WorldWideScience

Sample records for dna base compositions

  1. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  2. Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

    Science.gov (United States)

    Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

    2014-01-01

    A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays. Published by Elsevier Ireland Ltd.

  3. Nuclear DNA content and base composition in 28 taxa of Musa.

    Science.gov (United States)

    Kamaté, K; Brown, S; Durand, P; Bureau, J M; De Nay, D; Trinh, T H

    2001-08-01

    The nuclear DNA content of 28 taxa of Musa was assessed by flow cytometry, using line PxPC6 of Petunia hybrida as an internal standard. The 2C DNA value of Musa balbisiana (BB genome) was 1.16 pg, whereas Musa acuminata (AA genome) had an average 2C DNA value of 1.27 pg, with a difference of 11% between its subspecies. The two haploid (IC) genomes, A and B, comprising most of the edible bananas, are therefore of similar size, 0.63 pg (610 million bp) and 0.58 pg (560 million bp), respectively. The genome of diploid Musa is thus threefold that of Arabidopsis thaliana. The genome sizes in a set of triploid Musa cultivars or clones were quite different, with 2C DNA values ranging from 1.61 to 2.23 pg. Likewise, the genome sizes of tetraploid cultivars ranged from 1.94 to 2.37 pg (2C). Apparently, tetraploids (for instance, accession I.C.2) can have a genome size that falls within the range of triploid genome sizes, and vice versa (as in the case of accession Simili Radjah). The 2C values estimated for organs such as leaf, leaf sheath, rhizome, and flower were consistent, whereas root material gave atypical results, owing to browning. The genomic base composition of these Musa taxa had a median value of 40.8% GC (SD = 0.43%).

  4. The photoreaction between furocoumarins and various DNA with different base compositions

    International Nuclear Information System (INIS)

    Dall'Acqua, F.; Vedaldi, D.; Recher, M.

    1978-01-01

    The photoreactivity of psoralen and 8-methylpsoralen towards various samples of DNA having different base-pair compositions has been studied. The total photobinding capacity shown by the two furocoumarins increases by increasing the content of A-T, confirming the data previously obtained using synthetic polynucleotides. The amount of monofunctional fluorescent 4',5'-cycloadducts and of the cross-linkages formed during the photoreaction is not parallel to the content of A-T, but is highest when the A-T content is between 50 and 60%, while it decreases as the content of A-T is lowered or increased. The possible binding site for the formation of 4',5'-monofunctional cycloadducts as well as of cross-linkages is discussed. (author)

  5. Adjustment of Cell-Type Composition Minimizes Systematic Bias in Blood DNA Methylation Profiles Derived by DNA Collection Protocols.

    Science.gov (United States)

    Shiwa, Yuh; Hachiya, Tsuyoshi; Furukawa, Ryohei; Ohmomo, Hideki; Ono, Kanako; Kudo, Hisaaki; Hata, Jun; Hozawa, Atsushi; Iwasaki, Motoki; Matsuda, Koichi; Minegishi, Naoko; Satoh, Mamoru; Tanno, Kozo; Yamaji, Taiki; Wakai, Kenji; Hitomi, Jiro; Kiyohara, Yutaka; Kubo, Michiaki; Tanaka, Hideo; Tsugane, Shoichiro; Yamamoto, Masayuki; Sobue, Kenji; Shimizu, Atsushi

    2016-01-01

    Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS) using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03) when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50) when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14) by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45) and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17). These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.

  6. Adjustment of Cell-Type Composition Minimizes Systematic Bias in Blood DNA Methylation Profiles Derived by DNA Collection Protocols.

    Directory of Open Access Journals (Sweden)

    Yuh Shiwa

    Full Text Available Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03 when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50 when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14 by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45 and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17. These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.

  7. Gold surface supported spherical liposome-gold nano-particle nano-composite for label free DNA sensing.

    Science.gov (United States)

    Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K

    2013-03-15

    Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Carbon nanotube/polymer composite electrodes for flexible, attachable electrochemical DNA sensors.

    Science.gov (United States)

    Li, Jianfeng; Lee, Eun-Cheol

    2015-09-15

    All-solution-processed, easily-made, flexible multi-walled carbon nanotube (MWCNT)/polydimethylsiloxane (PDMS)-based electrodes were fabricated and used for electrochemical DNA sensors. These electrodes could serve as a recognition layer for DNA, without any surface modification, through π-π interactions between the MWCNTs and DNA, greatly simplifying the fabrication process for DNA sensors. The electrodes were directly connected to an electrochemical analyzer in the differential pulse voltammetry (DPV) and cyclic voltammetry (CV) measurements, where methylene blue was used as a redox indicator. Since neither functional groups nor probe DNA were immobilized on the surfaces of the electrodes, the sensor can be easily regenerated by washing these electrodes with water. The limit of detection was found to be 1.3 × 10(2)pM (S/N=3), with good DNA sequence differentiation ability. Fast fabrication of a DNA sensor was also achieved by cutting and attaching the MWCNT-PDMS composite electrodes at an analyte solution-containable region. Our results pave the way for developing user-fabricated easily attached DNA sensors at low costs. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  10. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.

    Science.gov (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-02-16

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  11. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    Science.gov (United States)

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  12. Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær; Bergmark, Lasse; Munk, Patrick

    2016-01-01

    that in standard protocols. Based on this insight, we designed an improved DNA isolation procedure optimized for microbiome genomics that can be used for the three examined specimen types and potentially also for other biological specimens. A standard operating procedure is available from https://dx.doi.org/10......Explorations of complex microbiomes using genomics greatly enhance our understanding about their diversity, biogeography, and function. The isolation of DNA from microbiome specimens is a key prerequisite for such examinations, but challenges remain in obtaining sufficient DNA quantities required...... for certain sequencing approaches, achieving accurate genomic inference of microbiome composition, and facilitating comparability of findings across specimen types and sequencing projects. These aspects are particularly relevant for the genomics-based global surveillance of infectious agents and antimicrobial...

  13. Self-reference and random sampling approach for label-free identification of DNA composition using plasmonic nanomaterials.

    Science.gov (United States)

    Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu

    2018-05-09

    The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.

  14. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Eiko E Kuramae

    Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.

  15. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva

    2016-06-10

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  16. Benchmarking DNA Metabarcoding for Biodiversity-Based Monitoring and Assessment

    KAUST Repository

    Aylagas, Eva; Borja, Á ngel; Irigoien, Xabier; Rodrí guez-Ezpeleta, Naiara

    2016-01-01

    Characterization of biodiversity has been extensively used to confidently monitor and assess environmental status. Yet, visual morphology, traditionally and widely used for species identification in coastal and marine ecosystem communities, is tedious and entails limitations. Metabarcoding coupled with high-throughput sequencing (HTS) represents an alternative to rapidly, accurately, and cost-effectively analyze thousands of environmental samples simultaneously, and this method is increasingly used to characterize the metazoan taxonomic composition of a wide variety of environments. However, a comprehensive study benchmarking visual and metabarcoding-based taxonomic inferences that validates this technique for environmental monitoring is still lacking. Here, we compare taxonomic inferences of benthic macroinvertebrate samples of known taxonomic composition obtained using alternative metabarcoding protocols based on a combination of different DNA sources, barcodes of the mitochondrial cytochrome oxidase I gene and amplification conditions. Our results highlight the influence of the metabarcoding protocol in the obtained taxonomic composition and suggest the better performance of an alternative 313 bp length barcode to the traditionally 658 bp length one used for metazoan metabarcoding. Additionally, we show that a biotic index inferred from the list of macroinvertebrate taxa obtained using DNA-based taxonomic assignments is comparable to that inferred using morphological identification. Thus, our analyses prove metabarcoding valid for environmental status assessment and will contribute to accelerating the implementation of this technique to regular monitoring programs.

  17. Electrochemical examination of ability of dsDNA/PAM composites for storing and releasing of doxorubicin.

    Science.gov (United States)

    Zabost, Ewelina; Liwinska, Wioletta; Karbarz, Marcin; Kurek, Eliza; Lyp, Marek; Donten, Mikolaj; Stojek, Zbigniew

    2016-06-01

    Composites consisting of ss- and ds-DNA strands and polyacrylamide (PAM) hydrogel have been synthesized. DNA was entrapped non-covalently. The obtained DNA biomaterial exhibited a strong increase in guanine and adenine anodic currents when temperature reached the physiological level. This increase was related to the unique oligonucleotide structural changes in the composite. The structural alterations in the PAM lattices were employed for the release of the drug accumulated in the composite. Doxorubicin (Dox) was selected as the drug; it was accumulated by intercalation to dsDNA and was slowly released from the dsDNA/PAM system by using a minor temperature increase (up to 40÷45 °C) as it is routinely done in hyperthermia. The applied release temperature was either constant or oscillating. The binding strength, the rate of Dox release and the properties of the composite were examined using voltammetry, SEM and ICP-MS. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.

    Science.gov (United States)

    Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin

    2017-11-28

    To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.

  19. Electrochemical monitoring of the interaction between mitomycin C and DNA at chitosan--carbon nanotube composite modified electrodes

    OpenAIRE

    CANAVAR, Pembe Ece; EKŞİN, Ece; ERDEM, Arzum

    2015-01-01

    Single-walled carbon nanotube (CNT) and chitosan composite (chitosan*CNT) based sensors were developed as DNA biosensors, and then they were applied for electrochemical investigation of the interaction between the anticancer drug mitomycin C (MC) and DNA. The oxidation signals of MC and guanine were monitored before and after the interaction process by differential pulse voltammetry (DPV). The DPV results were in good agreement with those of electrochemical impedance spectroscopy (EIS)....

  20. DNA-based watermarks using the DNA-Crypt algorithm

    Directory of Open Access Journals (Sweden)

    Barnekow Angelika

    2007-05-01

    Full Text Available Abstract Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  1. DNA-based watermarks using the DNA-Crypt algorithm.

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-05-29

    The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  2. DNA-based watermarks using the DNA-Crypt algorithm

    Science.gov (United States)

    Heider, Dominik; Barnekow, Angelika

    2007-01-01

    Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

  3. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  4. Patch size and base composition of ultraviolet light-induced repair synthesis in toluenized Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Ishai, R; Sharon, R [Technion-Israel Inst. of Tech., Haifa

    1978-04-15

    Small patch repair in ultraviolet-irradiated Escherichia coli was saturated at deoxynucleoside triphosphate concentrations (approximately 2..mu..M of each dNTP) that are severly limiting for DNA replication. The low requirement of the repair process for dNTPs permitted direct demonstration of u.v.-induced DNA synthesis by incorporation of labelled dNTP and determination of its extent, base composition and patch size. It is concluded that DNA polymerase 1 is involved in small patch repair and that an average of 13 to 16 nucleotides are re-inserted per pyrimidine dimer excised. The average base composition of the repaired stretches adjacent to the dimers is similar to that of total E.coli DNA. An assay utilizing endogenous u.v.-specific endonuclease to determine dimer excision is described.

  5. Principles of DNA architectonics: design of DNA-based nanoobjects

    International Nuclear Information System (INIS)

    Vinogradova, O A; Pyshnyi, D V

    2012-01-01

    The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

  6. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  7. Increasing the luminous efficiency of an MEH-PPV based PLED using salmon DNA and single walled carbon nanotube

    International Nuclear Information System (INIS)

    Madhwal, Devinder; Singh, Inderpreet; Kumar, Jitender; Bhatia, C.S.; Bhatnagar, P.K.; Mathur, P.C.

    2011-01-01

    The combined effect of a salmon deoxyribonucleic acid (DNA)-based electron blocking layer and a single walled carbon nanotube (SWCNT) composite-based electron transport layer on the performance of a poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) polymer light emitting diode (PLED) has been examined. The SWCNT network in the composite layer improves electron injection from cathode and the DNA blocks these high mobility electrons at the electron blocking layer-polymer interface, leading to high luminance from the device. The luminous efficiency of the PLED is increased ∼20 times compared to that of a PLED using only MEH-PPV. - Highlights: → We report fabrication of a high luminous efficiency MEH-PPV based polymer LED. → Salmon DNA-CTMA layer is used to block injected electrons in the polymer layer. → MEH-PPV-SWCNT composite is used to transport electrons in the polymer layer. → The luminous efficiency of the polymer LED thereby improves about 20 times.

  8. DNA:DNA hybridization studies on the pink-pigmented facultative methylotrophs.

    Science.gov (United States)

    Hood, D W; Dow, C S; Green, P N

    1987-03-01

    The genomic relatedness among 36 strains of pink-pigmented facultatively methylotrophic bacteria (PPFMs) was estimated by determination of DNA base composition and by DNA:DNA hybridization studies. A reproducible hybridization system was developed for the rapid analysis of multiple DNA samples. Results indicated that the PPFMs comprise four major and several minor homology groups, and that they should remain grouped in a single genus, Methylobacterium.

  9. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  10. [DNA complexes, formed on aqueous phase surfaces: new planar polymeric and composite nanostructures].

    Science.gov (United States)

    Antipina, M N; Gaĭnutdinov, R V; Rakhnianskaia, A A; Sergeev-Cherenkov, A N; Tolstikhina, A L; Iurova, T V; Kislov, V V; Khomutov, G B

    2003-01-01

    The formation of DNA complexes with Langmuir monolayers of the cationic lipid octadecylamine (ODA) and the new amphiphilic polycation poly-4-vinylpyridine with 16% of cetylpyridinium groups (PVP-16) on the surface of an aqueous solution of native DNA of low ionic strength was studied. Topographic images of Langmuir-Blodgett films of DNA/ODA and DNA/PVP-16 complexes applied to micaceous substrates were investigated by the method of atomic force microscopy. It was found that films of the amphiphilic polycation have an ordered planar polycrystalline structure. The morphology of planar DNA complexes with the amphiphilic cation substantially depended on the incubation time and the phase state of the monolayer on the surface of the aqueous DNA solution. Complex structures and individual DNA molecules were observed on the surface of the amphiphilic monolayer. Along with quasi-linear individual bound DNA molecules, characteristic extended net-like structures and quasi-circular toroidal condensed conformations of planar DNA complexes were detected. Mono- and multilayer films of DNA/PVP-16 complexes were used as templates and nanoreactors for the synthesis of inorganic nanostructures via the binding of metal cations from the solution and subsequent generation of the inorganic phase. As a result, ultrathin polymeric composite films with integrated DNA building blocks and quasi-linear arrays of inorganic semiconductor (CdS) and iron oxide nanoparticles and nanowires were obtained. The nanostructures obtained were characterized by scanning probe microscopy and transmission electron microscopy techniques. The methods developed are promising for investigating the mechanisms of structural organization and transformation in DNA and polyelectrolyte complexes at the gas-liquid interface and for the design of new extremely thin highly ordered planar polymeric and composite materials, films, and coatings with controlled ultrastructure for applications in nanoelectronics and

  11. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  12. DNA-Based Applications in Nanobiotechnology

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2010-01-01

    Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

  13. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  14. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  15. Evaluation of essential oil composition and DNA diversity of mint ...

    African Journals Online (AJOL)

    use

    2011-11-23

    Nov 23, 2011 ... Full Length Research Paper. Evaluation of essential oil composition and DNA diversity of mint resources from China. Chen Xiao Hua, G. R. Wang and Yao Lei*. Aromatic Plant R&D Centre, School of Agriculture and Biology, Shanghai Jiao Tong University Shanghai 200240, China. Accepted 19 September ...

  16. Metallic Nanostructures Based on DNA Nanoshapes

    Directory of Open Access Journals (Sweden)

    Boxuan Shen

    2016-08-01

    Full Text Available Metallic nanostructures have inspired extensive research over several decades, particularly within the field of nanoelectronics and increasingly in plasmonics. Due to the limitations of conventional lithography methods, the development of bottom-up fabricated metallic nanostructures has become more and more in demand. The remarkable development of DNA-based nanostructures has provided many successful methods and realizations for these needs, such as chemical DNA metallization via seeding or ionization, as well as DNA-guided lithography and casting of metallic nanoparticles by DNA molds. These methods offer high resolution, versatility and throughput and could enable the fabrication of arbitrarily-shaped structures with a 10-nm feature size, thus bringing novel applications into view. In this review, we cover the evolution of DNA-based metallic nanostructures, starting from the metallized double-stranded DNA for electronics and progress to sophisticated plasmonic structures based on DNA origami objects.

  17. Hide and seek: How do DNA glycosylases locate oxidatively damaged DNA bases amidst a sea of undamaged bases?

    Science.gov (United States)

    Lee, Andrea J; Wallace, Susan S

    2017-06-01

    The first step of the base excision repair (BER) pathway responsible for removing oxidative DNA damage utilizes DNA glycosylases to find and remove the damaged DNA base. How glycosylases find the damaged base amidst a sea of undamaged bases has long been a question in the BER field. Single molecule total internal reflection fluorescence microscopy (SM TIRFM) experiments have allowed for an exciting look into this search mechanism and have found that DNA glycosylases scan along the DNA backbone in a bidirectional and random fashion. By comparing the search behavior of bacterial glycosylases from different structural families and with varying substrate specificities, it was found that glycosylases search for damage by periodically inserting a wedge residue into the DNA stack as they redundantly search tracks of DNA that are 450-600bp in length. These studies open up a wealth of possibilities for further study in real time of the interactions of DNA glycosylases and other BER enzymes with various DNA substrates. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. A change in the composition of supramolecular DNA-bound phospholipids in thymus and liver of gamma-irradiated rats

    International Nuclear Information System (INIS)

    Krasichkova, Z.I.; Strazhevskaya, N.B.

    1984-01-01

    The composition of supramolecular DNA (SM DNA)-bound phospholipids (PL) of thymus and liver of intact rats and those 2 min, 2, 6 and 24 h after γ-irradiation (9.7 Gy) was studied. In norm, supramolecular DNA of the thymus was shown to contain 6.7 μg PL/mg DNA, and that of the liver, 6.1 μg PL/mg DNA, the main components of PL being cardiolipin (CL) and phosphatidylethanolamine (PEA). Substantial changes were detected in the PL composition of SM DNA of γ,irradiated rat organs. During the postirradiation period the concentration of PEA and CL in thymus SM DNA changed symbatically and irreversibly decAeased to traces; whereas in SM DNA of the liver, their concentrations changed antibatically and decreased only to a definite level thus maintaining the necessary ''lipid volume''. It was shown that PL were not restored in SM DNA of the radiopesistant liver

  19. Cell type specific DNA methylation in cord blood: A 450K-reference data set and cell count-based validation of estimated cell type composition.

    Science.gov (United States)

    Gervin, Kristina; Page, Christian Magnus; Aass, Hans Christian D; Jansen, Michelle A; Fjeldstad, Heidi Elisabeth; Andreassen, Bettina Kulle; Duijts, Liesbeth; van Meurs, Joyce B; van Zelm, Menno C; Jaddoe, Vincent W; Nordeng, Hedvig; Knudsen, Gunn Peggy; Magnus, Per; Nystad, Wenche; Staff, Anne Cathrine; Felix, Janine F; Lyle, Robert

    2016-09-01

    Epigenome-wide association studies of prenatal exposure to different environmental factors are becoming increasingly common. These studies are usually performed in umbilical cord blood. Since blood comprises multiple cell types with specific DNA methylation patterns, confounding caused by cellular heterogeneity is a major concern. This can be adjusted for using reference data consisting of DNA methylation signatures in cell types isolated from blood. However, the most commonly used reference data set is based on blood samples from adult males and is not representative of the cell type composition in neonatal cord blood. The aim of this study was to generate a reference data set from cord blood to enable correct adjustment of the cell type composition in samples collected at birth. The purity of the isolated cell types was very high for all samples (>97.1%), and clustering analyses showed distinct grouping of the cell types according to hematopoietic lineage. We explored whether this cord blood and the adult peripheral blood reference data sets impact the estimation of cell type composition in cord blood samples from an independent birth cohort (MoBa, n = 1092). This revealed significant differences for all cell types. Importantly, comparison of the cell type estimates against matched cell counts both in the cord blood reference samples (n = 11) and in another independent birth cohort (Generation R, n = 195), demonstrated moderate to high correlation of the data. This is the first cord blood reference data set with a comprehensive examination of the downstream application of the data through validation of estimated cell types against matched cell counts.

  20. Processing of free radical damaged DNA bases

    International Nuclear Information System (INIS)

    Wallace, S.

    2003-01-01

    Free radicals produced during the radiolysis of water gives rise to a plethora of DNA damages including single strand breaks, sites of base loss and a wide variety of purine and pyrimidine base lesions. All these damages are processed in cells by base excision repair. The oxidative DNA glycosylases which catalyze the first step in the removal of a base damage during base excision repair evolved primarily to protect the cells from the deleterious mutagenic effects of single free radical-induced DNA lesions arising during oxidative metabolism. This is evidenced by the high spontaneous mutation rate in bacterial mutants lacking the oxidative DNA glycosylases. However, when a low LET photon transverses the DNA molecule, a burst of free radicals is produced during the radiolysis of water that leads to the formation of clustered damages in the DNA molecule, that are recognized by the oxidative DNA glycosylases. When substrates containing two closely opposed sugar damages or base and sugar damages are incubated with the oxidative DNA glycosylases in vitro, one strand is readily incised by the lyase activity of the DNA glycosylase. Whether or not the second strand is incised depends on the distance between the strand break resulting from the incised first strand and the remaining DNA lesion on the other strand. If the lesions are more than two or three base pairs apart, the second strand is readily cleaved by the DNA glycosylase, giving rise to a double strand break. Even if the entire base excision repair system is reconstituted in vitro, whether or not a double strand break ensues depends solely upon the ability of the DNA glycosylase to cleave the second strand. These data predicted that cells deficient in the oxidative DNA glycosylases would be radioresistant while those that overproduce an oxidative DNA glycosylase would be radiosensitive. This prediction was indeed borne in Escherichia coli that is, mutants lacking the oxidative DNA glycosylases are radioresistant

  1. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  2. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  3. Highly sensitive aptasensor based on synergetic catalysis activity of MoS2-Au-HE composite using cDNA-Au-GOD for signal amplification.

    Science.gov (United States)

    Song, Hai-Yan; Kang, Tian-Fang; Lu, Li-Ping; Cheng, Shui-Yuan

    2017-03-01

    Single or few-layer nanosheets of MoS 2 (MoS 2 nanosheets) and a composite composed of MoS 2 nanosheets, Au nanoparticles (AuNPs) and hemin (HE) (denoted as MoS 2 -Au-HE) were prepared. The composites possessed high synergetic catalysis activity towards the electroreduction of hydrogen peroxide. Furthermore, glucose oxidase (GOD) and AuNPs were used as marker of the complementary DNA (cDNA) strand of kanamycin aptamer to prepare a conjugate (reffered as cDNA-Au-GOD) that was designed as the signal probe. Both cDNA-Au-GOD and MoS 2 -Au-HE were applied to fabricate aptasensor for kanamycin. MoS 2 -Au-HE acted as solid platform for kanamycin aptamer and signal transmitters. AuNPs were employed as the supporter of cDNA and GOD which catalyze dissolved oxygen to produce hydrogen peroxide in the presence of glucose. Then cathodic peak current of H 2 O 2 was recorded by differential pulse voltammetry (DPV). The electrochemical reduction of H 2 O 2 was catalyzed by MoS 2 -Au-HE that was modified onto the surface of a glassy carbon electrode (GCE). The cathodic peak current of H 2 O 2 was highly linearly decreased with an increase of kanamycin concentrations from 1.0ng/L to 1.0×10 5 ng/L, with a detection limit of 0.8ng/L. This aptasensor can be used to detect kanamycin in milk with high specificity, sensitivity and selectivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.

    Science.gov (United States)

    Gryson, Nicolas

    2010-03-01

    The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.

  5. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  6. Plasmid DNA linearization in the antibacterial action of a new fluorescent Ag nanoparticle-paracetamol dimer composite

    Science.gov (United States)

    Sahoo, Amaresh Kumar; Sk, Md Palashuddin; Ghosh, Siddhartha Sankar; Chattopadhyay, Arun

    2011-10-01

    Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the composite strongly interacted with the bacterial cell walls leading to cell bursting. Interestingly, enhancement in the reactive oxygen species (ROS) generation in bacteria was observed in the presence of the composite. It is proposed that the ROS generation led to oxidation of the dimer to N-acetyl-p-benzoquinone imine (NAPQI). The generated NAPQI acted as a DNA gyrase inhibitor causing cell death following linearization of DNA.Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the

  7. DNA Replication Is Required for Circadian Clock Function by Regulating Rhythmic Nucleosome Composition.

    Science.gov (United States)

    Liu, Xiao; Dang, Yunkun; Matsu-Ura, Toru; He, Yubo; He, Qun; Hong, Christian I; Liu, Yi

    2017-07-20

    Although the coupling between circadian and cell cycles allows circadian clocks to gate cell division and DNA replication in many organisms, circadian clocks were thought to function independently of cell cycle. Here, we show that DNA replication is required for circadian clock function in Neurospora. Genetic and pharmacological inhibition of DNA replication abolished both overt and molecular rhythmicities by repressing frequency (frq) gene transcription. DNA replication is essential for the rhythmic changes of nucleosome composition at the frq promoter. The FACT complex, known to be involved in histone disassembly/reassembly, is required for clock function and is recruited to the frq promoter in a replication-dependent manner to promote replacement of histone H2A.Z by H2A. Finally, deletion of H2A.Z uncoupled the dependence of the circadian clock on DNA replication. Together, these results establish circadian clock and cell cycle as interdependent coupled oscillators and identify DNA replication as a critical process in the circadian mechanism. Published by Elsevier Inc.

  8. A Highly Sensitive Electrochemical DNA Biosensor from Acrylic-Gold Nano-composite for the Determination of Arowana Fish Gender

    Science.gov (United States)

    Rahman, Mahbubur; Heng, Lee Yook; Futra, Dedi; Chiang, Chew Poh; Rashid, Zulkafli A.; Ling, Tan Ling

    2017-08-01

    The present research describes a simple method for the identification of the gender of arowana fish ( Scleropages formosus). The DNA biosensor was able to detect specific DNA sequence at extremely low level down to atto M regimes. An electrochemical DNA biosensor based on acrylic microsphere-gold nanoparticle (AcMP-AuNP) hybrid composite was fabricated. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesised with a facile and well-established one-step photopolymerization procedure and physically adsorbed on the AuNPs at the surface of a carbon screen printed electrode (SPE). The DNA biosensor was constructed simply by grafting an aminated DNA probe on the succinimide functionalised AcMPs via a strong covalent attachment. DNA hybridisation response was determined by differential pulse voltammetry (DPV) technique using anthraquinone monosulphonic acid redox probe as an electroactive oligonucleotide label (Table 1). A low detection limit at 1.0 × 10-18 M with a wide linear calibration range of 1.0 × 10-18 to 1.0 × 10-8 M ( R 2 = 0.99) can be achieved by the proposed DNA biosensor under optimal conditions. Electrochemical detection of arowana DNA can be completed within 1 hour. Due to its small size and light weight, the developed DNA biosensor holds high promise for the development of functional kit for fish culture usage.

  9. DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

    Science.gov (United States)

    Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

    2017-12-15

    The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

  11. Charge transport through DNA based electronic barriers

    Science.gov (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  12. PEGylated composite nanoparticles of PLGA and polyethylenimine for safe and efficient delivery of pDNA to lungs.

    Science.gov (United States)

    Kolte, Atul; Patil, Sushilkumar; Lesimple, Pierre; Hanrahan, John W; Misra, Ambikanandan

    2017-05-30

    Achieving stable, efficient and non-toxic pulmonary gene delivery is most challenging requirement for successful gene therapy to lung. Composite nanoparticles (NPs) of the poly(lactic-co-glycolic acid) (PLGA) and cationic polymer polyethyleneimine (PEI) is an efficient alternative to viral and liposomal vectors for the pulmonary delivery of pDNA. NPs with different weight ratios (0-12.5%w/w) of PLGA/PEI were prepared and characterized for size, morphology, surface charge, pDNA loading and in vitro release. The in vitro cell uptake and transfection studies in the CFBE41o-cell line revealed that NPs with 10% w/w PEI were more efficient but they exhibited significant cytotoxicity in MTT assays, challenging the safety of this formulation. Surface modifications of these composite NPs through PEGylation reduced toxicity and enhanced cellular uptake and pDNA expression. PEGylation improved diffusion of NPs through the mucus barrier and prevented uptake by pulmonary macrophages. Finally, PEGylated composite NPs were converted to DPI by lyophilization and combined with lactose carrier particles, which resulted in improved aerosolization properties and lung deposition, without affecting pDNA bioactivity. This study demonstrates that a multidisciplinary approach may enable the local delivery of pDNA to lung tissue for effective treatment of deadly lung diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  14. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

    2008-01-01

    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  15. Analysis of bacterial core communities in the central Baltic by comparative RNA-DNA-based fingerprinting provides links to structure-function relationships.

    Science.gov (United States)

    Brettar, Ingrid; Christen, Richard; Höfle, Manfred G

    2012-01-01

    Understanding structure-function links of microbial communities is a central theme of microbial ecology since its beginning. To this end, we studied the spatial variability of the bacterioplankton community structure and composition across the central Baltic Sea at four stations, which were up to 450 km apart and at a depth profile representative for the central part (Gotland Deep, 235 m). Bacterial community structure was followed by 16S ribosomal RNA (rRNA)- and 16S rRNA gene-based fingerprints using single-strand conformation polymorphism (SSCP) electrophoresis. Species composition was determined by sequence analysis of SSCP bands. High similarities of the bacterioplankton communities across several hundred kilometers were observed in the surface water using RNA- and DNA-based fingerprints. In these surface communities, the RNA- and DNA-based fingerprints resulted in very different pattern, presumably indicating large difference between the active members of the community as represented by RNA-based fingerprints and the present members represented by the DNA-based fingerprints. This large discrepancy changed gradually over depth, resulting in highly similar RNA- and DNA-based fingerprints in the anoxic part of the water column below 130 m depth. A conceivable mechanism explaining this high similarity could be the reduced oxidative stress in the anoxic zone. The stable communities on the surface and in the anoxic zone indicate the strong influence of the hydrography on the bacterioplankton community structure. Comparative analysis of RNA- and DNA-based community structure provided criteria for the identification of the core community, its key members and their links to biogeochemical functions.

  16. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  17. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  19. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  20. A universal DNA-based protein detection system.

    Science.gov (United States)

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  1. DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.

    Science.gov (United States)

    Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao

    2016-01-13

    Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.

  2. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)

    2017-10-20

    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  3. Synthesis of titanium oxide nanoparticles using DNA-complex as template for solution-processable hybrid dielectric composites

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, J.C. [Center for Sustainable Materials Chemistry, 153 Gilbert Hall, Oregon State University, Corvallis, OR (United States); Mejia, I.; Murphy, J.; Quevedo, M. [Department of Materials Science and Engineering, University of Texas at Dallas, Dallas, TX (United States); Garcia, P.; Martinez, C.A. [Engineering and Technology Institute, Autonomous University of Ciudad Juarez, Ciudad Juarez, Chihuahua (Mexico)

    2015-09-15

    Highlights: • We developed a synthesis method to produce TiO{sub 2} nanoparticles using a DNA complex. • The nanoparticles were anatase phase (~6 nm diameter), and stable in alcohols. • Composites showed a k of 13.4, 4.6 times larger than the k of polycarbonate. • Maximum processing temperature was 90 °C. • Low temperature enables their use in low-voltage, low-cost, flexible electronics. - Abstract: We report the synthesis of TiO{sub 2} nanoparticles prepared by the hydrolysis of titanium isopropoxide (TTIP) in the presence of a DNA complex for solution processable dielectric composites. The nanoparticles were incorporated as fillers in polycarbonate at low concentrations (1.5, 5 and 7 wt%) to produce hybrid dielectric films with dielectric constant higher than thermally grown silicon oxide. It was found that the DNA complex plays an important role as capping agent in the formation and suspension stability of nanocrystalline anatase phase TiO{sub 2} at room temperature with uniform size (∼6 nm) and narrow distribution. The effective dielectric constant of spin-cast polycarbonate thin-films increased from 2.84 to 13.43 with the incorporation of TiO{sub 2} nanoparticles into the polymer host. These composites can be solution processed with a maximum temperature of 90 °C and could be potential candidates for its application in low-cost macro-electronics.

  4. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  5. A comparison of sedimentary DNA and pollen from lake sediments in recording vegetation composition at the Siberian treeline.

    Science.gov (United States)

    Niemeyer, Bastian; Epp, Laura S; Stoof-Leichsenring, Kathleen R; Pestryakova, Luidmila A; Herzschuh, Ulrike

    2017-11-01

    Reliable information on past and present vegetation is important to project future changes, especially for rapidly transitioning areas such as the boreal treeline. To study past vegetation, pollen analysis is common, while current vegetation is usually assessed by field surveys. Application of detailed sedimentary DNA (sedDNA) records has the potential to enhance our understanding of vegetation changes, but studies systematically investigating the power of this proxy are rare to date. This study compares sedDNA metabarcoding and pollen records from surface sediments of 31 lakes along a north-south gradient of increasing forest cover in northern Siberia (Taymyr peninsula) with data from field surveys in the surroundings of the lakes. sedDNA metabarcoding recorded 114 plant taxa, about half of them to species level, while pollen analyses identified 43 taxa, both exceeding the 31 taxa found by vegetation field surveys. Increasing Larix percentages from north to south were consistently recorded by all three methods and principal component analyses based on percentage data of vegetation surveys and DNA sequences separated tundra from forested sites. Comparisons of the ordinations using procrustes and protest analyses show a significant fit among all compared pairs of records. Despite similarities of sedDNA and pollen records, certain idiosyncrasies, such as high percentages of Alnus and Betula in all pollen and high percentages of Salix in all sedDNA spectra, are observable. Our results from the tundra to single-tree tundra transition zone show that sedDNA analyses perform better than pollen in recording site-specific richness (i.e., presence/absence of taxa in the vicinity of the lake) and perform as well as pollen in tracing vegetation composition. © 2017 John Wiley & Sons Ltd.

  6. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

    Science.gov (United States)

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

    2017-01-01

    Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

  7. Synthesis and Characterization of Polyaniline/Graphene Composite Nanofiber and Its Application as an Electrochemical DNA Biosensor for the Detection of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Fatimah Syahidah Mohamad

    2017-12-01

    Full Text Available This article describes chemically modified polyaniline and graphene (PANI/GP composite nanofibers prepared by self-assembly process using oxidative polymerization of aniline monomer and graphene in the presence of a solution containing poly(methyl vinyl ether-alt-maleic acid (PMVEA. Characterization of the composite nanofibers was carried out by Fourier transform infrared (FTIR and Raman spectroscopy, transmission electron microscopy (TEM and scanning electron microscopy (SEM. SEM images revealed the size of the PANI nanofibers ranged from 90 to 360 nm in diameter and was greatly influenced by the proportion of PMVEA and graphene. The composite nanofibers with an immobilized DNA probe were used for the detection of Mycobacterium tuberculosis by using an electrochemical technique. A photochemical indicator, methylene blue (MB was used to monitor the hybridization of target DNA by using differential pulse voltammetry (DPV method. The detection range of DNA biosensor was obtained from of 10−6–10−9 M with the detection limit of 7.853 × 10−7 M under optimum conditions. The results show that the composite nanofibers have a great potential in a range of applications for DNA sensors.

  8. An ultrasensitive electrochemical DNA biosensor based on a copper oxide nanowires/single-walled carbon nanotubes nanocomposite

    International Nuclear Information System (INIS)

    Chen, Mei; Hou, Changjun; Huo, Danqun; Yang, Mei; Fa, Huanbao

    2016-01-01

    Graphical abstract: A novel and sensitive electrochemical biosensor based on hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH) was first developed for the detection of the specific-sequence target DNA. This schematic represents the fabrication procedure of our DNA biosensor. - Highlights: • An ultrasensitive DNA electrochemical biosensor was developed. • CuO NWs entangled with the SWCNTs formed a mesh structure with good conductivity. • It is the first time use of CuONWs-SWCNTs hybrid nanocomposite for DNA detection. • The biosensor is simple, selective, stable, and sensitive. • The biosensor has great potential for use in analysis of real samples. - Abstract: Here, we developed a novel and sensitive electrochemical biosensor to detect specific-sequence target DNA. The biosensor was based on a hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH). The resulting CuO NWs/SWCNTs layers exhibited a good differential pulse voltammetry (DPV) current response for the target DNA sequences, which we attributed to the properties of CuO NWs and SWCNTs. CuO NWs and SWCNTs hybrid composites with highly conductive and biocompatible nanostructure were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), and cyclic voltammetry (CV). Immobilization of the probe DNA on the electrode surface was largely improved due to the unique synergetic effect of CuO NWs and SWCNTs. DPV was applied to monitor the DNA hybridization event, using adriamycin as an electrochemical indicator. Under optimal conditions, the peak currents of adriamycin were linear with the logarithm of target DNA concentrations (ranging from 1.0 × 10"−"1"4 to 1.0 × 10"−"8 M), with a detection limit of 3.5 × 10"−"1"5 M (signal/noise ratio of 3). The biosensor also showed high selectivity to

  9. An ultrasensitive electrochemical DNA biosensor based on a copper oxide nanowires/single-walled carbon nanotubes nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mei [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Hou, Changjun, E-mail: houcj@cqu.edu.cn [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); National Key Laboratory of Fundamental Science of Micro/Nano-Device and System Technology, Chongqing University, Chongqing 400044 (China); Huo, Danqun [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); National Key Laboratory of Fundamental Science of Micro/Nano-Device and System Technology, Chongqing University, Chongqing 400044 (China); Yang, Mei [Key Laboratory of Biorheology Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Fa, Huanbao [College of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China)

    2016-02-28

    Graphical abstract: A novel and sensitive electrochemical biosensor based on hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH) was first developed for the detection of the specific-sequence target DNA. This schematic represents the fabrication procedure of our DNA biosensor. - Highlights: • An ultrasensitive DNA electrochemical biosensor was developed. • CuO NWs entangled with the SWCNTs formed a mesh structure with good conductivity. • It is the first time use of CuONWs-SWCNTs hybrid nanocomposite for DNA detection. • The biosensor is simple, selective, stable, and sensitive. • The biosensor has great potential for use in analysis of real samples. - Abstract: Here, we developed a novel and sensitive electrochemical biosensor to detect specific-sequence target DNA. The biosensor was based on a hybrid nanocomposite consisting of copper oxide nanowires (CuO NWs) and carboxyl-functionalized single-walled carbon nanotubes (SWCNTs-COOH). The resulting CuO NWs/SWCNTs layers exhibited a good differential pulse voltammetry (DPV) current response for the target DNA sequences, which we attributed to the properties of CuO NWs and SWCNTs. CuO NWs and SWCNTs hybrid composites with highly conductive and biocompatible nanostructure were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), and cyclic voltammetry (CV). Immobilization of the probe DNA on the electrode surface was largely improved due to the unique synergetic effect of CuO NWs and SWCNTs. DPV was applied to monitor the DNA hybridization event, using adriamycin as an electrochemical indicator. Under optimal conditions, the peak currents of adriamycin were linear with the logarithm of target DNA concentrations (ranging from 1.0 × 10{sup −14} to 1.0 × 10{sup −8} M), with a detection limit of 3.5 × 10{sup −15} M (signal/noise ratio of 3). The biosensor also showed high

  10. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  11. DNA-Based Enzyme Reactors and Systems

    Directory of Open Access Journals (Sweden)

    Veikko Linko

    2016-07-01

    Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.

  12. Quantifying quality in DNA self-assembly

    Science.gov (United States)

    Wagenbauer, Klaus F.; Wachauf, Christian H.; Dietz, Hendrik

    2014-01-01

    Molecular self-assembly with DNA is an attractive route for building nanoscale devices. The development of sophisticated and precise objects with this technique requires detailed experimental feedback on the structure and composition of assembled objects. Here we report a sensitive assay for the quality of assembly. The method relies on measuring the content of unpaired DNA bases in self-assembled DNA objects using a fluorescent de-Bruijn probe for three-base ‘codons’, which enables a comparison with the designed content of unpaired DNA. We use the assay to measure the quality of assembly of several multilayer DNA origami objects and illustrate the use of the assay for the rational refinement of assembly protocols. Our data suggests that large and complex objects like multilayer DNA origami can be made with high strand integration quality up to 99%. Beyond DNA nanotechnology, we speculate that the ability to discriminate unpaired from paired nucleic acids in the same macromolecule may also be useful for analysing cellular nucleic acids. PMID:24751596

  13. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Science.gov (United States)

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  14. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Directory of Open Access Journals (Sweden)

    Md. Mahbubur Rahman

    2015-02-01

    Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  15. Recent progress on DNA based walkers.

    Science.gov (United States)

    Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun

    2015-08-01

    DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    Science.gov (United States)

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. A well-resolved phylogeny of the trees of Puerto Rico based on DNA barcode sequence data.

    Science.gov (United States)

    Muscarella, Robert; Uriarte, María; Erickson, David L; Swenson, Nathan G; Zimmerman, Jess K; Kress, W John

    2014-01-01

    The use of phylogenetic information in community ecology and conservation has grown in recent years. Two key issues for community phylogenetics studies, however, are (i) low terminal phylogenetic resolution and (ii) arbitrarily defined species pools. We used three DNA barcodes (plastid DNA regions rbcL, matK, and trnH-psbA) to infer a phylogeny for 527 native and naturalized trees of Puerto Rico, representing the vast majority of the entire tree flora of the island (89%). We used a maximum likelihood (ML) approach with and without a constraint tree that enforced monophyly of recognized plant orders. Based on 50% consensus trees, the ML analyses improved phylogenetic resolution relative to a comparable phylogeny generated with Phylomatic (proportion of internal nodes resolved: constrained ML = 74%, unconstrained ML = 68%, Phylomatic = 52%). We quantified the phylogenetic composition of 15 protected forests in Puerto Rico using the constrained ML and Phylomatic phylogenies. We found some evidence that tree communities in areas of high water stress were relatively phylogenetically clustered. Reducing the scale at which the species pool was defined (from island to soil types) changed some of our results depending on which phylogeny (ML vs. Phylomatic) was used. Overall, the increased terminal resolution provided by the ML phylogeny revealed additional patterns that were not observed with a less-resolved phylogeny. With the DNA barcode phylogeny presented here (based on an island-wide species pool), we show that a more fully resolved phylogeny increases power to detect nonrandom patterns of community composition in several Puerto Rican tree communities. Especially if combined with additional information on species functional traits and geographic distributions, this phylogeny will (i) facilitate stronger inferences about the role of historical processes in governing the assembly and composition of Puerto Rican forests, (ii) provide insight into Caribbean

  18. Multiplex electrochemiluminescence DNA sensor for determination of hepatitis B virus and hepatitis C virus based on multicolor quantum dots and Au nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Linlin; Wang, Xinyan; Ma, Qiang; Lin, Zihan; Chen, Shufan; Li, Yang [Department of Analytical Chemistry, College of Chemistry, Jilin University, Changchun, 130012 (China); Lu, Lehui [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, 130022 (China); Qu, Hongping [Department of Biotechnology, College of Life Science, Jilin Normal University, Siping, 136000 (China); Su, Xingguang, E-mail: suxg@jlu.edu.cn [Department of Analytical Chemistry, College of Chemistry, Jilin University, Changchun, 130012 (China)

    2016-04-15

    In this work, a novel multiplex electrochemiluminescence (ECL) DNA sensor has been developed for determination of hepatitis B virus (HBV) and hepatitis C virus (HCV) based on multicolor CdTe quantum dots (CdTe QDs) and Au nanoparticles (Au NPs). The electrochemically synthesized graphene nanosheets (GNs) were selected as conducting bridge to anchor CdTe QDs{sub 551}-capture DNA{sub HBV} and CdTe QDs{sub 607}-capture DNA{sub HCV} on the glassy carbon electrode (GCE). Then, different concentrations of target DNA{sub HBV} and target DNA{sub HCV} were introduced to hybrid with complementary CdTe QDs-capture DNA. Au NPs-probe DNA{sub HBV} and Au NPs-probe DNA{sub HCV} were modified to the above composite film via hybrid with the unreacted complementary CdTe QDs-capture DNA. Au NPs could quench the electrochemiluminescence (ECL) intensity of CdTe QDs due to the inner filter effect. Therefore, the determination of target DNA{sub HBV} and target DNA{sub HCV} could be achieved by monitoring the ECL DNA sensor based on Au NPs-probe DNA/target DNA/CdTe QDs-capture DNA/GNs/GCE composite film. Under the optimum conditions, the ECL intensity of CdTe QDs{sub 551} and CdTe QDs{sub 607} and the concentration of target DNA{sub HBV} and target DNA{sub HCV} have good linear relationship in the range of 0.0005–0.5 nmol L{sup −1} and 0.001–1.0 nmol L{sup −1} respectively, and the limit of detection were 0.082 pmol L{sup −1} and 0.34 pmol L{sup −1} respectively (S/N = 3). The DNA sensor showed good sensitivity, selectivity, reproducibility and acceptable stability. The proposed DNA sensor has been employed for the determination of target DNA{sub HBV} and target DNA{sub HCV} in human serum samples with satisfactory results. - Highlights: • A novel electrochemiluminescence DNA sensor has been developed for the determination of target DNA{sub HBV} and target DNA{sub HCV}. • The DNA sensor shows good sensitivity, reproducibility and stability. • The ECL provided a

  19. Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

    Science.gov (United States)

    Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

    2004-10-01

    Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and

  20. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  1. DNA-based random number generation in security circuitry.

    Science.gov (United States)

    Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C

    2010-06-01

    DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.

  2. Mapping Base Modifications in DNA by Transverse-Current Sequencing

    Science.gov (United States)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2018-02-01

    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  3. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

    Science.gov (United States)

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

    2017-03-17

    Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. DNA as a component of ER materials

    International Nuclear Information System (INIS)

    Minagawa, K; Aoki, Y; Berber, M R; Mori, T; Tanaka, M

    2009-01-01

    Deoxyribonucleic acid (DNA), which is known as a typical biopolymer, has been utilized for a few types of ER materials. Suspensions were prepared with the particles of DNA, DNA/lipid complexes, and LDH (layered double hydroxide)/DNA composites. The purified DNA showed larger ER effect than the others, but this particle tended to absorb water, which caused less stability. Preliminary experiments of preparing composite with LDH indicated that this inorganic material would be useful for hydrophobic modification of DNA particles, although further optimization of composite preparation is needed. In addition, the LDH/DNA suspensions showed interesting behaviours under some conditions, which indicated possibility for controlling ER property in a wide range.

  5. DNA as a component of ER materials

    Energy Technology Data Exchange (ETDEWEB)

    Minagawa, K; Aoki, Y; Berber, M R [Institute of Technology and Science, University of Tokushima, Tokushima 770-8506 (Japan); Mori, T [Department of Applied Chemistry, Faculty of Engineering, Kyushu University, Fukuoka 819-0395 (Japan); Tanaka, M [Faculty of Pharmaceutical Science, Tokushima Bunri University, Tokushima 770-8514 (Japan)], E-mail: minagawa@chem.tokushima-u.ac.jp

    2009-02-01

    Deoxyribonucleic acid (DNA), which is known as a typical biopolymer, has been utilized for a few types of ER materials. Suspensions were prepared with the particles of DNA, DNA/lipid complexes, and LDH (layered double hydroxide)/DNA composites. The purified DNA showed larger ER effect than the others, but this particle tended to absorb water, which caused less stability. Preliminary experiments of preparing composite with LDH indicated that this inorganic material would be useful for hydrophobic modification of DNA particles, although further optimization of composite preparation is needed. In addition, the LDH/DNA suspensions showed interesting behaviours under some conditions, which indicated possibility for controlling ER property in a wide range.

  6. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  7. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  8. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    Science.gov (United States)

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  9. Using physicochemical and compositional characteristics of DNA sequence for prediction of genomic signals

    KAUST Repository

    Mulamba, Pierre Abraham

    2014-12-01

    The challenge in finding genes in eukaryotic organisms using computational methods is an ongoing problem in the biology. Based on various genomic signals found in eukaryotic genomes, this problem can be divided into many different sub­‐problems such as identification of transcription start sites, translation initiation sites, splice sites, poly (A) signals, etc. Each sub-­problem deals with a particular type of genomic signals and various computational methods are used to solve each sub-­problem. Aggregating information from all these individual sub-­problems can lead to a complete annotation of a gene and its component signals. The fundamental principle of most of these computational methods is the mapping principle – building an input-­output model for the prediction of a particular genomic signal based on a set of known input signals and their corresponding output signal. The type of input signals used to build the model is an essential element in most of these computational methods. The common factor of most of these methods is that they are mainly based on the statistical analysis of the basic nucleotide sequence string composition. 4 Our study is based on a novel approach to predict genomic signals in which uniquely generated structural profiles that combine compressed physicochemical properties with topological and compositional properties of DNA sequences are used to develop machine learning predictive models. The compression of the physicochemical properties is made using principal component analysis transformation. Our ideas are evaluated through prediction models of canonical splice sites using support vector machine models. We demonstrate across several species that the proposed methodology has resulted in the most accurate splice site predictors that are publicly available or described. We believe that the approach in this study is quite general and has various applications in other biological modeling problems.

  10. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

    Science.gov (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

    2013-01-01

    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  11. Oxidative DNA base modifications as factors in carcinogenesis

    International Nuclear Information System (INIS)

    Olinski, R.; Jaruga, P.; Zastawny, T.H.

    1998-01-01

    Reactive oxygen species can cause extensive DNA modifications including modified bases. Some of the DNA base damage has been found to possess premutagenic properties. Therefore, if not repaired, it can contribute to carcinogenesis. We have found elevated amounts of modified bases in cancerous and precancerous tissues as compared with normal tissues. Most of the agents used in anticancer therapy are paradoxically responsible for induction of secondary malignancies and some of them may generate free radicals. The results of our experiments provide evidence that exposure of cancer patients to therapeutic doses of ionizing radiation and anticancer drugs cause base modifications in genomic DNA of lymphocytes. Some of these base damages could lead to mutagenesis in critical genes and ultimately to secondary cancers such as leukemias. This may point to an important role of oxidative base damage in cancer initiation. Alternatively, the increased level of the modified base products may contribute to genetic instability and metastatic potential of tumor cells. (author)

  12. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Fei Chen

    2003-01-01

    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  13. Multiplex electrochemiluminescence DNA sensor for determination of hepatitis B virus and hepatitis C virus based on multicolor quantum dots and Au nanoparticles

    International Nuclear Information System (INIS)

    Liu, Linlin; Wang, Xinyan; Ma, Qiang; Lin, Zihan; Chen, Shufan; Li, Yang; Lu, Lehui; Qu, Hongping; Su, Xingguang

    2016-01-01

    In this work, a novel multiplex electrochemiluminescence (ECL) DNA sensor has been developed for determination of hepatitis B virus (HBV) and hepatitis C virus (HCV) based on multicolor CdTe quantum dots (CdTe QDs) and Au nanoparticles (Au NPs). The electrochemically synthesized graphene nanosheets (GNs) were selected as conducting bridge to anchor CdTe QDs_5_5_1-capture DNA_H_B_V and CdTe QDs_6_0_7-capture DNA_H_C_V on the glassy carbon electrode (GCE). Then, different concentrations of target DNA_H_B_V and target DNA_H_C_V were introduced to hybrid with complementary CdTe QDs-capture DNA. Au NPs-probe DNA_H_B_V and Au NPs-probe DNA_H_C_V were modified to the above composite film via hybrid with the unreacted complementary CdTe QDs-capture DNA. Au NPs could quench the electrochemiluminescence (ECL) intensity of CdTe QDs due to the inner filter effect. Therefore, the determination of target DNA_H_B_V and target DNA_H_C_V could be achieved by monitoring the ECL DNA sensor based on Au NPs-probe DNA/target DNA/CdTe QDs-capture DNA/GNs/GCE composite film. Under the optimum conditions, the ECL intensity of CdTe QDs_5_5_1 and CdTe QDs_6_0_7 and the concentration of target DNA_H_B_V and target DNA_H_C_V have good linear relationship in the range of 0.0005–0.5 nmol L"−"1 and 0.001–1.0 nmol L"−"1 respectively, and the limit of detection were 0.082 pmol L"−"1 and 0.34 pmol L"−"1 respectively (S/N = 3). The DNA sensor showed good sensitivity, selectivity, reproducibility and acceptable stability. The proposed DNA sensor has been employed for the determination of target DNA_H_B_V and target DNA_H_C_V in human serum samples with satisfactory results. - Highlights: • A novel electrochemiluminescence DNA sensor has been developed for the determination of target DNA_H_B_V and target DNA_H_C_V. • The DNA sensor shows good sensitivity, reproducibility and stability. • The ECL provided a convenient, low-cost, sensitive, and specific method for target DNA

  14. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  15. RNA-Based Assessment of Diversity and Composition of Active Archaeal Communities in the German Bight

    Directory of Open Access Journals (Sweden)

    Bernd Wemheuer

    2012-01-01

    Full Text Available Archaea play an important role in various biogeochemical cycles. They are known extremophiles inhabiting environments such as thermal springs or hydrothermal vents. Recent studies have revealed a significant abundance of Archaea in moderate environments, for example, temperate sea water. Nevertheless, the composition and ecosystem function of these marine archaeal communities is largely unknown. To assess diversity and composition of active archaeal communities in the German Bight, seven marine water samples were taken and studied by RNA-based analysis of ribosomal 16S rRNA. For this purpose, total RNA was extracted from the samples and converted to cDNA. Archaeal community structures were investigated by pyrosequencing-based analysis of 16S rRNA amplicons generated from cDNA. To our knowledge, this is the first study combining next-generation sequencing and metatranscriptomics to study archaeal communities in marine habitats. The pyrosequencing-derived dataset comprised 62,045 archaeal 16S rRNA sequences. We identified Halobacteria as the predominant archaeal group across all samples with increased abundance in algal blooms. Thermoplasmatales (Euryarchaeota and the Marine Group I (Thaumarchaeota were identified in minor abundances. It is indicated that archaeal community patterns were influenced by environmental conditions.

  16. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  17. A nuclear DNA-based species determination and DNA quantification assay for common poultry species.

    Science.gov (United States)

    Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S

    2014-12-01

    DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.

  18. Polypyrrole–gold nanoparticle composites for highly sensitive DNA detection

    International Nuclear Information System (INIS)

    Spain, Elaine; Keyes, Tia E.; Forster, Robert J.

    2013-01-01

    DNA capture surfaces represent a powerful approach to developing highly sensitive sensors for identifying the cause of infection. Electrochemically deposited polypyrrole, PPy, films have been functionalized with electrodeposited gold nanoparticles to give a nanocomposite material, PPy–AuNP. Thiolated capture strand DNA, that is complementary to the sequence from the pathogen Staphylococcus aureus that causes mammary gland inflammation, was then immobilized onto the gold nanoparticles and any of the underlying gold electrode that is exposed. A probe strand, labelled with horse radish peroxidase, HRP, was then hybridized to the target. The concentration of the target was determined by measuring the current generated by reducing benzoquinone produced by the HRP label. Semi-log plots of the pathogen DNA concentration vs. faradaic current are linear from 150 pM to 1 μM and pM concentrations can be detected without the need for molecular, e.g., PCR or NASBA, amplification. The nanocomposite also exhibits excellent selectivity and single base mismatches in a 30 mer sequence can be detected

  19. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

  20. Ultraviolet enhancement of DNA base release by bleomycin

    International Nuclear Information System (INIS)

    Kakinuma, J.; Tanabe, M.; Orii, H.

    1984-01-01

    The effect of UV irradiation on base-releasing activity of bleomycin was studied on bleomycin A 2 -DNA reaction mixture in the presence of Fe(II) and 2-mercaptoethanol. This effect was measured by the release of free bases from calf thymus DNA with high-performance liquid chromatography. UV irradiation enhanced DNA base-releasing activity of bleomycin and simultaneously caused disappearance of fluorescence emission maximum at 355 nm assigned to bithiazole rings and increase in the intensity of a peak at 400 nm. UV irradiation at 295 nm, the UV absorption maximum of bleomycin, is the most effective in releasing free bases and in changing fluorescence emission patterns. From these results, we suggest that some alterations in the bithiazole group of bleomycin molecule were initiated by UV irradiation and contributed to increased base-releasing activity of bleomycin through a yet unexplained mechanism, presumably through bleomycin dimer formation. (orig.)

  1. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  3. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  4. DNA Based Electrochromic and Photovoltaic Cells

    Science.gov (United States)

    2012-01-01

    using deoxyribonucleic acid complex as an electron blocking layer App. Phys. Lett. 88 (2006) 171109. 23. F.H.C. Crick , J.D. Watson . The complementary...9550-09-1-0647 final 01-09-2009 ; 30-11-2011 DNA Based Electrochromic and Photovoltaic Cells FA 9550-09-1-0647 Pawlicka, Agnieszka, J. Instituto de...Available. DNA is an abundant natural product with very good biodegradation properties and can be used to obtain gel polymer electrolytes (GPEs) with high

  5. A Rewritable, Random-Access DNA-Based Storage System.

    Science.gov (United States)

    Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica

    2015-09-18

    We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.

  6. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  7. Communication: Electron ionization of DNA bases

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, M. A.; Krishnakumar, E., E-mail: ekkumar@tifr.res.in

    2016-04-28

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.

  8. Using pseudoalignment and base quality to accurately quantify microbial community composition.

    Directory of Open Access Journals (Sweden)

    Mark Reppell

    2018-04-01

    Full Text Available Pooled DNA from multiple unknown organisms arises in a variety of contexts, for example microbial samples from ecological or human health research. Determining the composition of pooled samples can be difficult, especially at the scale of modern sequencing data and reference databases. Here we propose a novel method for taxonomic profiling in pooled DNA that combines the speed and low-memory requirements of k-mer based pseudoalignment with a likelihood framework that uses base quality information to better resolve multiply mapped reads. We apply the method to the problem of classifying 16S rRNA reads using a reference database of known organisms, a common challenge in microbiome research. Using simulations, we show the method is accurate across a variety of read lengths, with different length reference sequences, at different sample depths, and when samples contain reads originating from organisms absent from the reference. We also assess performance in real 16S data, where we reanalyze previous genetic association data to show our method discovers a larger number of quantitative trait associations than other widely used methods. We implement our method in the software Karp, for k-mer based analysis of read pools, to provide a novel combination of speed and accuracy that is uniquely suited for enhancing discoveries in microbial studies.

  9. Assessment of Carbon- and Metal-Based Nanoparticle DNA Damage with Microfluidic Electrophoretic Separation Technology.

    Science.gov (United States)

    Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M

    2015-02-01

    In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.

  10. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  11. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  12. PCR-based detection of a rare linear DNA in cell culture.

    Science.gov (United States)

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  13. Evolutionary implications of inversions that have caused intra-strand parity in DNA

    Directory of Open Access Journals (Sweden)

    Wei John

    2007-06-01

    Full Text Available Abstract Background Chargaff's rule of DNA base composition, stating that DNA comprises equal amounts of adenine and thymine (%A = %T and of guanine and cytosine (%C = %G, is well known because it was fundamental to the conception of the Watson-Crick model of DNA structure. His second parity rule stating that the base proportions of double-stranded DNA are also reflected in single-stranded DNA (%A = %T, %C = %G is more obscure, likely because its biological basis and significance are still unresolved. Within each strand, the symmetry of single nucleotide composition extends even further, being demonstrated in the balance of di-, tri-, and multi-nucleotides with their respective complementary oligonucleotides. Results Here, we propose that inversions are sufficient to account for the symmetry within each single-stranded DNA. Human mitochondrial DNA does not demonstrate such intra-strand parity, and we consider how its different functional drivers may relate to our theory. This concept is supported by the recent observation that inversions occur frequently. Conclusion Along with chromosomal duplications, inversions must have been shaping the architecture of genomes since the origin of life.

  14. Improved chaos-based video steganography using DNA alphabets

    Directory of Open Access Journals (Sweden)

    Nirmalya Kar

    2018-03-01

    Full Text Available DNA based steganography plays a vital role in the field of privacy and secure communication. Here, we propose a DNA properties-based mechanism to send data hidden inside a video file. Initially, the video file is converted into image frames. Random frames are then selected and data is hidden in these at random locations by using the Least Significant Bit substitution method. We analyze the proposed architecture in terms of peak signal-to-noise ratio as well as mean squared error measured between the original and steganographic files averaged over all video frames. The results show minimal degradation of the steganographic video file. Keywords: Chaotic map, DNA, Linear congruential generator, Video steganography, Least significant bit

  15. The effect of material composition of 3-dimensional graphene oxide and self-doped polyaniline nanocomposites on DNA analytical sensitivity.

    Science.gov (United States)

    Yang, Tao; Chen, Huaiyin; Yang, Ruirui; Wang, Xinxing; Nan, Fuxin; Jiao, Kui

    2015-09-01

    Until now, morphology effects of 2-dimensional or 3-dimensional graphene nanocomposites and the effect of material composition on the biosensors have been rarely reported. In this paper, the various nanocomposites based on graphene oxide and self-doped polyaniline nanofibres for studying the effect of morphology and material composition on DNA sensitivity were directly reported. The isolation and dispersion of graphene oxide were realized via intercalated self-doped polyaniline and ultrasonication, where the ultrasonication prompts the aggregates of graphite oxide to break up and self-doped polyaniline to diffuse into the stacked graphene oxide. Significant electrochemical enhancement has been observed due to the existence of self-doped polyaniline, which bridges the defects for electron transfer and, in the mean time, increases the basal spacing between graphene oxide sheets. Different morphologies can result in different ssDNA surface density, which can further influence the hybridization efficiency. Compared with 2-dimensional graphene oxide, self-doped polyaniline and other morphologies of nanocomposites, 3-dimensional graphene oxide-self-doped polyaniline nanowalls exhibited the highest surface density and hybridization efficiency. Furthermore, the fabricated biosensors presented the broad detection range with the low detection limit due to the specific surface area, a large number of electroactive species, and open accessible space supported by nanowalls. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Detailed screening of the soil faunal diversity using a tiered DNA metabarcoding approach

    DEFF Research Database (Denmark)

    Groot, G.A. de; Geisen, S.; Costa, D.

    is not a realistic proposition. DNA-based approaches, especially high-throughput DNA metabarcoding assays, potentially solve this issue, but the development of such methods targeting soil fauna lags far behind that of soil microbes. Within the EU FP7-project EcoFINDERS, we developed and tested a framework...... analyzed to obtain high resolution data for six different groups: mites, collembola, enchytraeids, nematodes, earthworms and protists. New primer sets, as well as reference barcode datasets were established for several of them. Here, we show the results of two test runs based on 454 pyrosequencing....... In the first run, artificially created DNA pools of known composition were analysed to test to which extent the taxonomic composition could successfully be retrieved. Preliminary results show that for all groups the majority of species in the DNA pool were recovered by the metabarcoding approach. By comparing...

  17. DNA hybridization sensor based on pentacene thin film transistor.

    Science.gov (United States)

    Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang

    2011-01-15

    A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu

    2010-12-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  19. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun

    2010-01-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  20. Triple-helix molecular switch-based aptasensors and DNA sensors.

    Science.gov (United States)

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Mixed DNA/Oligo(ethylene glycol) Functionalized Gold Surface Improve DNA Hybridization in Complex Media

    International Nuclear Information System (INIS)

    Lee, C.; Gamble, L.; Grainger, D.; Castner, D.

    2006-01-01

    Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s→π* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein

  2. The current state of eukaryotic DNA base damage and repair.

    Science.gov (United States)

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-02

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. DNA polymorphism sensitive impedimetric detection on gold-nanoislands modified electrodes.

    Science.gov (United States)

    Bonanni, Alessandra; Pividori, Maria Isabel; del Valle, Manel

    2015-05-01

    Nanocomposite materials are being increasingly used in biosensing applications as they can significantly improve biosensor performance. Here we report the use of a novel impedimetric genosensor based on gold nanoparticles graphite-epoxy nanocomposite (nanoAu-GEC) for the detection of triple base mutation deletion in a cystic-fibrosis (CF) related human DNA sequence. The developed platform consists of chemisorbing gold nano-islands surrounded by rigid, non-chemisorbing, and conducting graphite-epoxy composite. The ratio of the gold nanoparticles in the composite was carefully optimized by electrochemical and microscopy studies. Such platform allows the very fast and stable thiol immobilization of DNA probes on the gold islands, thus minimizing the steric and electrostatic repulsion among the DNA probes and improving the detection of DNA polymorphism down to 2.25fmol by using electrochemical impedance spectroscopy. These findings are very important in order to develop new and renewable platforms to be used in point-of-care devices for the detection of biomolecules. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. High-speed DNA-based rolling motors powered by RNase H

    Science.gov (United States)

    Yehl, Kevin; Mugler, Andrew; Vivek, Skanda; Liu, Yang; Zhang, Yun; Fan, Mengzhen; Weeks, Eric R.

    2016-01-01

    DNA-based machines that walk by converting chemical energy into controlled motion could be of use in applications such as next generation sensors, drug delivery platforms, and biological computing. Despite their exquisite programmability, DNA-based walkers are, however, challenging to work with due to their low fidelity and slow rates (~1 nm/min). Here, we report DNA-based machines that roll rather than walk, and consequently have a maximum speed and processivity that is three-orders of magnitude greater than conventional DNA motors. The motors are made from DNA-coated spherical particles that hybridise to a surface modified with complementary RNA; motion is achieved through the addition of RNase H, which selectively hydrolyses hybridised RNA. Spherical motors move in a self-avoiding manner, whereas anisotropic particles, such as dimerised particles or rod-shaped particles travel linearly without a track or external force. Finally, we demonstrate detection of single nucleotide polymorphism by measuring particle displacement using a smartphone camera. PMID:26619152

  5. Wood-based composite materials : panel products, glued-laminated timber, structural composite lumber, and wood-nonwood composite materials

    Science.gov (United States)

    Nicole M. Stark; Zhiyong Cai; Charles Carll

    2010-01-01

    This chapter gives an overview of the general types and composition of wood-based composite products and the materials and processes used to manufacture them. It describes conventional wood-based composite panels and structural composite materials intended for general construction, interior use, or both. This chapter also describes wood–nonwood composites. Mechanical...

  6. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  7. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    Science.gov (United States)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  8. Induced Polarization Influences the Fundamental Forces in DNA Base Flipping

    OpenAIRE

    Lemkul, Justin A.; Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Base flipping in DNA is an important process involved in genomic repair and epigenetic control of gene expression. The driving forces for these processes are not fully understood, especially in the context of the underlying dynamics of the DNA and solvent effects. We studied double-stranded DNA oligomers that have been previously characterized by imino proton exchange NMR using both additive and polarizable force fields. Our results highlight the importance of induced polarization on the base...

  9. pH-induced fabrication of DNA/chitosan/α-ZrP nanocomposite and DNA release

    International Nuclear Information System (INIS)

    Liu Limin; Zhang Haitang; Shen Bo; He Weijiang; Lu Guoyuan; Liu Yuge; Zhu Junjie

    2010-01-01

    With positively charged chitosan as an intermediary, herring sperm DNA was intercalated into the interlayer galleries of negatively charged α-ZrP to form DNA/chitosan/α-ZrP ternary hybrids at pH 5.5. Fourier-transform IR, x-ray diffraction and scanning electron microscopy confirmed not only the coexistence of DNA, chitosan and α-ZrP in the composite but also the layered composite structure with an interlayer distance of 4.25 nm. Circular dichroism (CD) and UV spectroscopic studies disclosed that the restraint of DNA by the layered α-ZrP favors stabilization of the double-helical conformation of DNA and enhances the denaturation temperature. The intercalated DNA can be effectively released from the ternary nanocomposites at pHs higher than 6.5, and the released DNA displayed a similar CD spectrum to that of free DNA. The current research displays the promising potential to obtain a non-viral gene vector by intercalating DNA into negatively charged inorganic layered materials in the presence of a positively charged intermediary.

  10. Cytophotometric and biochemical analyses of DNA in pentaploid and diploid Agave species.

    Science.gov (United States)

    Cavallini, A; Natali, L; Cionini, G; Castorena-Sanchez, I

    1996-04-01

    Nuclear DNA content, chromatin structure, and DNA composition were investigated in four Agave species: two diploid, Agave tequilana Weber and Agave angustifolia Haworth var. marginata Hort., and two pentaploid, Agave fourcroydes Lemaire and Agave sisalana Perrine. It was determined that the genome size of pentaploid species is nearly 2.5 times that of diploid ones. Cytophotometric analyses of chromatin structure were performed following Feulgen or DAPI staining to determine optical density profiles of interphase nuclei. Pentaploid species showed higher frequencies of condensed chromatin (heterochromatin) than diploid species. On the other hand, a lower frequency of A-T rich (DAPI stained) heterochromatin was found in pentaploid species than in diploid ones, indicating that heterochromatin in pentaploid species is made up of sequences with base compositions different from those of diploid species. Since thermal denaturation profiles of extracted DNA showed minor variations in the base composition of the genomes of the four species, it is supposed that, in pentaploid species, the large heterochromatin content is not due to an overrepresentation of G-C repetitive sequences but rather to the condensation of nonrepetitive sequences, such as, for example, redundant gene copies switched off in the polyploid complement. It is suggested that speciation in the genus Agave occurs through point mutations and minor DNA rearrangements, as is also indicated by the relative stability of the karyotype of this genus. Key words : Agave, DNA cytophotometry, DNA melting profiles, chromatin structure, genome size.

  11. Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

    Science.gov (United States)

    Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

    2005-10-01

    The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

  12. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    Science.gov (United States)

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  13. A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis

    Science.gov (United States)

    Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan

    2009-01-01

    DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301

  14. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

    1991-01-01

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  15. Recognition of base J in duplex DNA by J-binding protein

    NARCIS (Netherlands)

    Sabatini, Robert; Meeuwenoord, Nico; van Boom, Jacques H.; Borst, Piet

    2002-01-01

    beta-d-Glucosylhydroxymethyluracil, also called base J, is an unusual modified DNA base conserved among Kinetoplastida. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes. We have previously found a J-binding

  16. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Science.gov (United States)

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  17. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  18. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  19. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DNA methylation based biomarkers: Practical considerations and applications

    DEFF Research Database (Denmark)

    Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg

    2012-01-01

    of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...

  1. Self-assembly of multiferroic core-shell particulate nanocomposites through DNA-DNA hybridization and magnetic field directed assembly of superstructures

    Energy Technology Data Exchange (ETDEWEB)

    Sreenivasulu, Gollapudi; Srinivasan, Gopalan, E-mail: srinivas@oakland.edu, E-mail: chavez@oakland.edu [Department of Physics, Oakland University, Rochester, MI 48309-4401 (United States); Lochbiler, Thomas A.; Panda, Manashi; Chavez, Ferman A., E-mail: srinivas@oakland.edu, E-mail: chavez@oakland.edu [Department of Chemistry, Oakland University, Rochester, MI 48309-4401 (United States)

    2016-04-15

    Multiferroic composites of ferromagnetic and ferroelectric phases are of importance for studies on mechanical strain mediated coupling between the magnetic and electric subsystems. This work is on DNA-assisted self-assembly of superstructures of such composites with nanometer periodicity. The synthesis involved oligomeric DNA-functionalized ferroelectric and ferromagnetic nanoparticles, 600 nm BaTiO{sub 3} (BTO) and 200 nm NiFe{sub 2}O{sub 4} (NFO), respectively. Mixing BTO and NFO particles, possessing complementary DNA sequences, resulted in the formation of ordered core-shell heteronanocomposites held together by DNA hybridization. The composites were imaged by scanning electron microscopy and scanning microwave microscopy. The presence of heteroassemblies along with core-shell architecture is clearly observed. The reversible nature of the DNA hybridization allows for restructuring the composites into mm-long linear chains and 2D-arrays in the presence of a static magnetic field and ring-like structures in a rotating-magnetic field. Strong magneto-electric (ME) coupling in as-assembled composites is evident from static magnetic field H induced polarization and low-frequency magnetoelectric voltage coefficient measurements. Upon annealing the nanocomposites at high temperatures, evidence for the formation of bulk composites with excellent cross-coupling between the electric and magnetic subsystems is obtained by H-induced polarization and low-frequency ME voltage coefficient. The ME coupling strength in the self-assembled composites is measured to be much stronger than in bulk composites with randomly distributed NFO and BTO prepared by direct mixing and sintering.

  2. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  3. Indicator Based and Indicator - Free Electrochemical DNA Biosensors

    National Research Council Canada - National Science Library

    Kerman, Kagan

    2001-01-01

    The utility and advantages of an indicator free and MB based sequence specific DNA hybridization biosensor based on guanine and adenine oxidation signals and MB reduction signals have been demonstrated...

  4. DNA-Based Self-Assembly of Fluorescent Nanodiamonds.

    Science.gov (United States)

    Zhang, Tao; Neumann, Andre; Lindlau, Jessica; Wu, Yuzhou; Pramanik, Goutam; Naydenov, Boris; Jelezko, Fedor; Schüder, Florian; Huber, Sebastian; Huber, Marinus; Stehr, Florian; Högele, Alexander; Weil, Tanja; Liedl, Tim

    2015-08-12

    As a step toward deterministic and scalable assembly of ordered spin arrays we here demonstrate a bottom-up approach to position fluorescent nanodiamonds (NDs) with nanometer precision on DNA origami structures. We have realized a reliable and broadly applicable surface modification strategy that results in DNA-functionalized and perfectly dispersed NDs that were then self-assembled in predefined geometries. With optical studies we show that the fluorescence properties of the nitrogen-vacancy color centers in NDs are preserved during surface modification and DNA assembly. As this method allows the nanoscale arrangement of fluorescent NDs together with other optically active components in complex geometries, applications based on self-assembled spin lattices or plasmon-enhanced spin sensors as well as improved fluorescent labeling for bioimaging could be envisioned.

  5. Electrochemical DNA biosensor based on grafting-to mode of terminal deoxynucleoside transferase-mediated extension.

    Science.gov (United States)

    Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua

    2017-12-15

    Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Slow elimination of injured liver DNA bases of γ-irradiated old mice

    International Nuclear Information System (INIS)

    Gaziev, A.I.; Malakhov, L.V.; Fomenko, L.A.

    1982-01-01

    The paper presents a study of the elimination of injured bases from the liver DNA of old and young mice after their exposure to γ rays. The presented data show that if DNA from the liver of irradiated mice is treated with incision enzymes, its priming activity is increased. In the case of enzymatic treatment of DNA isolated 5 h after irradiation we find a great difference between the priming activity of the liver DNA of old and young mice. The reason for this difference is that the liver DNA of 20-month old mice 5 h after irradiation still has many unrepaired injured bases. These data indicated that the rate of incision of γ-injured DNA bases in the liver of old mice is lower than in the liver of young mice. In the liver of mice of different age the rate of restitution of DNA, single-strand breaks induced by γ rays in doses up to 100 Gy is the same. At the same time, the level of induced reparative synthesis of DNA in cells of an old organism is lower than in cells of a young organism. The obtained data suggest that reduction of the rate of elimination of modified bases from the cell DNA of 20-month old mice is due to reduction of the activity of the DNA repair enzymes or to restrictions in the chromatin in the access of these enzymes to the injured regions of DNA in the cells of old animals

  7. DNA/RNA-based formulations for treatment of breast cancer.

    Science.gov (United States)

    Xie, Zhaolu; Zeng, Xianghui

    2017-12-01

    To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.

  8. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  9. DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity

    NARCIS (Netherlands)

    Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard

    2008-01-01

    This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to

  10. Nanocellulose based polymer composite for acoustical materials

    Science.gov (United States)

    Farid, Mohammad; Purniawan, Agung; Susanti, Diah; Priyono, Slamet; Ardhyananta, Hosta; Rahmasita, Mutia E.

    2018-04-01

    Natural fibers are biodegradable materials that are innovatively and widely used for composite reinforcement in automotive components. Nanocellulose derived from natural fibers oil palm empty bunches have properties that are remarkable for use as a composite reinforcement. However, there have not been many investigations related to the use of nanocellulose-based composites for wideband sound absorption materials. The specimens of nanocellulose-based polyester composite were prepared using a spray method. An impedance tube method was used to measure the sound absorption coefficient of this composite material. To reveal the characteristics of the nanocellulose-based polyester composite material, SEM (scanning electron microscope), TEM (Transmission Electron Microscope), FTIR (Fourier Transform Infra Red), TGA (Thermogravimetric Analysis), and density tests were performed. Sound absorption test results showed the average value of sound absorption coefficient of 0.36 to 0,46 for frequency between 500 and 4000 Hz indicating that this nanocellulose-based polyester composite materials had a tendency to wideband sound absorption materials and potentially used as automotive interior materials.

  11. Highly sensitive DNA sensors based on cerium oxide nanorods

    Science.gov (United States)

    Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh

    2018-04-01

    In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.

  12. Bacterial radiosensitivity to gamma and ultraviolet. Compositional dependence and repair mechanisms

    International Nuclear Information System (INIS)

    Saez Angulo, R. M.; Davila, C. A.

    1974-01-01

    The gamma and ultraviolet radiosensitivity of several species of bacteria has been determined its dependence on DNAs composition and repair processes has been studied. Base composition are evaluated by chromatography, DNA melting temperature and isopycnic sedimentation on CsCl gradient. Repair capacity of gamma -and UV- lesions has been studied in two bacterial strains with same DMA base composition. It is concluded that the postulated correlation between radiosensitivity and base composition can not be generalized, the enzymatic repair mechanisms being of determining on radiosensitivity. (Author) 248 refs

  13. Effect of room temperature transport vials on DNA quality and phylogenetic composition of faecal microbiota of elderly adults and infants.

    LENUS (Irish Health Repository)

    Hill, Cian J

    2016-05-01

    Alterations in intestinal microbiota have been correlated with a growing number of diseases. Investigating the faecal microbiota is widely used as a non-invasive and ethically simple proxy for intestinal biopsies. There is an urgent need for collection and transport media that would allow faecal sampling at distance from the processing laboratory, obviating the need for same-day DNA extraction recommended by previous studies of freezing and processing methods for stool. We compared the faecal bacterial DNA quality and apparent phylogenetic composition derived using a commercial kit for stool storage and transport (DNA Genotek OMNIgene GUT) with that of freshly extracted samples, 22 from infants and 20 from older adults.

  14. Biosensor for label-free DNA quantification based on functionalized LPGs.

    Science.gov (United States)

    Gonçalves, Helena M R; Moreira, Luis; Pereira, Leonor; Jorge, Pedro; Gouveia, Carlos; Martins-Lopes, Paula; Fernandes, José R A

    2016-10-15

    A label-free fiber optic biosensor based on a long period grating (LPG) and a basic optical interrogation scheme using off the shelf components is used for the detection of in-situ DNA hybridization. A new methodology is proposed for the determination of the spectral position of the LPG mode resonance. The experimental limit of detection obtained for the DNA was 62±2nM and the limit of quantification was 209±7nM. The sample specificity was experimentally demonstrated using DNA targets with different base mismatches relatively to the probe and was found that the system has a single base mismatch selectivity. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. The chloroplast and mitochondrial DNA type are correlated with the nuclear composition of somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia.

    Science.gov (United States)

    Wolters, A M; Koornneef, M; Gilissen, L J

    1993-09-01

    This paper describes the analysis of chloroplast (cp) DNA and mitochondrial (mt) DNA in 21 somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia by means of Southern-blot hybridization. Each of these calli contained only one type of cpDNA; 14 had the N. plumbaginifolia (Np) type and seven the S. tuberosum (St) type. N. plumbaginifolia cpDNA was present in hybrids previously shown to contain predominantly N. plumbaginifolia chromosomes whereas hybrids in which S. tuberosum chromosomes predominated possessed cpDNA from potato. We have analyzed the mtDNA of these 21 somatic hybrid calli using four restriction enzyme/probe combinations. Most fusion products had only, or mostly, mtDNA fragments from the parent that predominated in the nucleus. The hybrids containing mtDNA fragments from only one parent (and new fragments) also possessed chloroplasts from the same species. The results suggest the existence of a strong nucleo-cytoplasmic incongruity which affects the genome composition of somatic hybrids between distantly related species.

  16. Composites Similarity Analysis Method Based on Knowledge Set in Composites Quality Control

    OpenAIRE

    Li Haifeng

    2016-01-01

    Composites similarity analysis is an important link of composites review, it can not only to declare composites review rechecking, still help composites applicants promptly have the research content relevant progress and avoid duplication. This paper mainly studies the composites similarity model in composites review. With the actual experience of composites management, based on the author’s knowledge set theory, paper analyzes deeply knowledge set representation of composites knowledge, impr...

  17. DNA Array-Based Gene Profiling

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario

    2005-01-01

    Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987

  18. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    Science.gov (United States)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  19. Characterization of polymer, DNA-based, and silk thin film resistivities and of DNA-based films prepared for enhanced electrical conductivity

    Science.gov (United States)

    Yaney, Perry P.; Ouchen, Fahima; Grote, James G.

    2009-08-01

    DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.

  20. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    Science.gov (United States)

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  1. One-Dimensional Multichromophor Arrays Based on DNA: From Self-Assembly to Light-Harvesting.

    Science.gov (United States)

    Ensslen, Philipp; Wagenknecht, Hans-Achim

    2015-10-20

    Light-harvesting complexes collect light energy and deliver it by a cascade of energy and electron transfer processes to the reaction center where charge separation leads to storage as chemical energy. The design of artificial light-harvesting assemblies faces enormous challenges because several antenna chromophores need to be kept in close proximity but self-quenching needs to be avoided. Double stranded DNA as a supramolecular scaffold plays a promising role due to its characteristic structural properties. Automated DNA synthesis allows incorporation of artificial chromophore-modified building blocks, and sequence design allows precise control of the distances and orientations between the chromophores. The helical twist between the chromophores, which is induced by the DNA framework, controls energy and electron transfer and thereby reduces the self-quenching that is typically observed in chromophore aggregates. This Account summarizes covalently multichromophore-modified DNA and describes how such multichromophore arrays were achieved by Watson-Crick-specific and DNA-templated self-assembly. The covalent DNA systems were prepared by incorporation of chromophores as DNA base substitutions (either as C-nucleosides or with acyclic linkers as substitutes for the 2'-deoxyribofuranoside) and as DNA base modifications. Studies with DNA base substitutions revealed that distances but more importantly relative orientations of the chromophores govern the energy transfer efficiencies and thereby the light-harvesting properties. With DNA base substitutions, duplex stabilization was faced and could be overcome, for instance, by zipper-like placement of the chromophores in both strands. For both principal structural approaches, DNA-based light-harvesting antenna could be realized. The major disadvantages, however, for covalent multichromophore DNA conjugates are the poor yields of synthesis and the solubility issues for oligonucleotides with more than 5-10 chromophore

  2. Processing and characterization of bio-based composites

    Science.gov (United States)

    Lu, Hong

    Much research has focused on bio-based composites as a potential material to replace petroleum-based plastics. Considering the high price of Polyhydroxyalkanoates (PHAs), PHA/ Distiller's Dried Grains with Solubles (DDGS) composite is a promising economical and high-performance biodegradable material. In this paper, we discuss the effect of DDGS on PHA composites in balancing cost with material performance. Poly (lactic acid) PLA/DDGS composite is another excellent biodegradable composite, although as a bio-based polymer its degradation time is relatively long. The goal of this research is therefore to accelerate the degradation process for this material. Both bio-based composites were extruded through a twin-screw microcompounder, and the two materials were uniformly mixed. The morphology of the samples was examined using a Scanning Electron Microscope (SEM); thermal stability was determined with a Thermal Gravimetric Analyzer (TGA); other thermal properties were studied using Differential Scanning Calorimetry (DSC) and a Dynamic Mechanical Analyzer (DMA). Viscoelastic properties were also evaluated using a Rheometer.

  3. DNA-based construction at the nanoscale: emerging trends and applications

    Science.gov (United States)

    Lourdu Xavier, P.; Chandrasekaran, Arun Richard

    2018-02-01

    The field of structural DNA nanotechnology has evolved remarkably—from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes—in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.

  4. Oxidatively-induced DNA damage and base excision repair in euthymic patients with bipolar disorder.

    Science.gov (United States)

    Ceylan, Deniz; Tuna, Gamze; Kirkali, Güldal; Tunca, Zeliha; Can, Güneş; Arat, Hidayet Ece; Kant, Melis; Dizdaroglu, Miral; Özerdem, Ayşegül

    2018-05-01

    Oxidatively-induced DNA damage has previously been associated with bipolar disorder. More recently, impairments in DNA repair mechanisms have also been reported. We aimed to investigate oxidatively-induced DNA lesions and expression of DNA glycosylases involved in base excision repair in euthymic patients with bipolar disorder compared to healthy individuals. DNA base lesions including both base and nucleoside modifications were measured using gas chromatography-tandem mass spectrometry and liquid chromatography-tandem mass spectrometry with isotope-dilution in DNA samples isolated from leukocytes of euthymic patients with bipolar disorder (n = 32) and healthy individuals (n = 51). The expression of DNA repair enzymes OGG1 and NEIL1 were measured using quantitative real-time polymerase chain reaction. The levels of malondialdehyde were measured using high performance liquid chromatography. Seven DNA base lesions in DNA of leukocytes of patients and healthy individuals were identified and quantified. Three of them had significantly elevated levels in bipolar patients when compared to healthy individuals. No elevation of lipid peroxidation marker malondialdehyde was observed. The level of OGG1 expression was significantly reduced in bipolar patients compared to healthy individuals, whereas the two groups exhibited similar levels of NEIL1 expression. Our results suggest that oxidatively-induced DNA damage occurs and base excision repair capacity may be decreased in bipolar patients when compared to healthy individuals. Measurement of oxidatively-induced DNA base lesions and the expression of DNA repair enzymes may be of great importance for large scale basic research and clinical studies of bipolar disorder. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  6. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  8. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  9. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  10. Opto-electronic DNA chip-based integrated card for clinical diagnostics.

    Science.gov (United States)

    Marchand, Gilles; Broyer, Patrick; Lanet, Véronique; Delattre, Cyril; Foucault, Frédéric; Menou, Lionel; Calvas, Bernard; Roller, Denis; Ginot, Frédéric; Campagnolo, Raymond; Mallard, Frédéric

    2008-02-01

    Clinical diagnostics is one of the most promising applications for microfluidic lab-on-a-chip or lab-on-card systems. DNA chips, which provide multiparametric data, are privileged tools for genomic analysis. However, automation of molecular biology protocol and use of these DNA chips in fully integrated systems remains a great challenge. Simplicity of chip and/or card/instrument interfaces is amongst the most critical issues to be addressed. Indeed, current detection systems for DNA chip reading are often complex, expensive, bulky and even limited in terms of sensitivity or accuracy. Furthermore, for liquid handling in the lab-on-cards, many devices use complex and bulky systems, either to directly manipulate fluids, or to ensure pneumatic or mechanical control of integrated valves. All these drawbacks prevent or limit the use of DNA-chip-based integrated systems, for point-of-care testing or as a routine diagnostics tool. We present here a DNA-chip-based protocol integration on a plastic card for clinical diagnostics applications including: (1) an opto-electronic DNA-chip, (2) fluid handling using electrically activated embedded pyrotechnic microvalves with closing/opening functions. We demonstrate both fluidic and electric packaging of the optoelectronic DNA chip without major alteration of its electronical and biological functionalities, and fluid control using novel electrically activable pyrotechnic microvalves. Finally, we suggest a complete design of a card dedicated to automation of a complex biological protocol with a fully electrical fluid handling and DNA chip reading.

  11. Macro-Fiber Composite Based Transduction

    Science.gov (United States)

    2016-03-01

    substrate Material properties of single crystal macro fiber composite actuators for active twist rotor blades Park, Jae-Sang (Seoul National...Passive Smart Structures and Integrated Systems 2007 Material properties of single crystal macro fiber composite actuators for active twist rotor ...19b. TELEPHONE NUMBER (Include area code) 10-03-20 16 Final Report 01 Jan 2013 - 31 Dec 2015 Macro-Fiber Composite Based Transduction N000-14-13-1-0212

  12. UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.

    Science.gov (United States)

    Baldock, Brandi L; Hutchison, James E

    2016-12-20

    DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.

  13. Trial watch: Naked and vectored DNA-based anticancer vaccines.

    Science.gov (United States)

    Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

    2015-05-01

    One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

  14. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

    Science.gov (United States)

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-02-28

    Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

  15. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  17. Application of DNA-based methods in forensic entomology.

    Science.gov (United States)

    Wells, Jeffrey D; Stevens, Jamie R

    2008-01-01

    A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.

  18. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    Science.gov (United States)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  19. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  20. DNA methylation patterns in cord blood DNA and body size in childhood.

    Directory of Open Access Journals (Sweden)

    Caroline L Relton

    Full Text Available Epigenetic markings acquired in early life may have phenotypic consequences later in development through their role in transcriptional regulation with relevance to the developmental origins of diseases including obesity. The goal of this study was to investigate whether DNA methylation levels at birth are associated with body size later in childhood.A study design involving two birth cohorts was used to conduct transcription profiling followed by DNA methylation analysis in peripheral blood. Gene expression analysis was undertaken in 24 individuals whose biological samples and clinical data were collected at a mean ± standard deviation (SD age of 12.35 (0.95 years, the upper and lower tertiles of body mass index (BMI were compared with a mean (SD BMI difference of 9.86 (2.37 kg/m(2. This generated a panel of differentially expressed genes for DNA methylation analysis which was then undertaken in cord blood DNA in 178 individuals with body composition data prospectively collected at a mean (SD age of 9.83 (0.23 years. Twenty-nine differentially expressed genes (>1.2-fold and p<10(-4 were analysed to determine DNA methylation levels at 1-3 sites per gene. Five genes were unmethylated and DNA methylation in the remaining 24 genes was analysed using linear regression with bootstrapping. Methylation in 9 of the 24 (37.5% genes studied was associated with at least one index of body composition (BMI, fat mass, lean mass, height at age 9 years, although only one of these associations remained after correction for multiple testing (ALPL with height, p(Corrected = 0.017.DNA methylation patterns in cord blood show some association with altered gene expression, body size and composition in childhood. The observed relationship is correlative and despite suggestion of a mechanistic epigenetic link between in utero life and later phenotype, further investigation is required to establish causality.

  1. Composite Techniques Based Color Image Compression

    Directory of Open Access Journals (Sweden)

    Zainab Ibrahim Abood

    2017-03-01

    Full Text Available Compression for color image is now necessary for transmission and storage in the data bases since the color gives a pleasing nature and natural for any object, so three composite techniques based color image compression is implemented to achieve image with high compression, no loss in original image, better performance and good image quality. These techniques are composite stationary wavelet technique (S, composite wavelet technique (W and composite multi-wavelet technique (M. For the high energy sub-band of the 3rd level of each composite transform in each composite technique, the compression parameters are calculated. The best composite transform among the 27 types is the three levels of multi-wavelet transform (MMM in M technique which has the highest values of energy (En and compression ratio (CR and least values of bit per pixel (bpp, time (T and rate distortion R(D. Also the values of the compression parameters of the color image are nearly the same as the average values of the compression parameters of the three bands of the same image.

  2. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  3. A DNA-based semantic fusion model for remote sensing data.

    Directory of Open Access Journals (Sweden)

    Heng Sun

    Full Text Available Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  4. A DNA-based semantic fusion model for remote sensing data.

    Science.gov (United States)

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  5. Radiation chemistry of the base components of DNA and related substances

    International Nuclear Information System (INIS)

    Teoule, R.

    1979-01-01

    The loss of UV absorption may be considered as a useful index to evaluate the extent of base destruction. The variations observed reflect the sum of different phenomena: the modification of base stacking, hydrogen bond rupture between DNA bases and the saturation of conjugated double bonds of heterocycles. Another way to measure the base degradation is by formic acid hydrolysis. Radiation products are very sensitive to the formic acid hydrolysis performed at 180 deg C. In aerated solutions, an important event responsible for the degradation of pyrimidine bases is the formation of hydroperoxide. This review consists of the following subheadings: identification of the DNA base damages; thymine fragment in aerated solutions and in deaerated solutions; adenine fragment; and cytosine fragment. The review concludes with the remarks: one has to be very cautious in the extrapolation of the results obtained by the gamma irradiation of free bases in solution to DNA. Free bases are liberated but no nucleoside during irradiation. (Yamashita, S.)

  6. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas

    2012-06-06

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  7. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    Science.gov (United States)

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. The use of gold nanoparticle aggregation for DNA computing and logic-based biomolecular detection

    International Nuclear Information System (INIS)

    Lee, In-Hee; Yang, Kyung-Ae; Zhang, Byoung-Tak; Lee, Ji-Hoon; Park, Ji-Yoon; Chai, Young Gyu; Lee, Jae-Hoon

    2008-01-01

    The use of DNA molecules as a physical computational material has attracted much interest, especially in the area of DNA computing. DNAs are also useful for logical control and analysis of biological systems if efficient visualization methods are available. Here we present a quick and simple visualization technique that displays the results of the DNA computing process based on a colorimetric change induced by gold nanoparticle aggregation, and we apply it to the logic-based detection of biomolecules. Our results demonstrate its effectiveness in both DNA-based logical computation and logic-based biomolecular detection

  9. Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

    Science.gov (United States)

    Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

    2012-02-01

    We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

  10. Optimization of DNA Sensor Model Based Nanostructured Graphene Using Particle Swarm Optimization Technique

    Directory of Open Access Journals (Sweden)

    Hediyeh Karimi

    2013-01-01

    Full Text Available It has been predicted that the nanomaterials of graphene will be among the candidate materials for postsilicon electronics due to their astonishing properties such as high carrier mobility, thermal conductivity, and biocompatibility. Graphene is a semimetal zero gap nanomaterial with demonstrated ability to be employed as an excellent candidate for DNA sensing. Graphene-based DNA sensors have been used to detect the DNA adsorption to examine a DNA concentration in an analyte solution. In particular, there is an essential need for developing the cost-effective DNA sensors holding the fact that it is suitable for the diagnosis of genetic or pathogenic diseases. In this paper, particle swarm optimization technique is employed to optimize the analytical model of a graphene-based DNA sensor which is used for electrical detection of DNA molecules. The results are reported for 5 different concentrations, covering a range from 0.01 nM to 500 nM. The comparison of the optimized model with the experimental data shows an accuracy of more than 95% which verifies that the optimized model is reliable for being used in any application of the graphene-based DNA sensor.

  11. DNA-based asymmetric organometallic catalysis in water

    NARCIS (Netherlands)

    Oelerich, Jens; Roelfes, Gerard

    2013-01-01

    Here, the first examples of DNA-based organometallic catalysis in water that give rise to high enantioselectivities are described. Copper complexes of strongly intercalating ligands were found to enable the asymmetric intramolecular cyclopropanation of alpha-diazo-beta-keto sulfones in water. Up to

  12. A DNA methylation-based definition of biologically distinct breast cancer subtypes.

    Science.gov (United States)

    Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel

    2015-03-01

    In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Correlation between Composition and Properties of Composite Material Based on Scrap Tires

    OpenAIRE

    Mālers, L; Plēsuma, R; Ločmele, L; Kalniņš, M

    2010-01-01

    Purpose of present work is to investigate mechanical and insulation properties of the composite material based on scrap tires and polyurethane-type binder in correlation with composition of composite material. The studies of material’s hardness must be considered as an express-method for estimation of the selected mechanical properties (E and ccompressive stress) of the composite material without direct experimental testing of given parameters. It was shown that composite material must be r...

  14. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  15. The essential component in DNA-based information storage system: robust error-tolerating module

    Directory of Open Access Journals (Sweden)

    Aldrin Kay-Yuen eYim

    2014-11-01

    Full Text Available The size of digital data is ever increasing and is expected to grow to 40,000EB by 2020, yet the estimated global information storage capacity in 2011 is less than 300EB, indicating that most of the data are transient. DNA, as a very stable nano-molecule, is an ideal massive storage device for long-term data archive. The two most notable illustrations are from Church et al. and Goldman et al., whose approaches are well-optimized for most sequencing platforms – short synthesized DNA fragments without homopolymer. Here we suggested improvements on error handling methodology that could enable the integration of DNA-based computational process, e.g. algorithms based on self-assembly of DNA. As a proof of concept, a picture of size 438 bytes was encoded to DNA with Low-Density Parity-Check error-correction code. We salvaged a significant portion of sequencing reads with mutations generated during DNA synthesis and sequencing and successfully reconstructed the entire picture. A modular-based programming framework - DNAcodec with a XML-based data format was also introduced. Our experiments demonstrated the practicability of long DNA message recovery with high error-tolerance, which opens the field to biocomputing and synthetic biology.

  16. Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

    Science.gov (United States)

    Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

    2013-12-15

    We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. DNA isolation by galactoacrylate-based nano-poly(HEMA-co-Gal-OPA) nanopolymers.

    Science.gov (United States)

    Türkcan Kayhan, Ceren; Zeynep Ural, Fulden; Koruyucu, Meryem; Gül Salman, Yeşim; Uygun, Murat; Aktaş Uygun, Deniz; Akgöl, Sinan; Denizli, Adil

    2017-10-01

    Isolation of DNA is one of the important processes for biotechnological applications such as investigation of DNA structures and functions, recombinant DNA preparations, identification of genetic factors and diagnosis and treatment of genetic disorders. The aim of this study was to synthesis and characterizes the galactoacrylate based nanopolymers with high surface area and to investigate the usability of these synthesized nanopolymers for DNA isolation studies. Nanopolymers were synthesized by the surfactant free emulsion polymerization technique by using the monomers of 2-hydroxyl ethylmethacrylate and 6-O-(2 ' -hydroxy-3 ' -acryloyloxypropyl)-1,2:3,4-di-O-isopropylidene-α-D-galactopyranose. Galactoacrylate origin of these newly synthesized nanopolymers increased the interaction between DNA and nanopolymers. Prepared nanopolymers were characterized by SEM, FT-IR and ZETA sizer analysis. Synthesized nanopolymers were spherical, and their average particle size was about 246.8 nm. Adsorption of DNA onto galactoacrylate based nanopolymers was investigated by using different pHs, temperatures, ionic strength, DNA concentrations and desorption studies and maximum DNA adsorption was found to be as 567.12 mg/g polymer at 25 °C, in pH 5.0 acetate buffer. Reusability was investigated for 5 successive reuse and DNA adsorption capacity decreased only about 10% at the end of the 5th reuse.

  18. Effect of cyclic loading on microleakage of silorane based composite compared with low shrinkage methacrylate-based composites

    Directory of Open Access Journals (Sweden)

    Hamid Kermanshah

    2016-01-01

    Conclusion: Silorane did not provide better marginal seal than the low shrinkage methacrylate-based composites (except Aelite. In addition, cyclic loading did not affect the marginal microleakage of evaluated composite restorations .

  19. DNA-Protected Silver Clusters for Nanophotonics

    Directory of Open Access Journals (Sweden)

    Elisabeth Gwinn

    2015-02-01

    Full Text Available DNA-protected silver clusters (AgN-DNA possess unique fluorescence properties that depend on the specific DNA template that stabilizes the cluster. They exhibit peak emission wavelengths that range across the visible and near-IR spectrum. This wide color palette, combined with low toxicity, high fluorescence quantum yields of some clusters, low synthesis costs, small cluster sizes and compatibility with DNA are enabling many applications that employ AgN-DNA. Here we review what is known about the underlying composition and structure of AgN-DNA, and how these relate to the optical properties of these fascinating, hybrid biomolecule-metal cluster nanomaterials. We place AgN-DNA in the general context of ligand-stabilized metal clusters and compare their properties to those of other noble metal clusters stabilized by small molecule ligands. The methods used to isolate pure AgN-DNA for analysis of composition and for studies of solution and single-emitter optical properties are discussed. We give a brief overview of structurally sensitive chiroptical studies, both theoretical and experimental, and review experiments on bringing silver clusters of distinct size and color into nanoscale DNA assemblies. Progress towards using DNA scaffolds to assemble multi-cluster arrays is also reviewed.

  20. Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers

    Directory of Open Access Journals (Sweden)

    MEMEN SURAHMAN

    2010-07-01

    Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.

  1. Droplet-based microscale colorimetric biosensor for multiplexed DNA analysis via a graphene nanoprobe

    International Nuclear Information System (INIS)

    Xiang Xia; Luo Ming; Shi Liyang; Ji Xinghu; He Zhike

    2012-01-01

    Graphical abstract: With a microvalve manipulate technique combined with droplet platform, a microscale fluorescence-based colorimetric sensor for multiplexed DNA analysis is developed via a graphene nanoprobe. Highlights: ► A quantitative detection for multiplexed DNA is first realized on droplet platform. ► The DNA detection is relied on a simple fluorescence-based colorimetric method. ► GO is served as a quencher for two different DNA fluorescent probes. ► This present work provides a rapid, sensitive, visual and convenient detection tool for droplet biosensor. - Abstract: The development of simple and inexpensive DNA detection strategy is very significant for droplet-based microfluidic system. Here, a droplet-based biosensor for multiplexed DNA analysis is developed with a common imaging device by using fluorescence-based colorimetric method and a graphene nanoprobe. With the aid of droplet manipulation technique, droplet size adjustment, droplet fusion and droplet trap are realized accurately and precisely. Due to the high quenching efficiency of graphene oxide (GO), in the absence of target DNAs, the droplet containing two single-stranded DNA probes and GO shows dark color, in which the DNA probes are labeled carboxy fluorescein (FAM) and 6-carboxy-X-rhodamine (ROX), respectively. The droplet changes from dark to bright color when the DNA probes form double helix with the specific target DNAs leading to the dyes far away from GO. This colorimetric droplet biosensor exhibits a quantitative capability for simultaneous detection of two different target DNAs with the detection limits of 9.46 and 9.67 × 10 −8 M, respectively. It is also demonstrated that this biosensor platform can become a promising detection tool in high throughput applications with low consumption of reagents. Moreover, the incorporation of graphene nanoprobe and droplet technique can drive the biosensor field one more step to some extent.

  2. Susceptibilities to DNA Structural Transitions within Eukaryotic Genomes

    Science.gov (United States)

    Zhabinskaya, Dina; Benham, Craig; Madden, Sally

    2012-02-01

    We analyze the competitive transitions to alternate secondary DNA structures in a negatively supercoiled DNA molecule of kilobase length and specified base sequence. We use statistical mechanics to calculate the competition among all regions within the sequence that are susceptible to transitions to alternate structures. We use an approximate numerical method since the calculation of an exact partition function is numerically cumbersome for DNA molecules of lengths longer than hundreds of base pairs. This method yields accurate results in reasonable computational times. We implement algorithms that calculate the competition between transitions to denatured states and to Z-form DNA. We analyze these transitions near the transcription start sites (TSS) of a set of eukaryotic genes. We find an enhancement of Z-forming regions upstream of the TSS and a depletion of denatured regions around the start sites. We confirm that these finding are statistically significant by comparing our results to a set of randomized genes with preserved base composition at each position relative to the gene start sites. When we study the correlation of these transitions in orthologous mouse and human genes we find a clear evolutionary conservation of both types of transitions around the TSS.

  3. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  4. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  5. DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

    Science.gov (United States)

    Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

    2017-01-11

    DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

  6. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  7. Transforming bases to bytes: Molecular computing with DNA

    Indian Academy of Sciences (India)

    Despite the popular image of silicon-based computers for computation, an embryonic field of mole- cular computation is emerging, where molecules in solution perform computational ..... [4] Mao C, Sun W, Shen Z and Seeman N C 1999. A nanomechanical device based on the B-Z transition of DNA; Nature 397 144–146.

  8. A Constant Rate of Spontaneous Mutation in DNA-Based Microbes

    Science.gov (United States)

    Drake, John W.

    1991-08-01

    In terms of evolution and fitness, the most significant spontaneous mutation rate is likely to be that for the entire genome (or its nonfrivolous fraction). Information is now available to calculate this rate for several DNA-based haploid microbes, including bacteriophages with single- or double-stranded DNA, a bacterium, a yeast, and a filamentous fungus. Their genome sizes vary by ≈6500-fold. Their average mutation rates per base pair vary by ≈16,000-fold, whereas their mutation rates per genome vary by only ≈2.5-fold, apparently randomly, around a mean value of 0.0033 per DNA replication. The average mutation rate per base pair is inversely proportional to genome size. Therefore, a nearly invariant microbial mutation rate appears to have evolved. Because this rate is uniform in such diverse organisms, it is likely to be determined by deep general forces, perhaps by a balance between the usually deleterious effects of mutation and the physiological costs of further reducing mutation rates.

  9. De novo DNA methylation during monkey pre-implantation embryogenesis.

    Science.gov (United States)

    Gao, Fei; Niu, Yuyu; Sun, Yi Eve; Lu, Hanlin; Chen, Yongchang; Li, Siguang; Kang, Yu; Luo, Yuping; Si, Chenyang; Yu, Juehua; Li, Chang; Sun, Nianqin; Si, Wei; Wang, Hong; Ji, Weizhi; Tan, Tao

    2017-04-01

    Critical epigenetic regulation of primate embryogenesis entails DNA methylome changes. Here we report genome-wide composition, patterning, and stage-specific dynamics of DNA methylation in pre-implantation rhesus monkey embryos as well as male and female gametes studied using an optimized tagmentation-based whole-genome bisulfite sequencing method. We show that upon fertilization, both paternal and maternal genomes undergo active DNA demethylation, and genome-wide de novo DNA methylation is also initiated in the same period. By the 8-cell stage, remethylation becomes more pronounced than demethylation, resulting in an increase in global DNA methylation. Promoters of genes associated with oxidative phosphorylation are preferentially remethylated at the 8-cell stage, suggesting that this mode of energy metabolism may not be favored. Unlike in rodents, X chromosome inactivation is not observed during monkey pre-implantation development. Our study provides the first comprehensive illustration of the 'wax and wane' phases of DNA methylation dynamics. Most importantly, our DNA methyltransferase loss-of-function analysis indicates that DNA methylation influences early monkey embryogenesis.

  10. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  11. Design and specificity of long ssDNA donors for CRISPR-based knock-in

    OpenAIRE

    Leonetti, Manuel; Li, Han; Beckman, Kyle; Pessino, Veronica; Huang, Bo; Weissman, Jonathan

    2017-01-01

    CRISPR/Cas technologies have transformed our ability to manipulate genomes for research and gene-based therapy. In particular, homology-directed repair after genomic cleavage allows for precise modification of genes using exogenous donor sequences as templates. While both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) forms of donors have been used as repair templates, a systematic comparison of the performance and specificity of repair using ssDNA versus dsDNA donors is still la...

  12. Species composition and diversity of fish larvae in the Subtropical Convergence Zone of the Sargasso Sea from morphology and DNA barcoding

    DEFF Research Database (Denmark)

    Ayala, Daniel Jiro; Munk, Peter; Riemann, Lasse

    2016-01-01

    . In order to evaluate spatial variability of larval fish in the region, we examined species diversity, composition and abundances at eight stations in the Subtropical Convergence Zone (STCZ) using morphological identification and DNA barcoding. From a total of approximately 3500 specimens collected...... of the strong environmental gradients. Common eel species were concentrated between the fronts whereas common myctophids were of highest abundance at the outer edges of the fronts. The abundances of most species were generally enhanced in the vicinity of the fronts. The use of combined morphological and DNA-barcoding...

  13. DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

    Science.gov (United States)

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

    2014-10-15

    An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Complexes of poly(ethylene glycol)-based cationic random copolymer and calf thymus DNA: a complete biophysical characterization.

    Science.gov (United States)

    Nisha, C K; Manorama, Sunkara V; Ganguli, Munia; Maiti, Souvik; Kizhakkedathu, Jayachandran N

    2004-03-16

    Complete biophysical characterization of complexes (polyplexes) of cationic polymers and DNA is needed to understand the mechanism underlying nonviral therapeutic gene transfer. In this article, we propose a new series of synthesized random cationic polymers (RCPs) from methoxy poly(ethylene glycol) monomethacrylate (MePEGMA) and (3-(methacryloylamino)propyl)trimethylammonium chloride with different mole ratios (32:68, 11:89, and 6:94) which could be used as a model system to address and answer the basic questions relating to the mechanism of the interaction of calf thymus DNA (CT-DNA) and cationic polymers. The solubility of the complexes of CT-DNA and RCP was followed by turbidity measurements. It has been observed that complexes of RCP with 68 mol % MePEGMA precipitate near the charge neutralization point, whereas complexes of the other two polymers are water-soluble and stable at all compositions. Dnase 1 digestion experiments show that DNA is inaccessible when it forms complexes with RCP. Ethidium bromide exclusion and gel electrophoretic mobility show that both polymers are capable of binding with CT-DNA. Atomic force microscopy images in conjunction with light scattering experiments showed that the complexes are spherical in nature and 75-100 nm in diameter. Circular dichroism spectroscopy studies indicated that the secondary structure of DNA in the complexes is not perturbed due to the presence of poly(ethylene glycol) segments in the polymer. Furthermore, we used a combination of spectroscopic and calorimetric techniques to determine complete thermodynamic profiles accompanying the helix-coil transition of CT-DNA in the complexes. UV and differential scanning calorimetry melting experiments revealed that DNA in the complexes is more stable than in the free state and the extent of stability depends on the polymer composition. Isothermal titration calorimetry experiments showed that the binding of these RCPs to CT-DNA is associated with small exothermic

  15. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification.

    Science.gov (United States)

    Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng

    2014-06-15

    Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  17. All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model

    Science.gov (United States)

    Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978

  18. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  19. Possible role(s) of nuclear matrix and DNA loop organization in fixation or repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Malyapa, R.S.; Wright, W.D.; Roti Roti, J.L.

    1995-01-01

    DNA double-strand breaks produced by ionizing radiation are considered to be a critical radiation-induced lesion responsible, in part, for cell killing. However, the manner in which structures within the nucleus involving DNA organization contribute to the balance between fixation or repair of these critical lesions remains largely obscure. The repair process requires both functional enzymes and substrate availability, i.e., access to and orientation of damage sites. Therefore, the ability to repair damaged DNA could be influenced not only by DNA integrity but also by the spatial organization of DNA. Therefore, the authors investigated the possibility that radiation-induced DNA damage differentially affects DNA supercoiling ability in cells of differing radiosensitivities using radioresistant and radiosensitive mutants of different origins. This study was also designed to determine if differences in the composition of the nuclear matrix exist between cell lines of each origin. Results from these studies indicate that differences in the composition of the nuclear matrix proteins and DNA stability might be related to intrinsic radiation resistance

  20. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  1. repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

    Science.gov (United States)

    Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

    2015-04-15

    In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Structuring polymers for delivery of DNA-based therapeutics: updated insights.

    Science.gov (United States)

    Gupta, Madhu; Tiwari, Shailja; Vyas, Suresh

    2012-01-01

    Gene therapy offers greater opportunities for treating numerous incurable diseases from genetic disorders, infections, and cancer. However, development of appropriate delivery systems could be one of the most important factors to overcome numerous biological barriers for delivery of various therapeutic molecules. A number of nonviral polymer-mediated vectors have been developed for DNA delivery and offer the potential to surmount the associated problems of their viral counterpart. To address the concerns associated with safety issues, a wide range of polymeric vectors are available and have been utilized successfully to deliver their therapeutics in vivo. Today's research is mainly focused on the various natural or synthetic polymer-based delivery carriers that protect the DNA molecule from degradation, which offer specific targeting to the desired cells after systemic administration, have transfection efficiencies equivalent to virus-mediated gene delivery, and have long-term gene expression through sustained-release mechanisms. This review explores an updated overview of different nonviral polymeric delivery system for delivery of DNA-based therapeutics. These polymeric carriers have been evaluated in vitro and in vivo and are being utilized in various stages of clinical evaluation. Continued research and understanding of the principles of polymer-based gene delivery systems will enable us to develop new and efficient delivery systems for the delivery of DNA-based therapeutics to achieve the goal of efficacious and specific gene therapy for a vast array of clinical disorders as the therapeutic solutions of tomorrow.

  3. Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

    Science.gov (United States)

    Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

    2010-03-01

    Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

  4. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    Science.gov (United States)

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

    2012-01-01

    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  5. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  6. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  7. Gold-silver-alloy nanoprobes for one-pot multiplex DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Doria, G; Larguinho, M; Dias, J T; Baptista, P V [Centro de Investigacao em Genetica Molecular Humana (CIGMH), Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Pereira, E [Rede de Quimica e Tecnologia (REQUIMTE), Departamento de Quimica, Faculdade de Ciencias, Universidade do Porto, 4169-007 Porto (Portugal); Franco, R, E-mail: pmvb@fct.unl.pt [Rede de Quimica e Tecnologia (REQUIMTE), Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal)

    2010-06-25

    A specific colorimetric DNA detection method based on oligonucleotide functionalized gold-silver-alloy nanoparticles (AuAg-alloy-nanoprobes) is presented. The AuAg-alloy-nanoprobes were then used for the specific detection of a DNA sequence from TP53-a gene involved in cancer development. The AuAg-alloy-nanoprobes were then used in combination with Au-nanoprobes for a one-pot dual-colour detection strategy that allowed for the simultaneous differential detection of two distinct target sequences. This system poses an unprecedented opportunity to explore the combined use of metal nanoparticles with different composition towards the development of a multiplex one-pot colorimetric assay for DNA detection.

  8. Gold-silver-alloy nanoprobes for one-pot multiplex DNA detection

    International Nuclear Information System (INIS)

    Doria, G; Larguinho, M; Dias, J T; Baptista, P V; Pereira, E; Franco, R

    2010-01-01

    A specific colorimetric DNA detection method based on oligonucleotide functionalized gold-silver-alloy nanoparticles (AuAg-alloy-nanoprobes) is presented. The AuAg-alloy-nanoprobes were then used for the specific detection of a DNA sequence from TP53-a gene involved in cancer development. The AuAg-alloy-nanoprobes were then used in combination with Au-nanoprobes for a one-pot dual-colour detection strategy that allowed for the simultaneous differential detection of two distinct target sequences. This system poses an unprecedented opportunity to explore the combined use of metal nanoparticles with different composition towards the development of a multiplex one-pot colorimetric assay for DNA detection.

  9. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  10. Isothermal amplification of environmental DNA (eDNA for direct field-based monitoring and laboratory confirmation of Dreissena sp.

    Directory of Open Access Journals (Sweden)

    Maggie R Williams

    Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a

  11. Plant DNA Detection from Grasshopper Guts: A Step-by-Step Protocol, from Tissue Preparation to Obtaining Plant DNA Sequences

    Directory of Open Access Journals (Sweden)

    Alina Avanesyan

    2014-02-01

    Full Text Available Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions.

  12. Sorption of DNA by diatomite-Zn(II) embedded supermacroporous monolithic p(HEMA) cryogels.

    Science.gov (United States)

    Tozak, Kabil Özcan; Erzengin, Mahmut; Sargin, Idris; Ünlü, Nuri

    2013-01-01

    In this study, the DNA sorption performance of diatomite-Zn(II) embedded supermacroporous monolithic p(HEMA) cryogels were investigated for the purpose of designing a novel adsorbent that can be utilized for DNA purification, separation and immunoadsorption studies such as removal of anti-dsDNA antibodies from systemic lupus erythematosus (SLE) patient plasma. Poly(2-hydroxyethyl methacrylate) [p(HEMA)]-based monolithic cryogel column embedded with Zn(2+)-diatomite particles was prepared by free radical cryo-copolymerization of 2-hydroxyethyl methacrylate (HEMA) with N,N'-methylene-bis-acrylamide (MBAAm). The polymerization reaction was initiated by N,N,N',N'-tetramethylene diamine (TEMED) and ammonium persulfate (APS) pair in an ice bath. After thawing, the monolithic composite cryogels were used for affinity sorption and then subsequent desorption of DNA molecules from aqueous solutions. Diatomite (DA) particles were characterized by XRF and BET method. The characterization of composite cryogel was done through SEM imaging. The effects of pH of the solution, initial DNA concentration, ionic strength, temperature and flow rates on adsorption were investigated to determine the optimum conditions for adsorption/desorption experiments. The particle embedding procedure was shown to yield significantly enhanced adsorption of DNA on the adsorbent. Furthermore, considering its excellent bio-compatibility, p(HEMA) cryogels are promising a candidate for further DNA sorption studies.

  13. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. HLA class I sequence-based typing using DNA recovered from frozen plasma.

    Science.gov (United States)

    Cotton, Laura A; Abdur Rahman, Manal; Ng, Carmond; Le, Anh Q; Milloy, M-J; Mo, Theresa; Brumme, Zabrina L

    2012-08-31

    We describe a rapid, reliable and cost-effective method for intermediate-to-high-resolution sequence-based HLA class I typing using frozen plasma as a source of genomic DNA. The plasma samples investigated had a median age of 8.5 years. Total nucleic acids were isolated from matched frozen PBMC (~2.5 million) and plasma (500 μl) samples from a panel of 25 individuals using commercial silica-based kits. Extractions yielded median [IQR] nucleic acid concentrations of 85.7 [47.0-130.0]ng/μl and 2.2 [1.7-2.6]ng/μl from PBMC and plasma, respectively. Following extraction, ~1000 base pair regions spanning exons 2 and 3 of HLA-A, -B and -C were amplified independently via nested PCR using universal, locus-specific primers and sequenced directly. Chromatogram analysis was performed using commercial DNA sequence analysis software and allele interpretation was performed using a free web-based tool. HLA-A, -B and -C amplification rates were 100% and chromatograms were of uniformly high quality with clearly distinguishable mixed bases regardless of DNA source. Concordance between PBMC and plasma-derived HLA types was 100% at the allele and protein levels. At the nucleotide level, a single partially discordant base (resulting from a failure to call both peaks in a mixed base) was observed out of >46,975 bases sequenced (>99.9% concordance). This protocol has previously been used to perform HLA class I typing from a variety of genomic DNA sources including PBMC, whole blood, granulocyte pellets and serum, from specimens up to 30 years old. This method provides comparable specificity to conventional sequence-based approaches and could be applied in situations where cell samples are unavailable or DNA quantities are limiting. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

    Science.gov (United States)

    Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

    2006-09-18

    A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

  16. A history of the DNA repair and mutagenesis field: The discovery of base excision repair.

    Science.gov (United States)

    Friedberg, Errol C

    2016-01-01

    This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.

  17. Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

    Science.gov (United States)

    Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

    2017-10-15

    Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Statistical length of DNA based on AFM image measured by a computer

    International Nuclear Information System (INIS)

    Chen Xinqing; Qiu Xijun; Zhang Yi; Hu Jun; Wu Shiying; Huang Yibo; Ai Xiaobai; Li Minqian

    2001-01-01

    Taking advantage of image processing technology, the contour length of DNA molecule was measured automatically by a computer. Based on the AFM image of DNA, the topography of DNA was simulated into a curve. Then the DNA length was measured automatically by inserting mode. It was shown that the experimental length of a naturally deposited DNA (180.4 +- 16.4 nm) was well consistent with the theoretical length (185.0 nm). Comparing to other methods, the present approach had advantages of precision and automatism. The stretched DNA was also measured. It present approach had advantages of precision and automatism. The stretched DNA was also measured. It was shown that the experimental length (343.6 +- 20.7 nm) was much longer than the theoretical length (307.0 nm). This result indicated that the stretching process had a distinct effect on the DNA length. However, the method provided here avoided the DNA-stretching effect

  19. DNA-based stable isotope probing: a link between community structure and function

    International Nuclear Information System (INIS)

    Uhlik, Ondrej; Jecna, Katerina; Leigh, Mary Beth; Mackova, Martina; Macek, Tomas

    2009-01-01

    DNA-based molecular techniques permit the comprehensive determination of microbial diversity but generally do not reveal the relationship between the identity and the function of microorganisms. The first direct molecular technique to enable the linkage of phylogeny with function is DNA-based stable isotope probing (DNA-SIP). Applying this method first helped describe the utilization of simple compounds, such as methane, methanol or glucose and has since been used to detect microbial communities active in the utilization of a wide variety of compounds, including various xenobiotics. The principle of the method lies in providing 13C-labeled substrate to a microbial community and subsequent analyses of the 13C-DNA isolated from the community. Isopycnic centrifugation permits separating 13C-labeled DNA of organisms that utilized the substrate from 12C-DNA of the inactive majority. As the whole metagenome of active populations is isolated, its follow-up analysis provides successful taxonomic identification as well as the potential for functional gene analyses. Because of its power, DNA-SIP has become one of the leading techniques of microbial ecology research. But from other point of view, it is a labor-intensive method that requires careful attention to detail during each experimental step in order to avoid misinterpretation of results.

  20. Designing thermal diode and heat pump based on DNA nanowire: Multifractal approach

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@iaurmia.ac.ir; Panahinia, R.

    2017-07-12

    The management of heat flow in DNA nano wire was considered. Thermal diode effect in DNA and the domain of its appearance dependent to system parameters have been detected. The appearance of directed thermal flow in thermodynamic sizes proposes the possibility of designing the macroscopic thermal rectifier. By applying driven force, pumping effect has been also observed. The resonance frequency of DNA and threshold amplitudes of driving force for attaining permanent pumping effect have been detected. Forasmuch as detecting negative differential thermal resistance (NDTR) phenomenon, DNA can act as a thermal transistor. By using an analytical parallel investigation based on Rényi spectrum analysis, threshold values to transition to NDTR and pumping regimes have been detected. - Highlights: • The control and management of heat current in DNA have been investigated. • Directed thermal flow and NDTR in DNA have been identified. • By increasing the system size, the reversed thermal rectification appeared. So, it is proposed the possibility of designing the macroscopic thermal rectifier. • Pumping effect accompanied with detection of resonance frequency of DNA has been observed. • To verify the results, we did a parallel analysis based on multifractal concept to detect threshold values for transition to pumping state and NDTR regime.

  1. Design of Composite Structures Using Knowledge-Based and Case Based Reasoning

    Science.gov (United States)

    Lambright, Jonathan Paul

    1996-01-01

    A method of using knowledge based and case based reasoning to assist designers during conceptual design tasks of composite structures was proposed. The cooperative use of heuristics, procedural knowledge, and previous similar design cases suggests a potential reduction in design cycle time and ultimately product lead time. The hypothesis of this work is that the design process of composite structures can be improved by using Case-Based Reasoning (CBR) and Knowledge-Based (KB) reasoning in the early design stages. The technique of using knowledge-based and case-based reasoning facilitates the gathering of disparate information into one location that is easily and readily available. The method suggests that the inclusion of downstream life-cycle issues into the conceptual design phase reduces potential of defective, and sub-optimal composite structures. Three industry experts were interviewed extensively. The experts provided design rules, previous design cases, and test problems. A Knowledge Based Reasoning system was developed using the CLIPS (C Language Interpretive Procedural System) environment and a Case Based Reasoning System was developed using the Design Memory Utility For Sharing Experiences (MUSE) xviii environment. A Design Characteristic State (DCS) was used to document the design specifications, constraints, and problem areas using attribute-value pair relationships. The DCS provided consistent design information between the knowledge base and case base. Results indicated that the use of knowledge based and case based reasoning provided a robust design environment for composite structures. The knowledge base provided design guidance from well defined rules and procedural knowledge. The case base provided suggestions on design and manufacturing techniques based on previous similar designs and warnings of potential problems and pitfalls. The case base complemented the knowledge base and extended the problem solving capability beyond the existence of

  2. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.

  3. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    DEFF Research Database (Denmark)

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong

    2011-01-01

    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...

  4. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Science.gov (United States)

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  6. Eukaryotic DNA Replication Fork.

    Science.gov (United States)

    Burgers, Peter M J; Kunkel, Thomas A

    2017-06-20

    This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

  7. Diet Assessment Based on Rumen Contents: A Comparison between DNA Metabarcoding and Macroscopy.

    Directory of Open Access Journals (Sweden)

    Ruth V Nichols

    Full Text Available Dietary choices are central to our understanding of ecology and evolution. Still, many aspects of food choice have been hampered by time consuming procedures and methodological problems. Faster and cheaper methods, such as DNA metabarcoding, have therefore been widely adopted. However, there is still very little empirical support that this new method is better and more accurate compared to the classic methods. Here, we compare DNA metabarcoding to macroscopic identifications of rumen contents in two species of wild free-ranging ungulates: roe deer and fallow deer. We found that the methods were comparable, but they did not completely overlap. Sometimes the DNA method failed to identify food items that were found macroscopically, and the opposite was also true. However, the total number of taxa identified increased using DNA compared to the macroscopic analysis. Moreover, the taxonomic precision of metabarcoding was substantially higher, with on average 90% of DNA-sequences being identified to genus or species level compared to 75% of plant fragments using macroscopy. In niche overlap analyses, presence/absence data showed that both methods came to very similar conclusions. When using the sequence count data and macroscopic weight, niche overlap was lower than when using presence-absence data yet tended to increase when using DNA compared to macroscopy. Nevertheless, the significant positive correlation between macroscopic quantity and number of DNA sequences counted from the same plant group give support for the use of metabarcoding to quantify plants in the rumen. This study thus shows that there is much to be gained by using metabarcoding to quantitatively assess diet composition compared to macroscopic analysis, including higher taxonomic precision, sensitivity and cost efficiency.

  8. Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

    KAUST Repository

    Fornander, Louise H

    2013-12-03

    The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

  9. Implementation options for DNA-based identification into ecological status assessment under the European Water Framework Directive.

    Science.gov (United States)

    Hering, Daniel; Borja, Angel; Jones, J Iwan; Pont, Didier; Boets, Pieter; Bouchez, Agnes; Bruce, Kat; Drakare, Stina; Hänfling, Bernd; Kahlert, Maria; Leese, Florian; Meissner, Kristian; Mergen, Patricia; Reyjol, Yorick; Segurado, Pedro; Vogler, Alfried; Kelly, Martyn

    2018-07-01

    Assessment of ecological status for the European Water Framework Directive (WFD) is based on "Biological Quality Elements" (BQEs), namely phytoplankton, benthic flora, benthic invertebrates and fish. Morphological identification of these organisms is a time-consuming and expensive procedure. Here, we assess the options for complementing and, perhaps, replacing morphological identification with procedures using eDNA, metabarcoding or similar approaches. We rate the applicability of DNA-based identification for the individual BQEs and water categories (rivers, lakes, transitional and coastal waters) against eleven criteria, summarised under the headlines representativeness (for example suitability of current sampling methods for DNA-based identification, errors from DNA-based species detection), sensitivity (for example capability to detect sensitive taxa, unassigned reads), precision of DNA-based identification (knowledge about uncertainty), comparability with conventional approaches (for example sensitivity of metrics to differences in DNA-based identification), cost effectiveness and environmental impact. Overall, suitability of DNA-based identification is particularly high for fish, as eDNA is a well-suited sampling approach which can replace expensive and potentially harmful methods such as gill-netting, trawling or electrofishing. Furthermore, there are attempts to replace absolute by relative abundance in metric calculations. For invertebrates and phytobenthos, the main challenges include the modification of indices and completing barcode libraries. For phytoplankton, the barcode libraries are even more problematic, due to the high taxonomic diversity in plankton samples. If current assessment concepts are kept, DNA-based identification is least appropriate for macrophytes (rivers, lakes) and angiosperms/macroalgae (transitional and coastal waters), which are surveyed rather than sampled. We discuss general implications of implementing DNA-based identification

  10. DENA: A Configurable Microarchitecture and Design Flow for Biomedical DNA-Based Logic Design.

    Science.gov (United States)

    Beiki, Zohre; Jahanian, Ali

    2017-10-01

    DNA is known as the building block for storing the life codes and transferring the genetic features through the generations. However, it is found that DNA strands can be used for a new type of computation that opens fascinating horizons in computational medicine. Significant contributions are addressed on design of DNA-based logic gates for medical and computational applications but there are serious challenges for designing the medium and large-scale DNA circuits. In this paper, a new microarchitecture and corresponding design flow is proposed to facilitate the design of multistage large-scale DNA logic systems. Feasibility and efficiency of the proposed microarchitecture are evaluated by implementing a full adder and, then, its cascadability is determined by implementing a multistage 8-bit adder. Simulation results show the highlight features of the proposed design style and microarchitecture in terms of the scalability, implementation cost, and signal integrity of the DNA-based logic system compared to the traditional approaches.

  11. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    Science.gov (United States)

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat

    2018-03-01

    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  12. DNA base-calling from a nanopore using a Viterbi algorithm.

    Science.gov (United States)

    Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-05-16

    Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  13. Plant DNA detection from grasshopper guts: A step-by-step protocol, from tissue preparation to obtaining plant DNA sequences1

    Science.gov (United States)

    Avanesyan, Alina

    2014-01-01

    • Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. • Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA) gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. • Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions. PMID:25202604

  14. Development and Use of Integrated Microarray-Based Genomic Technologies for Assessing Microbial Community Composition and Dynamics

    Energy Technology Data Exchange (ETDEWEB)

    J. Zhou; S.-K. Rhee; C. Schadt; T. Gentry; Z. He; X. Li; X. Liu; J. Liebich; S.C. Chong; L. Wu

    2004-03-17

    To effectively monitor microbial populations involved in various important processes, a 50-mer-based oligonucleotide microarray was developed based on known genes and pathways involved in: biodegradation, metal resistance and reduction, denitrification, nitrification, nitrogen fixation, methane oxidation, methanogenesis, carbon polymer decomposition, and sulfate reduction. This array contains approximately 2000 unique and group-specific probes with <85% similarity to their non-target sequences. Based on artificial probes, our results showed that at hybridization conditions of 50 C and 50% formamide, the 50-mer microarray hybridization can differentiate sequences having <88% similarity. Specificity tests with representative pure cultures indicated that the designed probes on the arrays appeared to be specific to their corresponding target genes. Detection limits were about 5-10ng genomic DNA in the absence of background DNA, and 50-100ng ({approx}1.3{sup o} 10{sup 7} cells) in the presence background DNA. Strong linear relationships between signal intensity and target DNA and RNA concentration were observed (r{sup 2} = 0.95-0.99). Application of this microarray to naphthalene-amended enrichments and soil microcosms demonstrated that composition of the microflora varied depending on incubation conditions. While the naphthalene-degrading genes from Rhodococcus-type microorganisms were dominant in enrichments, the genes involved in naphthalene degradation from Gram-negative microorganisms such as Ralstonia, Comamonas, and Burkholderia were most abundant in the soil microcosms (as well as those for polyaromatic hydrocarbon and nitrotoluene degradation). Although naphthalene degradation is widely known and studied in Pseudomonas, Pseudomonas genes were not detected in either system. Real-time PCR analysis of 4 representative genes was consistent with microarray-based quantification (r{sup 2} = 0.95). Currently, we are also applying this microarray to the study of several

  15. Slow elimination of DNA damaged bases in the liver of old gamma-irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Gaziev, A I; Malakhova, L V; Fomenko, L A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki

    1981-01-01

    Elimination of the DNA damaged bases in the liver of old and young mice after their gamma-irradiation is studied. It is established that the incision rate of DNA gamma-damaged bases in the liver of old mice is lower than in the liver of the young ones. It is supposed to be connected with the decrease of the activity of DNA reparation ferments or with the presence of limitations in chromatin for the access of these ferments to the damaged parts of DNA in the cells of old animals.

  16. Metal-composite adhesion based on diazonium chemistry.

    Science.gov (United States)

    Oweis, Yara; Alageel, Omar; Kozak, Paige; Abdallah, Mohamed-Nur; Retrouvey, Jean-Marc; Cerruti, Marta; Tamimi, Faleh

    2017-11-01

    Composite resins do not adhere well to dental alloys. This weak bond can result in failure at the composite-metal interface in fixed dental prostheses and orthodontic brackets. The aim of this study was to develop a new adhesive, based on diazonium chemistry, to facilitate chemical bonding between dental alloys and composite resin. Samples of two types of dental alloys, stainless steel and cobalt chromium were primed with a diazonium layer in order to create a surface coating favorable for composite adhesion. Untreated metal samples served as controls. The surface chemical composition of the treated and untreated samples was analyzed by X-ray photoelectron spectroscopy (XPS) and the tensile strength of the bond with composite resin was measured. The diazonium adhesive was also tested for shear bond strength between stainless steel orthodontic brackets and teeth. XPS confirmed the presence of a diazonium coating on the treated metals. The coating significantly increased the tensile and shear bond strengths by three and four folds respectively between the treated alloys and composite resin. diazonium chemistry can be used to develop composite adhesives for dental alloys. Diazonium adhesion can effectively achieve a strong chemical bond between dental alloys and composite resin. This technology can be used for composite repair of fractured crowns, for crown cementation with resin based cements, and for bracket bonding. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  17. High Interlaboratory Reprocucibility of DNA Sequence-based Typing of Bacteria in a Multicenter Study

    DEFF Research Database (Denmark)

    Sousa, MA de; Boye, Kit; Lencastre, H de

    2006-01-01

    Current DNA amplification-based typing methods for bacterial pathogens often lack interlaboratory reproducibility. In this international study, DNA sequence-based typing of the Staphylococcus aureus protein A gene (spa, 110 to 422 bp) showed 100% intra- and interlaboratory reproducibility without...... extensive harmonization of protocols for 30 blind-coded S. aureus DNA samples sent to 10 laboratories. Specialized software for automated sequence analysis ensured a common typing nomenclature....

  18. Fundamental study of the radiation monitoring system based on evaluation of DNA lesions

    International Nuclear Information System (INIS)

    Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.

    2011-01-01

    The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)

  19. REST based service composition

    DEFF Research Database (Denmark)

    Grönvall, Erik; Ingstrup, Mads; Pløger, Morten

    2011-01-01

    This paper presents an ongoing work developing and testing a Service Composition framework based upon the REST architecture named SECREST. A minimalistic approach have been favored instead of a creating a complete infrastructure. One focus has been on the system's interaction model. Indeed, an aim...

  20. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  1. A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

    Science.gov (United States)

    Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

    2015-07-01

    In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  3. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  4. DNA-Based Nanobiosensors as an Emerging Platform for Detection of Disease

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2015-06-01

    Full Text Available Detection of disease at an early stage is one of the biggest challenges in medicine. Different disciplines of science are working together in this regard. The goal of nanodiagnostics is to provide more accurate tools for earlier diagnosis, to reduce cost and to simplify healthcare delivery of effective and personalized medicine, especially with regard to chronic diseases (e.g., diabetes and cardiovascular diseases that have high healthcare costs. Up-to-date results suggest that DNA-based nanobiosensors could be used effectively to provide simple, fast, cost-effective, sensitive and specific detection of some genetic, cancer, and infectious diseases. In addition, they could potentially be used as a platform to detect immunodeficiency, and neurological and other diseases. This review examines different types of DNA-based nanobiosensors, the basic principles upon which they are based and their advantages and potential in diagnosis of acute and chronic diseases. We discuss recent trends and applications of new strategies for DNA-based nanobiosensors, and emphasize the challenges in translating basic research to the clinical laboratory.

  5. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2012-01-01

    Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  6. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier

    2014-01-01

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL −1 and 50 μg mL −1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  7. Excited state dynamics of DNA bases

    Czech Academy of Sciences Publication Activity Database

    Kleinermanns, K.; Nachtigallová, Dana; de Vries, M. S.

    2013-01-01

    Roč. 32, č. 2 (2013), s. 308-342 ISSN 0144-235X R&D Projects: GA ČR GAP208/12/1318 Grant - others:National Science Foundation(US) CHE-0911564; NASA (US) NNX12AG77G; Deutsche Forschungsgemeinschaft(DE) SFB 663; Deutsche Forschungsgemeinschaft(DE) KI 531-29 Institutional support: RVO:61388963 Keywords : DNA bases * nucleobases * excited state * dynamics * computations * gas phase * conical intersections Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.920, year: 2013

  8. Feasibility study of molecular memory device based on DNA using methylation to store information

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

    2016-07-14

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  9. Feasibility study of molecular memory device based on DNA using methylation to store information

    International Nuclear Information System (INIS)

    Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

    2016-01-01

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  10. DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis

    Science.gov (United States)

    Lucena-Aguilar, Gema; Sánchez-López, Ana María; Barberán-Aceituno, Cristina; Carrillo-Ávila, José Antonio; López-Guerrero, José Antonio

    2016-01-01

    High-quality human DNA samples and associated information of individuals are necessary for biomedical research. Biobanks act as a support infrastructure for the scientific community by providing a large number of high-quality biological samples for specific downstream applications. For this purpose, biobank methods for sample preparation must ensure the usefulness and long-term functionality of the products obtained. Quality indicators are the tool to measure these parameters, the purity and integrity determination being those specifically used for DNA. This study analyzes the quality indicators in DNA samples derived from 118 frozen human tissues in optimal cutting temperature (OCT) reactive, 68 formalin-fixed paraffin-embedded (FFPE) tissues, 119 frozen blood samples, and 26 saliva samples. The results obtained for DNA quality are discussed in association with the usefulness for downstream applications and availability of the DNA source in the target study. In brief, if any material is valid, blood is the most approachable option of prospective collection of samples providing high-quality DNA. However, if diseased tissue is a requisite or samples are available, the recommended source of DNA would be frozen tissue. These conclusions will determine the best source of DNA, according to the planned downstream application. Furthermore our results support the conclusion that a complete procedure of DNA quantification and qualification is necessary to guarantee the appropriate management of the samples, avoiding low confidence results, high costs, and a waste of samples. PMID:27158753

  11. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  12. A new model for ancient DNA decay based on paleogenomic meta-analysis.

    Science.gov (United States)

    Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G

    2017-06-20

    The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  14. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  15. Electroporation-based DNA delivery technology

    DEFF Research Database (Denmark)

    Gothelf, A; Gehl, Julie

    2014-01-01

    DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....

  16. Computational modeling of a carbon nanotube-based DNA nanosensor

    Energy Technology Data Exchange (ETDEWEB)

    Kalantari-Nejad, R; Bahrami, M [Mechanical Engineering Department, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Rafii-Tabar, H [Department of Medical Physics and Biomedical Engineering and Research Centre for Medical Nanotechnology and Tissue Engineering, Shahid Beheshti University of Medical Sciences, Evin, Tehran (Iran, Islamic Republic of); Rungger, I; Sanvito, S, E-mail: mbahrami@aut.ac.ir [School of Physics and CRANN, Trinity College, Dublin 2 (Ireland)

    2010-11-05

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  17. Computational modeling of a carbon nanotube-based DNA nanosensor

    International Nuclear Information System (INIS)

    Kalantari-Nejad, R; Bahrami, M; Rafii-Tabar, H; Rungger, I; Sanvito, S

    2010-01-01

    During the last decade the design of biosensors, based on quantum transport in one-dimensional nanostructures, has developed as an active area of research. Here we investigate the sensing capabilities of a DNA nanosensor, designed as a semiconductor single walled carbon nanotube (SWCNT) connected to two gold electrodes and functionalized with a DNA strand acting as a bio-receptor probe. In particular, we have considered both covalent and non-covalent bonding between the DNA probe and the SWCNT. The optimized atomic structure of the sensor is computed both before and after the receptor attaches itself to the target, which consists of another DNA strand. The sensor's electrical conductance and transmission coefficients are calculated at the equilibrium geometries via the non-equilibrium Green's function scheme combined with the density functional theory in the linear response limit. We demonstrate a sensing efficiency of 70% for the covalently bonded bio-receptor probe, which drops to about 19% for the non-covalently bonded one. These results suggest that a SWCNT may be a promising candidate for a bio-molecular FET sensor.

  18. DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects

    Energy Technology Data Exchange (ETDEWEB)

    Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)

    2014-02-01

    The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular

  19. DNA based random key generation and management for OTP encryption.

    Science.gov (United States)

    Zhang, Yunpeng; Liu, Xin; Sun, Manhui

    2017-09-01

    One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

  20. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  1. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  2. Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

    Science.gov (United States)

    Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

    2018-06-01

    Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

  3. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. MitBASE : a comprehensive and integrated mitochondrial DNA database. The present status

    NARCIS (Netherlands)

    Attimonelli, M.; Altamura, N.; Benne, R.; Brennicke, A.; Cooper, J. M.; D'Elia, D.; Montalvo, A.; Pinto, B.; de Robertis, M.; Golik, P.; Knoop, V.; Lanave, C.; Lazowska, J.; Licciulli, F.; Malladi, B. S.; Memeo, F.; Monnerot, M.; Pasimeni, R.; Pilbout, S.; Schapira, A. H.; Sloof, P.; Saccone, C.

    2000-01-01

    MitBASE is an integrated and comprehensive database of mitochondrial DNA data which collects, under a single interface, databases for Plant, Vertebrate, Invertebrate, Human, Protist and Fungal mtDNA and a Pilot database on nuclear genes involved in mitochondrial biogenesis in Saccharomyces

  5. Development of a self-compacting gypsum-based lightweight composite

    NARCIS (Netherlands)

    Yu, Q.; Brouwers, H.J.H.

    2012-01-01

    This article addresses experiments and theories of a self-compacting gypsum-based lightweight composite (SGLC). A ß-hemihydrate is used as binder and lightweight aggregate (LWA, 0–2 mm in different size ranges) is used as aggregate into this composite. The mix of the new composite is designed based

  6. DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging

    Directory of Open Access Journals (Sweden)

    Ricardo Gredilla

    2011-01-01

    Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.

  7. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    Science.gov (United States)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  8. Magnetophoresis of flexible DNA-based dumbbell structures

    Science.gov (United States)

    Babić, B.; Ghai, R.; Dimitrov, K.

    2008-02-01

    Controlled movement and manipulation of magnetic micro- and nanostructures using magnetic forces can give rise to important applications in biomedecine, diagnostics, and immunology. We report controlled magnetophoresis and stretching, in aqueous solution, of a DNA-based dumbbell structure containing magnetic and diamagnetic microspheres. The velocity and stretching of the dumbbell were experimentally measured and correlated with a theoretical model based on the forces acting on individual magnetic beads or the entire dumbbell structures. The results show that precise and predictable manipulation of dumbbell structures is achievable and can potentially be applied to immunomagnetic cell separators.

  9. Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

    Directory of Open Access Journals (Sweden)

    Nynne Sharma

    2013-01-01

    Full Text Available DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system.

  10. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  11. Self-Assembling Molecular Logic Gates Based on DNA Crossover Tiles.

    Science.gov (United States)

    Campbell, Eleanor A; Peterson, Evan; Kolpashchikov, Dmitry M

    2017-07-05

    DNA-based computational hardware has attracted ever-growing attention due to its potential to be useful in the analysis of complex mixtures of biological markers. Here we report the design of self-assembling logic gates that recognize DNA inputs and assemble into crossover tiles when the output signal is high; the crossover structures disassemble to form separate DNA stands when the output is low. The output signal can be conveniently detected by fluorescence using a molecular beacon probe as a reporter. AND, NOT, and OR logic gates were designed. We demonstrate that the gates can connect to each other to produce other logic functions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Science.gov (United States)

    Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E

    2014-01-01

    Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  13. A force-based, parallel assay for the quantification of protein-DNA interactions.

    Directory of Open Access Journals (Sweden)

    Katja Limmer

    Full Text Available Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA, parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

  14. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  15. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  16. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  17. Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.

    Science.gov (United States)

    Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei

    2016-11-01

    Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.

  18. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  19. Hydrogen peroxide biosensor based on DNA-Hb modified gold electrode

    International Nuclear Information System (INIS)

    Kafi, A.K.M.; Fan Yin; Shin, Hoon-Kyu; Kwon, Young-Soo

    2006-01-01

    A hydrogen peroxide (H 2 O 2 ) biosensor based on DNA-hemoglobin (Hb) modified electrode is described in this paper. The sensor was designed by DNA and hemoglobin dropletting onto gold electrode surface layer by layer. The sensor based on the direct electron transfer of iron of hemoglobin showed a well electrocatalytic response to the reduction of the H 2 O 2 . This sensor offered an excellent electrochemical response for H 2 O 2 concentration below micromole level with high sensitivity and selectivity and short response time. Experimental conditions influencing the biosensor performance such as, pH, potential were optimized and assessed. The levels of the RSD's ( 2 O 2 was observed from 10 to 120 μM with the detection limit of 0.4 μM (based on the S/N = 3)

  20. Detection of Different DNA Animal Species in Commercial Candy Products.

    Science.gov (United States)

    Muñoz-Colmenero, Marta; Martínez, Jose Luis; Roca, Agustín; Garcia-Vazquez, Eva

    2016-03-01

    Candy products are consumed all across the world, but there is not much information about their composition. In this study we have used a DNA-based approach for determining the animal species occurring in 40 commercial candies of different types. We extracted DNA and performed PCR amplification, cloning and sequencing for obtaining species-informative DNA sequences. Eight species were identified including fish (hake and anchovy) in 22% of the products analyzed. Bovine and porcine were the most abundant appearing in 27 samples each one. Most products contained a mixture of species. Marshmallows (7), jelly-types, and gummies (20) contained a significantly higher number of species than hard candies (9). We demonstrated the presence of DNA animal species in candy product which allow consumers to make choices and prevent allergic reaction. © 2016 Institute of Food Technologists®

  1. Structure-Composition-Property Relationships in Polymeric Amorphous Calcium Phosphate-Based Dental Composites

    Directory of Open Access Journals (Sweden)

    Drago Skrtic

    2009-11-01

    Full Text Available Our studies of amorphous calcium phosphate (ACP-based materials over the last decade have yielded bioactive polymeric composites capable of protecting teeth from demineralization or even regenerating lost tooth mineral. The anti-cariogenic/remineralizing potential of these ACP composites originates from their propensity, when exposed to the oral environment, to release in a sustained manner sufficient levels of mineral-forming calcium and phosphate ions to promote formation of stable apatitic tooth mineral. However, the less than optimal ACP filler/resin matrix cohesion, excessive polymerization shrinkage and water sorption of these experimental materials can adversely affect their physicochemical and mechanical properties, and, ultimately, limit their lifespan. This study demonstrates the effects of chemical structure and composition of the methacrylate monomers used to form the matrix phase of composites on degree of vinyl conversion (DVC and water sorption of both copolymers and composites and the release of mineral ions from the composites. Modification of ACP surface via introducing cations and/or polymers ab initio during filler synthesis failed to yield mechanically improved composites. However, moderate improvement in composite’s mechanical stability without compromising its remineralization potential was achieved by silanization and/or milling of ACP filler. Using ethoxylated bisphenol A dimethacrylate or urethane dimethacrylate as base monomers and adding moderate amounts of hydrophilic 2-hydroxyethyl methacrylate or its isomer ethyl-α-hydroxymethacrylate appears to be a promising route to maximize the remineralizing ability of the filler while maintaining high DVC. Exploration of the structure/composition/property relationships of ACP fillers and polymer matrices is complex but essential for achieving a better understanding of the fundamental mechanisms that govern dissolution/re-precipitation of bioactive ACP fillers, and

  2. Pros and cons of methylation-based enrichment methods for ancient DNA

    Science.gov (United States)

    Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

    2015-01-01

    The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828

  3. On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor

    International Nuclear Information System (INIS)

    Rizzi, Giovanni; Østerberg, Frederik W.; Henriksen, Anders D.; Dufva, Martin; Hansen, Mikkel F.

    2015-01-01

    We present real-time measurements of DNA melting curves in a chip-based system that detects the amount of surface-bound magnetic beads using magnetoresistive magnetic field sensors. The sensors detect the difference between the amount of beads bound to the top and bottom sensor branches of the differential sensor geometry. The sensor surfaces are functionalized with wild type (WT) and mutant type (MT) capture probes, differing by a single base insertion (a single nucleotide polymorphism, SNP). Complementary biotinylated targets in suspension couple streptavidin magnetic beads to the sensor surface. The beads are magnetized by the field arising from the bias current passed through the sensors. We demonstrate the first on-chip measurements of the melting of DNA hybrids upon a ramping of the temperature. This overcomes the limitation of using a single washing condition at constant temperature. Moreover, we demonstrate that a single sensor bridge can be used to genotype a SNP. - Highlights: • We apply magnetoresistive sensors to study solid-surface hybridization kinetics of DNA. • We measure DNA melting profiles for perfectly matching DNA duplexes and for a single base mismatch. • We present a procedure to correct for temperature dependencies of the sensor output. • We reliably extract melting temperatures for the DNA hybrids. • We demonstrate direct measurement of differential binding signal for two probes on a single sensor

  4. Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

    Science.gov (United States)

    Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

    2013-01-01

    To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

  5. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  6. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  7. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  8. Two-dimensional salt and temperature DNA denaturation analysis using a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Dufva, Martin; Hansen, Mikkel Fougt

    2017-01-01

    We present a microfluidic system and its use to measure DNA denaturation curves by varying the temperature or salt (Na+) concentration. The readout is based on real-time measurements of DNA hybridization using magnetoresistive sensors and magnetic nanoparticles (MNPs) as labels. We report the first...... melting curves of DNA hybrids measured as a function of continuously decreasing salt concentration at fixed temperature and compare them to the corresponding curves obtained vs. temperature at fixed salt concentration. The magnetoresistive sensor platform provided reliable results under varying....... The results demonstrate that concentration melting provides an attractive alternative to temperature melting in on-chip DNA denaturation experiments and further show that the magnetoresistive platform is attractive due to its low cross-sensitivity to temperature and liquid composition....

  9. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  10. Distortion of genetically modified organism quantification in processed foods: influence of particle size compositions and heat-induced DNA degradation.

    Science.gov (United States)

    Moreano, Francisco; Busch, Ulrich; Engel, Karl-Heinz

    2005-12-28

    Milling fractions from conventional and transgenic corn were prepared at laboratory scale and used to study the influence of sample composition and heat-induced DNA degradation on the relative quantification of genetically modified organisms (GMO) in food products. Particle size distributions of the obtained fractions (coarse grits, regular grits, meal, and flour) were characterized using a laser diffraction system. The application of two DNA isolation protocols revealed a strong correlation between the degree of comminution of the milling fractions and the DNA yield in the extracts. Mixtures of milling fractions from conventional and transgenic material (1%) were prepared and analyzed via real-time polymerase chain reaction. Accurate quantification of the adjusted GMO content was only possible in mixtures containing conventional and transgenic material in the form of analogous milling fractions, whereas mixtures of fractions exhibiting different particle size distributions delivered significantly over- and underestimated GMO contents depending on their compositions. The process of heat-induced nucleic acid degradation was followed by applying two established quantitative assays showing differences between the lengths of the recombinant and reference target sequences (A, deltal(A) = -25 bp; B, deltal(B) = +16 bp; values related to the amplicon length of the reference gene). Data obtained by the application of method A resulted in underestimated recoveries of GMO contents in the samples of heat-treated products, reflecting the favored degradation of the longer target sequence used for the detection of the transgene. In contrast, data yielded by the application of method B resulted in increasingly overestimated recoveries of GMO contents. The results show how commonly used food technological processes may lead to distortions in the results of quantitative GMO analyses.

  11. Physically transient photonics: random versus distributed feedback lasing based on nanoimprinted DNA.

    Science.gov (United States)

    Camposeo, Andrea; Del Carro, Pompilio; Persano, Luana; Cyprych, Konrad; Szukalski, Adam; Sznitko, Lech; Mysliwiec, Jaroslaw; Pisignano, Dario

    2014-10-28

    Room-temperature nanoimprinted, DNA-based distributed feedback (DFB) laser operation at 605 nm is reported. The laser is made of a pure DNA host matrix doped with gain dyes. At high excitation densities, the emission of the untextured dye-doped DNA films is characterized by a broad emission peak with an overall line width of 12 nm and superimposed narrow peaks, characteristic of random lasing. Moreover, direct patterning of the DNA films is demonstrated with a resolution down to 100 nm, enabling the realization of both surface-emitting and edge-emitting DFB lasers with a typical line width of <0.3 nm. The resulting emission is polarized, with a ratio between the TE- and TM-polarized intensities exceeding 30. In addition, the nanopatterned devices dissolve in water within less than 2 min. These results demonstrate the possibility of realizing various physically transient nanophotonics and laser architectures, including random lasing and nanoimprinted devices, based on natural biopolymers.

  12. The radiation chemistry of the purine bases within DNA and related model compounds

    International Nuclear Information System (INIS)

    Cadet, J.; Berger, M.; Shaw, A.

    1986-01-01

    Both the direct and indirect effects of ionizing radiations are believed to contribute to the chemical changes induced in cellular DNA. Relevant information on the possible degradation pathways has been provided by studies using DNA model compounds, the major proportion of which have focused on pyrimidine components and sugar derivatives. With the development of powerful analytical tools such as high performance liquid chromatography and soft ionization mass spectrometry techniques, progress has recently been made in the elucidation of the nature of the radiation-induced chemical modifications of purine bases in DNA and related nucleosides and nucleotides. This short review details recent aspects of the radiation-induced degradation of adenine and guanine bases in DNA and its model compounds as the result of both direct and indirect effects. 11 refs., 2 figs., 1 tab

  13. Biosensors Based on Ultrathin Film Composite Membranes

    Science.gov (United States)

    1994-01-25

    composite membranes should have a number C •’ of potential advantages including fast response time, simplicity of construction, and applicability to a number...The support membrane for the ultrathin film composite was an Anopore ( Alltech Associates) microporous alumina filter, these membranes are 55 Pm thick...constant 02 concentration in this solution. Finally, one of the most important potential advantage of a sensor based on an ultrathin film composite

  14. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage

    Science.gov (United States)

    Klungland, Arne; Rosewell, Ian; Hollenbach, Stephan; Larsen, Elisabeth; Daly, Graham; Epe, Bernd; Seeberg, Erling; Lindahl, Tomas; Barnes, Deborah E.

    1999-01-01

    DNA damage generated by oxidant byproducts of cellular metabolism has been proposed as a key factor in cancer and aging. Oxygen free radicals cause predominantly base damage in DNA, and the most frequent mutagenic base lesion is 7,8-dihydro-8-oxoguanine (8-oxoG). This altered base can pair with A as well as C residues, leading to a greatly increased frequency of spontaneous G·C→T·A transversion mutations in repair-deficient bacterial and yeast cells. Eukaryotic cells use a specific DNA glycosylase, the product of the OGG1 gene, to excise 8-oxoG from DNA. To assess the role of the mammalian enzyme in repair of DNA damage and prevention of carcinogenesis, we have generated homozygous ogg1−/− null mice. These animals are viable but accumulate abnormal levels of 8-oxoG in their genomes. Despite this increase in potentially miscoding DNA lesions, OGG1-deficient mice exhibit only a moderately, but significantly, elevated spontaneous mutation rate in nonproliferative tissues, do not develop malignancies, and show no marked pathological changes. Extracts of ogg1 null mouse tissues cannot excise the damaged base, but there is significant slow removal in vivo from proliferating cells. These findings suggest that in the absence of the DNA glycosylase, and in apparent contrast to bacterial and yeast cells, an alternative repair pathway functions to minimize the effects of an increased load of 8-oxoG in the genome and maintain a low endogenous mutation frequency. PMID:10557315

  15. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  16. Electrochemical DNA biosensor based on avidin-biotin conjugation for influenza virus (type A) detection

    Science.gov (United States)

    Chung, Da-Jung; Kim, Ki-Chul; Choi, Seong-Ho

    2011-09-01

    An electrochemical DNA biosensor (E-DNA biosensor) was fabricated by avidin-biotin conjugation of a biotinylated probe DNA, 5'-biotin-ATG AGT CTT CTA ACC GAG GTC GAA-3', and an avidin-modified glassy carbon electrode (GCE) to detect the influenza virus (type A). An avidin-modified GCE was prepared by the reaction of avidin and a carboxylic acid-modified GCE, which was synthesized by the electrochemical reduction of 4-carboxyphenyl diazonium salt. The current value of the E-DNA biosensor was evaluated after hybridization of the probe DNA and target DNA using cyclic voltammetry (CV). The current value decreased after the hybridization of the probe DNA and target DNA. The DNA that was used follows: complementary target DNA, 5'-TTC GAC CTC GGT TAG AAG ACT CAT-3' and two-base mismatched DNA, 5'-TTC GAC AGC GGT TAT AAG ACT CAT-3'.

  17. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  18. A comparative evaluation of microleakage of restorations using silorane-based dental composite and methacrylate-based dental composites in Class II cavities: An in vitro study

    Directory of Open Access Journals (Sweden)

    Jambai Sampath Kumar Sivakumar

    2016-01-01

    Full Text Available Aim: The aim of this in vitro study was to evaluate and compare the microleakage of restorations using low shrinkage silorane-based dental composite and methacrylate-based dental composites in Class II cavity at the occlusal and gingival margins. Materials and Methods: Sixty mandibular molars were collected and divided into three experimental groups and one negative control group. Class II slot cavity was prepared on the mesial surface. Experimental groups were restored with Group I: silorane-based microhybrid composite, Group II: methacrylate-based nanohybrid composite, and Group III: Methacrylate-based microhybrid composite, respectively. Group IV: negative control. The samples were thermocycled, root apices were sealed with sticky wax and coated with nail varnish except 1 mm around the restoration. This was followed by immersion in 2% Rhodamine-B dye solution under vacuum at room temperature for 24 h. Then, the samples were sectioned longitudinally in the mesiodistal direction and evaluated under stereomicroscope ×40 magnification. Scoring was done according to the depth of dye penetration in to the cavity. Statistical analysis of the data was done. Results: The results were that no statistically significant difference in the microleakage at the occlusal margin for all the restorative materials, whereas at the gingival margin, silorane-based microhybrid composite showed less microleakage than the methacrylate-based nano- and micro-hybrid composites. Conclusion: In general, silorane-based microhybrid composite had less microleakage among the other materials used in this in vitro study.

  19. The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy

    Directory of Open Access Journals (Sweden)

    Suneetha Amara

    2017-03-01

    Full Text Available DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer.

  20. A dynamic bead-based microarray for parallel DNA detection

    International Nuclear Information System (INIS)

    Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P

    2011-01-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

  1. Smart DNA vectors based on cyclodextrin polymers: compaction and endosomal release.

    Science.gov (United States)

    Wintgens, Véronique; Leborgne, Christian; Baconnais, Sonia; Burckbuchler, Virginie; Le Cam, Eric; Scherman, Daniel; Kichler, Antoine; Amiel, Catherine

    2012-02-01

    Neutral β-cyclodextrin polymers (polyβCD) associated with cationic adamantyl derivatives (Ada) can be used to deliver plasmid DNA into cells. In absence of an endosomolytic agent, transfection efficiency remains low because most complexes are trapped in the endosomal compartment. We asked whether addition of an imidazole-modified Ada can increase efficiency of polyβCD/cationic Ada-based delivery system. We synthesized two adamantyl derivatives: Ada5, which has a spacer arm between the Ada moiety and a bi-cationic polar head group, and Ada6, which presents an imidazole group. Strength of association between polyβCD and Ada derivatives was evaluated by fluorimetric titration. Gel mobility shift assay, zeta potential, and dark field transmission electron microscopy experiments demonstrated the system allowed for efficient DNA compaction. In vitro transfection experiments performed on HepG2 and HEK293 cells revealed the quaternary system polyβCD/Ada5/Ada6/DNA has efficiency comparable to cationic lipid DOTAP. We successfully designed fine-tuned DNA vectors based on cyclodextrin polymers combined with two new adamantyl derivatives, leading to significant transfection associated with low toxicity.

  2. One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.

    Science.gov (United States)

    Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E

    2014-06-01

    The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.

  3. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  4. Satellite DNA-based artificial chromosomes for use in gene therapy.

    Science.gov (United States)

    Hadlaczky, G

    2001-04-01

    Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.

  5. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features.

    Science.gov (United States)

    Zaman, Rianon; Chowdhury, Shahana Yasmin; Rashid, Mahmood A; Sharma, Alok; Dehzangi, Abdollah; Shatabda, Swakkhar

    2017-01-01

    DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM) as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  6. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features

    Directory of Open Access Journals (Sweden)

    Rianon Zaman

    2017-01-01

    Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  7. Role of minor groove width and hydration pattern on amsacrine interaction with DNA.

    Directory of Open Access Journals (Sweden)

    Deepak K Jangir

    Full Text Available Amsacrine is an anilinoacridine derivative anticancer drug, used to treat a wide variety of malignancies. In cells, amsacrine poisons topoisomerase 2 by stabilizing DNA-drug-enzyme ternary complex. Presence of amsacrine increases the steady-state concentration of these ternary complexes which in turn hampers DNA replication and results in subsequent cell death. Due to reversible binding and rapid slip-out of amsacrine from DNA duplex, structural data is not available on amsacrine-DNA complexes. In the present work, we designed five oligonucleotide duplexes, differing in their minor groove widths and hydration pattern, and examined their binding with amsacrine using attenuated total reflection Fourier transform infrared (ATR-FTIR spectroscopy. Complexes of amsacrine with calf thymus DNA were also evaluated for a comparison. Our results demonstrate for the first time that amsacrine is not a simple intercalator; rather mixed type of DNA binding (intercalation and minor groove takes place between amsacrine and DNA. Further, this binding is highly sensitive towards the geometries and hydration patterns of different minor grooves present in the DNA. This study shows that ligand binding to DNA could be very sensitive to DNA base composition and DNA groove structures. Results demonstrated here could have implication for understanding cytotoxic mechanism of aminoacridine based anticancer drugs and provide directions to modify these drugs for better efficacy and few side-effects.

  8. Highly Sensitive DNA Sensor Based on Upconversion Nanoparticles and Graphene Oxide.

    Science.gov (United States)

    Alonso-Cristobal, P; Vilela, P; El-Sagheer, A; Lopez-Cabarcos, E; Brown, T; Muskens, O L; Rubio-Retama, J; Kanaras, A G

    2015-06-17

    In this work we demonstrate a DNA biosensor based on fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er nanoparticles and graphene oxide (GO). Monodisperse NaYF4:Yb,Er nanoparticles with a mean diameter of 29.1 ± 2.2 nm were synthesized and coated with a SiO2 shell of 11 nm, which allowed the attachment of single strands of DNA. When these DNA-functionalized NaYF4:Yb,Er@SiO2 nanoparticles were in the proximity of the GO surface, the π-π stacking interaction between the nucleobases of the DNA and the sp(2) carbons of the GO induced a FRET fluorescence quenching due to the overlap of the fluorescence emission of the NaYF4:Yb,Er@SiO2 and the absorption spectrum of GO. By contrast, in the presence of the complementary DNA strands, the hybridization leads to double-stranded DNA that does not interact with the GO surface, and thus the NaYF4:Yb,Er@SiO2 nanoparticles remain unquenched and fluorescent. The high sensitivity and specificity of this sensor introduces a new method for the detection of DNA with a detection limit of 5 pM.

  9. Research Report Non-invasive DNA-based species and sex ...

    Indian Academy of Sciences (India)

    shrushti modi

    Non-invasive DNA-based species and sex identification of Asiatic wild dog (Cuon alpinus) .... We did not find any cross-gender amplification with any of the reference or field-collected samples. Success rate for sex discrimination for all field-.

  10. Developing a biological dosimeter based on mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Adams, S; Carlisle, S M; Unrau, P; Deugau, K V [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

    1996-12-31

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs.

  11. Developing a biological dosimeter based on mitochondrial DNA

    International Nuclear Information System (INIS)

    Adams, S.; Carlisle, S.M.; Unrau, P.; Deugau, K.V.

    1995-01-01

    Direct measurement of deoxyribonucleic acid (DNA) damage from ionizing radiation may be advantageous in determining radiation radiation exposures and assessing their effects on atomic radiation workers. The mitochondrial DNA molecule is one potential cellular DNA target which is: fully defined and sequenced; present in many copies per cell; not vital to cellular survival; and less subject to DNA repair than nuclear DNA. A method is described to isolate and analyse normal mitochondrial DNA. We describe the developments needed to determine DNA damage in mitochondrial DNA. The target is to make a biological dosimeter. (author). 6 refs., 3 figs

  12. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  13. Characterization of fabricated cobalt-based alloy/nano bioactive glass composites

    Energy Technology Data Exchange (ETDEWEB)

    Bafandeh, Mohammad Reza, E-mail: mr.bafandeh@gmail.com [Department of Materials Science and Engineering, Faculty of Engineering, University of Kashan, Kashan (Iran, Islamic Republic of); Gharahkhani, Raziyeh; Fathi, Mohammad Hossein [Department of Materials Engineering, Isfahan University of Technology (IUT), Isfahan 84156-83111 (Iran, Islamic Republic of)

    2016-12-01

    In this work, cobalt-based alloy/nano bioactive glass (NBG) composites with 10, 15 and 20 wt% NBG were prepared and their bioactivity after immersion in simulated body fluid (SBF) for 1 to 4 weeks was studied. Scanning electron microscopy images of two- step sintered composites revealed relatively dense microstructure. The results showed that density of composite samples decreased with increase in NBG amount. The microstructure analysis as well as energy dispersive X-ray analysis (EDX) revealed that small amount of calcium phosphate phases precipitates on the surface of composite samples after 1 week immersion in SBF. After 2 weeks immersion, considerable amounts of cauliflower-like shaped precipitations were seen on the surface of the composites. Based on EDX analysis, these precipitations were composed mainly from Ca, P and Si. The observed bands in the Fourier transform infrared spectroscopy of immersed composites samples for 4 weeks in SBF, were characteristic bands of hydroxyapatite. Therefore it is possible to form hydroxyapatite layer on the surface of composite samples during immersion in SBF. The results indicated that prepared composites unlike cobalt-based alloy are bioactive, promising their possibility for implant applications. - Highlights: • Co-based alloy/nano bioactive glass (NBG) composites with 10, 15 and 20 wt% NBG were prepared. • In order to study their bioactivity, composite samples were immersed in SBF solution for 1 to 4 weeks. • Immersion in SBF accompanied with precipitation of hydroxyapatite on surface of samples. • Prepared composite samples unlike cobalt-based alloy were bioactive.

  14. Characterization of fabricated cobalt-based alloy/nano bioactive glass composites

    International Nuclear Information System (INIS)

    Bafandeh, Mohammad Reza; Gharahkhani, Raziyeh; Fathi, Mohammad Hossein

    2016-01-01

    In this work, cobalt-based alloy/nano bioactive glass (NBG) composites with 10, 15 and 20 wt% NBG were prepared and their bioactivity after immersion in simulated body fluid (SBF) for 1 to 4 weeks was studied. Scanning electron microscopy images of two- step sintered composites revealed relatively dense microstructure. The results showed that density of composite samples decreased with increase in NBG amount. The microstructure analysis as well as energy dispersive X-ray analysis (EDX) revealed that small amount of calcium phosphate phases precipitates on the surface of composite samples after 1 week immersion in SBF. After 2 weeks immersion, considerable amounts of cauliflower-like shaped precipitations were seen on the surface of the composites. Based on EDX analysis, these precipitations were composed mainly from Ca, P and Si. The observed bands in the Fourier transform infrared spectroscopy of immersed composites samples for 4 weeks in SBF, were characteristic bands of hydroxyapatite. Therefore it is possible to form hydroxyapatite layer on the surface of composite samples during immersion in SBF. The results indicated that prepared composites unlike cobalt-based alloy are bioactive, promising their possibility for implant applications. - Highlights: • Co-based alloy/nano bioactive glass (NBG) composites with 10, 15 and 20 wt% NBG were prepared. • In order to study their bioactivity, composite samples were immersed in SBF solution for 1 to 4 weeks. • Immersion in SBF accompanied with precipitation of hydroxyapatite on surface of samples. • Prepared composite samples unlike cobalt-based alloy were bioactive.

  15. DNA methylation-based measures of biological age: meta-analysis predicting time to death

    Science.gov (United States)

    Chen, Brian H.; Marioni, Riccardo E.; Colicino, Elena; Peters, Marjolein J.; Ward-Caviness, Cavin K.; Tsai, Pei-Chien; Roetker, Nicholas S.; Just, Allan C.; Demerath, Ellen W.; Guan, Weihua; Bressler, Jan; Fornage, Myriam; Studenski, Stephanie; Vandiver, Amy R.; Moore, Ann Zenobia; Tanaka, Toshiko; Kiel, Douglas P.; Liang, Liming; Vokonas, Pantel; Schwartz, Joel; Lunetta, Kathryn L.; Murabito, Joanne M.; Bandinelli, Stefania; Hernandez, Dena G.; Melzer, David; Nalls, Michael; Pilling, Luke C.; Price, Timothy R.; Singleton, Andrew B.; Gieger, Christian; Holle, Rolf; Kretschmer, Anja; Kronenberg, Florian; Kunze, Sonja; Linseisen, Jakob; Meisinger, Christine; Rathmann, Wolfgang; Waldenberger, Melanie; Visscher, Peter M.; Shah, Sonia; Wray, Naomi R.; McRae, Allan F.; Franco, Oscar H.; Hofman, Albert; Uitterlinden, André G.; Absher, Devin; Assimes, Themistocles; Levine, Morgan E.; Lu, Ake T.; Tsao, Philip S.; Hou, Lifang; Manson, JoAnn E.; Carty, Cara L.; LaCroix, Andrea Z.; Reiner, Alexander P.; Spector, Tim D.; Feinberg, Andrew P.; Levy, Daniel; Baccarelli, Andrea; van Meurs, Joyce; Bell, Jordana T.; Peters, Annette; Deary, Ian J.; Pankow, James S.; Ferrucci, Luigi; Horvath, Steve

    2016-01-01

    Estimates of biological age based on DNA methylation patterns, often referred to as “epigenetic age”, “DNAm age”, have been shown to be robust biomarkers of age in humans. We previously demonstrated that independent of chronological age, epigenetic age assessed in blood predicted all-cause mortality in four human cohorts. Here, we expanded our original observation to 13 different cohorts for a total sample size of 13,089 individuals, including three racial/ethnic groups. In addition, we examined whether incorporating information on blood cell composition into the epigenetic age metrics improves their predictive power for mortality. All considered measures of epigenetic age acceleration were predictive of mortality (p≤8.2×10−9), independent of chronological age, even after adjusting for additional risk factors (p<5.4×10−4), and within the racial/ethnic groups that we examined (non-Hispanic whites, Hispanics, African Americans). Epigenetic age estimates that incorporated information on blood cell composition led to the smallest p-values for time to death (p=7.5×10−43). Overall, this study a) strengthens the evidence that epigenetic age predicts all-cause mortality above and beyond chronological age and traditional risk factors, and b) demonstrates that epigenetic age estimates that incorporate information on blood cell counts lead to highly significant associations with all-cause mortality. PMID:27690265

  16. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  17. A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

    Science.gov (United States)

    Yamamoto, F; Yamamoto, M

    2004-07-01

    We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

  18. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  19. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  20. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  1. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre

    2006-01-01

    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  2. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite

    2010-08-01

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  3. ABI Base Recall: Automatic Correction and Ends Trimming of DNA Sequences.

    Science.gov (United States)

    Elyazghi, Zakaria; Yazouli, Loubna El; Sadki, Khalid; Radouani, Fouzia

    2017-12-01

    Automated DNA sequencers produce chromatogram files in ABI format. When viewing chromatograms, some ambiguities are shown at various sites along the DNA sequences, because the program implemented in the sequencing machine and used to call bases cannot always precisely determine the right nucleotide, especially when it is represented by either a broad peak or a set of overlaying peaks. In such cases, a letter other than A, C, G, or T is recorded, most commonly N. Thus, DNA sequencing chromatograms need manual examination: checking for mis-calls and truncating the sequence when errors become too frequent. The purpose of this paper is to develop a program allowing the automatic correction of these ambiguities. This application is a Web-based program powered by Shiny and runs under R platform for an easy exploitation. As a part of the interface, we added the automatic ends clipping option, alignment against reference sequences, and BLAST. To develop and test our tool, we collected several bacterial DNA sequences from different laboratories within Institut Pasteur du Maroc and performed both manual and automatic correction. The comparison between the two methods was carried out. As a result, we note that our program, ABI base recall, accomplishes good correction with a high accuracy. Indeed, it increases the rate of identity and coverage and minimizes the number of mismatches and gaps, hence it provides solution to sequencing ambiguities and saves biologists' time and labor.

  4. Ionically conducting Er3+-doped DNA-based biomembranes for electrochromic devices

    International Nuclear Information System (INIS)

    Leones, R.; Fernandes, M.; Sentanin, F.; Cesarino, I.; Lima, J.F.; Zea Bermudez, V. de; Pawlicka, A.; Magon, C.J.; Donoso, J.P.; Silva, M.M.

    2014-01-01

    Biopolymer-based membranes have particular interest due to their biocompatibility, Biodegradability, easy extraction from natural resources and low cost. The incorporation of Er 3+ ions into natural macromolecule hosts with the purpose of producing highly efficient emitting phosphors is of widespread interest in materials science, due to their important roles in display devices. Thus, biomembranes may be viewed as innovative materials for the area of optics. This paper describes studies of luminescent material DNA-based membranes doped with erbium triflate and demonstrates that their potential technological applications may be expanded to electrochromic devices. The sample that exhibits the highest ionic conductivity is DNA 10 Er, (1.17 × 10 −5 and 7.76 × 10 −4 S.cm −1 at 30 and 100 °C, respectively). DSC, XRD and POM showed that the inclusion of the guest salt into DNA does not change significantly its amorphous nature. The overall redox stability was ca. 2.0 V indicating that these materials have an acceptable stability window for applications in solid state electrochemical devices. The EPR analysis suggested that the Er 3+ ions are distributed in various environments. A small ECD comprising a Er 3+ -doped DNA-based membrane was assembled and tested by cyclic voltammetry and chronoamperometry. These electrochemical analyses revealed a pale blue color to transparent color change and a decrease of the charge density from -4.0 to -1.2 mC.cm −2 during 4000 color/bleaching cycles

  5. Towards DNA-Based Programmable Matter

    Science.gov (United States)

    2012-02-28

    thiolated   ssDNA  was  first  immobilized  onto  the  gold...surface.  The  surface  was  then  passivated  with   mercaptohexanol.  Subsequently,  another  complementary   thiolated ...right).       Approach  3:  DNA-­‐mediated  interaction  between   polymer -­‐coated  surfaces   We  also  tried

  6. DNA based methods used for characterization and detection of food ...

    African Journals Online (AJOL)

    Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

  7. Mechanical properties of wood-based composite materials

    Science.gov (United States)

    Zhiyong Cai; Robert J. Ross

    2010-01-01

    The term composite is used to describe any wood material bonded together with adhesives. The current product mix ranges from fiberboard to laminated beams and components. In this chapter, wood-based composite materials are classified into the following categories: panel products (plywood, oriented strandboard (OSB), particleboard, fiberboard, medium-density fiberboard...

  8. Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.

    Science.gov (United States)

    Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan

    2017-09-26

    Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.

  9. DNA-based catalytic enantioselective intermolecular oxa-Michael addition reactions

    NARCIS (Netherlands)

    Megens, Rik P.; Roelfes, Gerard

    2012-01-01

    Using the DNA-based catalysis concept, a novel Cu(II) catalyzed enantioselective oxa-Michael addition of alcohols to enones is reported. Enantioselectivities of up to 86% were obtained. The presence of water is important for the reactivity, possibly by reverting unwanted side reactions such as

  10. A composite material based on recycled tires

    Science.gov (United States)

    Malers, L.; Plesuma, R.; Locmele, L.

    2009-01-01

    The present study is devoted to the elaboration and investigation of a composite material based on mechanically grinded recycled tires and a polymer binder. The correlation between the content of the binder, some technological parameters, and material properties of the composite was clarified. The apparent density, the compressive stress at a 10% strain, the compressive elastic modulus in static and cyclic loadings, and the insulating properties (acoustic and thermal) were the parameters of special interest of the present investigation. It is found that a purposeful variation of material composition and some technological parameters leads to multifunctional composite materials with different and predictable mechanical and insulation properties.

  11. Ultrasensitive Electrochemical Detection of Clostridium perfringens DNA Based Morphology-Dependent DNA Adsorption Properties of CeO2 Nanorods in Dairy Products

    Directory of Open Access Journals (Sweden)

    Xingcan Qian

    2018-06-01

    Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.

  12. Feasibility of using DNA-immobilized nanocellulose-based immunoadsorbent for systemic lupus erythematosus plasmapheresis.

    Science.gov (United States)

    Xu, Changgang; Carlsson, Daniel O; Mihranyan, Albert

    2016-07-01

    The goal of this project was to study the feasibility of using a DNA-immobilized nanocellulose-based immunoadsorbent for possible application in medical apheresis such as systemic lupus erythematosus (SLE) treatment. Calf thymus DNA was bound to high surface area nanocellulose membrane at varying concentrations using UV-irradiation. The DNA-immobilized samples were characterized with scanning electron microscopy, atomic force microscopy, and phosphorus elemental analysis. The anti-ds-DNA IgG binding was tested in vitro using ELISA. The produced sample showed high affinity in vitro to bind anti-ds-DNA-antibodies from mice, as much as 80% of added IgG was bound by the membrane. Furthermore, the binding efficiency was quantitatively dependent on the amount of immobilized DNA onto nanocellulose membrane. The described nanocellulose membranes are interesting immunoadsorbents for continued clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Graphene-Based Composites as Cathode Materials for Lithium Ion Batteries

    Directory of Open Access Journals (Sweden)

    Libao Chen

    2013-01-01

    Full Text Available Owing to the superior mechanical, thermal, and electrical properties, graphene was a perfect candidate to improve the performance of lithium ion batteries. Herein, we review the recent advances in graphene-based composites and their application as cathode materials for lithium ion batteries. We focus on the synthesis methods of graphene-based composites and the superior electrochemical performance of graphene-based composites as cathode materials for lithium ion batteries.

  14. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang

    2010-11-08

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  15. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang; Yu, Jun

    2010-01-01

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  16. Sequence heterogeneity accelerates protein search for targets on DNA

    International Nuclear Information System (INIS)

    Shvets, Alexey A.; Kolomeisky, Anatoly B.

    2015-01-01

    The process of protein search for specific binding sites on DNA is fundamentally important since it marks the beginning of all major biological processes. We present a theoretical investigation that probes the role of DNA sequence symmetry, heterogeneity, and chemical composition in the protein search dynamics. Using a discrete-state stochastic approach with a first-passage events analysis, which takes into account the most relevant physical-chemical processes, a full analytical description of the search dynamics is obtained. It is found that, contrary to existing views, the protein search is generally faster on DNA with more heterogeneous sequences. In addition, the search dynamics might be affected by the chemical composition near the target site. The physical origins of these phenomena are discussed. Our results suggest that biological processes might be effectively regulated by modifying chemical composition, symmetry, and heterogeneity of a genome

  17. Sequence heterogeneity accelerates protein search for targets on DNA

    Energy Technology Data Exchange (ETDEWEB)

    Shvets, Alexey A.; Kolomeisky, Anatoly B., E-mail: tolya@rice.edu [Department of Chemistry and Center for Theoretical Biological Physics, Rice University, Houston, Texas 77005 (United States)

    2015-12-28

    The process of protein search for specific binding sites on DNA is fundamentally important since it marks the beginning of all major biological processes. We present a theoretical investigation that probes the role of DNA sequence symmetry, heterogeneity, and chemical composition in the protein search dynamics. Using a discrete-state stochastic approach with a first-passage events analysis, which takes into account the most relevant physical-chemical processes, a full analytical description of the search dynamics is obtained. It is found that, contrary to existing views, the protein search is generally faster on DNA with more heterogeneous sequences. In addition, the search dynamics might be affected by the chemical composition near the target site. The physical origins of these phenomena are discussed. Our results suggest that biological processes might be effectively regulated by modifying chemical composition, symmetry, and heterogeneity of a genome.

  18. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

    Science.gov (United States)

    Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

    2016-12-15

    Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Ribonucleotides Linked to DNA of Herpes Simplex Virus Type 1

    Science.gov (United States)

    Hirsch, Ivan; Vonka, Vladimír

    1974-01-01

    Cells of a continuous cell line derived from rabbit embryo fibroblasts were infected with herpes simplex type 1 virus (HSV-1) and maintained in the presence of either [5-3H]uridine or [methyl-3H]thymidine or 32PO43−. Nucleocapsids were isolated from the cytoplasmic fraction, partially purified, and treated with DNase and RNase. From the pelleted nucleocapsids, DNA was extracted and purified by centrifugation in sucrose and cesium sulfate gradients. The acid-precipitable radioactivity of [5-3H]uridine-labeled DNA was partially susceptible to pancreatic RNase and alkaline treatment; the susceptibility to the enzyme decreased with increasing salt concentration. No drop of activity of DNA labeled with [3H]thymidine was observed either after RNase or alkali treatment. Base composition analysis of [5-3H]uridine-labeled DNA showed that the radioactivity was recovered as uracil and cytosine. In the cesium sulfate gradient, the purified [5-3H]uridine-labeled DNA banded at the same position as the 32P-labeled DNA. The present data tend to suggest that ribonucleotide sequences are present in HSV DNA, that they are covalently attached to the viral DNA, and that they can form double-stranded structures. PMID:4364894

  20. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  1. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  2. The influence of selenium status on body composition, oxidative DNA damage and total antioxidant capacity in newly diagnosed type 2 diabetes mellitus: A case-control study.

    Science.gov (United States)

    Othman, Fatimah Binti; Mohamed, Hamid Jan Bin Jan; Sirajudeen, K N S; Noh, Mohd Fairulnizal B Md; Rajab, Nor Fadilah

    2017-09-01

    Selenium is involved in the complex system of defense against oxidative stress in diabetes through its biological function of selenoproteins and the antioxidant enzyme. A case-control study was carried out to determine the association of plasma selenium with oxidative stress and body composition status presented in Type 2 Diabetes Mellitus (T2DM) patient and healthy control. This study involved 82 newly diagnosed T2DM patients and 82 healthy controls. Plasma selenium status was determined with Graphite Furnace Atomic Absorption Spectrometry. Body Mass Index, total body fat and visceral fat was assessed for body composition using Body Composition Analyzer (TANITA). Oxidative DNA damage and total antioxidant capacity were determined for oxidative stress biomarker status. In age, gender and BMI adjustment, no significant difference of plasma selenium level between T2DM and healthy controls was observed. There was as a significant difference of Oxidative DNA damage and total antioxidant capacity between T2DM patients and healthy controls with tail DNA% 20.62 [95% CI: 19.71,21.49] (T2DM), 17.67 [95% CI: 16.87,18.56] (control); log tail moment 0.41[95% CI: 0.30,0.52] (T2DM), 0.41[95% CI: 0.30,0.52] (control); total antioxidant capacity 0.56 [95% CI: 0.54,0.58] (T2DM), 0.60 [95% CI: 0.57,0.62] (control). Waist circumference, BMI, visceral fat, body fat and oxidative DNA damage in the T2DM group were significantly lower in the first plasma selenium tertile (38.65-80.90μg/L) compared to the second (80.91-98.20μg/L) and the third selenium tertiles (98.21-158.20μg/L). A similar trend, but not statistically significant, was observed in the control group. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. High-Throughput Array Instrument for DNA-Based Breast Cancer Diagnostics

    National Research Council Canada - National Science Library

    Swerdlow, Harold

    2000-01-01

    ...) for breast-cancer diagnostics. These methods are based upon large numbers of discrete DNA spots placed on glass microscope slides typically, and hybridized to a probe derived from a tIssue or blood sample...

  4. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  5. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    Science.gov (United States)

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

    2018-02-12

    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Two sides of the same coin: TFIIH complexes in transcription and DNA repair.

    Science.gov (United States)

    Zhovmer, Alexander; Oksenych, Valentyn; Coin, Frédéric

    2010-04-13

    TFIIH is organized into a seven-subunit core associated with a three-subunit Cdk-activating kinase (CAK) module. TFIIH has roles in both transcription initiation and DNA repair. During the last 15 years, several studies have been conducted to identify the composition of the TFIIH complex involved in DNA repair. Recently, a new technique combining chromatin immunoprecipitation and western blotting resolved the hidden nature of the TFIIH complex participating in DNA repair. Following the recruitment of TFIIH to the damaged site, the CAK module is released from the core TFIIH, and the core subsequently associates with DNA repair factors. The release of the CAK is specifically driven by the recruitment of the DNA repair factor XPA and is required to promote the incision/excision of the damaged DNA. Once the DNA lesions have been repaired, the CAK module returns to the core TFIIH on the chromatin, together with the release of the repair factors. These data highlight the dynamic composition of a fundamental cellular factor that adapts its subunit composition to the cell needs.

  7. Two Sides of the Same Coin: TFIIH Complexes in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Alexander Zhovmer

    2010-01-01

    Full Text Available TFIIH is organized into a seven-subunit core associated with a three-subunit Cdk-activating kinase (CAK module. TFIIH has roles in both transcription initiation and DNA repair. During the last 15 years, several studies have been conducted to identify the composition of the TFIIH complex involved in DNA repair. Recently, a new technique combining chromatin immunoprecipitation and western blotting resolved the hidden nature of the TFIIH complex participating in DNA repair. Following the recruitment of TFIIH to the damaged site, the CAK module is released from the core TFIIH, and the core subsequently associates with DNA repair factors. The release of the CAK is specifically driven by the recruitment of the DNA repair factor XPA and is required to promote the incision/excision of the damaged DNA. Once the DNA lesions have been repaired, the CAK module returns to the core TFIIH on the chromatin, together with the release of the repair factors. These data highlight the dynamic composition of a fundamental cellular factor that adapts its subunit composition to the cell needs.

  8. Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

    Science.gov (United States)

    El-Diasty, Fouad; Abdel-Wahab, Fathy

    2015-10-01

    The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.

  9. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

    International Nuclear Information System (INIS)

    Shamim, S.; Murtaza, S.; Nazar, M.F.

    2016-01-01

    A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

  11. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-01

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  13. Local stability perturbation in DNA structure induced by chain discontinuities

    International Nuclear Information System (INIS)

    Jorcano, J.L.; Mingot, F.; Davila, C.A.

    1976-01-01

    The thermal dependence of parameter ''h'' (number of base pairs broken near to internucleotide breaks) is studied. At 25degC, 0,2 M Na + and pH 7, the ''h'' value is about 12. Far from DNA melting temperature, ''h'' is not dependent upon ionic strength and it depends very little on temperature. This behavior suggests a non cooperative, entropically driven chain unzipping from terminals. Near melting temperature, ''h'' shows a thermal dependence asymptotic to Tm, and correlated with DNA composition. It seems to correspond to the cooperative denaturation. ''h'' values have been calculated from double and single break probabilities evaluated from hydrodynamically determined molecular weight distributions. (author)

  14. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  15. Ligation bias in illumina next-generation DNA libraries: implications for sequencing ancient genomes.

    Directory of Open Access Journals (Sweden)

    Andaine Seguin-Orlando

    Full Text Available Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.

  16. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  17. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  18. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun

    2007-01-01

    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  19. Diversity and Composition of Sulfate-Reducing Microbial Communities Based on Genomic DNA and RNA Transcription in Production Water of High Temperature and Corrosive Oil Reservoir

    Directory of Open Access Journals (Sweden)

    Xiao-Xiao Li

    2017-06-01

    Full Text Available Deep subsurface petroleum reservoir ecosystems harbor a high diversity of microorganisms, and microbial influenced corrosion is a major problem for the petroleum industry. Here, we used high-throughput sequencing to explore the microbial communities based on genomic 16S rDNA and metabolically active 16S rRNA analyses of production water samples with different extents of corrosion from a high-temperature oil reservoir. Results showed that Desulfotignum and Roseovarius were the most abundant genera in both genomic and active bacterial communities of all the samples. Both genomic and active archaeal communities were mainly composed of Archaeoglobus and Methanolobus. Within both bacteria and archaea, the active and genomic communities were compositionally distinct from one another across the different oil wells (bacteria p = 0.002; archaea p = 0.01. In addition, the sulfate-reducing microorganisms (SRMs were specifically assessed by Sanger sequencing of functional genes aprA and dsrA encoding the enzymes adenosine-5′-phosphosulfate reductase and dissimilatory sulfite reductase, respectively. Functional gene analysis indicated that potentially active Archaeoglobus, Desulfotignum, Desulfovibrio, and Thermodesulforhabdus were frequently detected, with Archaeoglobus as the most abundant and active sulfate-reducing group. Canonical correspondence analysis revealed that the SRM communities in petroleum reservoir system were closely related to pH of the production water and sulfate concentration. This study highlights the importance of distinguishing the metabolically active microorganisms from the genomic community and extends our knowledge on the active SRM communities in corrosive petroleum reservoirs.

  20. Diversity and Composition of Sulfate-Reducing Microbial Communities Based on Genomic DNA and RNA Transcription in Production Water of High Temperature and Corrosive Oil Reservoir

    Science.gov (United States)

    Li, Xiao-Xiao; Liu, Jin-Feng; Zhou, Lei; Mbadinga, Serge M.; Yang, Shi-Zhong; Gu, Ji-Dong; Mu, Bo-Zhong

    2017-01-01

    Deep subsurface petroleum reservoir ecosystems harbor a high diversity of microorganisms, and microbial influenced corrosion is a major problem for the petroleum industry. Here, we used high-throughput sequencing to explore the microbial communities based on genomic 16S rDNA and metabolically active 16S rRNA analyses of production water samples with different extents of corrosion from a high-temperature oil reservoir. Results showed that Desulfotignum and Roseovarius were the most abundant genera in both genomic and active bacterial communities of all the samples. Both genomic and active archaeal communities were mainly composed of Archaeoglobus and Methanolobus. Within both bacteria and archaea, the active and genomic communities were compositionally distinct from one another across the different oil wells (bacteria p = 0.002; archaea p = 0.01). In addition, the sulfate-reducing microorganisms (SRMs) were specifically assessed by Sanger sequencing of functional genes aprA and dsrA encoding the enzymes adenosine-5′-phosphosulfate reductase and dissimilatory sulfite reductase, respectively. Functional gene analysis indicated that potentially active Archaeoglobus, Desulfotignum, Desulfovibrio, and Thermodesulforhabdus were frequently detected, with Archaeoglobus as the most abundant and active sulfate-reducing group. Canonical correspondence analysis revealed that the SRM communities in petroleum reservoir system were closely related to pH of the production water and sulfate concentration. This study highlights the importance of distinguishing the metabolically active microorganisms from the genomic community and extends our knowledge on the active SRM communities in corrosive petroleum reservoirs. PMID:28638372

  1. Cloud-based adaptive exon prediction for DNA analysis.

    Science.gov (United States)

    Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen

    2018-02-01

    Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.

  2. Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe

    Science.gov (United States)

    He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing

    2011-11-01

    The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.

  3. Nanotechnology in plant disease management: DNA-directed silver nanoparticles on graphene oxide as an antibacterial against Xanthomonas perforans.

    Science.gov (United States)

    Ocsoy, Ismail; Paret, Mathews L; Ocsoy, Muserref Arslan; Kunwar, Sanju; Chen, Tao; You, Mingxu; Tan, Weihong

    2013-10-22

    Bacterial spot caused by Xanthomonas perforans is a major disease of tomatoes, leading to reduction in production by 10-50%. While copper (Cu)-based bactericides have been used for disease management, most of the X. perforans strains isolated from tomatoes in Florida and other locations worldwide are Cu-resistant. We have developed DNA-directed silver (Ag) nanoparticles (NPs) grown on graphene oxide (GO). These Ag@dsDNA@GO composites effectively decrease X. perforans cell viability in culture and on plants. At the very low concentration of 16 ppm of Ag@dsDNA@GO, composites show excellent antibacterial capability in culture with significant advantages in improved stability, enhanced antibacterial activity, and stronger adsorption properties. Application of Ag@dsDNA@GO at 100 ppm on tomato transplants in a greenhouse experiment significantly reduced the severity of bacterial spot disease compared to untreated plants, giving results similar to those of the current grower standard treatment, with no phytotoxicity.

  4. Interfacing DNA nanodevices with biology: challenges, solutions and perspectives

    International Nuclear Information System (INIS)

    Vinther, Mathias; Kjems, Jørgen

    2016-01-01

    The cellular machinery performs millions of complex reactions with extreme precision at nanoscale. From studying these reactions, scientists have become inspired to build artificial nanosized molecular devices with programmed functions. One of the fundamental tools in designing and creating these nanodevices is molecular self-assembly. In nature, deoxyribonucleic acid (DNA) is inarguably one of the most remarkable self-assembling molecules. Governed by the Watson–Crick base-pairing rules, DNA assembles with a structural reliability and predictability based on sequence composition unlike any other complex biological polymer. This consistency has enabled rational design of hundreds of two- and three-dimensional shapes with a molecular precision and homogeneity not preceded by any other known technology at the nanometer scale. During the last two decades, DNA nanotechnology has undergone a rapid evolution pioneered by the work of Nadrian Seeman (Kallenbach et al 1983 Nature 205 829–31). Especially the introduction of the versatile DNA Origami technique by Rothemund (2006 Nature 440 297–302) led to an efflorescence of new DNA-based self-assembled nanostructures (Andersen et al 2009 Nature 459 73–6, Douglas et al 2009 Nature 459 414–8, Dietz et al 2009 Science 325 725–30, Han et al 2011 Science 332 342–6, Iinuma et al 2014 Science 344 65–9), and variations of this technique have contributed to an increasing repertoire of DNA nanostructures (Wei et al 2012 Nature 485 623–6, Ke et al 2012 Science 338 1177–83, Benson et al 2015 Nature 523 441–4, Zhang et al 2015 Nat. Nanotechnol. 10 779–84, Scheible et al 2015 Small 11 5200–5). These advances have naturally triggered the question: What can these DNA nanostructures be used for? One of the leading proposals of use for DNA nanotechnology has been in biology and biomedicine acting as a molecular ‘nanorobot’ or smart drug interacting with the cellular machinery. In this review, we will explore and

  5. Interfacing DNA nanodevices with biology: challenges, solutions and perspectives

    Science.gov (United States)

    Vinther, Mathias; Kjems, Jørgen

    2016-08-01

    The cellular machinery performs millions of complex reactions with extreme precision at nanoscale. From studying these reactions, scientists have become inspired to build artificial nanosized molecular devices with programmed functions. One of the fundamental tools in designing and creating these nanodevices is molecular self-assembly. In nature, deoxyribonucleic acid (DNA) is inarguably one of the most remarkable self-assembling molecules. Governed by the Watson-Crick base-pairing rules, DNA assembles with a structural reliability and predictability based on sequence composition unlike any other complex biological polymer. This consistency has enabled rational design of hundreds of two- and three-dimensional shapes with a molecular precision and homogeneity not preceded by any other known technology at the nanometer scale. During the last two decades, DNA nanotechnology has undergone a rapid evolution pioneered by the work of Nadrian Seeman (Kallenbach et al 1983 Nature 205 829-31). Especially the introduction of the versatile DNA Origami technique by Rothemund (2006 Nature 440 297-302) led to an efflorescence of new DNA-based self-assembled nanostructures (Andersen et al 2009 Nature 459 73-6, Douglas et al 2009 Nature 459 414-8, Dietz et al 2009 Science 325 725-30, Han et al 2011 Science 332 342-6, Iinuma et al 2014 Science 344 65-9), and variations of this technique have contributed to an increasing repertoire of DNA nanostructures (Wei et al 2012 Nature 485 623-6, Ke et al 2012 Science 338 1177-83, Benson et al 2015 Nature 523 441-4, Zhang et al 2015 Nat. Nanotechnol. 10 779-84, Scheible et al 2015 Small 11 5200-5). These advances have naturally triggered the question: What can these DNA nanostructures be used for? One of the leading proposals of use for DNA nanotechnology has been in biology and biomedicine acting as a molecular ‘nanorobot’ or smart drug interacting with the cellular machinery. In this review, we will explore and examine the perspective of

  6. Detection of anthrax lef with DNA-based photonic crystal sensors

    Science.gov (United States)

    Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong

    2011-12-01

    Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

  7. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Science.gov (United States)

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Integrating DNA-based data into bioassessments improves our understanding of species distributions and species habitat relationships

    Science.gov (United States)

    The integration of DNA-based identification methods into bioassessments could result in more accurate representations of species distributions and species-habitat relationships. DNA-based approaches may be particularly informative for tracking the distributions of rare and/or inv...

  9. Comparative DNA isolation behaviours of silica and polymer based sorbents in batch fashion: monodisperse silica microspheres with bimodal pore size distribution as a new sorbent for DNA isolation.

    Science.gov (United States)

    Günal, Gülçin; Kip, Çiğdem; Eda Öğüt, S; İlhan, Hasan; Kibar, Güneş; Tuncel, Ali

    2018-02-01

    Monodisperse silica microspheres with bimodal pore-size distribution were proposed as a high performance sorbent for DNA isolation in batch fashion under equilibrium conditions. The proposed sorbent including both macroporous and mesoporous compartments was synthesized 5.1 μm in-size, by a "staged shape templated hydrolysis and condensation method". Hydrophilic polymer based sorbents were also obtained in the form of monodisperse-macroporous microspheres ca 5.5 μm in size, with different functionalities, by a developed "multi-stage microsuspension copolymerization" technique. The batch DNA isolation performance of proposed material was comparatively investigated using polymer based sorbents with similar morphologies. Among all sorbents tried, the best DNA isolation performance was achieved with the monodisperse silica microspheres with bimodal pore size distribution. The collocation of interconnected mesoporous and macroporous compartments within the monodisperse silica microspheres provided a high surface area and reduced the intraparticular mass transfer resistance and made easier both the adsorption and desorption of DNA. Among the polymer based sorbents, higher DNA isolation yields were achieved with the monodisperse-macroporous polymer microspheres carrying trimethoxysilyl and quaternary ammonium functionalities. However, batch DNA isolation performances of polymer based sorbents were significantly lower with respect to the silica microspheres.

  10. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.

    Science.gov (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D

    1988-09-12

    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  11. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  12. Structural Acoustic Physics Based Modeling of Curved Composite Shells

    Science.gov (United States)

    2017-09-19

    NUWC-NPT Technical Report 12,236 19 September 2017 Structural Acoustic Physics -Based Modeling of Curved Composite Shells Rachel E. Hesse...SUBTITLE Structural Acoustic Physics -Based Modeling of Curved Composite Shells 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...study was to use physics -based modeling (PBM) to investigate wave propagations through curved shells that are subjected to acoustic excitation. An

  13. One-step synthesis of DNA functionalized cadmium-free quantum dots and its application in FRET-based protein sensing

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Cuiling, E-mail: clzhang@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Ding, Caiping [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Zhou, Guohua [School of Chemistry and Chemical Engineering, Lingnan Normal University, Zhanjiang, 524048 (China); Xue, Qin [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China); Xian, Yuezhong, E-mail: yzxian@chem.ecnu.edu.cn [Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Shanghai 200241 (China)

    2017-03-08

    DNA functionalized quantum dots (QDs) are promising nanoprobes for the fluorescence resonance energy transfer (FRET)-based biosensing. Herein, cadmium-free DNA functionalized Mn-doped ZnS (DNA-ZnS:Mn{sup 2+}) QDs were successfully synthesized by one-step route. As-synthesized QDs show excellent photo-stability with the help of PAA and DNA. Then, we constructed a novel FRET model based on the QDs and WS{sub 2} nanosheets as the energy donor-acceptor pairs, which was successfully applied for the protein detection through the terminal protection of small molecule-linked DNA assay. This work not only explores the potential bioapplication of the DNA-ZnS:Mn{sup 2+} QDs, but also provides a platform for the investigation of small molecule-protein interaction. - Highlights: • The stable and cadmium-free DNA functionalized ZnS:Mn{sup 2+} QDs were successfully synthesized through a facile one-step route. • We constructed a novel FRET system based on one-step synthesized DNA-ZnS:Mn{sup 2+} QDs (donor) and WS{sub 2} nanosheets (acceptor). • The FRET-based strategy was applied for the detection of streptavidin and folate receptor by combining TPSMLD and Exo III.

  14. Chromatin remodelling: the industrial revolution of DNA around histones.

    Science.gov (United States)

    Saha, Anjanabha; Wittmeyer, Jacqueline; Cairns, Bradley R

    2006-06-01

    Chromatin remodellers are specialized multi-protein machines that enable access to nucleosomal DNA by altering the structure, composition and positioning of nucleosomes. All remodellers have a catalytic ATPase subunit that is similar to known DNA-translocating motor proteins, suggesting DNA translocation as a unifying aspect of their mechanism. Here, we explore the diversity and specialization of chromatin remodellers, discuss how nucleosome modifications regulate remodeller activity and consider a model for the exposure of nucleosomal DNA that involves the use of directional DNA translocation to pump 'DNA waves' around the nucleosome.

  15. Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor

    Science.gov (United States)

    Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh

    2017-09-01

    The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.

  16. Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.

    Science.gov (United States)

    Xiao, Lu; Xiang, Yu

    2016-06-01

    The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Dihydropyridines decrease X-ray-induced DNA base damage in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Wojewodzka, M., E-mail: marylaw@ichtj.waw.pl [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Gradzka, I.; Buraczewska, I.; Brzoska, K.; Sochanowicz, B. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Goncharova, R.; Kuzhir, T. [Institute of Genetics and Cytology, Belarussian National Academy of Sciences, Minsk (Belarus); Szumiel, I. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland)

    2009-12-01

    Compounds with the structural motif of 1,4-dihydropyridine display a broad spectrum of biological activities, often defined as bioprotective. Among them are L-type calcium channel blockers, however, also derivatives which do not block calcium channels exert various effects at the cellular and organismal levels. We examined the effect of sodium 3,5-bis-ethoxycarbonyl-2,6-dimethyl-1,4-dihydropyridine-4-carboxylate (denoted here as DHP and previously also as AV-153) on X-ray-induced DNA damage and mutation frequency at the HGPRT (hypoxanthine-guanine phosphoribosyl transferase) locus in Chinese hamster ovary CHO-K1 cells. Using formamido-pyrimidine glycosylase (FPG) comet assay, we found that 1-h DHP (10 nM) treatment before X-irradiation considerably reduced the initial level of FPG-recognized DNA base damage, which was consistent with decreased 8-oxo-7,8-dihydro-2'-deoxyguanosine content and mutation frequency lowered by about 40%. No effect on single strand break rejoining or on cell survival was observed. Similar base damage-protective effect was observed for two calcium channel blockers: nifedipine (structurally similar to DHP) or verapamil (structurally unrelated). So far, the specificity of the DHP-caused reduction in DNA damage - practically limited to base damage - has no satisfactory explanation.

  18. Sustainable hemp-based composites for the building industry application

    Science.gov (United States)

    Schwarzova, Ivana; Stevulova, Nadezda; Junak, Jozef; Hospodarova, Viola

    2017-07-01

    Sustainability goals are essential driving principles for the development of innovative materials in the building industry. Natural plant (e.g. hemp) fibers represent an attractive alternative as reinforcing material due to its good properties and sustainability prerequisites. In this study, hemp-based composite materials, designed for building application as non-load bearing material, providing both thermal insulation and physico-mechanical properties, are presented. Composite materials were produced by bonding hemp hurds with a novel inorganic binder (MgO-based cement) and then were characterized in terms of physical properties (bulk density, water absorption), thermal properties (thermal conductivity) and mechanical properties (compressive and tensile strength). The composites exhibited promising physical, thermal and mechanical characteristics, generally comparable to commercially available products. In addition, the hemp-based composites have the advantage of a significantly low environmental impact (thanks to the nature of both the dispersed and the binding phase) and no negative effects on human health. All things considered, the composite materials seem like very promising materials for the building industry application.

  19. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  20. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    Science.gov (United States)

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  1. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Science.gov (United States)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  2. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    International Nuclear Information System (INIS)

    Phuong Dinh Tam; Mai Anh Tuan; Tran Trung; Nguyen Duc Chien

    2009-01-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  3. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Science.gov (United States)

    Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

    2013-01-01

    Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  4. Cul8/Rtt101 Forms a Variety of Protein Complexes That Regulate DNA Damage Response and Transcriptional Silencing*

    OpenAIRE

    Mimura, Satoru; Yamaguchi, Tsuyoshi; Ishii, Satoru; Noro, Emiko; Katsura, Tomoya; Obuse, Chikashi; Kamura, Takumi

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, has three cullin proteins, which act as platforms for Cullin-based E3 ubiquitin ligases. Genetic evidence indicates that Cul8, together with Mms1, Mms22, and Esc4, is involved in the repair of DNA damage that can occur during DNA replication. Cul8 is thought to form a complex with these proteins, but the composition and the function of Cul8-based E3 ubiquitin ligases remain largely uncharacterized. Herein, we report a comprehensive biochemical anal...

  5. Application of capillary gas chromatography-mass spectrometry to chemical characterization of radiation-induced base damage of DNA: implications for assessing DNA repair processes

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1985-01-01

    The application of capillary gas chromatography-mass spectrometry (GC-MS) to the chemical characterization of radiation-induced base products of calf thymus DNA is presented. Samples of calf thymus DNA irradiated in N 2 O-saturated aqueous solution were hydrolyzed with HCOOH, trimethylsilylated, and subjected to GC-MS analysis using a fused-silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC properties and easily interpretable mass spectra; an intense molecular ion (M+.) and a characteristic (M-CH 3 )+ ion were observed. The complementary use of t-butyldimethylsilyl derivatives was also demonstrated. These derivatives provided an intense characteristic (M-57)+ ion, which appeared as either the base peak or the second most intense ion in the spectra. All mass spectra obtained are discussed

  6. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  7. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  8. Fracture resistance of premolar teeth restored with silorane-based or dimethacrylate-based composite resins.

    Science.gov (United States)

    Akbarian, Golsa; Ameri, Hamideh; Chasteen, Joseph E; Ghavamnasiri, Marjaneh

    2014-01-01

    To restore posterior teeth using low-shrinkage composite to minimize microleakage. To compare the fracture resistance of mesio-occlusal-distal (MOD) cavity preparations restored with either low-shrinkage composite or with dimethacrylate-based composite in conjunction with cavity liners and without them. The null hypothesis of the study is that there are no differences in either fracture resistance or fracture mode between the silorane group and dimethacrylate groups with and without the use of cavity liners. Sixty maxillary premolars were divided into six groups of 10. MOD cavities were prepared in four groups: F: posterior composite (Filtek P60); GF: 0.5-mm Glass Ionomer (Fuji LC) + posterior composite; FF: 0.5-mm flowable composite (Filtek Supreme XT) + posterior composite; and S: low-shrinkage composite (Filtek P90). Negative (N) and positive (P) control groups consisted of unrestored and sound teeth, respectively. The specimens were thermocycled and loaded. Data were analyzed using analysis of variance, Tukey, and chi-square tests (α = 0.05). Groups FF (1643.09 ± 187/80 N) and GF (1596.80 ± 163/93 N) (p = 0.06 > 0.05) were statistically identical, although less than group P (1742/33 ± 110/08 N), but still demonstrated greater fracture resistance than the other groups. The fracture resistance of group S (1434/69 ± 107/62 N) was identical to GF and FF (p = 0.06 > 0.05). The fracture resistance of F (1353/19 ± 233/90 N) was less than GF and FF, and statistically identical to S (p = 0.87 > 0.05). Silorane-based composite showed a resistance to fracture similar to methacrylate-based composite restorations regardless of whether cavity liners were used. The findings of this study support the selection of silorane-based composite for the restoration of maxillary premolars with standardized Class II cavity preparations in order to strengthen the resistance to fracture to the same extent as do dimethacrylate

  9. A silicon-based electrochemical sensor for highly sensitive, specific, label-free and real-time DNA detection

    International Nuclear Information System (INIS)

    Guo, Yuanyuan; Su, Shao; Wei, Xinpan; Zhong, Yiling; Su, Yuanyuan; He, Yao; Huang, Qing; Fan, Chunhai

    2013-01-01

    We herein present a new kind of silicon-based electrochemical sensor using a gold nanoparticles-decorated silicon wafer (AuNPs@Si) as a high-performance electrode, which is facilely prepared via in situ AuNPs growth on a silicon wafer. Particularly significantly, the resultant electrochemical sensor is efficacious for label-free DNA detection with high sensitivity due to the unique merits of the prepared silicon-based electrode. Typically, DNA at remarkably low concentrations (1–10 fM) could be readily detected without requiring additional signal-amplification procedures, which is better than or comparable to the lowest DNA concentration ever detected via well-studied signal-amplification-assisted electrochemical sensors. Moreover, the silicon-based sensor features high specificity, allowing unambiguous discrimination of single-based mismatches. We further show that real-time DNA assembly is readily monitored via recording the intensity changes of current signals due to the robust thermal stability of the silicon-based electrode. The unprecedented advantages of the silicon-based electrochemical sensor would offer new opportunities for myriad sensing applications. (paper)

  10. A treatise on benzimidazole based Schiff base metal(II) complexes accentuating their biological efficacy: Spectroscopic evaluation of DNA interactions, DNA cleavage and antimicrobial screening

    Energy Technology Data Exchange (ETDEWEB)

    Kumaravel, Ganesan; Raman, Natarajan, E-mail: ramchem1964@gmail.com

    2017-01-01

    Two novel imidazole derived Schiff bases, (Z)-1-(1H-benzo[d]imidazol-2-yl)-N-benzylidenemethanamine (L{sup 1}) and 1-(1H-benzo[d]imidazol-2-yl)-N-(4-nitrobenzylidene) methanamine, and a series of their transition metal complexes of the types [M(L{sup 1}){sub 2}]Cl{sub 2} and [M(L{sup 2}){sub 2}]Cl{sub 2} where, M = Cu(II), Ni(II), Co(II) and Zn(II) have been designed and synthesized. These compounds were characterized by various spectral and physicochemical data. UV–Vis, magnetic susceptibility and molar conductivity data indicate that all the complexes adopt square planar geometry. The EPR spectral data of the Cu(II) complexes have provided supportive evidence to the conclusion derived on the basis of electronic absorption and magnetic moment values. Moreover, the interaction of complexes with DNA via intercalation has been explored by absorption, fluorescence spectroscopy, cyclic voltammetry, viscosity and circular dichroism. Agarose gel electrophoresis technique reveals that the complexes are good metallonucleases. All the compounds have relatively high antibacterial and antifungal potencies. Among the metal complexes, Cu(II) complexes exhibit higher efficacy against all the pathogens. - Highlights: • Synthesis of new and efficient benzimidazole based DNA targeting complexes • Synthesis of efficient metallointercalators • Excellent DNA exploiting ability of Cu(II) complexes • Efficient antimicrobial agents against various pathogens.

  11. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Directory of Open Access Journals (Sweden)

    Wimalanathan Kokulapalan

    2011-01-01

    Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped

  12. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  13. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Science.gov (United States)

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A

    2016-06-21

    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  14. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  15. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  16. Enhancing durability of wood-based composites with nanotechnology

    Science.gov (United States)

    Carol Clausen

    2012-01-01

    Wood protection systems are needed for engineered composite products that are susceptible to moisture and biodeterioration. Protection systems using nano-materials are being developed to enhance the durability of wood-based composites through improved resistance to biodeterioration, reduced environmental impact from chemical leaching, and improved resistance to...

  17. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  18. Rapid, sensitive, and selective fluorescent DNA detection using iron-based metal-organic framework nanorods: Synergies of the metal center and organic linker.

    Science.gov (United States)

    Tian, Jingqi; Liu, Qian; Shi, Jinle; Hu, Jianming; Asiri, Abdullah M; Sun, Xuping; He, Yuquan

    2015-09-15

    Considerable recent attention has been paid to homogeneous fluorescent DNA detection with the use of nanostructures as a universal "quencher", but it still remains a great challenge to develop such nanosensor with the benefits of low cost, high speed, sensitivity, and selectivity. In this work, we report the use of iron-based metal-organic framework nanorods as a high-efficient sensing platform for fluorescent DNA detection. It only takes about 4 min to complete the whole "mix-and-detect" process with a low detection limit of 10 pM and a strong discrimination of single point mutation. Control experiments reveal the remarkable sensing behavior is a consequence of the synergies of the metal center and organic linker. This work elucidates how composition control of nanostructures can significantly impact their sensing properties, enabling new opportunities for the rational design of functional materials for analytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Use of DNA barcoding to reveal species composition of convenience seafood.

    Science.gov (United States)

    Huxley-Jones, Elizabeth; Shaw, Jennifer L A; Fletcher, Carly; Parnell, Juliette; Watts, Phillip C

    2012-04-01

    Increased education of consumers can be an effective tool for conservation of commercially harvested marine species when product labeling is accurate and allows an informed choice. However, generic labeling (e.g., as white fish or surimi) and mislabeling of seafood prevents this and may erode consumer confidence in seafood product labels in general. We used DNA barcoding to identify the species composition of two types of convenience seafood (i.e., products processed for ease of consumption): fish fingers (long pieces of fish covered with bread crumbs or batter, n = 241) and seafood sticks (long pieces of cooked fish, n = 30). In products labeled as either white fish or surimi, four teleost species were present. Less than 1.5% of fish fingers with species-specific information were mislabeled. Results of other studies show substantially more mislabeling (e.g., >25%) of teleost products, which likely reflects the lower economic gains associated with mislabeling of convenience seafood compared with whole fillets. In addition to species identification, seafood product labels should be required to contain information about, for example, harvesting practices, and our data indicate that consumers can have reasonable confidence in the accuracy of the labels of convenience seafood and thus select brands on the basis of information about current fisheries practice. ©2012 Society for Conservation Biology.

  20. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  1. Electrochemical DNA biosensor based on the BDD nanograss array electrode.

    Science.gov (United States)

    Jin, Huali; Wei, Min; Wang, Jinshui

    2013-04-10

    The development of DNA biosensor has attracted considerable attention due to their potential applications, including gene analysis, clinical diagnostics, forensic study and more medical applications. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry in this study. Electrochemical DNA biosensor was developed based on the BDD film electrode (fBDD) and BDD nanograss array electrode (nBDD). In comparison with fBDD and AuNPs/CA/fBDD electrode, the lower semicircle diameter of electrochemical impedance spectroscopy obtained on nBDD and AuNPs/CA/nBDD electrode indicated that the presence of nanograss array improved the reactive site, reduced the interfacial resistance, and made the electron transfer easier. Using electroactive daunomycin as an indicator, the hybridization detection was measured by differential pulse voltammetry. The experimental results demonstrated that the prepared AuNPs/CA/nBDD electrode was suitable for DNA hybridization with favorable performance of faster response, higher sensitivity, lower detection limit and satisfactory selectivity, reproducibility and stability.

  2. Thermal Properties of Cement-Based Composites for Geothermal Energy Applications

    Science.gov (United States)

    Bao, Xiaohua; Memon, Shazim Ali; Yang, Haibin; Dong, Zhijun; Cui, Hongzhi

    2017-01-01

    Geothermal energy piles are a quite recent renewable energy technique where geothermal energy in the foundation of a building is used to transport and store geothermal energy. In this paper, a structural–functional integrated cement-based composite, which can be used for energy piles, was developed using expanded graphite and graphite nanoplatelet-based composite phase change materials (CPCMs). Its mechanical properties, thermal-regulatory performance, and heat of hydration were evaluated. Test results showed that the compressive strength of GNP-Paraffin cement-based composites at 28 days was more than 25 MPa. The flexural strength and density of thermal energy storage cement paste composite decreased with increases in the percentage of CPCM in the cement paste. The infrared thermal image analysis results showed superior thermal control capability of cement based materials with CPCMs. Hence, the carbon-based CPCMs are promising thermal energy storage materials and can be used to improve the durability of energy piles. PMID:28772823

  3. Thermal Properties of Cement-Based Composites for Geothermal Energy Applications

    Directory of Open Access Journals (Sweden)

    Xiaohua Bao

    2017-04-01

    Full Text Available Geothermal energy piles are a quite recent renewable energy technique where geothermal energy in the foundation of a building is used to transport and store geothermal energy. In this paper, a structural–functional integrated cement-based composite, which can be used for energy piles, was developed using expanded graphite and graphite nanoplatelet-based composite phase change materials (CPCMs. Its mechanical properties, thermal-regulatory performance, and heat of hydration were evaluated. Test results showed that the compressive strength of GNP-Paraffin cement-based composites at 28 days was more than 25 MPa. The flexural strength and density of thermal energy storage cement paste composite decreased with increases in the percentage of CPCM in the cement paste. The infrared thermal image analysis results showed superior thermal control capability of cement based materials with CPCMs. Hence, the carbon-based CPCMs are promising thermal energy storage materials and can be used to improve the durability of energy piles.

  4. Thermal Properties of Cement-Based Composites for Geothermal Energy Applications.

    Science.gov (United States)

    Bao, Xiaohua; Memon, Shazim Ali; Yang, Haibin; Dong, Zhijun; Cui, Hongzhi

    2017-04-27

    Geothermal energy piles are a quite recent renewable energy technique where geothermal energy in the foundation of a building is used to transport and store geothermal energy. In this paper, a structural-functional integrated cement-based composite, which can be used for energy piles, was developed using expanded graphite and graphite nanoplatelet-based composite phase change materials (CPCMs). Its mechanical properties, thermal-regulatory performance, and heat of hydration were evaluated. Test results showed that the compressive strength of GNP-Paraffin cement-based composites at 28 days was more than 25 MPa. The flexural strength and density of thermal energy storage cement paste composite decreased with increases in the percentage of CPCM in the cement paste. The infrared thermal image analysis results showed superior thermal control capability of cement based materials with CPCMs. Hence, the carbon-based CPCMs are promising thermal energy storage materials and can be used to improve the durability of energy piles.

  5. DNA barcode goes two-dimensions: DNA QR code web server.

    Science.gov (United States)

    Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  6. DNA barcode goes two-dimensions: DNA QR code web server.

    Directory of Open Access Journals (Sweden)

    Chang Liu

    Full Text Available The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  7. Profiling the miRNAs for Early Cancer Detection using DNA-based Logic Gates

    Directory of Open Access Journals (Sweden)

    Tahereh Yahya

    2017-12-01

    Full Text Available Abstract Background: DNA-based computing is an emerging research aspect that enables the in-vivo computation and decision making with significant correctness. Recent papers show that the expression level of miRNAs are related to the progress status of some diseases such as cancers and DNA computing is introduced as a low cost and concise technique for detection of these biomarkers. In this paper, DNA-based logic gates are implemented in the laboratory to detect the level of miR-21 as the biomarker of cancer. Materials and Methods: At the first, required strands for designing DNA gates are synthesized. Then, double stranded gate is generated in laboratory using a temperature gradient that followed by electrophoresis process. This double strand is the computation engine for detecting the miR-21 biomarker. miR-21 is as input in designed gate. At the end, the expression level of miR-21 is identified by measuring the generated fluorescent. Results: at the first stage, the proposed DNA-based logic gate is evaluated by using the synthesized input strands and then it is experimented on a tumor tissue. Experimental results on synthesized strands show that its detection quality/correctness is 2.5x better than conventional methods. Conclusion: Experimental results on the tumor tissues are successful and are matched with those are extracted from real time PCR results. Also, the results show that this method is significantly more suitable than real time PCR in view of time and cost.

  8. Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

    Science.gov (United States)

    Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

    2018-09-15

    Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  10. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Phuong Dinh Tam; Mai Anh Tuan [International Training Institute for Materials Science (Viet Nam); Tran Trung [Department of Electrochemistry, Hung-Yen University of Technology and Education (Viet Nam); Nguyen Duc Chien [Institute of Engineering Physics, Hanoi University of Technology, 1 Dai Co Viet Road, Hanoi (Viet Nam)], E-mail: tr_trunghut@yahoo.com

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  11. Colloidal-based additive manufacturing of bio-inspired composites

    Science.gov (United States)

    Studart, Andre R.

    Composite materials in nature exhibit heterogeneous architectures that are tuned to fulfill the functional demands of the surrounding environment. Examples range from the cellulose-based organic structure of plants to highly mineralized collagen-based skeletal parts like bone and teeth. Because they are often utilized to combine opposing properties such as strength and low-density or stiffness and wear resistance, the heterogeneous architecture of natural materials can potentially address several of the technical limitations of artificial homogeneous composites. However, current man-made manufacturing technologies do not allow for the level of composition and fiber orientation control found in natural heterogeneous systems. In this talk, I will present two additive manufacturing technologies recently developed in our group to build composites with exquisite architectures only rivaled by structures made by living organisms in nature. Since the proposed techniques utilize colloidal suspensions as feedstock, understanding the physics underlying the stability, assembly and rheology of the printing inks is key to predict and control the architecture of manufactured parts. Our results will show that additive manufacturing routes offer a new exciting pathway for the fabrication of biologically-inspired composite materials with unprecedented architectures and functionalities.

  12. SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.

    Science.gov (United States)

    Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra

    2016-03-01

    Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.

  13. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting

    Science.gov (United States)

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai

    2009-01-01

    SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241

  14. Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta.

    Science.gov (United States)

    Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N

    2004-07-16

    A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

  15. DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils.

    Science.gov (United States)

    Schonhoft, Joseph D; Stivers, James T

    2013-04-16

    Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

  16. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  17. Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases

    International Nuclear Information System (INIS)

    Ahmed, Towfiq; Haraldsen, Jason T; Balatsky, Alexander V; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan

    2014-01-01

    Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology. (paper)

  18. Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases

    Science.gov (United States)

    Ahmed, Towfiq; Haraldsen, Jason T.; Rehr, John J.; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V.

    2014-03-01

    Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new ‘multi-point cross-correlation’ technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.

  19. DNA release from lipoplexes by anionic lipids: correlation with lipid mesomorphism, interfacial curvature, and membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Tarahovsky, Yury S.; Koynova, Rumiana; MacDonald, Robert C. (Northwestern)

    2010-01-18

    DNA release from lipoplexes is an essential step during lipofection and is probably a result of charge neutralization by cellular anionic lipids. As a model system to test this possibility, fluorescence resonance energy transfer between DNA and lipid covalently labeled with Cy3 and BODIPY, respectively, was used to monitor the release of DNA from lipid surfaces induced by anionic liposomes. The separation of DNA from lipid measured this way was considerably slower and less complete than that estimated with noncovalently labeled DNA, and depends on the lipid composition of both lipoplexes and anionic liposomes. This result was confirmed by centrifugal separation of released DNA and lipid. X-ray diffraction revealed a clear correlation of the DNA release capacity of the anionic lipids with the interfacial curvature of the mesomorphic structures developed when the anionic and cationic liposomes were mixed. DNA release also correlated with the rate of fusion of anionic liposomes with lipoplexes. It is concluded that the tendency to fuse and the phase preference of the mixed lipid membranes are key factors for the rate and extent of DNA release. The approach presented emphasizes the importance of the lipid composition of both lipoplexes and target membranes and suggests optimal transfection may be obtained by tailoring lipoplex composition to the lipid composition of target cells.

  20. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  1. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  2. Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization

    International Nuclear Information System (INIS)

    Liu, P.; Hun, X.; Qing, H.

    2011-01-01

    We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)

  3. Development of swine-specific DNA markers for biosensor-based halal authentication.

    Science.gov (United States)

    Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

    2012-06-29

    The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

  4. Solving probability reasoning based on DNA strand displacement and probability modules.

    Science.gov (United States)

    Zhang, Qiang; Wang, Xiaobiao; Wang, Xiaojun; Zhou, Changjun

    2017-12-01

    In computation biology, DNA strand displacement technology is used to simulate the computation process and has shown strong computing ability. Most researchers use it to solve logic problems, but it is only rarely used in probabilistic reasoning. To process probabilistic reasoning, a conditional probability derivation model and total probability model based on DNA strand displacement were established in this paper. The models were assessed through the game "read your mind." It has been shown to enable the application of probabilistic reasoning in genetic diagnosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Science.gov (United States)

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  6. Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand.

    Science.gov (United States)

    Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes

    2012-01-01

    Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.

  7. Dielectrophoretic trapping of DNA-coated gold nanoparticles on silicon based vertical nanogap devices.

    Science.gov (United States)

    Strobel, Sebastian; Sperling, Ralph A; Fenk, Bernhard; Parak, Wolfgang J; Tornow, Marc

    2011-06-07

    We report on the successful dielectrophoretic trapping and electrical characterization of DNA-coated gold nanoparticles on vertical nanogap devices (VNDs). The nanogap devices with an electrode distance of 13 nm were fabricated from Silicon-on-Insulator (SOI) material using a combination of anisotropic reactive ion etching (RIE), selective wet chemical etching and metal thin-film deposition. Au nanoparticles (diameter 40 nm) coated with a monolayer of dithiolated 8 base pairs double stranded DNA were dielectrophoretically trapped into the nanogap from electrolyte buffer solution at MHz frequencies as verified by scanning and transmission electron microscopy (SEM/TEM) analysis. First electrical transport measurements through the formed DNA-Au-DNA junctions partially revealed an approximately linear current-voltage characteristic with resistance in the range of 2-4 GΩ when measured in solution. Our findings point to the importance of strong covalent bonding to the electrodes in order to observe DNA conductance, both in solution and in the dry state. We propose our setup for novel applications in biosensing, addressing the direct interaction of biomolecular species with DNA in aqueous electrolyte media.

  8. Detection of DNA hybridization based on SnO2 nanomaterial enhanced fluorescence

    International Nuclear Information System (INIS)

    Gu Cuiping; Huang Jiarui; Ni Ning; Li Minqiang; Liu Jinhuai

    2008-01-01

    In this paper, enhanced fluorescence emissions were firstly investigated based on SnO 2 nanomaterial, and its application in the detection of DNA hybridization was also demonstrated. The microarray of SnO 2 nanomaterial was fabricated by the vapour phase transport method catalyzed by patterned Au nanoparticles on a silicon substrate. A probe DNA was immobilized on the substrate with patterned SnO 2 nanomaterial, respectively, by covalent and non-covalent linking schemes. When a fluorophore labelled target DNA was hybridized with a probe DNA on the substrate, fluorescence emissions were only observed on the surface of SnO 2 nanomaterial, which indicated the property of enhancing fluorescence signals from the SnO 2 nanomaterial. By comparing the different fluorescence images from covalent and non-covalent linking schemes, the covalent method was confirmed to be more effective for immobilizing a probe DNA. With the combined use of SnO 2 nanomaterial and the covalent linking scheme, the target DNA could be detected at a very low concentration of 10 fM. And the stability of SnO 2 nanomaterial under the experimental conditions was also compared with silicon nanowires. The findings strongly suggested that SnO 2 nanomaterial could be extensively applied in detections of biological samples with enhancing fluorescence property and high stability

  9. Repairability of CAD/CAM high-density PMMA- and composite-based polymers.

    Science.gov (United States)

    Wiegand, Annette; Stucki, Lukas; Hoffmann, Robin; Attin, Thomas; Stawarczyk, Bogna

    2015-11-01

    The study aimed to analyse the shear bond strength of computer-aided design and computer-aided manufacturing (CAD/CAM) polymethyl methacrylate (PMMA)- and composite-based polymer materials repaired with a conventional methacrylate-based composite after different surface pretreatments. Each 48 specimens was prepared from six different CAD/CAM polymer materials (Ambarino high-class, artBloc Temp, CAD-Temp, Lava Ultimate, Telio CAD, Everest C-Temp) and a conventional dimethacrylate-based composite (Filtek Supreme XTE, control) and aged by thermal cycling (5000 cycles, 5-55 °C). The surfaces were left untreated or were pretreated by mechanical roughening, aluminium oxide air abrasion or silica coating/silanization (each subgroup n = 12). The surfaces were further conditioned with an etch&rinse adhesive (OptiBond FL) before the repair composite (Filtek Supreme XTE) was adhered to the surface. After further thermal cycling, shear bond strength was tested, and failure modes were assessed. Shear bond strength was statistically analysed by two- and one-way ANOVAs and Weibull statistics, failure mode by chi(2) test (p ≤ 0.05). Shear bond strength was highest for silica coating/silanization > aluminium oxide air abrasion = mechanical roughening > no surface pretreatment. Independently of the repair pretreatment, highest bond strength values were observed in the control group and for the composite-based Everest C-Temp and Ambarino high-class, while PMMA-based materials (artBloc Temp, CAD-Temp and Telio CAD) presented significantly lowest values. For all materials, repair without any surface pretreatment resulted in adhesive failures only, which mostly were reduced when surface pretreatment was performed. Repair of CAD/CAM high-density polymers requires surface pretreatment prior to adhesive and composite application. However, four out of six of the tested CAD/CAM materials did not achieve the repair bond strength of a conventional dimethacrylate-based

  10. Repair Strength in Simulated Restorations of Methacrylate- or Silorane-Based Composite Resins.

    Science.gov (United States)

    Consani, Rafael Leonardo Xediek; Marinho, Tatiane; Bacchi, Atais; Caldas, Ricardo Armini; Feitosa, Victor Pinheiro; Pfeifer, Carmem Silvia

    2016-01-01

    The study verified the bond strength in simulated dental restorations of silorane- or methacrylate-based composites repaired with methacrylate-based composite. Methacrylate- (P60) or silorane-based (P90) composites were used associated with adhesive (Adper Single Bond 2). Twenty-four hemi-hourglass-shaped samples were repaired with each composite (n=12). Samples were divided according to groups: G1= P60 + Adper Single Bond 2+ P60; G2= P60 + Adper Single Bond 2 + P60 + thermocycling; G3= P90 + Adper Single Bond 2 + P60; and G4= P90 + Adper Single Bond 2 + P60 + thermocycling. G1 and G3 were submitted to tensile test 24 h after repair procedure, and G2 and G4 after submitted to 5,000 thermocycles at 5 and 55 ?#61616;C for 30 s in each bath. Tensile bond strength test was accomplished in an universal testing machine at crosshead speed of 0.5 mm/min. Data (MPa) were analyzed by two-way ANOVA and Tukey's test (5%). Sample failure pattern (adhesive, cohesive in resin or mixed) was evaluated by stereomicroscope at 30?#61655; and images were obtained in SEM. Bond strength values of methacrylate-based composite samples repaired with methacrylate-based composite (G1 and G2) were greater than for silorane-based samples (G3 and G4). Thermocycling decreased the bond strength values for both composites. All groups showed predominance of adhesive failures and no cohesive failure in composite resin was observed. In conclusion, higher bond strength values were observed in methacrylate-based resin samples and greater percentage of adhesive failures in silorane-based resin samples, both composites repaired with methacrylate-based resin.

  11. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    International Nuclear Information System (INIS)

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong

    2013-01-01

    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  12. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  13. Sisal organosolv pulp as reinforcement for cement based composites

    Directory of Open Access Journals (Sweden)

    Ana Paula Joaquim

    2009-09-01

    Full Text Available The present work describes non-conventional sisal (Agave sisalana chemical (organosolv pulp from residues of cordage as reinforcement to cement based materials. Sisal organosolv pulp was produced in a 1:1 ethanol/water mixture and post chemically and physically characterized in order to compare its properties with sisal kraft pulp. Cement based composites reinforced with organosolv or kraft pulps and combined with polypropylene (PP fibres were produced by the slurry de-watering and pressing method as a crude simulation of the Hatschek process. Composites were evaluated at 28 days of age, after exposition to accelerated carbonation and after 100 soak/dry cycles. Composites containing organosolv pulp presented lower mechanical strength, water absorption and apparent porosity than composites reinforced with kraft pulp. The best mechanical performance after ageing was also achieved by samples reinforced with kraft pulp. The addition of PP fibres favoured the maintenance of toughness after ageing. Accelerated carbonation promoted the densification of the composites reinforced with sisal organosolv + PP fibres.

  14. DNA Damage among Wood Workers Assessed with the Comet Assay

    Science.gov (United States)

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

  15. Forensic genetic SNP typing of low-template DNA and highly degraded DNA from crime case samples

    DEFF Research Database (Denmark)

    Børsting, Claus; Mogensen, Helle Smidt; Morling, Niels

    2013-01-01

    the heterozygote balance. Allele drop-ins were only observed in experiments with 25 pg of DNA and not in experiments with 50 and 100 pg of DNA. The allele drop-in rate in the 25 pg experiments was 0.06% or 100 times lower than what was previously reported for STR typing of LtDNA. A composite model and two......Heterozygote imbalances leading to allele drop-outs and disproportionally large stutters leading to allele drop-ins are known stochastic phenomena related to STR typing of low-template DNA (LtDNA). The large stutters and the many drop-ins in typical STR stutter positions are artifacts from the PCR...... amplification of tandem repeats. These artifacts may be avoided by typing bi-allelic markers instead of STRs. In this work, the SNPforID multiplex assay was used to type LtDNA. A sensitized SNP typing protocol was introduced, that increased signal strengths without increasing noise and without affecting...

  16. Zinc-based electrolyte compositions, and related electrochemical processes and articles

    Science.gov (United States)

    Kniajanski, Sergei; Soloveichik, Grigorii Lev

    2018-02-20

    An aqueous electrolyte composition is described, including a zinc salt based on zinc acetate or zinc glocolate. The saturation concentration of zinc in the electrolyte composition is in the range of about 2.5M to about 3.5M. The composition also contains at least one salt of a monovalent cation. The molar ratio of zinc to the monovalent cation is about 1:2. An aqueous zinc electroplating bath, containing the aqueous electrolyte composition, is also disclosed, along with a method for the electrochemical deposition of zinc onto a substrate surface, using the electroplating bath. Related flow batteries are also described, including a catholyte, as well as an anolyte based on the aqueous electrolyte composition, with a membrane between the catholyte and the anolyte.

  17. Synthesis and DNA interaction of a Sm(III) complex of a Schiff base ...

    African Journals Online (AJOL)

    The interaction between the Sm(III) complex of an ionic Schiff base [HL]-, derived from vanillin and L-tryptophan, and herring sperm DNA at physiological pH (7.40) has been studied by UV-Vis absorption, fluorescence and viscosity methods. The binding ratios nSm(III) : nK[HL] = 1:1 and nSm(III)L: nDNA =5:1 were confirmed ...

  18. Detection of Avian Influenza Virus by Fluorescent DNA Barcode-based Immunoassay with Sensitivity Comparable to PCR

    DEFF Research Database (Denmark)

    Cao, Cuong; Dhumpa, Raghuram; Bang, Dang Duong

    2010-01-01

    involves the sandwiching of the target AIV between magnetic immunoprobes and barcode-carrying immunoprobes. Because each barcode-carrying immunoprobe is functionalized with a multitude of fluorophore-DNA barcode strands, many DNA barcodes are released for each positive binding event resulting......In this paper, a coupling of fluorophore-DNA barcode and bead-based immunoassay for detecting avian influenza virus (AIV) with PCR-like sensitivity is reported. The assay is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representative barcodes. The detection...

  19. Oxidation resistance coating for niobium base structural composites

    International Nuclear Information System (INIS)

    Tabaru, T.; Shobu, K.; Kim, J.H.; Hirai, H.; Hanada, S.

    2003-01-01

    Oxidation behavior of Al-rich Mo(Si,Al) 2 base alloys, which is a candidate material for the oxidation resistance coating on Nb base structural composites, were investigated by thermogravimetry. The Mo(Si,Al) 2 base alloys containing Mo 5 (Si,Al) 3 up to about 10 vol% exhibits excellent oxidation resistance at temperatures ranging from 780 to 1580 K, particularly at 1580 K due to continuous Al 2 O 3 layer development. To evaluate the applicability of the Mo(Si,Al) 2 base coating, plasma spraying on Nb base composites were undertaken. However, interface reaction layer was found to form during the following heat treatment. Preparation of Mo(Si,Al) 2 /Al 2 O 3 /Nb layered structures via powder metallurgical process was attempted to preclude diffusion reaction between coating and substrate. (orig.)

  20. Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.

    Science.gov (United States)

    Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P

    2017-09-01

    Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

  1. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Bacterial radiosensitivity to gamma and ultraviolet. Compositional dependence and repair mechanisms; Radiosensibilidad bacteriana frente a gamma y ultravioleta. Dependencia composicional y mecanismos de reparacion

    Energy Technology Data Exchange (ETDEWEB)

    Saez Angulo, R M; Davila, C A

    1974-07-01

    The gamma and ultraviolet radiosensitivity of several species of bacteria has been determined its dependence on DNAs composition and repair processes has been studied. Base composition are evaluated by chromatography, DNA melting temperature and isopycnic sedimentation on CsCl gradient. Repair capacity of gamma -and UV- lesions has been studied in two bacterial strains with same DMA base composition. It is concluded that the postulated correlation between radiosensitivity and base composition can not be generalized, the enzymatic repair mechanisms being of determining on radiosensitivity. (Author) 248 refs.

  4. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  5. MD study of pyrimidine base damage on DNA and its recognition by repair enzyme

    International Nuclear Information System (INIS)

    Pinak, M.

    2000-01-01

    The molecular dynamics (MD) simulation was used on the study of two specific damages of pyrimidine bases of DNA. Pyrimidine bases are major targets either of free radicals induced by ionizing radiation in DNA surrounding environment or UV radiation. Thymine dimer (TD) is UV induced damage, in which two neighboring thymines in one strand are joined by covalent bonds of C(5)-C(5) and C(6)-C(6) atoms of thymines. Thymine glycol (TG) is ionizing radiation induced damage in which the free water radical adds to unsaturated bond C(5)-C(6) of thymine. Both damages are experimentally suggested to be mutagenetic and carcinogenic unless properly repaired by repair enzymes. In the case of MD of TD, there is detected strong kink around the TD site that is not observed in native DNA. In addition there is observed the different value of electrostatic energy at the TD site - negative '-10 kcal/mol', in contrary to nearly neutral value of native thymine site. Structural changes and specific electrostatic energy - seems to be important for proper recognition of TD damaged site, formation of DNA-enzyme complex and thus for subsequent repair of DNA. In the case of TG damaged DNA there is major structural distortion at the TG site, mainly the increased distance between TG and the C5' of adjacent nucleotide. This enlarged gap between the neighboring nucleotides may prevent the insertion of complementary base during replication causing the replication process to stop. In which extend this structural feature together with energy properties of TG contributes to the proper recognition of TG by repair enzyme Endonuclease III is subject of further computational MD study. (author)

  6. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  7. Ontology-based composition and matching for dynamic service coordination

    OpenAIRE

    Pahl, Claus; Gacitua-Decar, Veronica; Wang, MingXue; Yapa Bandara, Kosala

    2011-01-01

    Service engineering needs to address integration problems allowing services to collaborate and coordinate. The need to address dynamic automated changes - caused by on-demand environments and changing requirements - can be addressed through service coordination based on ontology-based composition and matching techniques. Our solution to composition and matching utilises a service coordination space that acts as a passive infrastructure for collaboration. We discuss the information models an...

  8. Radiation-induced electron migration along DNA

    International Nuclear Information System (INIS)

    Fuciarelli, A.F.; Sisk, E.C.; Miller, J.H.; Zimbrick, J.D.

    1994-04-01

    Radiation-induced electron migration along DNA is a mechanism by which randomly produced stochastic energy deposition events can lead to nonrandom types of damage along DNA manifested distal to the sites of the initial energy deposition. Electron migration along DNA is significantly influenced by the DNA base sequence and DNA conformation. Migration along 7 base pairs in oligonucleotides containing guanine bases was observed for oligonucleotides irradiated in solution which compares to average migration distances of 6 to 10 bases for Escherichia coli DNA irradiated in solution and 5.5 base pairs for Escherichia coli DNA irradiated in cells. Evidence also suggests that electron migration can occur preferentially in the 5' to 3' direction along DNA. Our continued efforts will provide information regarding the contribution of electron transfer along DNA to formation of locally multiply damaged sites created in DNA by exposure to ionizing radiation

  9. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-09-01

    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Anticancer drug-DNA interactions measured using a photoinduced electron-transfer mechanism based on luminescent quantum dots.

    Science.gov (United States)

    Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang

    2009-01-01

    A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.

  11. Development of antifriction composites based on polypyromellitimide matrix

    Energy Technology Data Exchange (ETDEWEB)

    Olifirov, L.K., E-mail: M80786@yandex.ru [National University of Science and Technology «MISIS» (Russian Federation); Kaloshkin, S.D.; Tcherdyntsev, V.V. [National University of Science and Technology «MISIS» (Russian Federation); Danilov, V.D. [Blagonravov Institute of Machines Science of Russian Academy of Sciences (Russian Federation)

    2014-02-15

    Highlights: • Polypyromellitimide powder from waste of production polyimide films were obtained. • Structure of polypyromellitimide strongly changes after high energy ball milling. • Addition of commercial polyimide powder improve moldability of polypyromellitimide. • Polypyromellitimide based composites show good tribological properties in dry friction mode. -- Abstract: A method of polypyromellitimide powder production from PM-A film was proposed and a possibility of fabricating bulk composites based on polypyromellitimide matrix was investigated. The powders were prepared by the treatment of PM-A films in a planetary ball mill. The compositions based on polypyromellitimide containing additives of Al{sub 65}Cu{sub 23}Fe{sub 12} quasicrystals, graphite, polytetrafluoroethylene and PI-PR-20 polyimide were prepared by the solid-state mixing in an IKA M20 batch mill. The bulk samples were fabricated by the compression molding technique. Thus produced materials were characterized by using the methods of sieve analysis, scanning electron microscopy, Fourier-transform infrared spectroscopy, dynamo-mechanical analysis and tribological tests. It was found that the PM-A polypyromellitimide powder had a low sinterability and, therefore, the bulk samples of unfilled PM-A and also the composites based on PM-A containing additives of Al{sub 65}Cu{sub 23}Fe{sub 12} quasicrystals, graphite and polytetrafluoroethylene exhibited a high brittleness and show unstable behavior in the tribological tests. It was found that an addition of 15 wt.% PI-PR-20 polyimide improved the sinterability of PM-A and also provides excellent antifriction properties.

  12. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  13. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  14. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    Science.gov (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  15. Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.

    Science.gov (United States)

    Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike

    2018-05-01

    We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.

  16. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    Science.gov (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  17. Increased humoral immunity by DNA vaccination using an alpha-tocopherol-based adjuvant

    DEFF Research Database (Denmark)

    Karlsson, Ingrid; Borggren, Marie; Nielsen, Jens

    2017-01-01

    approaches. We tested whether the emulsion-based and alpha-tocopherol containing adjuvant Diluvac Forte® has the ability to enhance the immunogenicity of a naked DNA vaccine (i.e., plasmid DNA). As a model vaccine, we used plasmids encoding both a surface-exposed viral glycoprotein (hemagglutinin......) and an internal non-glycosylated nucleoprotein in the Th1/Th2 balanced CB6F1 mouse model. The naked DNA (50 µg) was premixed at a 1:1 volume/volume ratio with Diluvac Forte®, an emulsion containing different concentrations of alpha-tocopherol, the emulsion alone or endotoxin-free phosphate-buffered saline (PBS......). The animals received two intracutaneous immunizations spaced 3 weeks apart. When combined with Diluvac Forte® or the emulsion containing alpha-tocopherol, the DNA vaccine induced a more potent and balanced immunoglobulin G (IgG)1 and IgG2c response, and both IgG subclass responses were significantly enhanced...

  18. Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

    Energy Technology Data Exchange (ETDEWEB)

    Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)

    2014-10-02

    DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

  19. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  20. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  1. Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

    Science.gov (United States)

    Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

    2018-01-01

    Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

  2. Meta-barcoding of 'dirt' DNA from soil reflects vertebrate biodiversity

    DEFF Research Database (Denmark)

    Andersen, Kenneth; Bird, Karen Lise; Rasmussen, Morten

    2012-01-01

    DNA molecules originating from animals and plants can be retrieved directly from sediments and have been used for reconstructing both contemporary and past ecosystems. However, the extent to which such 'dirt' DNA reflects taxonomic richness and structural diversity remains contentious. Here, we...... couple second generation high-throughput sequencing with 16S mitochondrial DNA (mtDNA) meta-barcoding, to explore the accuracy and sensitivity of 'dirt' DNA as an indicator of vertebrate diversity, from soil sampled at safari parks, zoological gardens and farms with known species compositions. PCR...

  3. Extracellular DNA metabolism in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Scott eChimileski

    2014-02-01

    Full Text Available Extracellular DNA is found in all environments and is a dynamic component of the micro-bial ecosystem. Microbial cells produce and interact with extracellular DNA through many endogenous mechanisms. Extracellular DNA is processed and internalized for use as genetic information and as a major source of macronutrients, and plays several key roles within prokaryotic biofilms. Hypersaline sites contain some of the highest extracellular DNA con-centrations measured in nature–a potential rich source of carbon, nitrogen and phosphorus for halophilic microorganisms. We conducted DNA growth studies for the halophilic archaeon Haloferax volcanii DS2 and show that this model Halobacteriales strain is capable of using exogenous double-stranded DNA as a nutrient. Further experiments with varying medium composition, DNA concentration and DNA types revealed that DNA is utilized primarily as a phosphorus source, that growth on DNA is concentration-dependent and that DNA isolated from different sources is metabolized selectively, with a bias against highly divergent methylated DNA sources. Additionally, fluorescence microscopy experiments showed that labeled DNA colocalized with Haloferax volcanii cells. The gene Hvo_1477 was also identified using a comparative genomic approach as a factor likely to be involved in extracellular DNA processing at the cell surface, and deletion of Hvo_1477 created an H. volcanii strain deficient in its ability to grow on extracellular DNA. Widespread distribution of Hvo_1477 homologs in archaea suggests metabolism of extracellular DNA may be of broad ecological and physiological relevance in this domain of life.

  4. Molecular Data for a Biochemical Model of DNA Radiation Damage: Electron Impact Ionization and Dissociative Ionization of DNA Bases and Sugar-Phosphate Backbone

    Science.gov (United States)

    Dateo, Christopher E.; Fletcher, Graham D.

    2004-01-01

    As part of the database for building up a biochemical model of DNA radiation damage, electron impact ionization cross sections of sugar-phosphate backbone and DNA bases have been calculated using the improved binary-encounter dipole (iBED) model. It is found that the total ionization cross sections of C3'- and C5'-deoxyribose-phospate, two conformers of the sugar-phosphate backbone, are close to each other. Furthermore, the sum of the ionization cross sections of the separate deoxyribose and phosphate fragments is in close agreement with the C3'- and C5'-deoxyribose-phospate cross sections, differing by less than 10%. Of the four DNA bases, the ionization cross section of guanine is the largest, then in decreasing order, adenine, thymine, and cytosine. The order is in accordance with the known propensity of oxidation of the bases by ionizing radiation. Dissociative ionization (DI), a process that both ionizes and dissociates a molecule, is investigated for cytosine. The DI cross section for the formation of H and (cytosine-Hl)(+), with the cytosine ion losing H at the 1 position, is also reported. The threshold of this process is calculated to be 17.1 eV. Detailed analysis of ionization products such as in DI is important to trace the sequential steps in the biochemical process of DNA damage.

  5. A NOVEL ROLLING BASED DNA CRYPTOGRAPHY

    Directory of Open Access Journals (Sweden)

    Rejwana Haque

    2017-05-01

    Full Text Available DNA Cryptography can be defined as a hiding data in terms of DNA Sequence. In this paper we propose a new DNA Encryption Technique where three different types of ordering is use to make binary data into cipher text. The main stages of this encryption technique are: Key Analysis, Data and Key Arrangement, Roll in encoding, Secondary Arrangement and Shifting. Decryption process has six main steps to obtain the original binary data from the encrypted data and key. Decryption steps are: Key Analysis, Shifting, Secondary Arrangement, Key Arrangement, Roll-out decoding, Data Arrangement. Here key size is half of binary data and the key is varies from data to data so key are used as one time pad. In this paper we also discuss about the implementation from sample data and security analysis for this given method.

  6. DNA sequence modeling based on context trees

    NARCIS (Netherlands)

    Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.

    2015-01-01

    Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such

  7. Application and comparison of large-scale solution-based DNA capture-enrichment methods on ancient DNA

    DEFF Research Database (Denmark)

    Avila Arcos, Maria del Carmen; Cappellini, Enrico; Romero-Navarro, J. Alberto

    2011-01-01

    The development of second-generation sequencing technologies has greatly benefitted the field of ancient DNA (aDNA). Its application can be further exploited by the use of targeted capture-enrichment methods to overcome restrictions posed by low endogenous and contaminating DNA in ancient samples...

  8. Potential for DNA-based identification of Great Lakes fauna: Match and mismatch between taxa inventories and DNA barcode libraries

    Science.gov (United States)

    DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to biotic condition assessment and non-native species early-detection monitoring. However, the abi...

  9. Pyrotechnic countermeasures: IV. Radiometric performance of a sulphur-based Flare composition

    Energy Technology Data Exchange (ETDEWEB)

    Koch, Ernst-Christian [NATO Munitions Safety Information Analysis Center (MSIAC), Brussels (Belgium)

    2008-10-15

    Radiometric performance of a sulphur-based flare composition has been investigated. Composition comprising sulphur, potassium perchlorate and antimony sulphide has acceptable band ratio but an order of magnitude weaker spectral efficiency than typical carbon-based compositions. The use of other sulphur compounds with potential for increased performance is discussed. For part III see Ref. [1]. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  10. Design, Synthesis, and Evaluation of Novel Tyrosine-Based DNA Gyrase B Inhibitors.

    Science.gov (United States)

    Cotman, Andrej E; Trampuž, Marko; Brvar, Matjaž; Kikelj, Danijel; Ilaš, Janez; Peterlin-Mašič, Lucija; Montalvão, Sofia; Tammela, Päivi; Frlan, Rok

    2017-08-01

    The discovery and synthesis of new tyrosine-based inhibitors of DNA gyrase B (GyrB), which target its ATPase subunit, is reported. Twenty-four compounds were synthesized and evaluated for activity against DNA gyrase and DNA topoisomerase IV. The antibacterial properties of selected GyrB inhibitors were demonstrated by their activity against Staphylococcus aureus and Enterococcus faecalis in the low micromolar range. The most promising compounds, 8a and 13e, inhibited Escherichia coli and S. aureus GyrB with IC 50 values of 40 and 30 µM. The same compound also inhibited the growth of S. aureus and E. faecalis with minimal inhibitory concentrations (MIC 90 ) of 14 and 28 µg/mL, respectively. © 2017 Deutsche Pharmazeutische Gesellschaft.

  11. DNA detection on ultrahigh-density optical fiber-based nanoarrays.

    Science.gov (United States)

    Tam, Jenny M; Song, Linan; Walt, David R

    2009-04-15

    Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

  12. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  13. Fracture strength and fatigue resistance of dental resin-based composites

    NARCIS (Netherlands)

    Keulemans, F.; Palav, P.; Aboushelib, M.M.N.; van Dalen, A.; Kleverlaan, C.J.; Feilzer, A.J.

    2009-01-01

    Objectives: The aim of this study was to evaluate in vitro the influence of fiber-reinforcement on the fracture strength and fatigue resistance of resin-based composites. Methods: One hundred rectangular bar-shaped specimens (2 mm × 2 mm × 25 mm) made of resin-based composite were prepared in a

  14. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  15. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  16. Soy-based fillers for thermoset composites

    Science.gov (United States)

    Watt, Paula

    Considerable work has been done with bio-based fillers in thermoplastics. Wood dust has been used for decades in wood plastic composites in conjunction with recycled high HDPE and PET. In recent years rapidly renewable fillers derived from dried distillery grains and from wood have been introduced commercially for thermoset polymers. These fillers provide bio-content and weight reduction to thermoset molding compounds but issues with moisture absorption and polymerization inhibition have limited their commercial acceptance. The intent of this research was to develop a bio-based filler suitable for thermoset composites. This filler would provide a low density alternative to mined mineral filler, such as CaCO3 or clay. Composites made with these fillers would be lighter in weight, which is desirable for many markets, particularly transportation. Cost parity to the mineral fillers, on a volume basis, was desirable and the use of green chemistry principles was a key objective of the project. This work provides a basis from which further development of modified soy flours as fillers for thermoset composites will continue. Biomass has been evaluated as fillers for thermoset composites since the early 1980s but failed to gain commercial acceptance due to excessive water absorption and inhibition issues with free radical curing. Biomass, with a large percentage of carbohydrates, are very hydrophilic due to their abundance of hydroxyl groups, while biomass, high in lignin, resulted in inhibition of the free radical cure of the unsaturated styrenated polyester matrix systems. Generally protein use as a filler is not desirable due to its food value. Torrefaction has proved to be a good, cost effective, process to reduce hydrophilicity of high cellulose feedstock. Surprising, however, some levels of torrefaction were found to induce the inhibition effect of the filler. Scientific inquiry into this problem proved that aromatics form during the torrefaction process and can

  17. Microcantilver-based DNA hybridization sensors for Salmonella identification

    Directory of Open Access Journals (Sweden)

    Carlo Ricciardi

    2012-02-01

    Full Text Available The detection of pathogenic microorganisms in foods remains a challenging since the safety of foodstuffs has to be ensured by the food producing companies. Conventional methods for the detection and identification of bacteria mainly rely on specific microbiological and biochemical identification. Biomolecular methods, are commonly used as a support for traditional techniques, thanks to their high sensitivity, specificity and not excessive costs. However, new methods like biosensors for example, can be an exciting alternative to the more traditional tecniques for the detection of pathogens in food. In this study we report Salmonella enterica serotype Enteritidis DNA detection through a novel class of label-free biosensors: microcantilevers (MCs. In general, MCs can operate as a microbalance and is used to detect the mass of the entities anchored to the cantilever surface using the decrease in the resonant frequency. We use DNA hybridization as model reaction system and for this reason, specific single stranded probe DNA of the pathogen and three different DNA targets (single-stranded complementary DNA, PCR product and serial dilutions of DNA extracted from S. Enteritidis strains were applied. Two protocols were reported in order to allow the probe immobilization on cantilever surface: i MC surface was functionalized with 3-aminopropyltriethoxysilane and glutaraldehyde and an amino-modified DNA probe was used; ii gold-coated sensors and thiolated DNA probes were used in order to generate a covalent bonding (Th-Au. For the first one, measures after hybridization with the PCR product showed related frequency shift 10 times higher than hybridization with complementary probe and detectable signals were obtained at the concentrations of 103 and 106 cfu/mL after hybridization with bacterial DNA. There are currently optimizations of the second protocol, where preliminary results have shown to be more uniform and therefore more precise within each of the

  18. Assembling high activity phosphotriesterase composites using hybrid nanoparticle peptide-DNA scaffolded architectures

    Science.gov (United States)

    Breger, Joyce C.; Buckhout-White, Susan; Walper, Scott A.; Oh, Eunkeu; Susumu, Kimihiro; Ancona, Mario G.; Medintz, Igor L.

    2017-06-01

    Nanoparticle (NP) display potentially offers a new way to both stabilize and, in many cases, enhance enzyme activity over that seen for native protein in solution. However, the large, globular and sometimes multimeric nature of many enzymes limits their ability to attach directly to the surface of NPs, especially when the latter are colloidally stabilized with bulky PEGylated ligands. Engineering extended protein linkers into the enzymes to achieve direct attachment through the PEG surface often detrimentally alters the enzymes catalytic ability. Here, we demonstrate an alternate, hybrid biomaterials-based approach to achieving directed enzyme assembly on PEGylated NPs. We self-assemble a unique architecture consisting of a central semiconductor quantum dot (QD) scaffold displaying controlled ratios of extended peptide-DNA linkers which penetrate through the PEG surface to directly couple enzymes to the QD surface. As a test case, we utilize phosphotriesterase (PTE), an enzyme of bio-defense interest due to its ability to hydrolyze organophosphate nerve agents. Moreover, this unique approach still allows PTE to maintain enhanced activity while also suggesting the ability of DNA to enhance enzyme activity in and of itself.

  19. Natural lipid extracts and biomembrane-mimicking lipid compositions are disposed to form nonlamellar phases, and they release DNA from lipoplexes most efficiently

    Energy Technology Data Exchange (ETDEWEB)

    Koynova, Rumiana; MacDonald, Robert C. (NWU)

    2010-01-18

    A viewpoint now emerging is that a critical factor in lipid-mediated transfection (lipofection) is the structural evolution of lipoplexes upon interacting and mixing with cellular lipids. Here we report our finding that lipid mixtures mimicking biomembrane lipid compositions are superior to pure anionic liposomes in their ability to release DNA from lipoplexes (cationic lipid/DNA complexes), even though they have a much lower negative charge density (and thus lower capacity to neutralize the positive charge of the lipoplex lipids). Flow fluorometry revealed that the portion of DNA released after a 30-min incubation of the cationic O-ethylphosphatidylcholine lipoplexes with the anionic phosphatidylserine or phosphatidylglycerol was 19% and 37%, respectively, whereas a mixture mimicking biomembranes (MM: phosphatidylcholine/phosphatidylethanolamine/phosphatidylserine /cholesterol 45:20:20:15 w/w) and polar lipid extract from bovine liver released 62% and 74%, respectively, of the DNA content. A possible reason for this superior power in releasing DNA by the natural lipid mixtures was suggested by structural experiments: while pure anionic lipids typically form lamellae, the natural lipid mixtures exhibited a surprising predilection to form nonlamellar phases. Thus, the MM mixture arranged into lamellar arrays at physiological temperature, but began to convert to the hexagonal phase at a slightly higher temperature, {approx} 40-45 C. A propensity to form nonlamellar phases (hexagonal, cubic, micellar) at close to physiological temperatures was also found with the lipid extracts from natural tissues (from bovine liver, brain, and heart). This result reveals that electrostatic interactions are only one of the factors involved in lipid-mediated DNA delivery. The tendency of lipid bilayers to form nonlamellar phases has been described in terms of bilayer 'frustration' which imposes a nonzero intrinsic curvature of the two opposing monolayers. Because the stored

  20. Phosphorescent quantum dots/doxorubicin nanohybrids based on photoinduced electron transfer for detection of DNA.

    Science.gov (United States)

    Miao, Yanming; Zhang, Zhifeng; Gong, Yan; Yan, Guiqin

    2014-09-15

    MPA-capped Mn-doped ZnS QDs/DXR nanohybrids (MPA: 3-mercaptopropionic acid; QDs: quantum dots; DXR: cetyltrimethyl ammonium bromide) were constructed via photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for detection of DNA. DXR as a quencher will quench the RTP of Mn-doped ZnS QDs via PIET, thereby forming Mn-doped ZnS QDs/DXR nanohybrids and storing RTP. With the addition of DNA, it will be inserted into DXR and thus DXR will be competitively desorbed from the surface of Mn-doped ZnS QDs, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this, a new method for DNA detection was built. The sensor for DNA has a detection limit of 0.039 mg L(-1) and a linear range from 0.1 to 14 mg L(-1). The present QDs-based RTP method does not need deoxidants or other inducers as required by conventional RTP detection methods, and avoids interference from autofluorescence and the scattering light of the matrix that are encountered in spectrofluorometry. Therefore, this method can be used to detect the DNA content in body fluid. Copyright © 2014 Elsevier B.V. All rights reserved.