder cancer samples was 48 ± 43.1 ng/µl. In 22% of samples, no amplification was achieved despite obtaining a mean DNA concentration of 58.3 ng/ul. In 81, 67 and 22% of samples, a DNA amplification of at least 110, 268 or 501 base pairs was obtained, respectively. No differences in DNA concentration according to the source of the samples were demonstrated. However, there were marked differences in DNA integrity among participating centers. Samples from public hospitals were of lower quality than those from private clinics. Despite some limitations, in 80% of cases, the integrity of DNA in archival samples from pathology services in our country would allow the use of molecular biology techniques.
Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha
2006-01-01
A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the
Directory of Open Access Journals (Sweden)
Orren David K
2006-01-01
Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These
Schonhoft, Joseph D; Stivers, James T
2013-04-16
Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.
Modes of DNA repair and replication
International Nuclear Information System (INIS)
Hanawalt, P.; Kondo, S.
1979-01-01
Modes of DNA repair and replication require close coordination as well as some overlap of enzyme functions. Some classes of recovery deficient mutants may have defects in replication rather than repair modes. Lesions such as the pyrimidine dimers produced by ultraviolet light irradiation are the blocks to normal DNA replication in vivo and in vitro. The DNA synthesis by the DNA polymerase 1 of E. coli is blocked at one nucleotide away from the dimerized pyrimidines in template strands. Thus, some DNA polymerases seem to be unable to incorporate nucleotides opposite to the non-pairing lesions in template DNA strands. The lesions in template DNA strands may block the sequential addition of nucleotides in the synthesis of daughter strands. Normal replication utilizes a constitutive ''error-free'' mode that copies DNA templates with high fidelity, but which may be totally blocked at a lesion that obscures the appropriate base pairing specificity. It might be expected that modified replication system exhibits generally high error frequency. The error rate of DNA polymerases may be controlled by the degree of phosphorylation of the enzyme. Inducible SOS system is controlled by recA genes that also control the pathways for recombination. It is possible that SOS system involves some process other than the modification of a blocked replication apparatus to permit error-prone transdimer synthesis. (Yamashita, S.)
Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.
2009-01-01
Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246
Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.
Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae
2016-12-01
In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Sergei Kuchin
2011-03-01
Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.
van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D
2015-01-01
The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand brea...
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
DNA rendering of polyhedral meshes at the nanoscale
Benson, Erik; Mohammed, Abdulmelik; Gardell, Johan; Masich, Sergej; Czeizler, Eugen; Orponen, Pekka; Högberg, Björn
2015-07-01
It was suggested more than thirty years ago that Watson-Crick base pairing might be used for the rational design of nanometre-scale structures from nucleic acids. Since then, and especially since the introduction of the origami technique, DNA nanotechnology has enabled increasingly more complex structures. But although general approaches for creating DNA origami polygonal meshes and design software are available, there are still important constraints arising from DNA geometry and sense/antisense pairing, necessitating some manual adjustment during the design process. Here we present a general method of folding arbitrary polygonal digital meshes in DNA that readily produces structures that would be very difficult to realize using previous approaches. The design process is highly automated, using a routeing algorithm based on graph theory and a relaxation simulation that traces scaffold strands through the target structures. Moreover, unlike conventional origami designs built from close-packed helices, our structures have a more open conformation with one helix per edge and are therefore stable under the ionic conditions usually used in biological assays.
Czech Academy of Sciences Publication Activity Database
Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří
Roč. 38, č. 1 ( 2010 ), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010
Effect of proton transfer on the electronic coupling in DNA
International Nuclear Information System (INIS)
Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.
2006-01-01
The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, V da , in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate V da for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the V da matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the V da matrix elements are also analyzed
Tan, L; Wang, H; Li, C; Pan, Y
2014-12-01
Acute exacerbations of chronic obstructive pulmonary disease (AE-COPD) are leading causes of mortality in hospital intensive care units. We sought to determine whether dental plaque biofilms might harbor pathogenic bacteria that can eventually cause lung infections in patients with severe AE-COPD. Paired samples of subgingival plaque biofilm and tracheal aspirate were collected from 53 patients with severe AE-COPD. Total bacterial DNA was extracted from each sample individually for polymerase chain reaction amplification and/or generation of bacterial 16S rDNA sequences and cDNA libraries. We used a metagenomic approach, based on bacterial 16S rDNA sequences, to compare the distribution of species present in dental plaque and lung. Analysis of 1060 sequences (20 clones per patient) revealed a wide range of aerobic, anaerobic, pathogenic, opportunistic, novel and uncultivable bacterial species. Species indistinguishable between the paired subgingival plaque and tracheal aspirate samples (97-100% similarity in 16S rDNA sequence) were dental plaque pathogens (Aggregatibacter actinomycetemcomitans, Capnocytophaga sputigena, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola) and lung pathogens (Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Streptococcus pneumoniae). Real-time polymerase chain reaction of 16S rDNA indicated lower levels of Pseudomonas aeruginosa and Porphyromonas gingivalis colonizing the dental plaques compared with the paired tracheal aspirate samples. These results support the hypothesis that dental bacteria may contribute to the pathology of severe AE-COPD. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Force regulated dynamics of RPA on a DNA fork.
Kemmerich, Felix E; Daldrop, Peter; Pinto, Cosimo; Levikova, Maryna; Cejka, Petr; Seidel, Ralf
2016-07-08
Replication protein A (RPA) is a single-stranded DNA binding protein, involved in most aspects of eukaryotic DNA metabolism. Here, we study the behavior of RPA on a DNA substrate that mimics a replication fork. Using magnetic tweezers we show that both yeast and human RPA can open forked DNA when sufficient external tension is applied. In contrast, at low force, RPA becomes rapidly displaced by the rehybridization of the DNA fork. This process appears to be governed by the binding or the release of an RPA microdomain (toehold) of only few base-pairs length. This gives rise to an extremely rapid exchange dynamics of RPA at the fork. Fork rezipping rates reach up to hundreds of base-pairs per second, being orders of magnitude faster than RPA dissociation from ssDNA alone. Additionally, we show that RPA undergoes diffusive motion on ssDNA, such that it can be pushed over long distances by a rezipping fork. Generally the behavior of both human and yeast RPA homologs is very similar. However, in contrast to yeast RPA, the dissociation of human RPA from ssDNA is greatly reduced at low Mg(2+) concentrations, such that human RPA can melt DNA in absence of force. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DNA fingerprints come to court
International Nuclear Information System (INIS)
Anon.
1988-01-01
DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person
Capturing a DNA duplex under near-physiological conditions
Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.
2010-10-01
We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.
Interaction between the Chlamydia trachomatis histone H1-like protein (Hc1) and DNA
DEFF Research Database (Denmark)
Christiansen, G; Pedersen, Lotte Bang; Koehler, J E
1993-01-01
maintained its DNA-binding capacity and was able at high concentrations to form condensed aggregates with DNA (one molecule of Hc1 per base pair) independently of the form or size of the DNA but with a slight preference for supercoiled DNA. Hc1 alone is thus able to package DNA into condensed spherical...
Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding
2008-07-11
Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick
Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.
Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J
2018-04-06
In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.
Quantifying quality in DNA self-assembly
Wagenbauer, Klaus F.; Wachauf, Christian H.; Dietz, Hendrik
2014-01-01
Molecular self-assembly with DNA is an attractive route for building nanoscale devices. The development of sophisticated and precise objects with this technique requires detailed experimental feedback on the structure and composition of assembled objects. Here we report a sensitive assay for the quality of assembly. The method relies on measuring the content of unpaired DNA bases in self-assembled DNA objects using a fluorescent de-Bruijn probe for three-base ‘codons’, which enables a comparison with the designed content of unpaired DNA. We use the assay to measure the quality of assembly of several multilayer DNA origami objects and illustrate the use of the assay for the rational refinement of assembly protocols. Our data suggests that large and complex objects like multilayer DNA origami can be made with high strand integration quality up to 99%. Beyond DNA nanotechnology, we speculate that the ability to discriminate unpaired from paired nucleic acids in the same macromolecule may also be useful for analysing cellular nucleic acids. PMID:24751596
Synthesis of furan-based DNA binders and their interaction with DNA
International Nuclear Information System (INIS)
Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef
2006-01-01
In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)
Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA
DEFF Research Database (Denmark)
Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.
1976-01-01
Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced...
Prediction of DNA-binding specificity in zinc finger proteins
Indian Academy of Sciences (India)
2012-06-25
Jun 25, 2012 ... Support Vector Machine (SVM) is a state-of-the-art classifica- tion technique. Using canonical binding model, the C2H2 zinc finger protein–DNA interaction interface is modelled by the pairwise amino acid–base interactions. Using a classification framework, known examples of non-binding ZF–DNA pairs.
Romero, Eduardo E; Hernandez, Florencio E
2018-01-03
Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.
International Nuclear Information System (INIS)
Yamamoto, Osamu; Ogawa, Masaaki; Hoshi, Masaharu
1982-01-01
Application of electrophoresis to the analysis of DNA strand breaks was studied comparing with the sedimentation analysis. A BRL gel electrophoresis system (Type V16) was used for this study. Calf thymus DNA (1 mg/ml) irradiated with 60 Co gamma-rays in SSC solution was applied to both the electrophoretic analysis and the sedimentation analysis. Lamda phage DNA and its fragments were employed as the standard size molecules. In a range from 1 k base pairs to 6 k base pairs in length for double stranded DNA or from 2 k bases to 12 k bases for single stranded DNA, the calculated average molecular weight from the electrophoresis coincided with that from the sedimentation. Number of single strand breaks and double strand breaks were 1.34 x 10 11 breaks/mg/rad (G = 0.215) and 0.48 x 10 5 breaks/mg/rad 2 , respectively. (author)
DNA nanotechnology from the test tube to the cell.
Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg
2015-09-01
The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.
DNA nanotechnology from the test tube to the cell
Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A.; Seelig, Georg
2015-09-01
The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology -- applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems -- lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.
DNA hybridization kinetics: zippering, internal displacement and sequence dependence.
Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A
2013-10-01
Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.
Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι
Energy Technology Data Exchange (ETDEWEB)
Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.
2017-03-08
N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the syn conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.
Simultaneous G-Quadruplex DNA Logic.
Bader, Antoine; Cockroft, Scott L
2018-04-03
A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom
2015-01-01
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724
Faustino, Ignacio; Marrink, S. J.
2017-01-01
Summary: We introduce cgHeliParm, a python program that provides the conformational analysis of Martini-based coarse-grained double strand DNA molecules. The software calculates the helical parameters such as base, base pair and base pair step parameters. cgHeliParm can be used for the analysis of
Multifunctional DNA Nanomaterials for Biomedical Applications
Directory of Open Access Journals (Sweden)
Dick Yan Tam
2015-01-01
Full Text Available The rapidly emerging DNA nanotechnology began with pioneer Seeman’s hypothesis that DNA not only can carry genetic information but also can be used as molecular organizer to create well-designed and controllable nanomaterials for applications in materials science, nanotechnology, and biology. DNA-based self-assembly represents a versatile system for nanoscale construction due to the well-characterized conformation of DNA and its predictability in the formation of base pairs. The structural features of nucleic acids form the basis of constructing a wide variety of DNA nanoarchitectures with well-defined shapes and sizes, in addition to controllable permeability and flexibility. More importantly, self-assembled DNA nanostructures can be easily functionalized to construct artificial functional systems with nanometer scale precision for multipurposes. Apparently scientists envision artificial DNA-based nanostructures as tool for drug loading and in vivo targeted delivery because of their abilities in selective encapsulation and stimuli-triggered release of cargo. Herein, we summarize the strategies of creating multidimensional self-assembled DNA nanoarchitectures and review studies investigating their stability, toxicity, delivery efficiency, loading, and control release of cargos in addition to their site-specific targeting and delivery of drug or cargo molecules to cellular systems.
Signature scheme based on bilinear pairs
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Accurate Estimation of the Standard Binding Free Energy of Netropsin with DNA
Directory of Open Access Journals (Sweden)
Hong Zhang
2018-01-01
Full Text Available DNA is the target of chemical compounds (drugs, pollutants, photosensitizers, etc., which bind through non-covalent interactions. Depending on their structure and their chemical properties, DNA binders can associate to the minor or to the major groove of double-stranded DNA. They can also intercalate between two adjacent base pairs, or even replace one or two base pairs within the DNA double helix. The subsequent biological effects are strongly dependent on the architecture of the binding motif. Discriminating between the different binding patterns is of paramount importance to predict and rationalize the effect of a given compound on DNA. The structural characterization of DNA complexes remains, however, cumbersome at the experimental level. In this contribution, we employed all-atom molecular dynamics simulations to determine the standard binding free energy of DNA with netropsin, a well-characterized antiviral and antimicrobial drug, which associates to the minor groove of double-stranded DNA. To overcome the sampling limitations of classical molecular dynamics simulations, which cannot capture the large change in configurational entropy that accompanies binding, we resort to a series of potentials of mean force calculations involving a set of geometrical restraints acting on collective variables.
Radiation-induced energy migration within solid DNA: The role of misonidazole as an electron trap
International Nuclear Information System (INIS)
Al-Kazwini, A.T.; O'Neill, P.; Adams, G.E.; Fielden, E.M.
1990-01-01
The in-pulse luminescence emission from solid DNA produced upon irradiation with electron pulses of energy below 260 keV has been investigated in vacuo at 293 K to gain an insight into the existence of radiation-induced charge/energy migration within DNA. The DNA samples contained misonidazole in the range 3 to 330 base pairs per misonidazole molecule. Under these conditions greater than 90% of the total energy is deposited in the DNA. The in-pulse radiation-induced luminescence spectrum of DNA was found to be critically dependent upon the misonidazole content of DNA. The luminescence intensity from the mixtures decreases with increasing content of misonidazole, and at the highest concentration, the intensity at 550 nm is reduced to 50% of that from DNA only. In the presence of 1 atm of oxygen, the observed emission intensity from DNA in the wavelength region 350-575 was reduced by 35-40% compared to that from DNA in vacuo. It is concluded that electron migration can occur in solid mixtures of DNA over a distance of up to about 100 base pairs
Maleki, Ehsan; Babashah, Hossein; Koohi, Somayyeh; Kavehvash, Zahra
2017-07-01
This paper presents an optical processing approach for exploring a large number of genome sequences. Specifically, we propose an optical correlator for global alignment and an extended moiré matching technique for local analysis of spatially coded DNA, whose output is fed to a novel three-dimensional artificial neural network for local DNA alignment. All-optical implementation of the proposed 3D artificial neural network is developed and its accuracy is verified in Zemax. Thanks to its parallel processing capability, the proposed structure performs local alignment of 4 million sequences of 150 base pairs in a few seconds, which is much faster than its electrical counterparts, such as the basic local alignment search tool.
DNA nanostructure-directed assembly of metal nanoparticle superlattices
Julin, Sofia; Nummelin, Sami; Kostiainen, Mauri A.; Linko, Veikko
2018-05-01
Structural DNA nanotechnology provides unique, well-controlled, versatile, and highly addressable motifs and templates for assembling materials at the nanoscale. These methods to build from the bottom-up using DNA as a construction material are based on programmable and fully predictable Watson-Crick base pairing. Researchers have adopted these techniques to an increasing extent for creating numerous DNA nanostructures for a variety of uses ranging from nanoelectronics to drug-delivery applications. Recently, an increasing effort has been put into attaching nanoparticles (the size range of 1-20 nm) to the accurate DNA motifs and into creating metallic nanostructures (typically 20-100 nm) using designer DNA nanoshapes as molds or stencils. By combining nanoparticles with the superior addressability of DNA-based scaffolds, it is possible to form well-ordered materials with intriguing and completely new optical, plasmonic, electronic, and magnetic properties. This focused review discusses the DNA structure-directed nanoparticle assemblies covering the wide range of different one-, two-, and three-dimensional systems.
International Nuclear Information System (INIS)
Pham, Quang Trung
2014-01-01
molecule in Geant4 by reading PDB (Protein Data Bank) files representing twelve base pairs of the DNA molecule and a di-nucleosome (347 base pairs). Finally, we developed a tool to correlate the positions of direct energy deposit in liquid water with the coordinates of the base pairs of DNA to calculate the number of single and double strand breaks in DNA. All calculations in this work were performed on the European Grid Infrastructure; performance tests are available to estimate the utility of this type of architecture for Monte Carlo calculations. (author) [fr
DNA responds to ionizing radiation as an insulator, not as a "molecular wire"
Debije, M.G.; Milano, M.T.; Bernhard, W.A.
1999-01-01
The yields of radicals trapped on DNA, measured by EPR spectroscopy of oligodeoxyribonucleotide crystals (the EPR spectrum of a single crystal of d(CCCTAGGG) is shown), are found to be very high (0.7 µmol¿J-1) and insensitive to long-range (>106 base pairs) versus short-range stacking (8 base pairs)
Predicting near-UV electronic circular dichroism in nucleosomal DNA by means of DFT response theory.
Norman, Patrick; Parello, Joseph; Polavarapu, Prasad L; Linares, Mathieu
2015-09-14
It is demonstrated that time-dependent density functional theory (DFT) calculations can accurately predict changes in near-UV electronic circular dichroism (ECD) spectra of DNA as the structure is altered from the linear (free) B-DNA form to the supercoiled N-DNA form found in nucleosome core particles. At the DFT/B3LYP level of theory, the ECD signal response is reduced by a factor of 6.7 in going from the B-DNA to the N-DNA form, and it is illustrated how more than 90% of the individual base-pair dimers contribute to this strong hypochromic effect. Of the several inter-base pair parameters, an increase in twist angles is identified as to strongly contribute to a reduced ellipticity. The present work provides first evidence that first-principles calculations can elucidate changes in DNA dichroism due to the supramolecular organization of the nucleoprotein particle and associates these changes with the local structural features of nucleosomal DNA.
Accurate interaction energies of base pairing and base stacking. The final chapter
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Jurečka, Petr; Hobza, Pavel
2005-01-01
Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics
Directory of Open Access Journals (Sweden)
Asma A. AL-Huqail
2015-01-01
Full Text Available The current study analyzed proteins and nuclear DNA of electric fields (ELF exposed and nonexposed maize seedlings for different exposure periods using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, isozymes, random amplified polymorphic DNA (RAPD, and comet assay, respectively. SDS-PAGE analysis revealed total of 46 polypeptides bands with different molecular weights ranging from 186.20 to 36.00 KDa. It generated distinctive polymorphism value of 84.62%. Leucine-aminopeptidase, peroxidase, and catalase isozymes showed the highest values of polymorphism (100% based on zymograms number, relative front (Rf, and optical intensity while esterase isozyme generated polymorphism value of 83.33%. Amino acids were analyzed using high-performance liquid chromatography, which revealed the presence of 17 amino acids of variable contents ranging from 22.65% to 28.09%. RAPD revealed that 78 amplified DNA products had highly polymorphism value (95.08% based on band numbers, with variable sizes ranging from 120 to 992 base pairs and band intensity. Comet assay recorded the highest extent of nuclear DNA damage as percentage of tailed DNA (2.38% and tail moment unit (5.36 at ELF exposure of maize nuclei for 5 days. The current study concluded that the longer ELF exposing periods had genotoxic stress on macromolecules of maize cells and biomarkers used should be augmented for reliable estimates of genotoxicity after exposure of economic plants to ELF stressors.
Goncharova, Iryna
2014-01-24
Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.
AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis
Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian
2016-01-01
Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
DNA interaction with platinum-based cytostatics revealed by DNA sequencing.
Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech
2017-12-15
The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.
VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI
Directory of Open Access Journals (Sweden)
Gun Gun Gumilar
2005-06-01
Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR
International Nuclear Information System (INIS)
Dizdaroglu, M.
1985-01-01
Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes
Human tissue factor: cDNA sequence and chromosome localization of the gene
International Nuclear Information System (INIS)
Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.
1987-01-01
A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes
Barrois, Sebastian; Wagenknecht, Hans-Achim
2013-05-21
The combination of thiazole orange (TO) and thiazole red (TR) as an internal pair of fluorescent DNA base surrogates ("DNA traffic lights") allows us to follow at least two consecutive DNA strand displacements in real time through a distinct fluorescence colour change from green to red and vice versa.
Characterization of a parallel-stranded DNA hairpin
International Nuclear Information System (INIS)
Germann, M.W.; Vogel, H.J.; Pon, R.T.; van de Sande, J.H.
1989-01-01
Recently, the authors have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure. In the present study, they have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T) 8 C 4 (A) 8 -3' and the related antiparallel (APS) hair 5'-d(T) 8 C 4 (A) 8 -3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31 P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. On the basis of NOESY measurements, they find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range. The results indicate a B-like conformation for each of the strands in the stem part of the PS hairpin and reverse Watson-Crick base pairing between the T and A residues. These data are consistent with a previously calculated structure for parallel-stranded DNA
The photoreaction between furocoumarins and various DNA with different base compositions
International Nuclear Information System (INIS)
Dall'Acqua, F.; Vedaldi, D.; Recher, M.
1978-01-01
The photoreactivity of psoralen and 8-methylpsoralen towards various samples of DNA having different base-pair compositions has been studied. The total photobinding capacity shown by the two furocoumarins increases by increasing the content of A-T, confirming the data previously obtained using synthetic polynucleotides. The amount of monofunctional fluorescent 4',5'-cycloadducts and of the cross-linkages formed during the photoreaction is not parallel to the content of A-T, but is highest when the A-T content is between 50 and 60%, while it decreases as the content of A-T is lowered or increased. The possible binding site for the formation of 4',5'-monofunctional cycloadducts as well as of cross-linkages is discussed. (author)
DFT study on metal-mediated uracil base pair complexes
Directory of Open Access Journals (Sweden)
Ayhan Üngördü
2017-11-01
Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
Noncanonical self-assembly of multifunctional DNA nanoflowers for biomedical applications.
Zhu, Guizhi; Hu, Rong; Zhao, Zilong; Chen, Zhuo; Zhang, Xiaobing; Tan, Weihong
2013-11-06
DNA nanotechnology has been extensively explored to assemble various functional nanostructures for versatile applications. Mediated by Watson-Crick base-pairing, these DNA nanostructures have been conventionally assembled through hybridization of many short DNA building blocks. Here we report the noncanonical self-assembly of multifunctional DNA nanostructures, termed as nanoflowers (NFs), and the versatile biomedical applications. These NFs were assembled from long DNA building blocks generated via rolling circle replication (RCR) of a designer template. NF assembly was driven by liquid crystallization and dense packaging of building blocks, without relying on Watson-Crick base-pairing between DNA strands, thereby avoiding the otherwise conventional complicated DNA sequence design. NF sizes were readily tunable in a wide range, by simply adjusting such parameters as assembly time and template sequences. NFs were exceptionally resistant to nuclease degradation, denaturation, or dissociation at extremely low concentration, presumably resulting from the dense DNA packaging in NFs. The exceptional biostability is critical for biomedical applications. By rational design, NFs can be readily incorporated with myriad functional moieties. All these properties make NFs promising for versatile applications. As a proof-of-principle demonstration, in this study, NFs were integrated with aptamers, bioimaging agents, and drug loading sites, and the resultant multifunctional NFs were demonstrated for selective cancer cell recognition, bioimaging, and targeted anticancer drug delivery.
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
Theoretical modelling of epigenetically modified DNA sequences [version 2; referees: 2 approved
Directory of Open Access Journals (Sweden)
Alexandra Teresa Pires Carvalho
2015-05-01
Full Text Available We report herein a set of calculations designed to examine the effects of epigenetic modifications on the structure of DNA. The incorporation of methyl, hydroxymethyl, formyl and carboxy substituents at the 5-position of cytosine is shown to hardly affect the geometry of CG base pairs, but to result in rather larger changes to hydrogen-bond and stacking binding energies, as predicted by dispersion-corrected density functional theory (DFT methods. The same modifications within double-stranded GCG and ACA trimers exhibit rather larger structural effects, when including the sugar-phosphate backbone as well as sodium counterions and implicit aqueous solvation. In particular, changes are observed in the buckle and propeller angles within base pairs and the slide and roll values of base pair steps, but these leave the overall helical shape of DNA essentially intact. The structures so obtained are useful as a benchmark of faster methods, including molecular mechanics (MM and hybrid quantum mechanics/molecular mechanics (QM/MM methods. We show that previously developed MM parameters satisfactorily reproduce the trimer structures, as do QM/MM calculations which treat bases with dispersion-corrected DFT and the sugar-phosphate backbone with AMBER. The latter are improved by inclusion of all six bases in the QM region, since a truncated model including only the central CG base pair in the QM region is considerably further from the DFT structure. This QM/MM method is then applied to a set of double-stranded DNA heptamers derived from a recent X-ray crystallographic study, whose size puts a DFT study beyond our current computational resources. These data show that still larger structural changes are observed than in base pairs or trimers, leading us to conclude that it is important to model epigenetic modifications within realistic molecular contexts.
Role of cyclobutane dimers in UV-denaturation of DNA
International Nuclear Information System (INIS)
Zavil'gel'skij, G.B.; Zuev, A.V.
1978-01-01
UV irradiation of double-stranded DNA produces local denatured regions. The evidence presented indicates that these single-stranded regions arise from photoproducts other than pyrimidine dimers. The irradiation of T2 DNA at 8x10 4 erg/mm 2 (254 nm) produces 6-8% thymine dimers, amd Tsub(mel) drops by 12-14 deg C, accompanied by a significant broadening of the transition profile. The kinetics of denatured region formation and lowering Tsub(mel) corresponds to that of formation of crosslinkages and differs markedly from the kinetics of formation of cyclobutane pyrimidine dimers. Treatment of UV-irradiated DNA with light in the presence of yeast photoreactivating enzyme monomerizes almost all thymine dimers but does not change the Tsub(mel). Local denatured regions are detected in UV-irradiated DNA and are absent from AcPhM-sensibilized DNA, which contains 20-25% thymine dimers, as determined by the accridine orange fluorescence technique. S1 nuclease from Aspergillis oryzae produces single-strand breaks in UV-irradiated DNA of phage PM2 but is not active on AcPhM-treated PM2 DNA, which contains about 50 thymine dimers. It is supposed that the formation of a cyclobutane dimer only weakens the hydrogen bonds in the AT base pair rather than breaks them. Local denatured regions are thought to arise from the accumulation in UV-irradiated DNA (254 nm) of the sufficient number of photoproducts with impaired ability to base pairing
From nonspecific DNA-protein encounter complexes to the prediction of DNA-protein interactions.
Directory of Open Access Journals (Sweden)
Mu Gao
2009-03-01
Full Text Available DNA-protein interactions are involved in many essential biological activities. Because there is no simple mapping code between DNA base pairs and protein amino acids, the prediction of DNA-protein interactions is a challenging problem. Here, we present a novel computational approach for predicting DNA-binding protein residues and DNA-protein interaction modes without knowing its specific DNA target sequence. Given the structure of a DNA-binding protein, the method first generates an ensemble of complex structures obtained by rigid-body docking with a nonspecific canonical B-DNA. Representative models are subsequently selected through clustering and ranking by their DNA-protein interfacial energy. Analysis of these encounter complex models suggests that the recognition sites for specific DNA binding are usually favorable interaction sites for the nonspecific DNA probe and that nonspecific DNA-protein interaction modes exhibit some similarity to specific DNA-protein binding modes. Although the method requires as input the knowledge that the protein binds DNA, in benchmark tests, it achieves better performance in identifying DNA-binding sites than three previously established methods, which are based on sophisticated machine-learning techniques. We further apply our method to protein structures predicted through modeling and demonstrate that our method performs satisfactorily on protein models whose root-mean-square Calpha deviation from native is up to 5 A from their native structures. This study provides valuable structural insights into how a specific DNA-binding protein interacts with a nonspecific DNA sequence. The similarity between the specific DNA-protein interaction mode and nonspecific interaction modes may reflect an important sampling step in search of its specific DNA targets by a DNA-binding protein.
DNA template dependent accuracy variation of nucleotide selection in transcription.
Directory of Open Access Journals (Sweden)
Harriet Mellenius
Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.
Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.
Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik
2016-09-07
One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.
Directory of Open Access Journals (Sweden)
Maslin Osathanunkul
Full Text Available DNA barcoding coupled high resolution melting (Bar-HRM is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Croton (Euphorbiaceae, one of the largest genera of plants with over 1,200 species. Seven primer pairs were evaluated (matK, rbcL1, rbcL2, rbcL3, rpoC, trnL and ITS1 from four plastid regions, matK, rbcL, rpoC, and trnL, and the nuclear ribosomal marker ITS1. The primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL1 primer pair gave the lowest resolution. It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Our Bar-HRM results here also provide further support for the hypothesis that both sequence and base composition affect DNA duplex stability.
International Nuclear Information System (INIS)
Wurdeman, R.L.; Gold, B.
1988-01-01
DNA alkylation by N-alkyl-N-nitrosoureas is generally accepted to be responsible for their mutagenic, carcinogenic, and antineoplastic activities. The exact nature of the ultimate alkylating intermediate is still controversial, with a variety of species having been nominated. The sequence specificity for DNA alkylation by simple N-alkyl-N-nitrosoureas has not been reported, although such information is basic in understanding the specific point mutations induced by these compounds in oncogene targets. These two points are addressed by using N-methyl-N-nitrosourea methylation of a 576 base-pair 32 P-end-labeled DNA restriction fragment and high-resolution polyacrylamide sequencing gels. This method provides information on the formation of N 7 -methylguanine, by the generation of single-strand breaks upon exposure to piperidine
DNA Electrochemistry with Tethered Methylene Blue
Pheeney, Catrina G.
2012-01-01
Methylene blue (MB′), covalently attached to DNA through a flexible C12 alkyl linker, provides a sensitive redox reporter in DNA electrochemistry measurements. Tethered, intercalated MB′ is reduced through DNA-mediated charge transport; the incorporation of a single base mismatch at position 3, 10, or 14 of a 17-mer causes an attenuation of the signal to 62 ± 3% of the well-matched DNA, irrespective of position in the duplex. The redox signal intensity for MB′–DNA is found to be least 3-fold larger than that of Nile blue (NB)–DNA, indicating that MB′ is even more strongly coupled to the π-stack. The signal attenuation due to an intervening mismatch does, however, depend on DNA film density and the backfilling agent used to passivate the surface. These results highlight two mechanisms for reduction of MB′ on the DNA-modified electrode: reduction mediated by the DNA base pair stack and direct surface reduction of MB′ at the electrode. These two mechanisms are distinguished by their rates of electron transfer that differ by 20-fold. The extent of direct reduction at the surface can be controlled by assembly and buffer conditions. PMID:22512327
DNA based radiological dosimetry technology
International Nuclear Information System (INIS)
Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin
2008-01-01
Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)
Specificity of cellular DNA-binding sites of microbial populations in a Florida reservoir
International Nuclear Information System (INIS)
Paul, J.H.; Pichard, S.L.
1989-01-01
The substrate specificity of the DNA-binding mechanism(s) of bacteria in a Florida reservoir was investigated in short- and long-term uptake studies with radiolabeled DNA and unlabeled competitors. Thymine oligonucleotides ranging in size from 2 base pairs to 19 to 24 base pairs inhibited DNA binding in 20-min incubations by 43 to 77%. Deoxynucleoside monophosphates, thymidine, and thymine had little effect on short-term DNA binding, although several of these compounds inhibited the uptake of the radiolabel from DNA in 4-h incubations. Inorganic phosphate and glucose-1-phosphate inhibited neither short- nor long-term binding of [ 3 H]- or [ 32 P]DNA, indicating that DNA was not utilized as a phosphorous source in this reservoir. RNA inhibited both short- and long-term radiolabeled DNA uptake as effectively as unlabeled DNA. Collectively these results indicate that aquatic bacteria possess a generalized nuclei acid uptake/binding mechanism specific for compounds containing phosphodiester bonds and capable of recognizing oligonucleotides as short as dinucleotides. This binding site is distinct from nucleoside-, nucleotide-, phosphomonoester-, and inorganic phosphate-binding sites. Such a nucleic acid-binding mechanism may have evolved for the utilization of extracellular DNA (and perhaps RNA), which is abundant in many marine and freshwater environments
EGNAS: an exhaustive DNA sequence design algorithm
Directory of Open Access Journals (Sweden)
Kick Alfred
2012-06-01
Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.
Energy Technology Data Exchange (ETDEWEB)
Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.
2008-01-28
Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.
Directory of Open Access Journals (Sweden)
Masudur Rahman
2016-10-01
Full Text Available Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.
Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.
2016-01-01
Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material. PMID:28335324
Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J
2013-04-01
The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry
Restriction enzyme cleavage of ultraviolet-damaged Simian virus 40 and pBR322 DNA
International Nuclear Information System (INIS)
Cleaver, J.E.
1983-01-01
Cleavage of specific DNA sequences by the restriction enzymes EcoRI, HindIII and TaqI was prevented when the DNA was irradiated with ultraviolet light. Most of the effects were attributed to cyclobutane pyrimidine dimers in the recognition sequences; the effectiveness of irradiation was directly proportional to the number of potential dimer sites in the DNA. Combining EcoRI with dimer-specific endonuclease digestion revealed that pyrimidine dimers blocked cleavage within one base-pair on the strand opposite to the dimer but did not block cleavage three to four base-pairs away on the same strand. These are the probable limits for the range of influence of pyrimidine dimers along the DNA, at least for this enzyme. The effect of irradiation on cleavage by TaqI seemed far greater than expected for the cyclobutane dimer yield, possibly because of effects from photoproducts flanking the tetranucleotide recognition sequence and the effect of non-cyclobutane (6-4)pyrimidine photoproducts involving adjacent T and C bases. (author)
Control of DNA hybridization by photoswitchable molecular glue.
Dohno, Chikara; Nakatani, Kazuhiko
2011-12-01
Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.
Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H
2015-02-14
The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.
Phylogenetic and structural analysis of centromeric DNA and kinetochore proteins
Meraldi, Patrick; McAinsh, Andrew D; Rheinbay, Esther; Sorger, Peter K
2006-01-01
Background: Kinetochores are large multi-protein structures that assemble on centromeric DNA (CEN DNA) and mediate the binding of chromosomes to microtubules. Comprising 125 base-pairs of CEN DNA and 70 or more protein components, Saccharomyces cerevisiae kinetochores are among the best understood. In contrast, most fungal, plant and animal cells assemble kinetochores on CENs that are longer and more complex, raising the question of whether kinetochore architecture has been conserved through ...
Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates
International Nuclear Information System (INIS)
Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.
1991-01-01
Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures
Human mitochondrial DNA (mtDNA) types in Malaysia
International Nuclear Information System (INIS)
Lian, L.H.; Koh, C.L.; Lim, M.E.
2000-01-01
Each human cell contains hundreds of mitochondria and thousands of double-stranded circular mtDNA. The delineation of human mtDNA variation and genetics over the past decade has provided unique and often startling insights into human evolution, degenerative diseases, and aging. Each mtDNA of 16,569 base pairs, encodes 13 polypeptides essential to the enzymes of the mitochondrial energy generating pathway, plus the necessary tRNAs and rRNAs. The highly polymorphic noncoding D-(displacement) loop region, also called the control region, is approximately 1.2 kb long. It contains two well-characterized hypervariable (HV-) regions, HV1 and HV2. MtDNA identification is usually based on these sequence differences. According to the TWTGDAM (Technical Working Group for DNA Analysis Methods), the minimum requirement for a mtDNA database for HV1 is from positions 16024 to 16365 and for HV2, from positions 00073 to 00340. The targeted Malaysian population subgroups for this study were mainly the Malays, Chinese, Indians, and indigenous Ibans, Bidayuhs, Kadazan-Dusuns, and Bajaus. Research methodologies undertaken included DNA extraction of samples from unrelated individuals, amplification of the specific regions via the polymerase chain reaction (PCR), and preparation of template DNA for sequencing by using an automated DNA sequencer. Sufficient nucleotide sequence data were generated from the mtDNA analysis. When the sequences were analyzed, sequence variations were found to be caused by nucleotide substitutions, insertions, and deletions. Of the three causes of the sequence variations, nucleotide substitutions (86.1%) accounted for the vast majority of polymorphism. It is noted that transitions (83.5%) were predominant when compared to the significantly lower frequencies of transversions (2.6%). Insertions (0.9%) and deletions (13.0%) were rather rare and found only in HV2. The data generated will also form the basis of a Malaysian DNA sequence database of mtDNA D
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Hammerly, Susan C; Morrow, Michael E; Johnson, Jeff A
2013-11-01
The primary goal of captive breeding programmes for endangered species is to prevent extinction, a component of which includes the preservation of genetic diversity and avoidance of inbreeding. This is typically accomplished by minimizing mean kinship in the population, thereby maintaining equal representation of the genetic founders used to initiate the captive population. If errors in the pedigree do exist, such an approach becomes less effective for minimizing inbreeding depression. In this study, both pedigree- and DNA-based methods were used to assess whether inbreeding depression existed in the captive population of the critically endangered Attwater's Prairie-chicken (Tympanuchus cupido attwateri), a subspecies of prairie grouse that has experienced a significant decline in abundance and concurrent reduction in neutral genetic diversity. When examining the captive population for signs of inbreeding, variation in pedigree-based inbreeding coefficients (f(pedigree)) was less than that obtained from DNA-based methods (f(DNA)). Mortality of chicks and adults in captivity were also positively correlated with parental relatedness (r(DNA)) and f(DNA), respectively, while no correlation was observed with pedigree-based measures when controlling for additional variables such as age, breeding facility, gender and captive/release status. Further, individual homozygosity by loci (HL) and parental rDNA values were positively correlated with adult mortality in captivity and the occurrence of a lethal congenital defect in chicks, respectively, suggesting that inbreeding may be a contributing factor increasing the frequency of this condition among Attwater's Prairie-chickens. This study highlights the importance of using DNA-based methods to better inform management decisions when pedigrees are incomplete or errors may exist due to uncertainty in pairings. © 2013 John Wiley & Sons Ltd.
Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA
International Nuclear Information System (INIS)
Fye, R.M.; Benham, C.J.
1999-01-01
Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N 2 ) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements
Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai
2015-01-01
One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995
Benchmarking BarraCUDA on Epigenetic DNA and nVidia Pascal GPUs
Langdon, W
2016-01-01
Typically BarraCUDA uses CUDA graphics cards to map DNA reads to the human genome. Previously its software source code was genetically improved for short paired end next generation sequences. On longer, 150 base paired end noisy Cambridge Epigenetix's data, a Pascal GTX 1080 processes about 10000 strings per second, comparable with twin nVidia Tesla K40.
International Nuclear Information System (INIS)
Komano, T.; Inouye, S.; Inouye, M.
1985-01-01
Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin
Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins
DEFF Research Database (Denmark)
Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra
2015-01-01
STUDY OBJECTIVES: Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins...... structure to assess within-pair effects of sleep duration on mtDNA copy number. MEASUREMENTS AND RESULTS: Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P sleep efficiency (β = 0.51; 95% CI 0.......06, 0.95; P DNA copy number within twin pairs. Thus every 1-minute decrease in actigraphy-defined sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated...
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Cooperative interactions between paired domain and homeodomain.
Jun, S; Desplan, C
1996-09-01
The Pax proteins are a family of transcriptional regulators involved in many developmental processes in all higher eukaryotes. They are characterized by the presence of a paired domain (PD), a bipartite DNA binding domain composed of two helix-turn-helix (HTH) motifs,the PAI and RED domains. The PD is also often associated with a homeodomain (HD) which is itself able to form homo- and hetero-dimers on DNA. Many of these proteins therefore contain three HTH motifs each able to recognize DNA. However, all PDs recognize highly related DNA sequences, and most HDs also recognize almost identical sites. We show here that different Pax proteins use multiple combinations of their HTHs to recognize several types of target sites. For instance, the Drosophila Paired protein can bind, in vitro, exclusively through its PAI domain, or through a dimer of its HD, or through cooperative interaction between PAI domain and HD. However, prd function in vivo requires the synergistic action of both the PAI domain and the HD. Pax proteins with only a PD appear to require both PAI and RED domains, while a Pax-6 isoform and a new Pax protein, Lune, may rely on the RED domain and HD. We propose a model by which Pax proteins recognize different target genes in vivo through various combinations of their DNA binding domains, thus expanding their recognition repertoire.
PHENANTHROLINE TEMPLATED SCHIFF BASE
African Journals Online (AJOL)
DNA in intercalative mode and in the development of unique chemotherapeutics where they impact on the ... between base pairs of DNA. .... h, i, j, k belong to fragmentation products of impap. ..... Sm(III) complex and herring sperm DNA. Bull.
Mesoscopic modeling of DNA denaturation rates: Sequence dependence and experimental comparison
Energy Technology Data Exchange (ETDEWEB)
Dahlen, Oda, E-mail: oda.dahlen@ntnu.no; Erp, Titus S. van, E-mail: titus.van.erp@ntnu.no [Department of Chemistry, Norwegian University of Science and Technology (NTNU), Høgskoleringen 5, Realfagbygget D3-117 7491 Trondheim (Norway)
2015-06-21
Using rare event simulation techniques, we calculated DNA denaturation rate constants for a range of sequences and temperatures for the Peyrard-Bishop-Dauxois (PBD) model with two different parameter sets. We studied a larger variety of sequences compared to previous studies that only consider DNA homopolymers and DNA sequences containing an equal amount of weak AT- and strong GC-base pairs. Our results show that, contrary to previous findings, an even distribution of the strong GC-base pairs does not always result in the fastest possible denaturation. In addition, we applied an adaptation of the PBD model to study hairpin denaturation for which experimental data are available. This is the first quantitative study in which dynamical results from the mesoscopic PBD model have been compared with experiments. Our results show that present parameterized models, although giving good results regarding thermodynamic properties, overestimate denaturation rates by orders of magnitude. We believe that our dynamical approach is, therefore, an important tool for verifying DNA models and for developing next generation models that have higher predictive power than present ones.
Binding of the antitumor drug nogalamycin and its derivatives to DNA: Structural comparison
International Nuclear Information System (INIS)
Gao, Yi-Gui; Liaw, Yen-Chywan; Robinson, H.; Wang, A. H.-J.
1990-01-01
The three-dimensional molecular structures of the complexes between a novel antitumor drug nogalamycin and its derivative U-58872 with a modified DNA hexamer d[m 5 CGT(pS)Am 5 CG] have been determined at 1.7- and 1.8-angstrom resolution, respectively, by X-ray diffraction analyses. Both structures (in space group P6 1 ) have been refined with constrained refinement procedure to final R factors of 0.208 (3386 reflections) and 0.196 (2143 reflections). In both complexes, two nogalamycins bind to the DNA hexamer double helix in a 2:1 ratio with the elongated aglycon chromophore intercalated between the CpG steps at both ends of the helix. The aglycon chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. Most of the sugars remain in the C2'-endo pucker family, except three deoxycytidine residues (terminal C1, C7, and internal C5). All nucleotides are in the anti conformation. Specific hydrogen bonds are found in the complex between the drug and guanine-cytosine bases in both grooves of the helix. One hydroxyl group of the aminoglucose donates a hydrogen bond to the N7 of guanine, while the other receives a hydrogen bond from the N4 amino group of cytosine. The orientation of these two hydrogen bonds suggests that nogalamycin prefers a GC base pair with its aglycon chromophore intercalating at the 5'-side of a guanine (between NpG), or at the 3'-side of a cytosine (between CpN) with the sugars pointing toward the GC base pair. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through, suggesting that nogalamycin prefers GC sequences embedded in a stretch of AT sequences
Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates
2008-06-01
might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed
NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT
Directory of Open Access Journals (Sweden)
Testiana Deni Wijayatiningsih
2017-04-01
Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.
Antioxidant effect of naturally occurring xanthines on the oxidative damage of DNA bases
Vieira, A. J. S. C.; Telo, J. P.; Pereira, H. F.; Patrocínio, P. F.; Dias, R. M. B.
1999-01-01
The repair of the oxidised radicals of adenine and guanosine by several naturally occurring xanthines was studied. Each pair of DNA purine/xanthine was made to react with the sulphate radical and the decrease of the concentration of both compounds was measured by HPLC as a function of irradiation time. The results show that xanthine efficiently prevents the oxidation of the two DNA purines. Theophyline and paraxanthine repair the oxidised radical of adenine but not the one from guanosine. Theobromine and caffeine do not show any protecting effect. An order of the oxidation potentials of all the purines studied is proposed. La réparation des radicaux oxydés de l'adénine et de la guanosine par des xanthines naturelles a été étudiée en soumettant chaque paire base de l'ADN/xanthine à l'oxydation par le radical sulfate et en mesurant par HPLC la disparition des deux composés en fonction du temps d'irradiation. Les résultats montrent que la xanthine joue un rôle protecteur efficace contre l'oxydation des deux purines de l'ADN. La théophyline et la paraxanthine réparent le radical oxydé de l'adénine mais pas celui de la guanosine. La théobromine et la cafeíne n'ont pas d'effet protecteur. Un ordre de potentiels d'oxydation des purines étudiées est proposé.
DNA-Based Sensor for Real-Time Measurement of the Enzymatic Activity of Human Topoisomerase I
DEFF Research Database (Denmark)
Marcussen, Lærke Bay; Jepsen, Morten Leth; Kristoffersen, Emil Laust
2013-01-01
Sensors capable of quantitative real-time measurements may present the easiest and most accurate way to study enzyme activities. Here we present a novel DNA-based sensor for specific and quantitative real-time measurement of the enzymatic activity of the essential human enzyme, topoisomerase I....... The basic design of the sensor relies on two DNA strands that hybridize to form a hairpin structure with a fluorophore-quencher pair. The quencher moiety is released from the sensor upon reaction with human topoisomerase I thus enabling real-time optical measurement of enzymatic activity. The sensor....... The cytotoxic effect of camptothecins correlates directly with the intracellular topoisomerase I activity. We therefore envision that the presented sensor may find use for the prediction of cellular drug response. Moreover, inhibition of topoisomerase I by camptothecin is readily detectable using the presented...
Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang
2017-07-05
DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Duguid, J; Bloomfield, V A; Benevides, J; Thomas, G J
1993-11-01
Interactions of divalent metal cations (Mg2+, Ca2+, Ba2+, Sr2+, Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) with DNA have been investigated by laser Raman spectroscopy. Both genomic calf-thymus DNA (> 23 kilobase pairs) and mononucleosomal fragments (160 base pairs) were employed as targets of metal interaction in solutions containing 5 weight-% DNA and metal:phosphate molar ratios of 0.6:1. Raman difference spectra reveal that transition metal cations (Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) induce the greatest structural changes in B-DNA. The Raman (vibrational) band differences are extensive and indicate partial disordering of the B-form backbone, reduction in base stacking, reduction in base pairing, and specific metal interaction with acceptor sites on the purine (N7) and pyrimidine (N3) rings. Many of the observed spectral changes parallel those accompanying thermal denaturation of B-DNA and suggest that the metals link the bases of denatured DNA. While exocyclic carbonyls of dT, dG, and dC may stabilize metal ligation, correlation plots show that perturbations of the carbonyls are mainly a consequence of metal-induced denaturation of the double helix. Transition metal interactions with the DNA phosphates are weak in comparison to interactions with the bases, except in the case of Cu2+, which strongly perturbs both base and phosphate group vibrations. On the other hand, the Raman signature of B-DNA is largely unperturbed by Mg2+, Ca2+, Sr2+, and Ba2+, suggesting much weaker interactions of the alkaline earth metals with both base and phosphate sites. A notable exception is a moderate perturbation by alkaline earths of purine N7 sites in 160-base pair DNA, with Ca2+ causing the greatest effect. Correlation plots demonstrate a strong interrelationship between perturbations of Raman bands assigned to ring vibrations of the bases and those of bands assigned to exocyclic carbonyls and backbone phosphodiester groups. However, strong correlations do not occur between
Chawla, Mohit
2015-06-27
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi
2015-01-01
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K
2012-10-01
A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.
Capability of ds-DNA duplex structure in growing fluorescent silver nanoclusters
International Nuclear Information System (INIS)
Wu, Tao; Lin, Fan; Hu, Yuehua; Wang, Ying; Zhou, Xiaoshun; Shao, Yong
2016-01-01
Silver nanoclusters (AgNCs) have attracted wide interests in variant fields due to their easy synthesis and practical tunability in fluorescence properties. DNA has been generally used as the host to grow AgNCs due to the sequence-dependent fluorescence behavior. Actually, in such DNA, various ss-DNA segments that are structurally confined by the rigid ds-DNA counterparts have been used as the AgNCsГ—Ві growth sites. However, whether the ds-DNA structure plays somewhat role in AgNCsГ—Ві creation has not been well elucidated. Herein, we found that ds-DNA can also accommodate the growth of fluorescent AgNCs. The fluorescent AgNCs grown on ds-DNA should be separated each other and the G/C base pairs with right context sequences are the growth sites of fluorescent AgNCs. The intermediate A/T base pair among the continuous G/C ones seems to quench the growth of fluorescent AgNCs. For the repeat sequences, the fluorescence band position of AgNCs is not changed but the intensity is enhanced upon increasing the ds-DNA length, which is different from the results obtained with the previously reported ss-DNAs. AgNCs should be grown on the ds-DNA major groove, as convinced by the cytosine methylation experiment. Our work demonstrates that besides the ss-DNA role in defining AgNCs, one should also take into account the critical role of the ds-DNA segment in tuning the AgNCsГ—Ві fluorescence property.
Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen
2015-10-29
Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae
Lang, Gregory I.; Murray, Andrew W.
2008-01-01
Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Poincaré recurrences of DNA sequences
Frahm, K. M.; Shepelyansky, D. L.
2012-01-01
We analyze the statistical properties of Poincaré recurrences of Homo sapiens, mammalian, and other DNA sequences taken from the Ensembl Genome data base with up to 15 billion base pairs. We show that the probability of Poincaré recurrences decays in an algebraic way with the Poincaré exponent β≈4 even if the oscillatory dependence is well pronounced. The correlations between recurrences decay with an exponent ν≈0.6 that leads to an anomalous superdiffusive walk. However, for Homo sapiens sequences, with the largest available statistics, the diffusion coefficient converges to a finite value on distances larger than one million base pairs. We argue that the approach based on Poncaré recurrences determines new proximity features between different species and sheds a new light on their evolution history.
Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins.
Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F
2015-10-01
Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Academic clinical research center. 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a "normal" (7-9 h/24) and "short" (sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. © 2015 Associated Professional Sleep Societies, LLC.
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Non-destructive sampling of ancient insect DNA
DEFF Research Database (Denmark)
Thomsen, Philip Francis; Elias, Scott; Gilbert, Tom
2009-01-01
BACKGROUND: A major challenge for ancient DNA (aDNA) studies on insect remains is that sampling procedures involve at least partial destruction of the specimens. A recent extraction protocol reveals the possibility of obtaining DNA from past insect remains without causing visual morphological...... of 77-204 base pairs (-bp) in size using species-specific and general insect primers. CONCLUSION/SIGNIFICANCE: The applied non-destructive DNA extraction method shows promising potential on insect museum specimens of historical age as far back as AD 1820, but less so on the ancient permafrost......-preserved insect fossil remains tested, where DNA was obtained from samples up to ca. 26,000 years old. The non-frozen sediment DNA approach appears to have great potential for recording the former presence of insect taxa not normally preserved as macrofossils and opens new frontiers in research on ancient...
Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H
2014-11-10
cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ayaz, Meryem S.; Kwak, Minseok; Alemdaroglu, Fikri E.; Wang, Jie; Berger, Ruediger; Herrmann, Andreas; Berger, Rüdiger
2011-01-01
Ultra-high molecular weight DNA/polymer hybrid materials were prepared employing molecular biology techniques. Nucleic acid restriction and ligation enzymes were used to generate linear DNA di- and triblock copolymers that contain up to thousands of base pairs in the DNA segments.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Directory of Open Access Journals (Sweden)
Noorain Khan
2015-04-01
Full Text Available Conformational polymorphism of DNA is a major causative factor behind several incurable trinucleotide repeat expansion disorders that arise from overexpansion of trinucleotide repeats located in coding/non-coding regions of specific genes. Hairpin DNA structures that are formed due to overexpansion of CAG repeat lead to Huntington's disorder and spinocerebellar ataxias. Nonetheless, DNA hairpin stem structure that generally embraces B-form with canonical base pairs is poorly understood in the context of periodic noncanonical A…A mismatch as found in CAG repeat overexpansion. Molecular dynamics simulations on DNA hairpin stems containing A…A mismatches in a CAG repeat overexpansion show that A…A dictates local Z-form irrespective of starting glycosyl conformation, in sharp contrast to canonical DNA duplex. Transition from B-to-Z is due to the mechanistic effect that originates from its pronounced nonisostericity with flanking canonical base pairs facilitated by base extrusion, backbone and/or base flipping. Based on these structural insights we envisage that such an unusual DNA structure of the CAG hairpin stem may have a role in disease pathogenesis. As this is the first study that delineates the influence of a single A…A mismatch in reversing DNA helicity, it would further have an impact on understanding DNA mismatch repair.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
UVB DNA dosimeters analyzed by polymerase chain reactors
International Nuclear Information System (INIS)
Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL
1997-01-01
Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)
Zhang, Yuetao
2012-01-01
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization
DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.
Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao
2016-01-13
Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.
Binary electrokinetic separation of target DNA from background DNA primers.
Energy Technology Data Exchange (ETDEWEB)
James, Conrad D.; Derzon, Mark Steven
2005-10-01
This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Atomistic details of the molecular recognition of DNA-RNA hybrid ...
Indian Academy of Sciences (India)
conformations corresponding to typical A- and B-type nucleic acids and the .... protein chains and five base pairs in DNA-RNA hybrid ... employed to treat the long range electrostatic interac- .... The solvent accessible surface areas (SASA) of.
Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.
Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R
2009-07-01
The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/
Bifunctional rhodium intercalator conjugates as mismatch-directing DNA alkylating agents.
Schatzschneider, Ulrich; Barton, Jacqueline K
2004-07-21
A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covalent modification was established on the basis of the enhanced depurination associated with N-alkylation. The site-selective alkylation at mismatched DNA renders these conjugates useful tools for the covalent tagging of DNA base pair mismatches and new chemotherapeutic design.
Sordaria, a model system to uncover links between meiotic pairing and recombination.
Zickler, Denise; Espagne, Eric
2016-06-01
The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.
Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei
2018-05-08
Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.
Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs
Energy Technology Data Exchange (ETDEWEB)
Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)
2016-05-06
The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Valle-Orero, J; Wildes, A R; Theodorakopoulos, N; Cuesta-López, S; Peyrard, M; Garden, J-L; Danilkin, S
2014-01-01
The DNA molecule can take various conformational forms. Investigations focus mainly on the so-called ‘B-form’, schematically drawn in the famous paper by Watson and Crick [1]. This is the usual form of DNA in a biological environment and is the only form that is stable in an aqueous environment. Other forms, however, can teach us much about DNA. They have the same nucleotide base pairs for ‘building blocks’ as B-DNA, but with different relative positions, and studying these forms gives insight into the interactions between elements under conditions far from equilibrium in the B-form. Studying the thermal denaturation is particularly interesting because it provides a direct probe of those interactions which control the growth of the fluctuations when the ‘melting’ temperature is approached. Here we report such a study on the ‘A-form’ using calorimetry and neutron scattering. We show that it can be carried further than a similar study on B-DNA, requiring the improvement of thermodynamic models for DNA. (paper)
Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC
Energy Technology Data Exchange (ETDEWEB)
Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)
2017-10-20
DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.
Guanine is indispensable for immunoglobulin switch region RNA-DNA hybrid formation
International Nuclear Information System (INIS)
Mizuta, Ryushin; Mizuta, Midori; Kitamura, Daisuke
2005-01-01
It is suggested that the formation of the switch (S) region RNA-DNA hybrid and the subsequent generation of higher-order chromatin structures including R-loop initiate a class switch recombination of the immunoglobulin gene. The primary factor of this recombination is the S-region derived noncoding RNA. However, the biochemical character of this guanine-rich (G-rich) transcript is poorly understood. The present study was performed to analyze the structure of this G-rich RNA using atomic force microscope (AFM). The in vitro transcribed S-region RNA was spread on a mica plate, air-dried and observed by non-contact mode AFM in air. The G-rich transcripts tend to aggregate on the template DNA and to generate a higher-order RNA-DNA complex. However, the transcripts that incorporated guanine analogues as substitutes for guanine neither aggregated nor generated higher-order structures. Incorporation of guanine analogues in transcribes RNA partially disrupts hydrogen bonds related to guanine, such as Watson-Crick GC-base pair and Hoogsteen bond GG-base pair. Thus, aggregation of S-region RNA and generation of the higher-order RNA-DNA complex are attributed to hydrogen bonds of guanine. (author)
Structural basis for sequence-specific recognition of DNA by TAL effectors
Deng, Dong; Yan, Chuangye; Pan, Xiaojing; Mahfouz, Magdy M.; Wang, Jiawei; Zhu, Jiankang; Shi, Yi Gong; Yan, Nieng
2012-01-01
TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair
International Nuclear Information System (INIS)
Kalnik, M.W.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1989-01-01
The pairing of O 6 etG with C located four base pairs in from either end of the self-complementary d(C1-G2-C3-O 6 etG4-A5-G6-C7-T8-C9-G10-C11-G12) duplex (designated O 6 etG·C 12-mer) has been investigated from an analysis of proton and phosphorus two-dimensional NMR experiments. The structural consequences of increasing the alkyl group size were elucidated from a comparative study of the pairing of O 6 meG4 with C9 in a related sequence (designated O 6 meG·C 12-mer). The NMR parameters for both O 6 alkG-containing dodecanucleotides are also compared with those of the control sequence containing G4·C9 base pairs (designated G·C 12-mer). The NOE cross-peaks detected in the two-dimensional NOESY spectra of the O 6 alkG·C 12-mer duplexes in H 2 O solution establish that the O 6 etG4/O 6 meG4 and C9 bases at the lesion site stack into the helix between the flanking C3·G10 and A5·T8 Watson-Crick base pairs. The observed NOEs between the amino protons of C9 and the CH 3 protons of O 6 alkG4 establish a syn orientation of the O 6 -alkyl group with respect to the N 1 of alkylated guanine. A wobble alignment of the O 6 alkG4·C9 base pair stabilized by two hydrogen bonds, one between the amino group of C9 and N 1 of O 6 alkG and the other between the amino group of O 6 alkG and N 3 of C9, is tentatively proposed on the basis of the NOEs between the amino protons of C9 at the lesion site and the imino protons of flanking Watson-Crick base pairs
Mechanisms for radiation damage in DNA
International Nuclear Information System (INIS)
Sevilla, M.D.
1993-12-01
In this project the author has proposed several mechanisms for radiation damage to DNA and its constituents, and has detailed a series of experiments utilizing electron spin resonance spectroscopy, HPLC, GC-mass spectroscopy and ab initio molecular orbital calculations to test the proposed mechanisms. In this years work he has completed several experiments on the role of hydration water on DNA radiation damage, continued the investigation of the localization of the initial charges and their reactions on DNA, investigated protonation reactions in DNA base anions, and employed ab initio molecular orbital theory to gain insight into the initial events of radiation damage to DNA. Ab initio calculations have provided an understanding of the energetics evolved in anion and cation formation, ion radical transfer in DNA as well as proton transfer with DNA base pair radical ions. This has been extended in this years work to a consideration of ionization energies of various components of the DNA deoxyribose backbone and resulting neutral sugar radicals. This information has aided the formation of new radiation models for the effect of radiation on DNA. During this fiscal year four articles have been published, four are in press, one is submitted and several more are in preparation. Four papers have been presented at scientific meetings. This years effort will include another review article on the open-quotes Electron Spin Resonance of Radiation Damage to DNAclose quotes
MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter
Energy Technology Data Exchange (ETDEWEB)
Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)
2016-06-15
Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed small volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)
MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter
International Nuclear Information System (INIS)
Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N
2016-01-01
Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed small volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)
Effect of serotonin on the yield of UV-induced thymine dimers in DNA
International Nuclear Information System (INIS)
Frajkin, G.Ya.; Strakhovskaya, M.G.; Ivanova, Eh.V.
1985-01-01
Using fluorescence method serotonin interaction with DNA is studied and bond constant Ksub(c)=4.2x10 4 M -1 is defined. It is shown that bound serotonin reduces yield of UV-induced thymine dimers. Value of efficient distance of protective serotonin effect constituting part of DNA chain of 4 base pairs, is determined
Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun
2016-05-24
DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.
Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.
2016-01-01
Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050
Cloning, sequencing, and expression of cDNA for human β-glucuronidase
International Nuclear Information System (INIS)
Oshima, A.; Kyle, J.W.; Miller, R.D.
1987-01-01
The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
Bubble generation in a twisted and bent DNA-like model
DEFF Research Database (Denmark)
Larsen, Peter Ulrik Vingaard; Christiansen, Peter Leth; Bang, Ole
2004-01-01
The DNA molecule is modeled by a parabola embedded chain with long-range interactions between twisted base pair dipoles. A mechanism for bubble generation is presented and investigated in two different configurations. Using random normally distributed initial conditions to simulate thermal...
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
A polarized view on DNA under tension
van Mameren, Joost; Vermeulen, Karen; Wuite, Gijs J. L.; Peterman, Erwin J. G.
2018-03-01
In the past decades, sensitive fluorescence microscopy techniques have contributed significantly to our understanding of the dynamics of DNA. The specific labeling of DNA using intercalating dyes has allowed for quantitative measurement of the thermal fluctuations the polymers undergo. On the other hand, recent advances in single-molecule manipulation techniques have unraveled the mechanical and elastic properties of this intricate polymer. Here, we have combined these two approaches to study the conformational dynamics of DNA under a wide range of tensions. Using polarized fluorescence microscopy in conjunction with optical-tweezers-based manipulation of YOYO-intercalated DNA, we controllably align the YOYO dyes using DNA tension, enabling us to disentangle the rapid dynamics of the dyes from that of the DNA itself. With unprecedented control of the DNA alignment, we resolve an inconsistency in reports about the tilted orientation of intercalated dyes. We find that intercalated dyes are on average oriented perpendicular to the long axis of the DNA, yet undergo fast dynamics on the time scale of absorption and fluorescence emission. In the overstretching transition of double-stranded DNA, we do not observe changes in orientation or orientational dynamics of the dyes. Only beyond the overstretching transition, a considerable depolarization is observed, presumably caused by an average tilting of the DNA base pairs. Our combined approach thus contributes to the elucidation of unique features of the molecular dynamics of DNA.
International Nuclear Information System (INIS)
Das, Saurabh; Mandal, Parikshit C.
2009-01-01
Ionizing radiation when allowed to fall upon cells or DNA, the radicals produced modify the base-pair region of the double strands. Radiation-induced double-strand modifications in calf thymus DNA were detected using Ni(II) and Fe(III) complexes of 1,2 dihydroxy 9,10 anthraquinone (DHA). 60 Co was used as the source for γ-radiation and ethidium bromide (EB) as the fluorescent dye for detecting double-strand modifications caused in DNA. Results show that the Fe(III)-DHA complex is more efficient in modifying the base-pair region in double-stranded DNA in comparison to DHA or the Ni(II)-DHA complex
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
DNA Damage Signals and Space Radiation Risk
Cucinotta, Francis A.
2011-01-01
Space radiation is comprised of high-energy and charge (HZE) nuclei and protons. The initial DNA damage from HZE nuclei is qualitatively different from X-rays or gamma rays due to the clustering of damage sites which increases their complexity. Clustering of DNA damage occurs on several scales. First there is clustering of single strand breaks (SSB), double strand breaks (DSB), and base damage within a few to several hundred base pairs (bp). A second form of damage clustering occurs on the scale of a few kbp where several DSB?s may be induced by single HZE nuclei. These forms of damage clusters do not occur at low to moderate doses of X-rays or gamma rays thus presenting new challenges to DNA repair systems. We review current knowledge of differences that occur in DNA repair pathways for different types of radiation and possible relationships to mutations, chromosomal aberrations and cancer risks.
DNA Charge Transport: From Chemical Principles to the Cell
Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.
2016-01-01
The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744
Prado, E A; Faivre-Rampant, P; Schneider, C; Darmency, M A
1996-10-01
Fluorescent in situ hybridization (FISH) was applied to related Populus species (2n = 19) in order to detect rDNA loci. An interspecific variability in the number of hybridization sites was revealed using as probe an homologous 25S clone from Populus deltoides. The application of image analysis methods to measure fluorescence intensity of the hybridization signals has enabled us to characterize major and minor loci in the 18S-5.8S-25S rDNA. We identified one pair of such rDNA clusters in Populus alba; two pairs, one major and one minor, in both Populus nigra and P. deltoides; and three pairs in Populus balsamifera, (two major and one minor) and Populus euroamericana (one major and two minor). FISH results are in agreement with those based on RFLP analysis. The pBG13 probe containing 5S sequence from flax detected two separate clusters corresponding to the two size classes of units that coexist within 5S rDNA of most Populus species. Key words : Populus spp., fluorescent in situ hybridization, FISH, rDNA variability, image analysis.
Physical signals for protein–DNA recognition
International Nuclear Information System (INIS)
Cao, Xiao-Qin; Zeng, Jia; Yan, Hong
2009-01-01
This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein–DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do
Transcription factors as readers and effectors of DNA methylation.
Zhu, Heng; Wang, Guohua; Qian, Jiang
2016-08-01
Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.
RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.
Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab
2012-01-01
RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.
Directory of Open Access Journals (Sweden)
Kristen K. Merritt
2014-10-01
Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Controlling charge current through a DNA based molecular transistor
Energy Technology Data Exchange (ETDEWEB)
Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.
2017-01-05
Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.
DNA-Based Enzyme Reactors and Systems
Directory of Open Access Journals (Sweden)
Veikko Linko
2016-07-01
Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.
Wang, Gongke; Wang, Shuangli; Yan, Changling; Bai, Guangyue; Liu, Yufang
2018-04-05
Despite their practical applications, Ag + ions are environmental pollutants and affect human health. So the effective detection methods of Ag + ions are imperative. Herein, we developed a simple, sensitive, selective, and cost-effective fluorescence polarization sensor for Ag + detection in aqueous solution using thiol-DNA-functionalized gold nanoparticles (AuNPs). In this sensing strategy, Ag + ions can specifically interact with a cytosine-cytosine (CC) mismatch in DNA duplexes and form stable metal-mediated cytosine-Ag + -cytosine (C-Ag + -C) base pairs. The formation of the C-Ag + -C complex results in evident changes in the molecular volume and fluorescence polarization signal. To achieve our aims, we prepared two complementary DNA strands containing C-base mismatches (probe A: 5'-SH-A 10 -TACCACTCCTCAC-3' and probe B: 5'-TCCTCACCAGTCCTA-FAM-3'). The stable hybridization between probe A and probe B occurs with the formation of the C-Ag + -C complex in the presence of Ag + ions, leading to obvious fluorescence quenching in comparison to the system without AuNP enhancement. The assay can be used to identify nanomolar levels of Ag + within 6 min at room temperature, and has extremely high specificity for Ag + , even in the presence of higher concentrations of interfering metal ions. Furthermore, the sensor was successfully applied to the detection of Ag + ions in environmental water samples and showed excellent selectivity and high sensitivity, implying its promising application in the future. Copyright © 2018 Elsevier B.V. All rights reserved.
DNA lability induced by nimustine and ramustine in rat glioma cells.
Mineura, K; Fushimi, S; Itoh, Y; Kowada, M
1988-01-01
The DNA labile sites induced by two nitrosoureas, nimustine (ACNU) and ramustine (MCNU) synthesised in Japan, have been examined in highly reiterated DNA sequences of rat glioma cells. Reiterated fragments of 167 and 203 base pairs (bp), obtained after Hind III and Hae III restriction endonuclease digestion of rat glioma cells DNA, were used as target DNA sequences to determine the labile sites. In vitro reaction with ACNU and MCNU resulted in scission products corresponding to the locations of guanine. Subsequent piperidine hydrolysis produced more frequent breaks of the phosphodiester bonds at guanine positions, thus forming alkali-labile sites. Images PMID:3236017
Methyl-Analyzer--whole genome DNA methylation profiling.
Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G
2011-08-15
Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.
Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L
2018-04-12
Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon
2015-01-01
Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Directory of Open Access Journals (Sweden)
Md. Mahbubur Rahman
2015-02-01
Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.
Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers
Directory of Open Access Journals (Sweden)
Liwu Zhang
2015-10-01
Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.
Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers
Institute of Scientific and Technical Information of China (English)
Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi
2015-01-01
Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.
Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes
Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji
2013-01-01
Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052
Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes
Directory of Open Access Journals (Sweden)
Yuji Miyahara
2013-02-01
Full Text Available Peptide nucleic acid (PNA has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.
Recent progress on DNA based walkers.
Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun
2015-08-01
DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.
Mapping of 34 minisatellite loci resolved by two-dimensional DNA typing
DEFF Research Database (Denmark)
Børglum, Anders; Nyegaard, Mette; Kvistgaard, AB
1997-01-01
Two-dimensional (2-D) DNA typing is based on electrophoretic separation of genomic DNA fragments in two dimensions according to independent criteria (size and base-pair sequence), followed by hybridization analysis using multilocus probes. The technique allows simultaneous visualization of several...... could be deduced, showing no evidence of clustering. In the analysis of spot patterns, use was made of a computerized image analysis system specifically designed for 2-D DNA typing. Since experimental variations between different separation patterns were automatically corrected for with this program......, rapid and reliable scorings could be obtained. The results presented demonstrate the availability of reliable genetic information throughout the 2-D separation pattern. Adding the use of semiautomated computerized pattern analysis, this study further substantiates the applicability of 2-D DNA typing...
Synthesis and NMR of {sup 15}N-labeled DNA fragments
Energy Technology Data Exchange (ETDEWEB)
Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)
1994-12-01
DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.
A model for the induction of DNA damages and their evolution into cell clonogenic inactivation
International Nuclear Information System (INIS)
Yamaguchi, Hiroshi; Ohara, Hiroshi; Waker, A.J.
2006-01-01
The dependence of the initial production of DNA damages on radiation quality was examined by using a proposed new model on the basis of target theory. For the estimation of DNA damage-production by different radiation qualities, five possible modes of radiation action, including both direct and indirect effects, were assumed inside a target the molecular structure of which was defined to consist of 10 base-pairs of DNA surrounded by water molecules. The induction of DNA damage was modeled on the basis of comparisons between the primary ionization mean free path and the distance between pairs of ionized atoms, such distance being characteristic on the mode of radiation action. The OH radicals per average energy to produce an ion pair on the nanosecond time scale was estimated and used for indirect action. Assuming a relation between estimated yields of DNA damages and experimental inactivation cross sections for AT-cells, the present model enabled the quantitative reproduction of experimental results for AT-cell killing under aerobic or hypoxic conditions. The results suggest a higher order organization of DNA in a way that there will be at least two types of water environment, one filling half the space surrounding DNA with a depth of 3.7-4.3 nm and the other filling all space with a depth 4.6-4.9 nm. (author)
Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...
Indian Academy of Sciences (India)
The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...
Energy Technology Data Exchange (ETDEWEB)
Vadhavkar, Nikhil [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Pham, Christopher [University of Texas, Houston, TX (United States). MD Anderson Cancer Center; Georgescu, Walter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Deschamps, Thomas [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Heuskin, Anne-Catherine [Univ. of Namur (Belgium). Namur Research inst. for Life Sciences (NARILIS), Research Center for the Physics of Matter and Radiation (PMR); Tang, Jonathan [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Costes, Sylvain V. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.
2014-09-01
In contrast to the classic view of static DNA double-strand breaks (DSBs) being repaired at the site of damage, we hypothesize that DSBs move and merge with each other over large distances (m). As X-ray dose increases, the probability of having DSB clusters increases as does the probability of misrepair and cell death. Experimental work characterizing the X-ray dose dependence of radiation-induced foci (RIF) in nonmalignant human mammary epithelial cells (MCF10A) is used here to validate a DSB clustering model. We then use the principles of the local effect model (LEM) to predict the yield of DSBs at the submicron level. Two mechanisms for DSB clustering, namely random coalescence of DSBs versus active movement of DSBs into repair domains are compared and tested. Simulations that best predicted both RIF dose dependence and cell survival after X-ray irradiation favored the repair domain hypothesis, suggesting the nucleus is divided into an array of regularly spaced repair domains of ~;;1.55 m sides. Applying the same approach to high-linear energy transfer (LET) ion tracks, we are able to predict experimental RIF/m along tracks with an overall relative error of 12percent, for LET ranging between 30 350 keV/m and for three different ions. Finally, cell death was predicted by assuming an exponential dependence on the total number of DSBs and of all possible combinations of paired DSBs within each simulated RIF. Relative biological effectiveness (RBE) predictions for cell survival of MCF10A exposed to high-LET showed an LET dependence that matches previous experimental results for similar cell types. Overall, this work suggests that microdosimetric properties of ion tracks at the submicron level are sufficient to explain both RIF data and survival curves for any LET, similarly to the LEM assumption. Conversely, high-LET death mechanism does not have to infer linear-quadratic dose formalism as done in the LEM. In addition, the size of repair domains derived in our model
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
Ford, K G; Neidle, S
1995-06-01
The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.
Chou, Y. C.
2018-04-01
The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.
Comparison of Suitability of the Most Common Ancient DNA Quantification Methods.
Brzobohatá, Kristýna; Drozdová, Eva; Smutný, Jiří; Zeman, Tomáš; Beňuš, Radoslav
2017-04-01
Ancient DNA (aDNA) extracted from historical bones is damaged and fragmented into short segments, present in low quantity, and usually copurified with microbial DNA. A wide range of DNA quantification methods are available. The aim of this study was to compare the five most common DNA quantification methods for aDNA. Quantification methods were tested on DNA extracted from skeletal material originating from an early medieval burial site. The tested methods included ultraviolet (UV) absorbance, real-time quantitative polymerase chain reaction (qPCR) based on SYBR ® green detection, real-time qPCR based on a forensic kit, quantification via fluorescent dyes bonded to DNA, and fragmentary analysis. Differences between groups were tested using a paired t-test. Methods that measure total DNA present in the sample (NanoDrop ™ UV spectrophotometer and Qubit ® fluorometer) showed the highest concentrations. Methods based on real-time qPCR underestimated the quantity of aDNA. The most accurate method of aDNA quantification was fragmentary analysis, which also allows DNA quantification of the desired length and is not affected by PCR inhibitors. Methods based on the quantification of the total amount of DNA in samples are unsuitable for ancient samples as they overestimate the amount of DNA presumably due to the presence of microbial DNA. Real-time qPCR methods give undervalued results due to DNA damage and the presence of PCR inhibitors. DNA quantification methods based on fragment analysis show not only the quantity of DNA but also fragment length.
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
Structural basis for sequence-specific recognition of DNA by TAL effectors
Deng, Dong
2012-01-05
TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13. Here, we report the crystal structures of an 11.5-repeat TAL effector in both DNA-free and DNA-bound states. Each TAL repeat comprises two helices connected by a short RVD-containing loop. The 11.5 repeats form a right-handed, superhelical structure that tracks along the sense strand of DNA duplex, with RVDs contacting the major groove. The 12th residue stabilizes the RVD loop, whereas the 13th residue makes a base-specific contact. Understanding DNA recognition by TAL effectors may facilitate rational design of DNA-binding proteins with biotechnological applications.
Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.
Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun
2018-04-04
Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery. Expected final online publication date for the Annual Review of Biomedical Engineering Volume 20 is June 4, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.
2015-01-01
The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855
Nucleic acid nanomaterials: Silver-wired DNA
Auffinger, Pascal; Ennifar, Eric
2017-10-01
DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.
Replicative DNA polymerase mutations in cancer☆
Heitzer, Ellen; Tomlinson, Ian
2014-01-01
Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393
Blood extracellular DNA after irradiation
International Nuclear Information System (INIS)
Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.
1993-01-01
It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action
DNA-based random number generation in security circuitry.
Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C
2010-06-01
DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.
Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor
International Nuclear Information System (INIS)
Pohlmann, R.; Nagel, G.; Schmidt, B.
1987-01-01
Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12
An entropy-based improved k-top scoring pairs (TSP) method for ...
African Journals Online (AJOL)
An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...
No evidence of extra-pair paternity in a colonial seabird, the common tern (Sterna hirundo)
DEFF Research Database (Denmark)
Griggio, M.; Matessi, Giuliano; Marin, G.
2004-01-01
The incidence of extra-pair paternity and egg dumping was investigated in a colony of common terns (Sterna hirundo), a colonial seabird, in the Venetian lagoon. Ten families were sampled and multilocus DNA fingerprinting analysis was performed. No indication of extra-pair paternity or egg dumping...... was found in any of the families. The results are discussed in the light of life-history strategies, the benefits of coloniality and the evolution of adoption behaviour in the species.......The incidence of extra-pair paternity and egg dumping was investigated in a colony of common terns (Sterna hirundo), a colonial seabird, in the Venetian lagoon. Ten families were sampled and multilocus DNA fingerprinting analysis was performed. No indication of extra-pair paternity or egg dumping...
Gao, Jing; Wang, Haixing; Zang, Wanchun; Li, Beifang; Rao, Guanhua; Li, Lei; Yu, Yang; Li, Zhongwu; Dong, Bin; Lu, Zhihao; Jiang, Zhi; Shen, Lin
2017-09-01
Overcoming tumor heterogeneity is a major challenge for personalized treatment of gastric cancer, especially for human epidermal growth factor receptor-2 targeted therapy. Analysis of circulating tumor DNA allows a more comprehensive analysis of tumor heterogeneity than traditional biopsies in lung cancer and breast cancer, but little is known in gastric cancer. We assessed mutation profiles of ctDNA and primary tumors from 30 patients with advanced gastric cancer, then performed a comprehensive analysis of tumor mutations by multiple biopsies from five patients, and finally analyzed the concordance of HER2 amplification in ctDNA and paired tumor tissues in 70 patients. By comparing with a single tumor sample, ctDNA displayed a low concordance of mutation profile, only approximately 50% (138/275) somatic mutations were found in paired tissue samples, however, when compared with multiple biopsies, most DNA mutations in ctDNA were also shown in paired tumor tissues. ctDNA had a high concordance (91.4%, Kappa index = 0.784, P < 0.001) of HER2 amplification with tumor tissues, suggesting it might be an alternative for tissue. It implied that ctDNA-based assessment could partially overcome the tumor heterogeneity, and might serve as a potential surrogate for HER2 analysis in gastric cancer. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Taylor, Rhys Dylan; Asamitsu, Sefan; Takenaka, Tomohiro; Yamamoto, Makoto; Hashiya, Kaori; Kawamoto, Yusuke; Bando, Toshikazu; Nagase, Hiroki; Sugiyama, Hiroshi
2014-01-27
Hairpin N-methylpyrrole-N-methylimidazole polyamide seco-CBI conjugates 2-6 were designed for synthesis by Fmoc solid-phase synthesis, and their DNA-alkylating activities against the Kras codon 13 mutation were compared by high-resolution denaturing gel electrophoresis with 225 base pair (bp) DNA fragments. Conjugate 5 had high reactivity towards the Kras codon 13 mutation site, with alkylation occurring at the A of the sequence 5'-ACGTCACCA-3' (site 2), including minor 1 bp-mismatch alkylation against wild type 5'-ACGCCACCA-3' (site 3). Conjugate 6, which differs from conjugate 5 by exchanging one Py unit with a β unit, showed high selectivity but only weakly alkylated the A of 5'-ACGTCACCA-3' (site 2). The hairpin polyamide seco-CBI conjugate 5 thus alkylates according to Dervan's pairing rule with the pairing recognition which β/β pair targets T-A and A-T pairs. SPR and a computer-minimized model suggest that 5 binds to the target sequence with high affinity in a hairpin conformation, allowing for efficient DNA alkylation. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mapping Base Modifications in DNA by Transverse-Current Sequencing
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2018-02-01
Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.
Watson-Crick hydrogen bonds : Nature and role in DNA replication
Guerra, Célia Fonseca; Bickelhaupt, F. Matthias
2006-01-01
The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of
Antioxidant effect of naturally occurring xanthines on the oxidative damage of DNA bases
International Nuclear Information System (INIS)
Vieira, A.J.S.C.; Telo, J.P.; Pereira, H.F.; Patrocinio, P.F.; Dias, R.M.B.
1999-01-01
The repair of the oxidised radicals of adenine and guanosine by several naturally occurring xanthines was studied. Each pair of DNA purine/xanthine was made to react with the sulphate radical and the decrease of the concentration of both compounds was measured by HPLC as a function of irradiation time. The results show that xanthine efficiently prevents the oxidation of the two DNA purines. Theophylline and para-xanthine repair the oxidizes radical of adenine but not the one from guanosine. Theobromine and caffeine to do not show any protecting effect. An order of the oxidation potentials of all the purines studied is proposed. (authors)
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The impact of base stacking on the conformations and electrostatics of single-stranded DNA.
Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois
2017-04-20
Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-10-30
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Substituent Effects on Hydrogen Bonds in DNA : A Kohn-Sham DFT Approach
Guerra, Célia Fonseca; Bickelhaupt, F. Matthias
2006-01-01
In this Chapter, we discuss how the hydrogen bonds in Watson-Crick base pairs can be tuned both structurally and in terms of bond strength by exposing the DNA bases to different kinds of substitutions: (1) substitution in the X-H Y hydrogen bonding moiety, (2) remote substitution, i.e., introducing
Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom
2017-01-01
DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.
G-Quadruplexes in DNA Replication: A Problem or a Necessity?
Valton, Anne-Laure; Prioleau, Marie-Noëlle
2016-11-01
DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.
Analytical Devices Based on Direct Synthesis of DNA on Paper.
Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M
2016-01-05
This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.
Molecular cloning and nucleotide sequence of cDNA for human liver arginase
International Nuclear Information System (INIS)
Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.
1987-01-01
Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes
An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation.
Directory of Open Access Journals (Sweden)
Ke Shi
Full Text Available Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting-rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions.
Study of force induced melting of dsDNA as a function of length and conformation
International Nuclear Information System (INIS)
Danilowicz, Claudia; Hatch, Kristi; Conover, Alyson; Gunaratne, Ruwan; Coljee, Vincent; Prentiss, Mara; Ducas, Theodore
2010-01-01
We measure the constant force required to melt double-stranded (ds) DNA as a function of length for lengths from 12 to 100 000 base pairs, where the force is applied to the 3'3' or 5'5' ends of the dsDNA. Molecules with 32 base pairs or fewer melt before overstretching. For these short molecules, the melting force is independent of the ends to which the force is applied and the shear force as a function of length is well described by de Gennes theory with a de Gennes length of less than 10 bp. Molecules with lengths of 500 base pairs or more overstretch before melting. For these long molecules, the melting force depends on the ends to which the force is applied. The melting force as a function of length increases even when the length exceeds 1000 bp, where the length dependence is inconsistent with de Gennes theory. Finally, we expand de Gennes melting theory to 3'5' pulling and compare the predictions with experimental results.
International Nuclear Information System (INIS)
D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.
1988-01-01
cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus
Effects of sequence on DNA wrapping around histones
Ortiz, Vanessa
2011-03-01
A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).