Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

Science.gov (United States)

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

DNA electronic circular dichroism on the inter-base pair scale

DEFF Research Database (Denmark)

Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

2015-01-01

A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

Directory of Open Access Journals (Sweden)

Shu-ichi Nakano

2014-08-01

Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

International Nuclear Information System (INIS)

Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

2012-01-01

We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

2012-11-01

8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

International Nuclear Information System (INIS)

Swasey, Steven M; Gwinn, Elisabeth G

2016-01-01

The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

Science.gov (United States)

Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

2012-11-01

Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

Directory of Open Access Journals (Sweden)

Mudasir Mudasir

2010-06-01

Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

Science.gov (United States)

Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

2013-01-01

Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

Science.gov (United States)

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

Science.gov (United States)

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

Czech Academy of Sciences Publication Activity Database

Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

2012-01-01

Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

International Nuclear Information System (INIS)

Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

2012-01-01

Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Leszczynski, J.

2001-01-01

Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

Science.gov (United States)

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

International Nuclear Information System (INIS)

Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

1995-01-01

For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

International Nuclear Information System (INIS)

Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

2015-01-01

Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

Directory of Open Access Journals (Sweden)

Alexandra Peacock-Villada

Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

Science.gov (United States)

Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

2017-11-02

In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

Science.gov (United States)

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

Science.gov (United States)

Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

2013-10-01

A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

OpenAIRE

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

International Nuclear Information System (INIS)

Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

2003-01-01

Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

Czech Academy of Sciences Publication Activity Database

Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

2002-01-01

Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

Science.gov (United States)

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

Science.gov (United States)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

Directory of Open Access Journals (Sweden)

Ol'ha O. Brovarets'

2018-02-01

Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

Directory of Open Access Journals (Sweden)

Aleksandra Delplanque

Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

Science.gov (United States)

Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

2015-01-01

Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

Science.gov (United States)

Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

A novel pseudo-complementary PNA G-C base pair

DEFF Research Database (Denmark)

Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

2011-01-01

Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

International Nuclear Information System (INIS)

Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

2009-01-01

The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

Directory of Open Access Journals (Sweden)

Hsin-Ming Liu

2012-08-01

Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport through DNA based electronic barriers

Science.gov (United States)

Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

2018-05-01

We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

Science.gov (United States)

Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

2012-02-01

The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

Energy Technology Data Exchange (ETDEWEB)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

2016-04-19

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

Science.gov (United States)

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

KAUST Repository

Chawla, Mohit

2018-01-02

The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

Science.gov (United States)

Mondal Roy, Sutapa

2018-08-01

The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

Science.gov (United States)

Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

2003-01-01

A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

International Nuclear Information System (INIS)

Straehle, U.; Klock, G.; Schuetz, G.

1987-01-01

To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

Science.gov (United States)

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

International Nuclear Information System (INIS)

Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.

2007-01-01

M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

Science.gov (United States)

Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

Science.gov (United States)

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

KAUST Repository

Wong, Ka-Chun; Li, Yue; Peng, Chengbin

2015-01-01

Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

KAUST Repository

Wong, Ka-Chun

2015-09-27

Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

Science.gov (United States)

Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

2015-03-01

We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

Science.gov (United States)

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

Directory of Open Access Journals (Sweden)

Camila Ximenes

2014-12-01

Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

A rule of seven in Watson-Crick base-pairing of mismatched sequences.

Science.gov (United States)

Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

2012-05-13

Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

Science.gov (United States)

Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

2018-01-01

Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

Science.gov (United States)

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

Photochemical selectivity in guanine-cytosine base-pair structures

Czech Academy of Sciences Publication Activity Database

Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

2005-01-01

Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

Science.gov (United States)

Hirao, Ichiro; Kimoto, Michiko

2012-01-01

Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

Science.gov (United States)

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

Science.gov (United States)

Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

2014-01-25

Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

A universal DNA-based protein detection system.

Science.gov (United States)

Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

2013-09-25

Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

Studies of base pair sequence effects on DNA solvation based on all

Indian Academy of Sciences (India)

Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

Science.gov (United States)

Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

2015-12-01

Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

International Nuclear Information System (INIS)

Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

2000-01-01

This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

Science.gov (United States)

Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

2014-01-01

DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

International Nuclear Information System (INIS)

Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

1991-01-01

Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

NARCIS (Netherlands)

Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

2000-01-01

Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

DNA-Mediated Electrochemistry

Science.gov (United States)

Gorodetsky, Alon A.; Buzzeo, Marisa C.

2009-01-01

The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

Science.gov (United States)

Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

2017-04-03

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

Report on Pairing-based Cryptography.

Science.gov (United States)

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

[Single-molecule detection and characterization of DNA replication based on DNA origami].

Science.gov (United States)

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

OpenAIRE

Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

2012-01-01

We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

DNA nanostructure-based drug delivery nanosystems in cancer therapy.

Science.gov (United States)

Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

2017-11-25

DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

Energy Technology Data Exchange (ETDEWEB)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

2016-02-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

International Nuclear Information System (INIS)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

2016-01-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

A Constant Rate of Spontaneous Mutation in DNA-Based Microbes

Science.gov (United States)

Drake, John W.

1991-08-01

In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

Directory of Open Access Journals (Sweden)

Michael F Sloma

2017-11-01

Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

Science.gov (United States)

Sloma, Michael F; Mathews, David H

2017-11-01

Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

International Nuclear Information System (INIS)

Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

1988-01-01

High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element.

Science.gov (United States)

Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf

2014-10-01

Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit.

Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element

Science.gov (United States)

Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R.; Jauch, Ralf

2014-01-01

Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6–DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939

Electronic properties and assambly of DNA-based molecules on gold surfaces

DEFF Research Database (Denmark)

Salvatore, Princia

, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

Science.gov (United States)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

How stable are the mutagenic tautomers of DNA bases?

Directory of Open Access Journals (Sweden)

Brovarets’ O. O.

2010-02-01

Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

International Nuclear Information System (INIS)

Li, Ying; Wilson, W.D.; Zon, G.

1991-01-01

1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

Low frequency of extra-pair fertilizations in the Great Tit Parus major revealed by DNA fingerprinting

NARCIS (Netherlands)

Verboven, N.; Mateman, A.C.

1997-01-01

Multilocus DNA fingerprinting was used to estimate the frequency of extra-pair fertilizations in a low density, island population of Great Tits Parus major. A total of 69 pairs and 516 offspring from 82 breeding attempts were examined. Only 18 offspring (3.5%) in seven different nests were not

AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

International Nuclear Information System (INIS)

Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

2005-01-01

The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

DNA based methods used for characterization and detection of food ...

African Journals Online (AJOL)

Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

Science.gov (United States)

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Insights into the Structures of DNA Damaged by Hydroxyl Radical: Crystal Structures of DNA Duplexes Containing 5-Formyluracil

Directory of Open Access Journals (Sweden)

Masaru Tsunoda

2010-01-01

Full Text Available Hydroxyl radicals are potent mutagens that attack DNA to form various base and ribose derivatives. One of the major damaged thymine derivatives is 5-formyluracil (fU, which induces pyrimidine transition during replication. In order to establish the structural basis for such mutagenesis, the crystal structures of two kinds of DNA d(CGCGRATfUCGCG with R = A/G have been determined by X-ray crystallography. The fU residues form a Watson-Crick-type pair with A and two types of pairs (wobble and reversed wobble with G, the latter being a new type of base pair between ionized thymine base and guanine base. In silico structural modeling suggests that the DNA polymerase can accept the reversed wobble pair with G, as well as the Watson-Crick pair with A.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Processing of free radical damaged DNA bases

International Nuclear Information System (INIS)

Wallace, S.

2003-01-01

Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

Science.gov (United States)

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Triple-helix molecular switch-based aptasensors and DNA sensors.

Science.gov (United States)

Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

2018-07-15

Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Radiation-induced electron migration along DNA

International Nuclear Information System (INIS)

Fuciarelli, A.F.; Sisk, E.C.; Miller, J.H.; Zimbrick, J.D.

1994-04-01

Radiation-induced electron migration along DNA is a mechanism by which randomly produced stochastic energy deposition events can lead to nonrandom types of damage along DNA manifested distal to the sites of the initial energy deposition. Electron migration along DNA is significantly influenced by the DNA base sequence and DNA conformation. Migration along 7 base pairs in oligonucleotides containing guanine bases was observed for oligonucleotides irradiated in solution which compares to average migration distances of 6 to 10 bases for Escherichia coli DNA irradiated in solution and 5.5 base pairs for Escherichia coli DNA irradiated in cells. Evidence also suggests that electron migration can occur preferentially in the 5' to 3' direction along DNA. Our continued efforts will provide information regarding the contribution of electron transfer along DNA to formation of locally multiply damaged sites created in DNA by exposure to ionizing radiation

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Radical-pair based avian magnetoreception

Science.gov (United States)

Procopio, Maria; Ritz, Thorsten

2014-03-01

Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

Branched DNA nanostructures efficiently stabilised and monitored by novel pyrene-perylene 2'-α-l-amino-LNA FRET pairs

DEFF Research Database (Denmark)

Astakhova, I Kira; Santhosh Kumar, T; Campbell, Meghan A

2013-01-01

Novel pyrene-perylene α-l-LNA FRET pairs described herein effectively detect assembly of 2- and 3-way branched DNA nanostructures prepared by postsynthetic microwave-assisted CuAAC click chemistry. The fluorescent signalling of assembly by internally positioned FRET pairs is achieved with low...

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

DEFF Research Database (Denmark)

Svendsen, Anders J; Gervin, Kristina; Lyle, Robert

2016-01-01

: Smoking was significantly associated with hypomethylation of a DMR overlapping the promoter region of the RNF5 and the AGPAT1, which are implicated in inflammation and autoimmunity, whereas DMARD treatment induced hypermethylation of the same region. Additionally, the promotor region of both S100A6......OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

Science.gov (United States)

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

Science.gov (United States)

Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

2012-09-12

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

Science.gov (United States)

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

Science.gov (United States)

Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

2006-03-01

Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

Science.gov (United States)

Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

2016-07-15

A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

Science.gov (United States)

Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

2012-06-18

In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

Science.gov (United States)

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Modeling DNA

Science.gov (United States)

Robertson, Carol

2016-01-01

Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

Science.gov (United States)

Moktan, Hem; Pezza, Roberto; Zhou, Donghua

2015-03-01

The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

International Nuclear Information System (INIS)

Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

2010-01-01

2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage

Science.gov (United States)

Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan

2012-01-01

ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

Science.gov (United States)

Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

2012-01-01

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

An effective approach for identification of in vivo protein-DNA binding sites from paired-end ChIP-Seq data

Directory of Open Access Journals (Sweden)

Wilson Zoe A

2010-02-01

Full Text Available Abstract Background ChIP-Seq, which combines chromatin immunoprecipitation (ChIP with high-throughput massively parallel sequencing, is increasingly being used for identification of protein-DNA interactions in vivo in the genome. However, to maximize the effectiveness of data analysis of such sequences requires the development of new algorithms that are able to accurately predict DNA-protein binding sites. Results Here, we present SIPeS (Site Identification from Paired-end Sequencing, a novel algorithm for precise identification of binding sites from short reads generated by paired-end solexa ChIP-Seq technology. In this paper we used ChIP-Seq data from the Arabidopsis basic helix-loop-helix transcription factor ABORTED MICROSPORES (AMS, which is expressed within the anther during pollen development, the results show that SIPeS has better resolution for binding site identification compared to two existing ChIP-Seq peak detection algorithms, Cisgenome and MACS. Conclusions When compared to Cisgenome and MACS, SIPeS shows better resolution for binding site discovery. Moreover, SIPeS is designed to calculate the mappable genome length accurately with the fragment length based on the paired-end reads. Dynamic baselines are also employed to effectively discriminate closely adjacent binding sites, for effective binding sites discovery, which is of particular value when working with high-density genomes.

High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

Science.gov (United States)

Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

2003-01-01

We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

International Nuclear Information System (INIS)

Lau How Mooi

1998-01-01

Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs

International Nuclear Information System (INIS)

Yang, Mengsi; Jin, Jianhua; Xu, Guiqing; Cui, Fengling; Luo, Hongxia

2014-01-01

Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

Science.gov (United States)

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

Directory of Open Access Journals (Sweden)

Rie Kawai

2012-03-01

Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

Hyperstretching DNA

NARCIS (Netherlands)

Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

2017-01-01

The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

International Nuclear Information System (INIS)

Cortini, Ruggero; Cheng, Xiaolin

2017-01-01

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order of 1k B T. Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.

Quantum entanglement and quantum information in biological systems (DNA)

Science.gov (United States)

Hubač, Ivan; Švec, Miloslav; Wilson, Stephen

2017-12-01

Recent studies of DNA show that the hydrogen bonds between given base pairs can be treated as diabatic systems with spin-orbit coupling. For solid state systems strong diabaticity and spin-orbit coupling the possibility of forming Majorana fermions has been discussed. We analyze the hydrogen bonds in the base pairs in DNA from this perspective. Our analysis is based on a quasiparticle supersymmetric transformation which couples electronic and vibrational motion and includes normal coordinates and the corresponding momenta. We define qubits formed by Majorana fermions in the hydrogen bonds and also discuss the entangled states in base pairs. Quantum information and quantum entropy are introduced. In addition to the well-known classical information connected with the DNA base pairs, we also consider quantum information and show that the classical and quantum information are closely connected.

Sequence specific electronic conduction through polyion-stabilized double-stranded DNA in nanoscale break junctions

International Nuclear Information System (INIS)

Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B

2007-01-01

This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection

Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase

International Nuclear Information System (INIS)

Heller, E.P.; Goldthwait, D.A.

1983-01-01

Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair

Ten helical twist angles of B-DNA

Energy Technology Data Exchange (ETDEWEB)

Kabsch, W; Sander, C; Trifonov, E N

1982-01-01

On the assumption that the twist angles between adjacent base-pairs in the DNA molecule are additive a linear system of 40 equations was derived from experimental measurements of the total twist angles for different pieces of DNA of known sequences. This system of equations is found to be statistically consistent providing a solution for all ten possible twist angles of B-DNA by a least squares fitting procedure. Four of the calculated twist angles were not known before. The other six twist angles calculated are very close to the experimentally measured ones. The data used were obtained by the electrophoretic band-shift method, crystallography and nuclease digestion of DNA adsorbed to mica or Ca-phosphate surface. The validity of the principle of additivity of the twist angles implies that the angle between any particular two base-pairs is a function of only these base-pairs, independent of nearest neighbors.

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data

Science.gov (United States)

Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.

2013-01-01

SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).

SSR_pipeline: a bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data.

Science.gov (United States)

Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M

2013-01-01

SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).

DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

Science.gov (United States)

Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

2014-10-15

An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.

A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1

International Nuclear Information System (INIS)

Sebastian, J.; Sancar, G.B.

1991-01-01

The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription

A dynamic bead-based microarray for parallel DNA detection

International Nuclear Information System (INIS)

Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P

2011-01-01

A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

Science.gov (United States)

Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

2013-02-12

We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.

Science.gov (United States)

Ensslen, Philipp; Wagenknecht, Hans-Achim

2015-10-20

modifications in a row. A logical alternative approach is to leave out the phosphodiester bridges between the chromophores and let chromophore-nucleoside conjugates self-assemble specifically along single stranded DNA as template. The self-organization of chromophores along the DNA template based on canonical base pairing would be advantageous because sequence selective base pairing could provide a structural basis for programmed complexity within the chromophore assembly. The self-assembly is governed by two interactions. The chromophore-nucleoside conjugates as guest molecules are recognized via hydrogen bonds to the corresponding counter bases in the single stranded DNA template. Moreover, the π-π interactions between the stacked chromophores stabilize these self-assembled constructs with increasing length. Longer DNA templates are more attractive for self-assembled antenna. The helicity in the stack of porphyrins as guest molecules assembled on the DNA template can be switched by environmental changes, such as pH variations. DNA-templated stacks of ethynyl pyrene and nile red exhibit left-handed chirality, which stands in contrast to similar covalent multichromophore-DNA conjugates with enforced right-handed helicity. With ethynyl nile red, it is possible to occupy every available binding site on the templates. Mixed assemblies of ethynyl pyrene and nile red show energy transfer and thereby provide a proof-of-principle that simple light-harvesting antennae can be obtained in a noncovalent and self-assembled fashion. With respect to the next important step, chemical storage of the absorbed light energy, future research has to focus on the coupling of sophisticated DNA-based light-harvesting antenna to reaction centers.

Solution-based targeted genomic enrichment for precious DNA samples

Directory of Open Access Journals (Sweden)

Shearer Aiden

2012-05-01

Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

Science.gov (United States)

Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

2016-03-15

In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

Theoretical study of GC+/GC base pair derivatives

International Nuclear Information System (INIS)

Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

2005-01-01

The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

Theoretical analysis of noncanonical base pairing interactions in ...

Indian Academy of Sciences (India)

PRAKASH KUMAR

Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

DNA base sequence changes induced by ultraviolet light mutagenesis of a gene on a chromosome in Chinese hamster ovary cells

Energy Technology Data Exchange (ETDEWEB)

Romac, S; Leong, P; Sockett, H; Hutchinson, F [Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry

1989-09-20

The DNA base sequence changes induced by mutagenesis with ultraviolet light have been determined in a gene on a chromosome of cultured Chinese hamster ovary (CHO) cells. The gene was the Excherichia coli gpt gene, of which a single copy was stably incorporated and expressed in the CHO cell genome. The cells were irradiated with ultraviolet light and gpt{sup -} colonies were selected by resistance to 6-thioguanine. The gpt gene was amplified from chromosomal DNA by use of the polymerase chain reaction (PCR) and the amplified DNA sequenced directly by the dideoxy method. Of the 58 sequenced mutants of independent origin 53 were base change mutations. Forty-one base substitutions were single base changes, ten had two adjacent (or tandem) base changes, and one had two base changes separated by a single base-pair. Only one mutant had a multiple base change mutation with two or more well separated base changes. In contrast much higher levels of such mutations were reported in ultraviolet mutagenesis of genes on a shuttle vector in primate cells. Two deletions of a single base-pair were observed and three deletions ranging from 6 to 37 base-pairs. The mutation spectrum in the gpt gene had similarities to the ultraviolet mutation spectra for several genes in prokaryotes, which suggests similarities in mutational mechanisms in prokaryotes and eukaryotes. (author).

Structure of a stacked anthraquinone–DNA complex

Science.gov (United States)

De Luchi, Daniela; Usón, Isabel; Wright, Glenford; Gouyette, Catherine; Subirana, Juan A.

2010-01-01

The crystal structure of the telomeric sequence d(UBrAGG) interacting with an anthraquinone derivative has been solved by MAD. In all previously studied complexes of intercalating drugs, the drug is usually sandwiched between two DNA base pairs. Instead, the present structure looks like a crystal of stacked anthraquinone molecules in which isolated base pairs are intercalated. Unusual base pairs are present in the structure, such as G·G and A·UBr reverse Watson–Crick base pairs. PMID:20823516

Sequence-dependent DNA deformability studied using molecular dynamics simulations.

Science.gov (United States)

Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

2007-01-01

Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

Directory of Open Access Journals (Sweden)

Marx Kenneth A

2006-03-01

Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

Changes in DNA base sequence induced by gamma-ray mutagenesis of lambda phage and prophage

Energy Technology Data Exchange (ETDEWEB)

Tindall, K.R.; Stein, J.; Hutchinson, F.

1988-04-01

Mutations in the cI (repressor) gene were induced by gamma-ray irradiation of lambda phage and of prophage, and 121 mutations were sequenced. Two-thirds of the mutations in irradiated phage assayed in recA host cells (no induction of the SOS response) were G:C to A:T transitions; it is hypothesized that these may arise during DNA replication from adenine mispairing with a cytosine product deaminated by irradiation. For irradiated phage assayed in host cells in which the SOS response had been induced, 85% of the mutations were base substitutions, and in 40 of the 41 base changes, a preexisting base pair had been replaced by an A:T pair; these might come from damaged bases acting as AP (apurinic or apyrimidinic) sites. The remaining mutations were 1 and 2 base deletions. In irradiated prophage, base change mutations involved the substitution of both A:T and of G:C pairs for the preexisting pairs; the substitution of G:C pairs shows that some base substitution mechanism acts on the cell genome but not on the phage. In the irradiated prophage, frameshifts and a significant number of gross rearrangements were also found.

Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.

OpenAIRE

Noll, W W; Collins, M

1987-01-01

Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

Crystallographic study of one turn of G/C-rich B-DNA.

Science.gov (United States)

Heinemann, U; Alings, C

1989-11-20

The DNA decamer d(CCAGGCCTGG) has been studied by X-ray crystallography. At a nominal resolution of 1.6 A, the structure was refined to R = 16.9% using stereochemical restraints. The oligodeoxyribonucleotide forms a straight B-DNA double helix with crystallographic dyad symmetry and ten base-pairs per turn. In the crystal lattice, DNA fragments stack end-to-end along the c-axis to form continuous double helices. The overall helical structure and, notably, the groove dimensions of the decamer are more similar to standard, fiber diffraction-determined B-DNA than A-tract DNA. A unique stacking geometry is observed at the CA/TG base-pair step, where an increased rotation about the helix axis and a sliding motion of the base-pairs along their long axes leads to a superposition of the base rings with neighboring carbonyl and amino functions. Three-center (bifurcated) hydrogen bonds are possible at the CC/GG base-pair steps of the decamer. In their common sequence elements, d(CCAGGCCTGG) and the related G.A mismatch decamer d(CCAAGATTGG) show very similar three-dimensional structures, except that d(CCAGGCCTGG) appears to have a less regularly hydrated minor groove. The paucity of minor groove hydration in the center of the decamer may be a general feature of G/C-rich DNA and explain its relative instability in the B-form of DNA.

Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

International Nuclear Information System (INIS)

Noll, W.W.; Collins, M.

1987-01-01

Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases

Pairing of heterochromatin in response to cellular stress

International Nuclear Information System (INIS)

Abdel-Halim, H.I.; Mullenders, L.H.F.; Boei, J.J.W.A.

2006-01-01

We previously reported that exposure of human cells to DNA-damaging agents (X-rays and mitomycin C (MMC)) induces pairing of the homologous paracentromeric heterochromatin of chromosome 9 (9q12-13). Here, we show that UV irradiation and also heat shock treatment of human cells lead to similar effects. Since the various agents induce very different types and frequencies of damage to cellular constituents, the data suggest a general stress response as the underlying mechanism. Moreover, local UV irradiation experiments revealed that pairing of heterochromatin is an event that can be triggered without induction of DNA damage in the heterochromatic sequences. The repair deficient xeroderma pigmentosum cells (group F) previously shown to fail pairing after MMC displayed elevated pairing after heat shock treatment but not after UV exposure. Taken together, the present results indicate that pairing of heterochromatin following exposure to DNA-damaging agents is initiated by a general stress response and that the sensing of stress or the maintenance of the paired status of the heterochromatin might be dependent on DNA repair

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

Science.gov (United States)

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Force induced DNA melting

International Nuclear Information System (INIS)

Santosh, Mogurampelly; Maiti, Prabal K

2009-01-01

When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to this highly overstretched form of DNA is very cooperative. Applying a force perpendicular to the DNA axis (unzipping), double-strand DNA can also be separated into two single-stranded DNA, this being a fundamental process in DNA replication. We study the DNA overstretching and unzipping transition using fully atomistic molecular dynamics (MD) simulations and argue that the conformational changes of double-strand DNA associated with either of the above mentioned processes can be viewed as force induced DNA melting. As the force at one end of the DNA is increased the DNA starts melting abruptly/smoothly above a critical force depending on the pulling direction. The critical force f m , at which DNA melts completely decreases as the temperature of the system is increased. The melting force in the case of unzipping is smaller compared to the melting force when the DNA is pulled along the helical axis. In the case of melting through unzipping, the double-strand separation has jumps which correspond to the different energy minima arising due to sequence of different base pairs. The fraction of Watson-Crick base pair hydrogen bond breaking as a function of force does not show smooth and continuous behavior and consists of plateaus followed by sharp jumps.

Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

Science.gov (United States)

Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

2015-05-26

DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.

Science.gov (United States)

Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin

2015-01-01

Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes. © 2014 Wiley Periodicals, Inc.

The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

Czech Academy of Sciences Publication Activity Database

Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

2016-01-01

Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

Science.gov (United States)

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-01-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

Simulation of 125I-induced DNA strand breaks in a CAP-DNA complex

International Nuclear Information System (INIS)

Li, W.; Friedland, W.; Jacob, P.

2000-01-01

DNA strand breakage induced by decay of 125 I incorporated into the pyrimidine of a small piece of DNA with a specific base pair sequence has been investigated theoretically and experimentally (Lobachevsky and Martin 2000a, 2000b; Nikjoo et al., 1996; Pomplun and Terrissol, 1994; Charlton and Humm, 1988). Recently an attempt was made to analyse the DNA kinks in a CAP-DNA complex with 125 I induced DNA strand breakage (Karamychev et al., 1999). This method could be used as a so called radioprobing for such DNa distortions like other chemical and biological assays, provided that it has been tested and confirmed in a corresponding theoretical simulation. In the measurement, the distribution of the first breaks on the DNA strands starting from their labeled end can be determined. Based on such first breakage distributions, the simulation calculation could then be used to derive information on the structure of a given DNA-protein complex. The biophysical model PARTRAC has been applied successfully in simulating DNA damage induced by irradiation (Friedland et al., 1998; 1999). In the present study PARTRAC is adapted to a DNA-protein complex in which a specific sequence of 30 base pairs of DNA is connected with the catabolite gene activator protein (CAP). This report presents the first step of the analysis in which the CAP-DNA model used in NIH is overlaid with electron track structures in liquid water and the strand breaks due to direct ionization and due to radical attack are simulated. The second step will be to take into account the neutralization of the heavily charged tellurium and the protective effect of the CAP protein against radical attack. (orig.)

Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition.

Science.gov (United States)

Jun, S; Wallen, R V; Goriely, A; Kalionis, B; Desplan, C

1998-11-10

Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix-turn-helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes.

NMR studies of DNA oligomers and their interactions with minor groove binding ligands

Energy Technology Data Exchange (ETDEWEB)

Fagan, Patricia A. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1 ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

Science.gov (United States)

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-02-28

Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms

Science.gov (United States)

2009-05-01

base pair)  Watson ‐ Crick  strand pairs that bind perfectly within pairs, but poorly across pairs. A variety  of  DNA  strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE

Structure of DNA damaged by UV and psoralen

International Nuclear Information System (INIS)

Sung-hou Kim; Tomic, M.T.; Wemmer, D.E.; Pearlman, D.; Holbrook, S.

1988-01-01

The authors have used NMR methods to determine a three-dimensional model of an 8 base-pair DNA fragment cross-linked with psoralen. The duplex form of the self-complementary deoxyribonucleotide d-GGGTACCC, contains a psoralen cross-linkable site at the center of the duplex. The cross-link was formed by UV irradiation of a mixture of the purified DNA octamer and 4'-(aminomethyl)-4,5',8-trimethylpsoralen (AMT). Structural information was obtained using one and two-dimensional NMR techniques. Two-dimensional NOE experiments were used to assign the spectrum and estimate distances for many pairs of protons in the cross-linked DNA. Structural parameters obtained are qualitatively consistent with a previously proposed model for kinked and unwound cross-linked B-form DNA derived from crystallography and molecular modeling. The NMR derived model has a 53 degree bend into the major groove occuring primarily at the site of drug addition, and a 56 degree unwinding spanning the 8 base pair duplex. (author)

DNA Nanotechnology for Cancer Therapy

Science.gov (United States)

Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

2016-01-01

DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

DNA-based watermarks using the DNA-Crypt algorithm

Directory of Open Access Journals (Sweden)

Barnekow Angelika

2007-05-01

Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

DNA-based watermarks using the DNA-Crypt algorithm.

Science.gov (United States)

Heider, Dominik; Barnekow, Angelika

2007-05-29

The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

DNA-based watermarks using the DNA-Crypt algorithm

Science.gov (United States)

Heider, Dominik; Barnekow, Angelika

2007-01-01

Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

Sequence analysis of Leukemia DNA

Science.gov (United States)

Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

2018-03-01

Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

High performance of a new PCR-based urine assay for HPV-DNA detection and genotyping.

Science.gov (United States)

Tanzi, Elisabetta; Bianchi, Silvia; Fasolo, Maria Michela; Frati, Elena R; Mazza, Francesca; Martinelli, Marianna; Colzani, Daniela; Beretta, Rosangela; Zappa, Alessandra; Orlando, Giovanna

2013-01-01

Human papillomavirus (HPV) testing has been proposed as a means of replacing or supporting conventional cervical screening (Pap test). However, both methods require the collection of cervical samples. Urine sample is easier and more acceptable to collect and could be helpful in facilitating cervical cancer screening. The aim of this study was to evaluate the sensitivity and specificity of urine testing compared to conventional cervical smear testing using a PCR-based method with a new, designed specifically primer set. Paired cervical and first voided urine samples collected from 107 women infected with HIV were subjected to HPV-DNA detection and genotyping using a PCR-based assay and a restriction fragment length polymorphism method. Sensitivity, specificity, Positive Predictive Value (PPV), and Negative Predictive Value (NPV) were calculated using the McNemar's test for differences. Concordance between tests was assessed using the Cohen's unweighted Kappa (k). HPV DNA was detected in 64.5% (95% CI: 55.1-73.1%) of both cytobrush and urine samples. High concordance rates of HPV-DNA detection (k = 0.96; 95% CI: 0.90-1.0) and of high risk-clade and low-risk genotyping in paired samples (k = 0.80; 95% CI: 0.67-0.92 and k = 0.74; 95% CI: 0.60-0.88, respectively) were observed. HPV-DNA detection in urine versus cervix testing revealed a sensitivity of 98.6% (95% CI: 93.1-99.9%) and a specificity of 97.4% (95% CI: 87.7-99.9%), with a very high NPV (97.4%; 95% CI: 87.7-99.9%). The PCR-based assay utilized in this study proved highly sensitive and specific for HPV-DNA detection and genotyping in urine samples. These data suggest that a urine-based assay would be a suitable and effective tool for epidemiological surveillance and, most of all, screening programs. Copyright © 2012 Wiley Periodicals, Inc.

Learning preferences from paired opposite-based semantics

DEFF Research Database (Denmark)

Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

2017-01-01

Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

Science.gov (United States)

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

2017-01-01

Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

Science.gov (United States)

Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

2013-03-15

Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

Dynamic investigation of DNA bending and wrapping by type II topoisomerases

Science.gov (United States)

Shao, Qing; Finzi, Laura; Dunlap, David

2009-11-01

Type II topoisomerases catalyze DNA decatenation and unwinding which is crucial for cell division, and therefore type II topoisomerases are some of the main targets of anti-cancer drugs. A recent crystal structure shows that, during the catalytic cycle, a yeast type II topoimerase can bend a 10 base pair DNA segment by up to 150 degrees. Bacterial gyrase, another type II topoisomerase, can wrap DNA into a tight 180 degree turn. Bending a stiff polymer like DNA requires considerable energy and could represent the rate limiting step in the catalytic (topological) cycle. Using modified deoxyribonucleotides in PCR reactions, stiffer DNA fragments have been produced and used as substrates for topoisomerase II-mediated relaxation of plectonemes introduced in single molecules using magnetic tweezers. The wrapping ability of gyrase decreases for diamino-purine-substituted DNA in which every base pair has three hydrogen-bonds. The overall rate of relaxation of plectonemes by recombinant human topoisomerase II alpha also decreases. These results reveal the dynamic properties of DNA bending and wrapping by type II topisomerases and suggest that A:T base pair melting is a rate determining step for bending and wrapping.

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

SSR_pipeline--computer software for the identification of microsatellite sequences from paired-end Illumina high-throughput DNA sequence data

Science.gov (United States)

Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.

2013-01-01

SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (SSRs; for example, microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains three analysis modules along with a fourth control module that can be used to automate analyses of large volumes of data. The modules are used to (1) identify the subset of paired-end sequences that pass quality standards, (2) align paired-end reads into a single composite DNA sequence, and (3) identify sequences that possess microsatellites conforming to user specified parameters. Each of the three separate analysis modules also can be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc). All modules are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, Windows). The program suite relies on a compiled Python extension module to perform paired-end alignments. Instructions for compiling the extension from source code are provided in the documentation. Users who do not have Python installed on their computers or who do not have the ability to compile software also may choose to download packaged executable files. These files include all Python scripts, a copy of the compiled extension module, and a minimal installation of Python in a single binary executable. See program documentation for more information.

Twist-stretch profiles of DNA chains

Science.gov (United States)

Zoli, Marco

2017-06-01

Helical molecules change their twist number under the effect of a mechanical load. We study the twist-stretch relation for a set of short DNA molecules modeled by a mesoscopic Hamiltonian. Finite temperature path integral techniques are applied to generate a large ensemble of possible configurations for the base pairs of the sequence. The model also accounts for the bending and twisting fluctuations between adjacent base pairs along the molecules stack. Simulating a broad range of twisting conformation, we compute the helix structural parameters by averaging over the ensemble of base pairs configurations. The method selects, for any applied force, the average twist angle which minimizes the molecule’s free energy. It is found that the chains generally over-twist under an applied stretching and the over-twisting is physically associated to the contraction of the average helix diameter, i.e. to the damping of the base pair fluctuations. Instead, assuming that the maximum amplitude of the bending fluctuations may decrease against the external load, the DNA molecule first over-twists for weak applied forces and then untwists above a characteristic force value. Our results are discussed in relation to available experimental information albeit for kilo-base long molecules.

DNA-based machines.

Science.gov (United States)

Wang, Fuan; Willner, Bilha; Willner, Itamar

2014-01-01

The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

cGAS senses long and HMGB/TFAM-bound U-turn DNA by forming protein-DNA ladders.

Science.gov (United States)

Andreeva, Liudmila; Hiller, Björn; Kostrewa, Dirk; Lässig, Charlotte; de Oliveira Mann, Carina C; Jan Drexler, David; Maiser, Andreas; Gaidt, Moritz; Leonhardt, Heinrich; Hornung, Veit; Hopfner, Karl-Peter

2017-09-21

Cytosolic DNA arising from intracellular pathogens triggers a powerful innate immune response. It is sensed by cyclic GMP-AMP synthase (cGAS), which elicits the production of type I interferons by generating the second messenger 2'3'-cyclic-GMP-AMP (cGAMP). Endogenous nuclear or mitochondrial DNA can also be sensed by cGAS under certain conditions, resulting in sterile inflammation. The cGAS dimer binds two DNA ligands shorter than 20 base pairs side-by-side, but 20-base-pair DNA fails to activate cGAS in vivo and is a poor activator in vitro. Here we show that cGAS is activated in a strongly DNA length-dependent manner both in vitro and in human cells. We also show that cGAS dimers form ladder-like networks with DNA, leading to cooperative sensing of DNA length: assembly of the pioneering cGAS dimer between two DNA molecules is ineffective; but, once formed, it prearranges the flanking DNA to promote binding of subsequent cGAS dimers. Remarkably, bacterial and mitochondrial nucleoid proteins HU and mitochondrial transcription factor A (TFAM), as well as high-mobility group box 1 protein (HMGB1), can strongly stimulate long DNA sensing by cGAS. U-turns and bends in DNA induced by these proteins pre-structure DNA to nucleate cGAS dimers. Our results suggest a nucleation-cooperativity-based mechanism for sensitive detection of mitochondrial DNA and pathogen genomes, and identify HMGB/TFAM proteins as DNA-structuring host factors. They provide an explanation for the peculiar cGAS dimer structure and suggest that cGAS preferentially binds incomplete nucleoid-like structures or bent DNA.

Master equation approach to DNA breathing in heteropolymer DNA

DEFF Research Database (Denmark)

Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A

2007-01-01

After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

Science.gov (United States)

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

2017-03-17

Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Integrating DNA strand-displacement circuitry with DNA tile self-assembly

Science.gov (United States)

Zhang, David Yu; Hariadi, Rizal F.; Choi, Harry M.T.; Winfree, Erik

2013-01-01

DNA nanotechnology has emerged as a reliable and programmable way of controlling matter at the nanoscale through the specificity of Watson–Crick base pairing, allowing both complex self-assembled structures with nanometer precision and complex reaction networks implementing digital and analog behaviors. Here we show how two well-developed frameworks, DNA tile self-assembly and DNA strand-displacement circuits, can be systematically integrated to provide programmable kinetic control of self-assembly. We demonstrate the triggered and catalytic isothermal self-assembly of DNA nanotubes over 10 μm long from precursor DNA double-crossover tiles activated by an upstream DNA catalyst network. Integrating more sophisticated control circuits and tile systems could enable precise spatial and temporal organization of dynamic molecular structures. PMID:23756381

NMR studies on the structure and dynamics of lac operator DNA

International Nuclear Information System (INIS)

Lee, S.C.

1985-01-01

Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with a maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent

A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

Directory of Open Access Journals (Sweden)

Francesca Bertolini

Full Text Available The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43% in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97 and lower for avian species (0.70. PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

One-step synthesis of DNA functionalized cadmium-free quantum dots and its application in FRET-based protein sensing

Energy Technology Data Exchange (ETDEWEB)

Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)

2017-03-08

DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.

Molecular identification of birds: performance of distance-based DNA barcoding in three genes to delimit parapatric species.

Directory of Open Access Journals (Sweden)

Mansour Aliabadian

Full Text Available DNA barcoding based on the mitochondrial cytochrome oxidase subunit I gene (cox1 or COI has been successful in species identification across a wide array of taxa but in some cases failed to delimit the species boundaries of closely allied allopatric species or of hybridising sister species.In this study we extend the sample size of prior studies in birds for cox1 (2776 sequences, 756 species and target especially species that are known to occur parapatrically, and/or are known to hybridise, on a Holarctic scale. In order to obtain a larger set of taxa (altogether 2719 species, we include also DNA sequences of two other mitochondrial genes: cytochrome b (cob (4614 sequences, 2087 species and 16S (708 sequences, 498 species. Our results confirm the existence of a wide gap between intra- and interspecies divergences for both cox1 and cob, and indicate that distance-based DNA barcoding provides sufficient information to identify and delineate bird species in 98% of all possible pairwise comparisons. This DNA barcoding gap was not statistically influenced by the number of individuals sequenced per species. However, most of the hybridising parapatric species pairs have average divergences intermediate between intraspecific and interspecific distances for both cox1 and cob.DNA barcoding, if used as a tool for species discovery, would thus fail to identify hybridising parapatric species pairs. However, most of them can probably still assigned to known species by character-based approaches, although development of complementary nuclear markers will be necessary to account for mitochondrial introgression in hybridising species.

Charge transport in DNA oligonucleotides with various base-pairing patterns

Czech Academy of Sciences Publication Activity Database

Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

2010-01-01

Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

Dielectrophoretic trapping of DNA-coated gold nanoparticles on silicon based vertical nanogap devices.

Science.gov (United States)

Strobel, Sebastian; Sperling, Ralph A; Fenk, Bernhard; Parak, Wolfgang J; Tornow, Marc

2011-06-07

We report on the successful dielectrophoretic trapping and electrical characterization of DNA-coated gold nanoparticles on vertical nanogap devices (VNDs). The nanogap devices with an electrode distance of 13 nm were fabricated from Silicon-on-Insulator (SOI) material using a combination of anisotropic reactive ion etching (RIE), selective wet chemical etching and metal thin-film deposition. Au nanoparticles (diameter 40 nm) coated with a monolayer of dithiolated 8 base pairs double stranded DNA were dielectrophoretically trapped into the nanogap from electrolyte buffer solution at MHz frequencies as verified by scanning and transmission electron microscopy (SEM/TEM) analysis. First electrical transport measurements through the formed DNA-Au-DNA junctions partially revealed an approximately linear current-voltage characteristic with resistance in the range of 2-4 GΩ when measured in solution. Our findings point to the importance of strong covalent bonding to the electrodes in order to observe DNA conductance, both in solution and in the dry state. We propose our setup for novel applications in biosensing, addressing the direct interaction of biomolecular species with DNA in aqueous electrolyte media.

Principles of DNA architectonics: design of DNA-based nanoobjects

International Nuclear Information System (INIS)

Vinogradova, O A; Pyshnyi, D V

2012-01-01

The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

Breather trapping and breather transmission in a DNA model with an interface

DEFF Research Database (Denmark)

Alvarez, A.; Romero, F.R.; Archilla, J.F.R.

2006-01-01

We study the dynamics of moving discrete breathers in an interfaced piecewise DNA molecule. This is a DNA chain in which all the base pairs are identical and there exists an interface such that the base pairs dipole moments at each side are oriented in opposite directions. The Hamiltonian...... of the Peyrard-Bishop model is augmented with a term that includes the dipole-dipole coupling between base pairs. Numerical simulations show the existence of two dynamical regimes. If the translational kinetic energy of a moving breather launched towards the interface is below a critical value, it is trapped...

Mechanisms for radiation damadge in DNA

International Nuclear Information System (INIS)

Sevilla, M.D.

1994-11-01

A comprehensive report is provided of the author's research since 1986 on radiolysis of DNA as well as current state of knowledge in this area. In particular study areas such as the influence of hydration on the absolute yield of primary ionic free radicals in irradiated DNA at 77K, Ab Initio molecular orbital calculations of DNA base pairs and their radical ions, and radiation-induced DNA damage as a function of hydration are discussed

HLA class I sequence-based typing using DNA recovered from frozen plasma.

Science.gov (United States)

Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L

2012-08-31

We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.

A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

Science.gov (United States)

Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

2015-07-01

In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

The Effect of Basepair Mismatch on DNA Strand Displacement

OpenAIRE

Broadwater, D.?W.?Bo; Kim, Harold?D.

2016-01-01

DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied si...

The mechanism of the emergence of distinct overstretched DNA states

Energy Technology Data Exchange (ETDEWEB)

Zhu, You-Liang; Sun, Zhao-Yan, E-mail: zysun@ciac.ac.cn [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Lu, Zhong-Yuan [State Key Laboratory of Supramolecular Structure and Materials, Institute of Theoretical Chemistry, Jilin University, Changchun 130023 (China)

2016-01-14

Although multiple overstretched DNA states were identified in experiments, the mechanism of the emergence of distinct states is still unclear. Molecular dynamics simulation is an ideal tool to clarify the mechanism, but the force loading rates in stretching achieved by conventional all-atom DNA models are much faster, which essentially affect overstretching states. We employed a modified coarse-grained DNA model with an unprecedented low loading rate in simulations to study the overstretching transitions of end-opened double-stranded DNA. We observed two-strand peeling off for DNA with low stability and the S-DNA with high stability under tension. By introducing a melting-forbidden model which prevents base-pair breaking, we still observed the overstretching transition induced by the formation of S-DNA due to the change of dihedral angle. Hence, we confirmed that the competition between the two strain-softening manners, i.e., base-pair breaking and dihedral angle variation, results in the emergence of distinct overstretched DNA states.

Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

Czech Academy of Sciences Publication Activity Database

Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

2014-01-01

Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

Science.gov (United States)

Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

2016-03-16

We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Intrinsic flexibility of B-DNA: the experimental TRX scale.

Science.gov (United States)

Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

2010-01-01

B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.

Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

Directory of Open Access Journals (Sweden)

Geoffrey R Bennett

Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

HPLC-UV, MALDI-TOF-MS and ESI-MS/MS analysis of the mechlorethamine DNA crosslink at a cytosine-cytosine mismatch pair.

Directory of Open Access Journals (Sweden)

Pornchai Rojsitthisak

Full Text Available Mechlorethamine [ClCH(2CH(2N(CH(3CH(2CH(2Cl], a nitrogen mustard alkylating agent, has been proven to form a DNA interstrand crosslink at a cytosine-cytosine (C-C mismatch pair using gel electrophoresis. However, the atomic connectivity of this unusual crosslink is unknown.HPLC-UV, MALDI-TOF-MS, and ESI-MS/MS were used to determine the atomic connectivity of the DNA C-C crosslink formed by mechlorethamine, MALDI-TOF-MS of the HPLC-purified reaction product of mechlorethamine with the DNA duplex d[CTCACACCGTGGTTC]•d[GAACCACCGTGTGAG] (underlined bases are a C-C mismatch pair indicated formation of an interstrand crosslink at m/z 9222.088 [M-2H+Na](+. Following enzymatic digestion of the crosslinked duplex by snake venom phosphodiesterase and calf intestinal phosphatase, ESI-MS/MS indicated the presence of dC-mech-dC [mech = CH(2CH(2N(CH(3CH(2CH(2] at m/z 269.2 [M](2+ (expected m/z 269.6, exact mass 539.27 and its hydrolytic product dC-mech-OH at m/z 329.6 [M](+ (expected m/z 329.2. Fragmentation of dC-mech-dC gave product ions at m/z 294.3 and 236.9 [M](+, which are both due to loss of the 4-amino group of cytosine (as ammonia, in addition to dC and dC+HN(CH(3CH = CH(2, respectively. The presence of m/z 269.2 [M](2+ and loss of ammonia exclude crosslink formation at cytosine N(4 or O(2 and indicate crosslinking through cytosine N(3 with formation of two quaternary ammonium ions.Our results provide an important addition to the literature, as the first example of the use of HPLC and MS for analysis of a DNA adduct at the N(3 position of cytosine.

DNA nanotechnology: a future perspective

Science.gov (United States)

2013-01-01

In addition to its genetic function, DNA is one of the most distinct and smart self-assembling nanomaterials. DNA nanotechnology exploits the predictable self-assembly of DNA oligonucleotides to design and assemble innovative and highly discrete nanostructures. Highly ordered DNA motifs are capable of providing an ultra-fine framework for the next generation of nanofabrications. The majority of these applications are based upon the complementarity of DNA base pairing: adenine with thymine, and guanine with cytosine. DNA provides an intelligent route for the creation of nanoarchitectures with programmable and predictable patterns. DNA strands twist along one helix for a number of bases before switching to the other helix by passing through a crossover junction. The association of two crossovers keeps the helices parallel and holds them tightly together, allowing the assembly of bigger structures. Because of the DNA molecule's unique and novel characteristics, it can easily be applied in a vast variety of multidisciplinary research areas like biomedicine, computer science, nano/optoelectronics, and bionanotechnology. PMID:23497147

Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase

Science.gov (United States)

Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

2015-01-01

1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169

Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage

Science.gov (United States)

Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.

1999-01-01

DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315

Modeling the mechanical properties of DNA nanostructures.

Science.gov (United States)

Arbona, Jean Michel; Aimé, Jean-Pierre; Elezgaray, Juan

2012-11-01

We discuss generalizations of a previously published coarse-grained description [Mergell et al., Phys. Rev. E 68, 021911 (2003)] of double stranded DNA (dsDNA). The model is defined at the base-pair level and includes the electrostatic repulsion between neighbor helices. We show that the model reproduces mechanical and elastic properties of several DNA nanostructures (DNA origamis). We also show that electrostatic interactions are necessary to reproduce atomic force microscopy measurements on planar DNA origamis.

Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

International Nuclear Information System (INIS)

Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

1988-01-01

Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

Energy Technology Data Exchange (ETDEWEB)

X Qiu; D Rau; V Parsegian; L Fang; C Knobler; W Gelbart

2011-12-31

Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In the commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.

Prevalence of parvovirus B19 and parvovirus V9 DNA and antibodies in paired bone marrow and serum samples from healthy individuals.

Science.gov (United States)

Heegaard, Erik D; Petersen, Bodil Laub; Heilmann, Carsten J; Hornsleth, Allan

2002-03-01

Parvovirus B19 (hereafter referred to as B19) exhibits a marked tropism to human bone marrow (BM), and infection may lead to erythema infectiosum, arthropathy, hydrops fetalis, and various hematologic disorders. Recently, a distinct parvovirus isolate termed V9 with an unknown clinical spectrum was discovered. In contrast to the many studies of B19 serology and viremia, valid information on the frequency of B19 or V9 DNA in the BM of healthy individuals is limited. To develop a reference value, paired BM and serum samples from healthy subjects were tested for the presence of B19 and V9 DNA and specific antibodies. Immunoglobulin M (IgM) was not found in any of the serum samples. The prevalence of IgG showed a gradual and steady increase from 37% in children aged 1 to 5 years to 87% in people aged >50 years. When 190 well-characterized subjects were examined, B19 DNA was detected in the BM of 4 individuals (2.1%; 95% confidence interval, 0.58 to 5.3%) while none of the paired serum samples showed evidence of circulating viral DNA. V9 DNA was not found in any of the BM or serum samples. The finding of B19 DNA probably indicated a primary infection in one 7-year-old individual and reinfection or reactivation of persistent infection in the remaining three persons, aged 47 to 58 years. Serving as a benchmark for future studies, these findings are useful when interpreting epidemiologic data, performing BM transplantation, or considering clinical implications of parvovirus infection.

Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

Science.gov (United States)

Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

2018-06-01

Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

DNA damage due to perfluorooctane sulfonate based on nano-gold embedded in nano-porous poly-pyrrole film

Energy Technology Data Exchange (ETDEWEB)

Lu, Liping, E-mail: lipinglu@bjut.edu.cn; Xu, Laihui; Kang, Tianfang; Cheng, Shuiyuan

2013-11-01

DNA damage induced from perfluorooctane sulfonate (PFOS) was further developed on a nano-porous bionic interface. The interface was formed by assembling DNA on nano-gold particles which were embedded in a nano-porous overoxidized polypyrrole film (OPPy). Atomic force microscopy, scanning electron microscope and electrochemical investigations indicate that OPPy can be treated to form nano-pore structures. DNA damage due to PFOS was proved using electrochemistry and X-ray photoelectron spectroscopy (XPS) and was investigated by detecting differential pulse voltammetry (DPV) response of methylene blue (MB) which was used as electro-active indicator in the system. The current of MB attenuates obviously after incubation of DNA in PFOS. Moreover, electrochemical impedance spectroscopy (EIS) demonstrates that PFOS weakens DNA charge transport. The tentative binding ratio of PFOS: DNA base pair was obtained by analyzing XPS data of this system.

Whole genome DNA methylation: beyond genes silencing

OpenAIRE

Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

2016-01-01

The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

Human β satellite DNA: Genomic organization and sequence definition of a class of highly repetitive tandem DNA

International Nuclear Information System (INIS)

Waye, J.S.; Willard, H.F.

1989-01-01

The authors describe a class of human repetitive DNA, called β satellite, that, at a most fundamental level, exists as tandem arrays of diverged ∼68-base-pair monomer repeat units. The monomer units are organized as distinct subsets, each characterized by a multimeric higher-order repeat unit that is tandemly reiterated and represents a recent unit of amplification. They have cloned, characterized, and determined the sequence of two β satellite higher-order repeat units: one located on chromosome 9, the other on the acrocentric chromosomes (13, 14, 15, 21, and 22) and perhaps other sites in the genome. Analysis by pulsed-field gel electrophoresis reveals that these tandem arrays are localized in large domains that are marked by restriction fragment length polymorphisms. In total, β-satellite sequences comprise several million base pairs of DNA in the human genome. Analysis of this DNA family should permit insights into the nature of chromosome-specific and nonspecific modes of satellite DNA evolution and provide useful tools for probing the molecular organization and concerted evolution of the acrocentric chromosomes

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

Science.gov (United States)

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

Science.gov (United States)

Makarova, A V; Kulbachinskiy, A V

2012-06-01

Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

DNA bases assembled on the Au(110)/electrolyte interface: A combined experimental and theoretical study

DEFF Research Database (Denmark)

Salvatore, Princia; Nazmutdinov, Renat R.; Ulstrup, Jens

2015-01-01

Among the low-index single-crystal gold surfaces, the Au(110) surface is the most active toward molecular adsorption and the one with fewest electrochemical adsorption data reported. Cyclic voltammetry (CV), electrochemically controlled scanning tunneling microscopy (EC-STM), and density functional......, accompanied by a pair of strong voltammetry peaks in the double-layer region in acid solutions. Adsorption of the DNA bases gives featureless voltammograms with lower double-layer capacitance, suggesting that all the bases are chemisorbed on the Au(110) surface. Further investigation of the surface structures...... of the adlayers of the four DNA bases by EC-STM disclosed lifting of the Au(110) reconstruction, specific molecular packing in dense monolayers, and pH dependence of the A and G adsorption. DFT computations based on a cluster model for the Au(110) surface were performed to investigate the adsorption energy...

Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

Science.gov (United States)

Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

2014-02-01

Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

The structure of metallo-DNA with consecutive thymine-Hg-II-thymine base pairs explains positive entropy for the metallo base pair formation

Czech Academy of Sciences Publication Activity Database

Yamaguchi, H.; Šebera, Jakub; Kondo, J.; Oda, S.; Komuro, T.; Kawamura, T.; Dairaku, T.; Kondo, Y.; Okamoto, I.; Ono, A.; Burda, J. V.; Kojima, C.; Sychrovský, Vladimír; Tanaka, Y.

2014-01-01

Roč. 42, č. 6 (2014), s. 4094-4099 ISSN 0305-1048 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR structures * mercury * metalation * metal- DNA binding * DFT Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/6/4094.full

Twist–radial normal mode analysis in double-stranded DNA chains

International Nuclear Information System (INIS)

Torrellas, Germán; Maciá, Enrique

2012-01-01

We study the normal modes of a duplex DNA chain at low temperatures. We consider the coupling between the hydrogen-bond radial oscillations and the twisting motion of each base pair within the Peyrard–Bishop–Dauxois model. The coupling is mediated by the stacking interaction between adjacent base pairs along the helix. We explicitly consider different mass values for different nucleotides, extending previous works. We disclose several resonance conditions of interest, determined by the fine-tuning of certain model parameters. The role of these dynamical effects on the DNA chain charge transport properties is discussed.

DNA-Based Applications in Nanobiotechnology

Directory of Open Access Journals (Sweden)

Khalid M. Abu-Salah

2010-01-01

Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

Involvement of a bifunctional, paired-like DNA-binding domain and a transpositional enhancer in Sleeping Beauty transposition.

Science.gov (United States)

Izsvák, Zsuzsanna; Khare, Dheeraj; Behlke, Joachim; Heinemann, Udo; Plasterk, Ronald H; Ivics, Zoltán

2002-09-13

Sleeping Beauty (SB) is the most active Tc1/mariner-like transposon in vertebrate species. Each of the terminal inverted repeats (IRs) of SB contains two transposase-binding sites (DRs). This feature, termed the IR/DR structure, is conserved in a group of Tc1-like transposons. The DNA-binding region of SB transposase, similar to the paired domain of Pax proteins, consists of two helix-turn-helix subdomains (PAI + RED = PAIRED). The N-terminal PAI subdomain was found to play a dominant role in contacting the DRs. Transposase was able to bind to mutant sites retaining the 3' part of the DRs; thus, primary DNA binding is not sufficient to determine the specificity of the transposition reaction. The PAI subdomain was also found to bind to a transpositional enhancer-like sequence within the left IR of SB, and to mediate protein-protein interactions between transposase subunits. A tetrameric form of the transposase was detected in solution, consistent with an interaction between the IR/DR structure and a transposase tetramer. We propose a model in which the transpositional enhancer and the PAI subdomain stabilize complexes formed by a transposase tetramer bound at the IR/DR. These interactions may result in enhanced stability of synaptic complexes, which might explain the efficient transposition of Sleeping Beauty in vertebrate cells.

DNA Polymerase Fidelity: Beyond Right and Wrong.

Science.gov (United States)

Washington, M Todd

2016-11-01

Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

Typical signature of DNA damage in white blood cells: a pilot study on etheno adducts in Danish mother-newborn child pairs

DEFF Research Database (Denmark)

Arab, K; Pedersen, Marie; Nair, J

2009-01-01

The impact of DNA damage commonly thought to be involved in chronic degenerative disease causation is particularly detrimental during fetal development. Within a multicenter study, we analyzed 77 white blood cell (WBC) samples from mother-newborn child pairs to see if imprinting of DNA damage...... in mother and newborn shows a similar pattern. Two adducts 1,N(6)-ethenodeoxyadenosine (epsilondA) and 3,N(4)-ethenodeoxycytidine (epsilondC) were measured by our ultrasensitive immunoaffinity (32)P-post-labeling method. These miscoding etheno-DNA adducts are generated by the reaction of lipid peroxidation...... arising from endogenous reactive aldehydes in WBC of both mother and newborn can be reliably assessed by epsilondA and epsilondC as biomarkers. The high correlation of etheno adduct levels in mother and child WBC suggests that a typical signature of DNA damage is induced similarly in fetus and mother...

DNA functionalization by dynamic chemistry

Directory of Open Access Journals (Sweden)

Zeynep Kanlidere

2016-10-01

Full Text Available Dynamic combinatorial chemistry (DCC is an attractive method to efficiently generate libraries of molecules from simpler building blocks by reversible reactions under thermodynamic control. Here we focus on the chemical modification of DNA oligonucleotides with acyclic diol linkers and demonstrate their potential for the deoxyribonucleic acid functionalization and generation of libraries of reversibly interconverting building blocks. The syntheses of phosphoramidite building blocks derived from D-threoninol are presented in two variants with protected amino or thiol groups. The threoninol building blocks were successfully incorporated via automated solid-phase synthesis into 13mer oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was obtained, whereas, the highest selectivity (over 80% was found for the guanine aldehyde templated by the complementary cytosine containing DNA. The elevated occurrence of mismatches can be explained by increased backbone plasticity derived from the linear threoninol building block as a cyclic deoxyribose analogue.

Force fluctuations assist nanopore unzipping of DNA

International Nuclear Information System (INIS)

Viasnoff, V; Chiaruttini, N; Muzard, J; Bockelmann, U

2010-01-01

We experimentally study the statistical distributions and the voltage dependence of the unzipping time of 45 base-pair-long double-stranded DNA through a nanopore. We then propose a quantitative theoretical description considering the nanopore unzipping process as a random walk of the opening fork through the DNA sequence energy landscape biased by a time-fluctuating force. To achieve quantitative agreement fluctuations need to be correlated over the millisecond range and have an amplitude of order k B T/bp. Significantly slower or faster fluctuations are not appropriate, suggesting that the unzipping process is efficiently enhanced by noise in the kHz range. We further show that the unzipping time of short 15 base-pair hairpins does not always increase with the global stability of the double helix and we theoretically study the role of DNA elasticity on the conversion of the electrical bias into a mechanical unzipping force.

Long span DNA paired-end-tag (DNA-PET sequencing strategy for the interrogation of genomic structural mutations and fusion-point-guided reconstruction of amplicons.

Directory of Open Access Journals (Sweden)

Fei Yao

Full Text Available Structural variations (SVs contribute significantly to the variability of the human genome and extensive genomic rearrangements are a hallmark of cancer. While genomic DNA paired-end-tag (DNA-PET sequencing is an attractive approach to identify genomic SVs, the current application of PET sequencing with short insert size DNA can be insufficient for the comprehensive mapping of SVs in low complexity and repeat-rich genomic regions. We employed a recently developed procedure to generate PET sequencing data using large DNA inserts of 10-20 kb and compared their characteristics with short insert (1 kb libraries for their ability to identify SVs. Our results suggest that although short insert libraries bear an advantage in identifying small deletions, they do not provide significantly better breakpoint resolution. In contrast, large inserts are superior to short inserts in providing higher physical genome coverage for the same sequencing cost and achieve greater sensitivity, in practice, for the identification of several classes of SVs, such as copy number neutral and complex events. Furthermore, our results confirm that large insert libraries allow for the identification of SVs within repetitive sequences, which cannot be spanned by short inserts. This provides a key advantage in studying rearrangements in cancer, and we show how it can be used in a fusion-point-guided-concatenation algorithm to study focally amplified regions in cancer.

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

Science.gov (United States)

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

Brain cDNA clone for human cholinesterase

International Nuclear Information System (INIS)

McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

1987-01-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

Quasiparticle properties of DNA bases from GW calculations in a Wannier basis

Science.gov (United States)

Qian, Xiaofeng; Marzari, Nicola; Umari, Paolo

2009-03-01

The quasiparticle GW-Wannier (GWW) approach [1] has been recently developed to overcome the size limitations of conventional planewave GW calculations. By taking advantage of the localization properties of the maximally-localized Wannier functions and choosing a small set of polarization basis we reduce the number of Bloch wavefunctions products required for the evaluation of dynamical polarizabilities, and in turn greatly reduce memory requirements and computational efficiency. We apply GWW to study quasiparticle properties of different DNA bases and base-pairs, and solvation effects on the energy gap, demonstrating in the process the key advantages of this approach. [1] P. Umari,G. Stenuit, and S. Baroni, cond-mat/0811.1453

Homologous subfamilies of human alphoid repetitive DNA on different nucleolus organizing chromosomes

International Nuclear Information System (INIS)

Joergensen, A.L.; Bostock, C.J.; Bak, A.L.

1987-01-01

The organization of alphoid repeated sequences on human nucleolus-organizing (NOR) chromosomes 13, 21, and 22 has been investigated. Analysis of hybridization of alphoid DNA probes to Southern transfers of restriction enzyme-digested DNA fragments from hybrid cells containing single human chromosomes shows that chromosomes 13 and 21 share one subfamily of alphoid repeats, whereas a different subfamily may be held in common by chromosomes 13 and 22. The sequences of cloned 680-base-pair EcoRI fragments of the alphoid DNA from chromosomes 13 and 21 show that the basic unit of this subfamily is indistinguishable on each chromosome. The sequence of cloned 1020-base-pair Xba I fragments from chromosome 22 is related to, but distinguishable from, that of the 680-base-pair EcoRI alphoid subfamily of chromosomes 13 and 21. These results suggest that, at some point after they originated and were homogenized, different subfamilies of alphoid sequences must have exchanged between chromosomes 13 and 21 and separately between chromosomes 13 and 22

DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects

Energy Technology Data Exchange (ETDEWEB)

Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)

2014-02-01

The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular

Sequence periodicity in nucleosomal DNA and intrinsic curvature.

Science.gov (United States)

Nair, T Murlidharan

2010-05-17

Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

Metallic Nanostructures Based on DNA Nanoshapes

Directory of Open Access Journals (Sweden)

Boxuan Shen

2016-08-01

Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.

Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics.

Science.gov (United States)

Mallajosyula, Sairam S; Pati, Swapan K

2007-10-11

Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases?

Science.gov (United States)

Lee, Andrea J; Wallace, Susan S

2017-06-01

The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

[Quality of DNA from archival pathological samples of gallbladder cancer].

Science.gov (United States)

Roa, Iván; de Toro, Gonzalo; Sánchez, Tamara; Slater, Jeannie; Ziegler, Anne Marie; Game, Anakaren; Arellano, Leonardo; Schalper, Kurt; de Aretxabala, Xabier

2013-12-01

The quality of the archival samples stored at pathology services could be a limiting factor for molecular biology studies. To determine the quality of DNA extracted from gallbladder cancer samples at different institutions. One hundred ninety four samples coming from five medical centers in Chile, were analyzed. DNA extraction was quantified determining genomic DNA concentration. The integrity of DNA was determined by polymerase chain reaction amplification of different length fragments of a constitutive gene (β-globin products of 110, 268 and 501 base pairs). The mean DNA concentration obtained in 194 gallbladder cancer samples was 48 ± 43.1 ng/µl. In 22% of samples, no amplification was achieved despite obtaining a mean DNA concentration of 58.3 ng/ul. In 81, 67 and 22% of samples, a DNA amplification of at least 110, 268 or 501 base pairs was obtained, respectively. No differences in DNA concentration according to the source of the samples were demonstrated. However, there were marked differences in DNA integrity among participating centers. Samples from public hospitals were of lower quality than those from private clinics. Despite some limitations, in 80% of cases, the integrity of DNA in archival samples from pathology services in our country would allow the use of molecular biology techniques.

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

Science.gov (United States)

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the

Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins

Directory of Open Access Journals (Sweden)

Orren David K

2006-01-01

Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These

DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils.

Science.gov (United States)

Schonhoft, Joseph D; Stivers, James T

2013-04-16

Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

Modes of DNA repair and replication

International Nuclear Information System (INIS)

Hanawalt, P.; Kondo, S.

1979-01-01

Modes of DNA repair and replication require close coordination as well as some overlap of enzyme functions. Some classes of recovery deficient mutants may have defects in replication rather than repair modes. Lesions such as the pyrimidine dimers produced by ultraviolet light irradiation are the blocks to normal DNA replication in vivo and in vitro. The DNA synthesis by the DNA polymerase 1 of E. coli is blocked at one nucleotide away from the dimerized pyrimidines in template strands. Thus, some DNA polymerases seem to be unable to incorporate nucleotides opposite to the non-pairing lesions in template DNA strands. The lesions in template DNA strands may block the sequential addition of nucleotides in the synthesis of daughter strands. Normal replication utilizes a constitutive ''error-free'' mode that copies DNA templates with high fidelity, but which may be totally blocked at a lesion that obscures the appropriate base pairing specificity. It might be expected that modified replication system exhibits generally high error frequency. The error rate of DNA polymerases may be controlled by the degree of phosphorylation of the enzyme. Inducible SOS system is controlled by recA genes that also control the pathways for recombination. It is possible that SOS system involves some process other than the modification of a blocked replication apparatus to permit error-prone transdimer synthesis. (Yamashita, S.)

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

Science.gov (United States)

Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

2009-01-01

Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

Science.gov (United States)

Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

2016-12-01

In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

Directory of Open Access Journals (Sweden)

Sergei Kuchin

2011-03-01

Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

OpenAIRE

van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

2015-01-01

The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand brea...

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

DNA rendering of polyhedral meshes at the nanoscale

Science.gov (United States)

Benson, Erik; Mohammed, Abdulmelik; Gardell, Johan; Masich, Sergej; Czeizler, Eugen; Orponen, Pekka; Högberg, Björn

2015-07-01

It was suggested more than thirty years ago that Watson-Crick base pairing might be used for the rational design of nanometre-scale structures from nucleic acids. Since then, and especially since the introduction of the origami technique, DNA nanotechnology has enabled increasingly more complex structures. But although general approaches for creating DNA origami polygonal meshes and design software are available, there are still important constraints arising from DNA geometry and sense/antisense pairing, necessitating some manual adjustment during the design process. Here we present a general method of folding arbitrary polygonal digital meshes in DNA that readily produces structures that would be very difficult to realize using previous approaches. The design process is highly automated, using a routeing algorithm based on graph theory and a relaxation simulation that traces scaffold strands through the target structures. Moreover, unlike conventional origami designs built from close-packed helices, our structures have a more open conformation with one helix per edge and are therefore stable under the ionic conditions usually used in biological assays.

A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

Czech Academy of Sciences Publication Activity Database

Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří

Roč. 38, č. 1 ( 2010 ), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010

Effect of proton transfer on the electronic coupling in DNA

International Nuclear Information System (INIS)

Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

2006-01-01

The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, V da , in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate V da for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the V da matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the V da matrix elements are also analyzed

16S rDNA-based metagenomic analysis of dental plaque and lung bacteria in patients with severe acute exacerbations of chronic obstructive pulmonary disease.

Science.gov (United States)

Tan, L; Wang, H; Li, C; Pan, Y

2014-12-01

Acute exacerbations of chronic obstructive pulmonary disease (AE-COPD) are leading causes of mortality in hospital intensive care units. We sought to determine whether dental plaque biofilms might harbor pathogenic bacteria that can eventually cause lung infections in patients with severe AE-COPD. Paired samples of subgingival plaque biofilm and tracheal aspirate were collected from 53 patients with severe AE-COPD. Total bacterial DNA was extracted from each sample individually for polymerase chain reaction amplification and/or generation of bacterial 16S rDNA sequences and cDNA libraries. We used a metagenomic approach, based on bacterial 16S rDNA sequences, to compare the distribution of species present in dental plaque and lung. Analysis of 1060 sequences (20 clones per patient) revealed a wide range of aerobic, anaerobic, pathogenic, opportunistic, novel and uncultivable bacterial species. Species indistinguishable between the paired subgingival plaque and tracheal aspirate samples (97-100% similarity in 16S rDNA sequence) were dental plaque pathogens (Aggregatibacter actinomycetemcomitans, Capnocytophaga sputigena, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola) and lung pathogens (Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Streptococcus pneumoniae). Real-time polymerase chain reaction of 16S rDNA indicated lower levels of Pseudomonas aeruginosa and Porphyromonas gingivalis colonizing the dental plaques compared with the paired tracheal aspirate samples. These results support the hypothesis that dental bacteria may contribute to the pathology of severe AE-COPD. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Force regulated dynamics of RPA on a DNA fork.

Science.gov (United States)

Kemmerich, Felix E; Daldrop, Peter; Pinto, Cosimo; Levikova, Maryna; Cejka, Petr; Seidel, Ralf

2016-07-08

Replication protein A (RPA) is a single-stranded DNA binding protein, involved in most aspects of eukaryotic DNA metabolism. Here, we study the behavior of RPA on a DNA substrate that mimics a replication fork. Using magnetic tweezers we show that both yeast and human RPA can open forked DNA when sufficient external tension is applied. In contrast, at low force, RPA becomes rapidly displaced by the rehybridization of the DNA fork. This process appears to be governed by the binding or the release of an RPA microdomain (toehold) of only few base-pairs length. This gives rise to an extremely rapid exchange dynamics of RPA at the fork. Fork rezipping rates reach up to hundreds of base-pairs per second, being orders of magnitude faster than RPA dissociation from ssDNA alone. Additionally, we show that RPA undergoes diffusive motion on ssDNA, such that it can be pushed over long distances by a rezipping fork. Generally the behavior of both human and yeast RPA homologs is very similar. However, in contrast to yeast RPA, the dissociation of human RPA from ssDNA is greatly reduced at low Mg(2+) concentrations, such that human RPA can melt DNA in absence of force. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA fingerprints come to court

International Nuclear Information System (INIS)

Anon.

1988-01-01

DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person

Capturing a DNA duplex under near-physiological conditions

Science.gov (United States)

Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.

2010-10-01

We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.

Interaction between the Chlamydia trachomatis histone H1-like protein (Hc1) and DNA

DEFF Research Database (Denmark)

Christiansen, G; Pedersen, Lotte Bang; Koehler, J E

1993-01-01

maintained its DNA-binding capacity and was able at high concentrations to form condensed aggregates with DNA (one molecule of Hc1 per base pair) independently of the form or size of the DNA but with a slight preference for supercoiled DNA. Hc1 alone is thus able to package DNA into condensed spherical...

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.

Science.gov (United States)

Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J

2018-04-06

In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.

Quantifying quality in DNA self-assembly

Science.gov (United States)

Wagenbauer, Klaus F.; Wachauf, Christian H.; Dietz, Hendrik

2014-01-01

Molecular self-assembly with DNA is an attractive route for building nanoscale devices. The development of sophisticated and precise objects with this technique requires detailed experimental feedback on the structure and composition of assembled objects. Here we report a sensitive assay for the quality of assembly. The method relies on measuring the content of unpaired DNA bases in self-assembled DNA objects using a fluorescent de-Bruijn probe for three-base ‘codons’, which enables a comparison with the designed content of unpaired DNA. We use the assay to measure the quality of assembly of several multilayer DNA origami objects and illustrate the use of the assay for the rational refinement of assembly protocols. Our data suggests that large and complex objects like multilayer DNA origami can be made with high strand integration quality up to 99%. Beyond DNA nanotechnology, we speculate that the ability to discriminate unpaired from paired nucleic acids in the same macromolecule may also be useful for analysing cellular nucleic acids. PMID:24751596

Synthesis of furan-based DNA binders and their interaction with DNA

International Nuclear Information System (INIS)

Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

2006-01-01

In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA

DEFF Research Database (Denmark)

Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.

1976-01-01

Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced...

Prediction of DNA-binding specificity in zinc finger proteins

Indian Academy of Sciences (India)

2012-06-25

Jun 25, 2012 ... Support Vector Machine (SVM) is a state-of-the-art classifica- tion technique. Using canonical binding model, the C2H2 zinc finger protein–DNA interaction interface is modelled by the pairwise amino acid–base interactions. Using a classification framework, known examples of non-binding ZF–DNA pairs.

Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

Science.gov (United States)

Romero, Eduardo E; Hernandez, Florencio E

2018-01-03

Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

Comparison of the electrophoretic method with the sedimentation method for the analysis of DNA strand breaks

International Nuclear Information System (INIS)

Yamamoto, Osamu; Ogawa, Masaaki; Hoshi, Masaharu

1982-01-01

Application of electrophoresis to the analysis of DNA strand breaks was studied comparing with the sedimentation analysis. A BRL gel electrophoresis system (Type V16) was used for this study. Calf thymus DNA (1 mg/ml) irradiated with 60 Co gamma-rays in SSC solution was applied to both the electrophoretic analysis and the sedimentation analysis. Lamda phage DNA and its fragments were employed as the standard size molecules. In a range from 1 k base pairs to 6 k base pairs in length for double stranded DNA or from 2 k bases to 12 k bases for single stranded DNA, the calculated average molecular weight from the electrophoresis coincided with that from the sedimentation. Number of single strand breaks and double strand breaks were 1.34 x 10 11 breaks/mg/rad (G = 0.215) and 0.48 x 10 5 breaks/mg/rad 2 , respectively. (author)

DNA nanotechnology from the test tube to the cell.

Science.gov (United States)

Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg

2015-09-01

The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

DNA nanotechnology from the test tube to the cell

Science.gov (United States)

Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A.; Seelig, Georg

2015-09-01

The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology -- applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems -- lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

Science.gov (United States)

Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

2013-10-01

Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι

Energy Technology Data Exchange (ETDEWEB)

Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

2017-03-08

N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the syn conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.

Simultaneous G-Quadruplex DNA Logic.

Science.gov (United States)

Bader, Antoine; Cockroft, Scott L

2018-04-03

A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

Science.gov (United States)

Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom

2015-01-01

Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

cgHeliParm : analysis of dsDNA helical parameters for coarse-grained MARTINI molecular dynamics simulations

NARCIS (Netherlands)

Faustino, Ignacio; Marrink, S. J.

2017-01-01

Summary: We introduce cgHeliParm, a python program that provides the conformational analysis of Martini-based coarse-grained double strand DNA molecules. The software calculates the helical parameters such as base, base pair and base pair step parameters. cgHeliParm can be used for the analysis of

Multifunctional DNA Nanomaterials for Biomedical Applications

Directory of Open Access Journals (Sweden)

Dick Yan Tam

2015-01-01

Full Text Available The rapidly emerging DNA nanotechnology began with pioneer Seeman’s hypothesis that DNA not only can carry genetic information but also can be used as molecular organizer to create well-designed and controllable nanomaterials for applications in materials science, nanotechnology, and biology. DNA-based self-assembly represents a versatile system for nanoscale construction due to the well-characterized conformation of DNA and its predictability in the formation of base pairs. The structural features of nucleic acids form the basis of constructing a wide variety of DNA nanoarchitectures with well-defined shapes and sizes, in addition to controllable permeability and flexibility. More importantly, self-assembled DNA nanostructures can be easily functionalized to construct artificial functional systems with nanometer scale precision for multipurposes. Apparently scientists envision artificial DNA-based nanostructures as tool for drug loading and in vivo targeted delivery because of their abilities in selective encapsulation and stimuli-triggered release of cargo. Herein, we summarize the strategies of creating multidimensional self-assembled DNA nanoarchitectures and review studies investigating their stability, toxicity, delivery efficiency, loading, and control release of cargos in addition to their site-specific targeting and delivery of drug or cargo molecules to cellular systems.

Signature scheme based on bilinear pairs

Science.gov (United States)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

Accurate Estimation of the Standard Binding Free Energy of Netropsin with DNA

Directory of Open Access Journals (Sweden)

Hong Zhang

2018-01-01

Full Text Available DNA is the target of chemical compounds (drugs, pollutants, photosensitizers, etc., which bind through non-covalent interactions. Depending on their structure and their chemical properties, DNA binders can associate to the minor or to the major groove of double-stranded DNA. They can also intercalate between two adjacent base pairs, or even replace one or two base pairs within the DNA double helix. The subsequent biological effects are strongly dependent on the architecture of the binding motif. Discriminating between the different binding patterns is of paramount importance to predict and rationalize the effect of a given compound on DNA. The structural characterization of DNA complexes remains, however, cumbersome at the experimental level. In this contribution, we employed all-atom molecular dynamics simulations to determine the standard binding free energy of DNA with netropsin, a well-characterized antiviral and antimicrobial drug, which associates to the minor groove of double-stranded DNA. To overcome the sampling limitations of classical molecular dynamics simulations, which cannot capture the large change in configurational entropy that accompanies binding, we resort to a series of potentials of mean force calculations involving a set of geometrical restraints acting on collective variables.

Radiation-induced energy migration within solid DNA: The role of misonidazole as an electron trap

International Nuclear Information System (INIS)

Al-Kazwini, A.T.; O'Neill, P.; Adams, G.E.; Fielden, E.M.

1990-01-01

The in-pulse luminescence emission from solid DNA produced upon irradiation with electron pulses of energy below 260 keV has been investigated in vacuo at 293 K to gain an insight into the existence of radiation-induced charge/energy migration within DNA. The DNA samples contained misonidazole in the range 3 to 330 base pairs per misonidazole molecule. Under these conditions greater than 90% of the total energy is deposited in the DNA. The in-pulse radiation-induced luminescence spectrum of DNA was found to be critically dependent upon the misonidazole content of DNA. The luminescence intensity from the mixtures decreases with increasing content of misonidazole, and at the highest concentration, the intensity at 550 nm is reduced to 50% of that from DNA only. In the presence of 1 atm of oxygen, the observed emission intensity from DNA in the wavelength region 350-575 was reduced by 35-40% compared to that from DNA in vacuo. It is concluded that electron migration can occur in solid mixtures of DNA over a distance of up to about 100 base pairs

High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network.

Science.gov (United States)

Maleki, Ehsan; Babashah, Hossein; Koohi, Somayyeh; Kavehvash, Zahra

2017-07-01

This paper presents an optical processing approach for exploring a large number of genome sequences. Specifically, we propose an optical correlator for global alignment and an extended moiré matching technique for local analysis of spatially coded DNA, whose output is fed to a novel three-dimensional artificial neural network for local DNA alignment. All-optical implementation of the proposed 3D artificial neural network is developed and its accuracy is verified in Zemax. Thanks to its parallel processing capability, the proposed structure performs local alignment of 4 million sequences of 150 base pairs in a few seconds, which is much faster than its electrical counterparts, such as the basic local alignment search tool.

DNA nanostructure-directed assembly of metal nanoparticle superlattices

Science.gov (United States)

Julin, Sofia; Nummelin, Sami; Kostiainen, Mauri A.; Linko, Veikko

2018-05-01

Structural DNA nanotechnology provides unique, well-controlled, versatile, and highly addressable motifs and templates for assembling materials at the nanoscale. These methods to build from the bottom-up using DNA as a construction material are based on programmable and fully predictable Watson-Crick base pairing. Researchers have adopted these techniques to an increasing extent for creating numerous DNA nanostructures for a variety of uses ranging from nanoelectronics to drug-delivery applications. Recently, an increasing effort has been put into attaching nanoparticles (the size range of 1-20 nm) to the accurate DNA motifs and into creating metallic nanostructures (typically 20-100 nm) using designer DNA nanoshapes as molds or stencils. By combining nanoparticles with the superior addressability of DNA-based scaffolds, it is possible to form well-ordered materials with intriguing and completely new optical, plasmonic, electronic, and magnetic properties. This focused review discusses the DNA structure-directed nanoparticle assemblies covering the wide range of different one-, two-, and three-dimensional systems.

Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

International Nuclear Information System (INIS)

Pham, Quang Trung

2014-01-01

molecule in Geant4 by reading PDB (Protein Data Bank) files representing twelve base pairs of the DNA molecule and a di-nucleosome (347 base pairs). Finally, we developed a tool to correlate the positions of direct energy deposit in liquid water with the coordinates of the base pairs of DNA to calculate the number of single and double strand breaks in DNA. All calculations in this work were performed on the European Grid Infrastructure; performance tests are available to estimate the utility of this type of architecture for Monte Carlo calculations. (author) [fr

DNA responds to ionizing radiation as an insulator, not as a "molecular wire"

NARCIS (Netherlands)

Debije, M.G.; Milano, M.T.; Bernhard, W.A.

1999-01-01

The yields of radicals trapped on DNA, measured by EPR spectroscopy of oligodeoxyribonucleotide crystals (the EPR spectrum of a single crystal of d(CCCTAGGG) is shown), are found to be very high (0.7 µmol¿J-1) and insensitive to long-range (>106 base pairs) versus short-range stacking (8 base pairs)

Predicting near-UV electronic circular dichroism in nucleosomal DNA by means of DFT response theory.

Science.gov (United States)

Norman, Patrick; Parello, Joseph; Polavarapu, Prasad L; Linares, Mathieu

2015-09-14

It is demonstrated that time-dependent density functional theory (DFT) calculations can accurately predict changes in near-UV electronic circular dichroism (ECD) spectra of DNA as the structure is altered from the linear (free) B-DNA form to the supercoiled N-DNA form found in nucleosome core particles. At the DFT/B3LYP level of theory, the ECD signal response is reduced by a factor of 6.7 in going from the B-DNA to the N-DNA form, and it is illustrated how more than 90% of the individual base-pair dimers contribute to this strong hypochromic effect. Of the several inter-base pair parameters, an increase in twist angles is identified as to strongly contribute to a reduced ellipticity. The present work provides first evidence that first-principles calculations can elucidate changes in DNA dichroism due to the supramolecular organization of the nucleoprotein particle and associates these changes with the local structural features of nucleosomal DNA.

Accurate interaction energies of base pairing and base stacking. The final chapter

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

2005-01-01

Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

Evaluation of Genetic Variations in Maize Seedlings Exposed to Electric Field Based on Protein and DNA Markers

Directory of Open Access Journals (Sweden)

Asma A. AL-Huqail

2015-01-01

Full Text Available The current study analyzed proteins and nuclear DNA of electric fields (ELF exposed and nonexposed maize seedlings for different exposure periods using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, isozymes, random amplified polymorphic DNA (RAPD, and comet assay, respectively. SDS-PAGE analysis revealed total of 46 polypeptides bands with different molecular weights ranging from 186.20 to 36.00 KDa. It generated distinctive polymorphism value of 84.62%. Leucine-aminopeptidase, peroxidase, and catalase isozymes showed the highest values of polymorphism (100% based on zymograms number, relative front (Rf, and optical intensity while esterase isozyme generated polymorphism value of 83.33%. Amino acids were analyzed using high-performance liquid chromatography, which revealed the presence of 17 amino acids of variable contents ranging from 22.65% to 28.09%. RAPD revealed that 78 amplified DNA products had highly polymorphism value (95.08% based on band numbers, with variable sizes ranging from 120 to 992 base pairs and band intensity. Comet assay recorded the highest extent of nuclear DNA damage as percentage of tailed DNA (2.38% and tail moment unit (5.36 at ELF exposure of maize nuclei for 5 days. The current study concluded that the longer ELF exposing periods had genotoxic stress on macromolecules of maize cells and biomarkers used should be augmented for reliable estimates of genotoxicity after exposure of economic plants to ELF stressors.

Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

Science.gov (United States)

Goncharova, Iryna

2014-01-24

Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

OpenAIRE

Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

2016-01-01

Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

Science.gov (United States)

Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

2017-12-15

The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI

Directory of Open Access Journals (Sweden)

Gun Gun Gumilar

2005-06-01

Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR

Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

International Nuclear Information System (INIS)

Dizdaroglu, M.

1985-01-01

Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

Human tissue factor: cDNA sequence and chromosome localization of the gene

International Nuclear Information System (INIS)

Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

1987-01-01

A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

In-stem labelling allows visualization of DNA strand displacements by distinct fluorescent colour change.

Science.gov (United States)

Barrois, Sebastian; Wagenknecht, Hans-Achim

2013-05-21

The combination of thiazole orange (TO) and thiazole red (TR) as an internal pair of fluorescent DNA base surrogates ("DNA traffic lights") allows us to follow at least two consecutive DNA strand displacements in real time through a distinct fluorescence colour change from green to red and vice versa.