WorldWideScience

Sample records for dna barcoding method

  1. DNA barcoding of recently diverged species: relative performance of matching methods.

    Directory of Open Access Journals (Sweden)

    Robin van Velzen

    Full Text Available Recently diverged species are challenging for identification, yet they are frequently of special interest scientifically as well as from a regulatory perspective. DNA barcoding has proven instrumental in species identification, especially in insects and vertebrates, but for the identification of recently diverged species it has been reported to be problematic in some cases. Problems are mostly due to incomplete lineage sorting or simply lack of a 'barcode gap' and probably related to large effective population size and/or low mutation rate. Our objective was to compare six methods in their ability to correctly identify recently diverged species with DNA barcodes: neighbor joining and parsimony (both tree-based, nearest neighbor and BLAST (similarity-based, and the diagnostic methods DNA-BAR, and BLOG. We analyzed simulated data assuming three different effective population sizes as well as three selected empirical data sets from published studies. Results show, as expected, that success rates are significantly lower for recently diverged species (∼75% than for older species (∼97% (P<0.00001. Similarity-based and diagnostic methods significantly outperform tree-based methods, when applied to simulated DNA barcode data (P<0.00001. The diagnostic method BLOG had highest correct query identification rate based on simulated (86.2% as well as empirical data (93.1%, indicating that it is a consistently better method overall. Another advantage of BLOG is that it offers species-level information that can be used outside the realm of DNA barcoding, for instance in species description or molecular detection assays. Even though we can confirm that identification success based on DNA barcoding is generally high in our data, recently diverged species remain difficult to identify. Nevertheless, our results contribute to improved solutions for their accurate identification.

  2. DNA barcoding a nightmare taxon: assessing barcode index numbers and barcode gaps for sweat bees.

    Science.gov (United States)

    Gibbs, Jason

    2018-01-01

    There is an ongoing campaign to DNA barcode the world's >20 000 bee species. Recent revisions of Lasioglossum (Dialictus) (Hymenoptera: Halictidae) for Canada and the eastern United States were completed using integrative taxonomy. DNA barcode data from 110 species of L. (Dialictus) are examined for their value in identification and discovering additional taxonomic diversity. Specimen identification success was estimated using the best close match method. Error rates were 20% relative to current taxonomic understanding. Barcode Index Numbers (BINs) assigned using Refined Single Linkage Analysis (RESL) and barcode gaps using the Automatic Barcode Gap Discovery (ABGD) method were also assessed. RESL was incongruent for 44.5% of species, although some cryptic diversity may exist. Forty-three of 110 species were part of merged BINs with multiple species. The barcode gap is non-existent for the data set as a whole and ABGD showed levels of discordance similar to the RESL. The viridatum species-group is particularly problematic, so that DNA barcodes alone would be misleading for species delimitation and specimen identification. Character-based methods using fixed nucleotide substitutions could improve specimen identification success in some cases. The use of DNA barcoding for species discovery for standard taxonomic practice in the absence of a well-defined barcode gap is discussed.

  3. Efficient alignment-free DNA barcode analytics.

    Science.gov (United States)

    Kuksa, Pavel; Pavlovic, Vladimir

    2009-11-10

    In this work we consider barcode DNA analysis problems and address them using alternative, alignment-free methods and representations which model sequences as collections of short sequence fragments (features). The methods use fixed-length representations (spectrum) for barcode sequences to measure similarities or dissimilarities between sequences coming from the same or different species. The spectrum-based representation not only allows for accurate and computationally efficient species classification, but also opens possibility for accurate clustering analysis of putative species barcodes and identification of critical within-barcode loci distinguishing barcodes of different sample groups. New alignment-free methods provide highly accurate and fast DNA barcode-based identification and classification of species with substantial improvements in accuracy and speed over state-of-the-art barcode analysis methods. We evaluate our methods on problems of species classification and identification using barcodes, important and relevant analytical tasks in many practical applications (adverse species movement monitoring, sampling surveys for unknown or pathogenic species identification, biodiversity assessment, etc.) On several benchmark barcode datasets, including ACG, Astraptes, Hesperiidae, Fish larvae, and Birds of North America, proposed alignment-free methods considerably improve prediction accuracy compared to prior results. We also observe significant running time improvements over the state-of-the-art methods. Our results show that newly developed alignment-free methods for DNA barcoding can efficiently and with high accuracy identify specimens by examining only few barcode features, resulting in increased scalability and interpretability of current computational approaches to barcoding.

  4. Review and future prospects for DNA barcoding methods in forensic palynology.

    Science.gov (United States)

    Bell, Karen L; Burgess, Kevin S; Okamoto, Kazufusa C; Aranda, Roman; Brosi, Berry J

    2016-03-01

    Pollen can be a critical forensic marker in cases where determining geographic origin is important, including investigative leads, missing persons cases, and intelligence applications. However, its use has previously been limited by the need for a high level of specialization by expert palynologists, slow speeds of identification, and relatively poor taxonomic resolution (typically to the plant family or genus level). By contrast, identification of pollen through DNA barcoding has the potential to overcome all three of these limitations, and it may seem surprising that the method has not been widely implemented. Despite what might seem a straightforward application of DNA barcoding to pollen, there are technical issues that have delayed progress. However, recent developments of standard methods for DNA barcoding of pollen, along with improvements in high-throughput sequencing technology, have overcome most of these technical issues. Based on these recent methodological developments in pollen DNA barcoding, we believe that now is the time to start applying these techniques in forensic palynology. In this article, we discuss the potential for these methods, and outline directions for future research to further improve on the technology and increase its applicability to a broader range of situations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. DNA Bar-Coding for Phytoplasma Identification

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2013-01-01

    Phytoplasma identi fi cation has proved dif fi cult due to their inability to be maintained in vitro. DNA barcoding is an identi fi cation method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identi fi cat...... genes, can be used to identify the following phytoplasma groups: 16SrI, 16SrII, 16SrIII, 16SrIV, 16SrV, 16SrVI, 16SrVII, 16SrIX, 16SrX, 16SrXI, 16SrXII, 16SrXV, 16SrXX, 16SrXXI....... cation. While other sequencebased methods may be well adapted to identification of particular strains of phytoplasmas, often they cannot be used for the simultaneous identification of phytoplasmas from different groups. The phytoplasma DNA barcoding protocol in this chapter, based on the tuf and 16SrRNA......Phytoplasma identi fi cation has proved dif fi cult due to their inability to be maintained in vitro. DNA barcoding is an identi fi cation method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identi fi...

  6. BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources

    Science.gov (United States)

    2009-01-01

    Background DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. Results We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Conclusion Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org. PMID:19958506

  7. A comparison of DNA barcode clustering methods applied

    Indian Academy of Sciences (India)

    2012-10-15

    Oct 15, 2012 ... to geography-based vs clade-based sampling of amphibians. ANDREA ... phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification ...... odes for soil nematode identification. Mol. .... barcoding amphibians: take the chance, meet the challenge. Mol.

  8. Two new computational methods for universal DNA barcoding: a benchmark using barcode sequences of bacteria, archaea, animals, fungi, and land plants.

    Science.gov (United States)

    Tanabe, Akifumi S; Toju, Hirokazu

    2013-01-01

    Taxonomic identification of biological specimens based on DNA sequence information (a.k.a. DNA barcoding) is becoming increasingly common in biodiversity science. Although several methods have been proposed, many of them are not universally applicable due to the need for prerequisite phylogenetic/machine-learning analyses, the need for huge computational resources, or the lack of a firm theoretical background. Here, we propose two new computational methods of DNA barcoding and show a benchmark for bacterial/archeal 16S, animal COX1, fungal internal transcribed spacer, and three plant chloroplast (rbcL, matK, and trnH-psbA) barcode loci that can be used to compare the performance of existing and new methods. The benchmark was performed under two alternative situations: query sequences were available in the corresponding reference sequence databases in one, but were not available in the other. In the former situation, the commonly used "1-nearest-neighbor" (1-NN) method, which assigns the taxonomic information of the most similar sequences in a reference database (i.e., BLAST-top-hit reference sequence) to a query, displays the highest rate and highest precision of successful taxonomic identification. However, in the latter situation, the 1-NN method produced extremely high rates of misidentification for all the barcode loci examined. In contrast, one of our new methods, the query-centric auto-k-nearest-neighbor (QCauto) method, consistently produced low rates of misidentification for all the loci examined in both situations. These results indicate that the 1-NN method is most suitable if the reference sequences of all potentially observable species are available in databases; otherwise, the QCauto method returns the most reliable identification results. The benchmark results also indicated that the taxon coverage of reference sequences is far from complete for genus or species level identification in all the barcode loci examined. Therefore, we need to accelerate

  9. Q-Bank Phytoplasma: A DNA Barcoding Tool for Phytoplasma Identification

    DEFF Research Database (Denmark)

    Contaldo, Nicoletta; Paltrinieri, Samanta; Makarova, Olga

    2015-01-01

    DNA barcoding is an identification method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identification. This phytoplasma DNA barcoding protocol based on the tuf gene has been shown to identify phytoplasmas...

  10. Ten years of barcoding at the African Centre for DNA Barcoding.

    Science.gov (United States)

    Bezeng, B S; Davies, T J; Daru, B H; Kabongo, R M; Maurin, O; Yessoufou, K; van der Bank, H; van der Bank, M

    2017-07-01

    The African Centre for DNA Barcoding (ACDB) was established in 2005 as part of a global initiative to accurately and rapidly survey biodiversity using short DNA sequences. The mitochondrial cytochrome c oxidase 1 gene (CO1) was rapidly adopted as the de facto barcode for animals. Following the evaluation of several candidate loci for plants, the Plant Working Group of the Consortium for the Barcoding of Life in 2009 recommended that two plastid genes, rbcLa and matK, be adopted as core DNA barcodes for terrestrial plants. To date, numerous studies continue to test the discriminatory power of these markers across various plant lineages. Over the past decade, we at the ACDB have used these core DNA barcodes to generate a barcode library for southern Africa. To date, the ACDB has contributed more than 21 000 plant barcodes and over 3000 CO1 barcodes for animals to the Barcode of Life Database (BOLD). Building upon this effort, we at the ACDB have addressed questions related to community assembly, biogeography, phylogenetic diversification, and invasion biology. Collectively, our work demonstrates the diverse applications of DNA barcoding in ecology, systematics, evolutionary biology, and conservation.

  11. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    Science.gov (United States)

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

    2012-01-01

    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  12. DNA barcode goes two-dimensions: DNA QR code web server.

    Science.gov (United States)

    Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  13. DNA barcode goes two-dimensions: DNA QR code web server.

    Directory of Open Access Journals (Sweden)

    Chang Liu

    Full Text Available The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  14. Defining operational taxonomic units using DNA barcode data.

    Science.gov (United States)

    Blaxter, Mark; Mann, Jenna; Chapman, Tom; Thomas, Fran; Whitton, Claire; Floyd, Robin; Abebe, Eyualem

    2005-10-29

    The scale of diversity of life on this planet is a significant challenge for any scientific programme hoping to produce a complete catalogue, whatever means is used. For DNA barcoding studies, this difficulty is compounded by the realization that any chosen barcode sequence is not the gene 'for' speciation and that taxa have evolutionary histories. How are we to disentangle the confounding effects of reticulate population genetic processes? Using the DNA barcode data from meiofaunal surveys, here we discuss the benefits of treating the taxa defined by barcodes without reference to their correspondence to 'species', and suggest that using this non-idealist approach facilitates access to taxon groups that are not accessible to other methods of enumeration and classification. Major issues remain, in particular the methodologies for taxon discrimination in DNA barcode data.

  15. DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species.

    Science.gov (United States)

    Yu, Min; Jiao, Lichao; Guo, Juan; Wiedenhoeft, Alex C; He, Tuo; Jiang, Xiaomei; Yin, Yafang

    2017-12-01

    ITS2+ trnH - psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens. The increase in illegal logging and timber trade of CITES-listed tropical species necessitates the development of unambiguous identification methods at the species level. For these methods to be fully functional and deployable for law enforcement, they must work using wood or wood products. DNA barcoding of wood has been promoted as a promising tool for species identification; however, the main barrier to extensive application of DNA barcoding to wood is the lack of a comprehensive and reliable DNA reference library of barcodes from wood. In this study, xylarium wood specimens of nine Dalbergia species were selected from the Wood Collection of the Chinese Academy of Forestry and DNA was then extracted from them for further PCR amplification of eight potential DNA barcode sequences (ITS2, matK, trnL, trnH-psbA, trnV-trnM1, trnV-trnM2, trnC-petN, and trnS-trnG). The barcodes were tested singly and in combination for species-level discrimination ability by tree-based [neighbor-joining (NJ)] and distance-based (TaxonDNA) methods. We found that the discrimination ability of DNA barcodes in combination was higher than any single DNA marker among the Dalbergia species studied, with the best two-marker combination of ITS2+trnH-psbA analyzed with NJ trees performing the best (100% accuracy). These barcodes are relatively short regions (wood as the source material, a necessary factor to apply DNA barcoding to timber trade. The present results demonstrate the feasibility of using vouchered xylarium specimens to build DNA barcoding reference databases.

  16. DNA barcoding the floras of biodiversity hotspots.

    Science.gov (United States)

    Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G; Savolainen, Vincent

    2008-02-26

    DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a "DNA barcoding gap" is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes.

  17. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  18. Do DNA barcoding delimitation methods affect our view of stream biodiversity?

    Science.gov (United States)

    How we delimit molecular operational taxonomic units (MOTUs) is an important aspect in the use of DNA barcoding for bioassessment. Four delimitation methods were examined to gain an understanding of their relative strengths at organizing data from 5300 specimens collected during ...

  19. DNA Barcoding as a Reliable Method for the Authentication of Commercial Seafood Products

    Directory of Open Access Journals (Sweden)

    Silvia Nicolè

    2012-01-01

    Full Text Available Animal DNA barcoding allows researchers to identify different species by analyzing a short nucleotide sequence, typically the mitochondrial gene cox1. In this paper, we use DNA barcoding to genetically identify seafood samples that were purchased from various locations throughout Italy. We adopted a multi-locus approach to analyze the cob, 16S-rDNA and cox1 genes, and compared our sequences to reference sequences in the BOLD and GenBank online databases. Our method is a rapid and robust technique that can be used to genetically identify crustaceans, mollusks and fishes. This approach could be applied in the future for conservation, particularly for monitoring illegal trade of protected and endangered species. Additionally, this method could be used for authentication in order to detect mislabeling of commercially processed seafood.

  20. Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae

    Directory of Open Access Journals (Sweden)

    Giovanna Câmara Giudicelli

    2015-04-01

    Full Text Available DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1 region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species.

  1. A DNA barcode for land plants.

    Science.gov (United States)

    2009-08-04

    DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.

  2. DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters

    Science.gov (United States)

    Fernández-Álvarez, Fernando Ángel; Machordom, Annie

    2013-09-01

    For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.

  3. Choosing and Using a Plant DNA Barcode

    Science.gov (United States)

    Hollingsworth, Peter M.; Graham, Sean W.; Little, Damon P.

    2011-01-01

    The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance. PMID:21637336

  4. Choosing and using a plant DNA barcode.

    Directory of Open Access Journals (Sweden)

    Peter M Hollingsworth

    Full Text Available The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1 mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance.

  5. A DNA barcode for land plants

    Science.gov (United States)

    Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.

    2009-01-01

    DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622

  6. Novel DNA barcodes for detection, idenfication and tracking of stachybotrys and chaetomium species

    DEFF Research Database (Denmark)

    Lewinska, Anna Malgorzata; Hoof, Jakob Blæsbjerg; Peuhkuri, Ruut Hannele

    2014-01-01

    Detection and identification of indoor fungi in water-damaged buildings is crucial for preventi and control of fungal growth. This study focuses on a molecular method called DNA barcoding. evaluates commonly used sequences in DNA barcoding for fungal species identification Chaetomium...... and Stachybotrys. The existing DNA barcodes: ITS, SSU, LSU, B-TUB, CMD, RP and TEF-1α do not give satisfying species resolution to be considered as DNA barcodes for the two genera. Therefore, novel barcodes for them are needed. Barcode potentials, such as HOG1 a NAHA, were identified using bioinformatics...

  7. Internal Transcribed Spacer (ITS), an ideal DNA barcode for species ...

    African Journals Online (AJOL)

    Background: DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. Materials and Methods: In the present study, four potential DNA barcodes, namely rbcL, matK, ...

  8. Constructing DNA Barcode Sets Based on Particle Swarm Optimization.

    Science.gov (United States)

    Wang, Bin; Zheng, Xuedong; Zhou, Shihua; Zhou, Changjun; Wei, Xiaopeng; Zhang, Qiang; Wei, Ziqi

    2018-01-01

    Following the completion of the human genome project, a large amount of high-throughput bio-data was generated. To analyze these data, massively parallel sequencing, namely next-generation sequencing, was rapidly developed. DNA barcodes are used to identify the ownership between sequences and samples when they are attached at the beginning or end of sequencing reads. Constructing DNA barcode sets provides the candidate DNA barcodes for this application. To increase the accuracy of DNA barcode sets, a particle swarm optimization (PSO) algorithm has been modified and used to construct the DNA barcode sets in this paper. Compared with the extant results, some lower bounds of DNA barcode sets are improved. The results show that the proposed algorithm is effective in constructing DNA barcode sets.

  9. Assessment of the Authenticity of Herbal Dietary Supplements: Comparison of Chemical and DNA Barcoding Methods.

    Science.gov (United States)

    Pawar, Rahul S; Handy, Sara M; Cheng, Raymond; Shyong, Nicole; Grundel, Erich

    2017-07-01

    About 7 % of the U. S. population reports using botanical dietary supplements. Increased use of such supplements has led to discussions related to their authenticity and quality. Reports of adulteration with substandard materials or pharmaceuticals are of concern because such substitutions, whether inadvertent or deliberate, may reduce the efficacy of specific botanicals or lead to adverse events. Methods for verifying the identity of botanicals include macroscopic and microscopic examinations, chemical analysis, and DNA-based methods including DNA barcoding. Macroscopic and microscopic examinations may fail when a supplement consists of botanicals that have been processed beyond the ability to provide morphological characterizations. Chemical analysis of specific marker compounds encounters problems when these compounds are not distinct to a given species or when purified reference standards are not available. Recent investigations describing DNA barcoding analysis of botanical dietary supplements have raised concerns about the authenticity of the supplements themselves as well as the appropriateness of using DNA barcoding techniques with finished botanical products. We collected 112 market samples of frequently consumed botanical dietary supplements of ginkgo, soy, valerian, yohimbe, and St. John's wort and analyzed each for specific chemical markers (i.e., flavonol glycosides, total isoflavones, total valerenic acids, yohimbine, and hypericins, respectively). We used traditional DNA barcoding techniques targeting the nuclear ITS2 gene and the chloroplast gene psb A- trn H on the same samples to determine the presence of DNA of the labelled ingredient. We compared the results obtained by both methods to assess the contribution of each in determining the identity of the samples. Georg Thieme Verlag KG Stuttgart · New York.

  10. Multilocus inference of species trees and DNA barcoding.

    Science.gov (United States)

    Mallo, Diego; Posada, David

    2016-09-05

    The unprecedented amount of data resulting from next-generation sequencing has opened a new era in phylogenetic estimation. Although large datasets should, in theory, increase phylogenetic resolution, massive, multilocus datasets have uncovered a great deal of phylogenetic incongruence among different genomic regions, due both to stochastic error and to the action of different evolutionary process such as incomplete lineage sorting, gene duplication and loss and horizontal gene transfer. This incongruence violates one of the fundamental assumptions of the DNA barcoding approach, which assumes that gene history and species history are identical. In this review, we explain some of the most important challenges we will have to face to reconstruct the history of species, and the advantages and disadvantages of different strategies for the phylogenetic analysis of multilocus data. In particular, we describe the evolutionary events that can generate species tree-gene tree discordance, compare the most popular methods for species tree reconstruction, highlight the challenges we need to face when using them and discuss their potential utility in barcoding. Current barcoding methods sacrifice a great amount of statistical power by only considering one locus, and a transition to multilocus barcodes would not only improve current barcoding methods, but also facilitate an eventual transition to species-tree-based barcoding strategies, which could better accommodate scenarios where the barcode gap is too small or inexistent.This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.

  11. Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

    Science.gov (United States)

    Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

    2012-11-14

    DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

  12. A DNA mini-barcode for land plants.

    Science.gov (United States)

    Little, Damon P

    2014-05-01

    Small portions of the barcode region - mini-barcodes - may be used in place of full-length barcodes to overcome DNA degradation for samples with poor DNA preservation. 591,491,286 rbcL mini-barcode primer combinations were electronically evaluated for PCR universality, and two novel highly universal sets of priming sites were identified. Novel and published rbcL mini-barcode primers were evaluated for PCR amplification [determined with a validated electronic simulation (n = 2765) and empirically (n = 188)], Sanger sequence quality [determined empirically (n = 188)], and taxonomic discrimination [determined empirically (n = 30,472)]. PCR amplification for all mini-barcodes, as estimated by validated electronic simulation, was successful for 90.2-99.8% of species. Overall Sanger sequence quality for mini-barcodes was very low - the best mini-barcode tested produced sequences of adequate quality (B20 ≥ 0.5) for 74.5% of samples. The majority of mini-barcodes provide correct identifications of families in excess of 70.1% of the time. Discriminatory power noticeably decreased at lower taxonomic levels. At the species level, the discriminatory power of the best mini-barcode was less than 38.2%. For samples believed to contain DNA from only one species, an investigator should attempt to sequence, in decreasing order of utility and probability of success, mini-barcodes F (rbcL1/rbcLB), D (F52/R193) and K (F517/R604). For samples believed to contain DNA from more than one species, an investigator should amplify and sequence mini-barcode D (F52/R193). © 2013 John Wiley & Sons Ltd.

  13. DNA Barcoding of Marine Metazoa

    Science.gov (United States)

    Bucklin, Ann; Steinke, Dirk; Blanco-Bercial, Leocadio

    2011-01-01

    More than 230,000 known species representing 31 metazoan phyla populate the world's oceans. Perhaps another 1,000,000 or more species remain to be discovered. There is reason for concern that species extinctions may outpace discovery, especially in diverse and endangered marine habitats such as coral reefs. DNA barcodes (i.e., short DNA sequences for species recognition and discrimination) are useful tools to accelerate species-level analysis of marine biodiversity and to facilitate conservation efforts. This review focuses on the usual barcode region for metazoans: a ˜648 base-pair region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcodes have also been used for population genetic and phylogeographic analysis, identification of prey in gut contents, detection of invasive species, forensics, and seafood safety. More controversially, barcodes have been used to delimit species boundaries, reveal cryptic species, and discover new species. Emerging frontiers are the use of barcodes for rapid and increasingly automated biodiversity assessment by high-throughput sequencing, including environmental barcoding and the use of barcodes to detect species for which formal identification or scientific naming may never be possible.

  14. Use of DNA barcodes to identify flowering plants

    OpenAIRE

    Kress, W. John; Wurdack, Kenneth J.; Zimmer, Elizabeth A.; Weigt, Lee A.; Janzen, Daniel H.

    2005-01-01

    Methods for identifying species by using short orthologous DNA sequences, known as “DNA barcodes,” have been proposed and initiated to facilitate biodiversity studies, identify juveniles, associate sexes, and enhance forensic analyses. The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal barcoding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. We ther...

  15. Evaluation of the DNA barcodes in Dendrobium (Orchidaceae) from mainland Asia.

    Science.gov (United States)

    Xu, Songzhi; Li, Dezhu; Li, Jianwu; Xiang, Xiaoguo; Jin, Weitao; Huang, Weichang; Jin, Xiaohua; Huang, Luqi

    2015-01-01

    DNA barcoding has been proposed to be one of the most promising tools for accurate and rapid identification of taxa. However, few publications have evaluated the efficiency of DNA barcoding for the large genera of flowering plants. Dendrobium, one of the largest genera of flowering plants, contains many species that are important in horticulture, medicine and biodiversity conservation. Besides, Dendrobium is a notoriously difficult group to identify. DNA barcoding was expected to be a supplementary means for species identification, conservation and future studies in Dendrobium. We assessed the power of 11 candidate barcodes on the basis of 1,698 accessions of 184 Dendrobium species obtained primarily from mainland Asia. Our results indicated that five single barcodes, i.e., ITS, ITS2, matK, rbcL and trnH-psbA, can be easily amplified and sequenced with the currently established primers. Four barcodes, ITS, ITS2, ITS+matK, and ITS2+matK, have distinct barcoding gaps. ITS+matK was the optimal barcode based on all evaluation methods. Furthermore, the efficiency of ITS+matK was verified in four other large genera including Ficus, Lysimachia, Paphiopedilum, and Pedicularis in this study. Therefore, we tentatively recommend the combination of ITS+matK as a core DNA barcode for large flowering plant genera.

  16. Statistical Approaches for DNA Barcoding

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Matz, M.

    2006-01-01

    The use of DNA as a tool for species identification has become known as "DNA barcoding" (Floyd et al., 2002; Hebert et al., 2003; Remigio and Hebert, 2003). The basic idea is straightforward: a small amount of DNA is extracted from the specimen, amplified and sequenced. The gene region sequenced...... is chosen so that it is nearly identical among individuals of the same species, but different between species, and therefore its sequence, can serve as an identification tag for the species ("DNA barcode"). By matching the sequence obtained from an unidentified specimen ("query" sequence) to the database...

  17. The campaign to DNA barcode all fishes, FISH-BOL.

    Science.gov (United States)

    Ward, R D; Hanner, R; Hebert, P D N

    2009-02-01

    FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.

  18. DNA barcoding of commercially important catfishes in the Philippines.

    Science.gov (United States)

    Quilang, Jonas P; Yu, Shiny Cathlynne S

    2015-06-01

    Many species of catfish are important resources for human consumption, for sport fishing and for use in aquarium industry. In the Philippines, some species are cultivated and some are caught in the wild for food and a few introduced species have become invasive. In this study, DNA barcoding using the mitochondrial cytochrome c oxidase I (COI) gene was done on commercially and economically important Philippine catfishes. A total of 75 specimens belonging to 11 species and 5 families were DNA barcoded. The genetic distances were computed and Neighbor-Joining (NJ) trees were constructed based on the Kimura 2-Parameter (K2P) method. The average K2P distances within species, genus, family and order were 0.2, 8.2, 12.7 and 21.9%, respectively. COI sequences clustered according to their species designation for 7 of the 11 catfishes. DNA barcoding was not able to discriminate between Arius dispar and A. manillensis and between Pterygoplichthys disjunctivus and P. pardalis. The morphological characters that are used to distinguish between these species do not complement molecular identification through DNA barcoding. DNA barcoding also showed that Clarias batrachus from the Philippines is different from the species found in India and Thailand, which supports earlier suggestions based on morphology that those found in India should be designated as C. magur and those in mainland Southeast Asia as C. aff. batrachus "Indochina". This study has shown that DNA barcoding can be used for species delineation and for tagging some species for further taxonomic investigation, which has implications on proper management and conservation strategies.

  19. Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication.

    Science.gov (United States)

    Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin; de Boer, Hugo

    2018-03-01

    Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono-substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry-based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence-based identification are necessary before DNA-based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd.

  20. An In silico approach for the evaluation of DNA barcodes

    Directory of Open Access Journals (Sweden)

    Shehzad Wasim

    2010-07-01

    Full Text Available Abstract Background DNA barcoding is a key tool for assessing biodiversity in both taxonomic and environmental studies. Essential features of barcodes include their applicability to a wide spectrum of taxa and their ability to identify even closely related species. Several DNA regions have been proposed as barcodes and the region selected strongly influences the output of a study. However, formal comparisons between barcodes remained limited until now. Here we present a standard method for evaluating barcode quality, based on the use of a new bioinformatic tool that performs in silico PCR over large databases. We illustrate this approach by comparing the taxonomic coverage and the resolution of several DNA regions already proposed for the barcoding of vertebrates. To assess the relationship between in silico and in vitro PCR, we also developed specific primers amplifying different species of Felidae, and we tested them using both kinds of PCR Results Tests on specific primers confirmed the correspondence between in silico and in vitro PCR. Nevertheless, results of in silico and in vitro PCRs can be somehow different, also because tuning PCR conditions can increase the performance of primers with limited taxonomic coverage. The in silico evaluation of DNA barcodes showed a strong variation of taxonomic coverage (i.e., universality: barcodes based on highly degenerated primers and those corresponding to the conserved region of the Cyt-b showed the highest coverage. As expected, longer barcodes had a better resolution than shorter ones, which are however more convenient for ecological studies analysing environmental samples. Conclusions In silico PCR could be used to improve the performance of a study, by allowing the preliminary comparison of several DNA regions in order to identify the most appropriate barcode depending on the study aims.

  1. Prospects and Problems for Identification of Poisonous Plants in China using DNA Barcodes.

    Science.gov (United States)

    Xie, Lei; Wang, Ying Wei; Guan, Shan Yue; Xie, Li Jing; Long, Xin; Sun, Cheng Ye

    2014-10-01

    Poisonous plants are a deadly threat to public health in China. The traditional clinical diagnosis of the toxic plants is inefficient, fallible, and dependent upon experts. In this study, we tested the performance of DNA barcodes for identification of the most threatening poisonous plants in China. Seventy-four accessions of 27 toxic plant species in 22 genera and 17 families were sampled and three DNA barcodes (matK, rbcL, and ITS) were amplified, sequenced and tested. Three methods, Blast, pairwise global alignment (PWG) distance, and Tree-Building were tested for discrimination power. The primer universality of all the three markers was high. Except in the case of ITS for Hemerocallis minor, the three barcodes were successfully generated from all the selected species. Among the three methods applied, Blast showed the lowest discrimination rate, whereas PWG Distance and Tree-Building methods were equally effective. The ITS barcode showed highest discrimination rates using the PWG Distance and Tree-Building methods. When the barcodes were combined, discrimination rates were increased for the Blast method. DNA barcoding technique provides us a fast tool for clinical identification of poisonous plants in China. We suggest matK, rbcL, ITS used in combination as DNA barcodes for authentication of poisonous plants. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  2. Four years of DNA barcoding: current advances and prospects.

    Science.gov (United States)

    Frézal, Lise; Leblois, Raphael

    2008-09-01

    Research using cytochrome c oxidase barcoding techniques on zoological specimens was initiated by Hebert et al. [Hebert, P.D.N., Ratnasingham, S., deWaard, J.R., 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B 270, S96-S99]. By March 2004, the Consortium for the Barcode of Life started to promote the use of a standardized DNA barcoding approach, consisting of identifying a specimen as belonging to a certain animal species based on a single universal marker: the DNA barcode sequence. Over the last 4 years, this approach has become increasingly popular and advances as well as limitations have clearly emerged as increasing amounts of organisms have been studied. Our purpose is to briefly expose DNA Barcode of Life principles, pros and cons, relevance and universality. The initially proposed Barcode of life framework has greatly evolved, giving rise to a flexible description of DNA barcoding and a larger range of applications.

  3. Evaluation of the DNA barcodes in Dendrobium (Orchidaceae from mainland Asia.

    Directory of Open Access Journals (Sweden)

    Songzhi Xu

    Full Text Available DNA barcoding has been proposed to be one of the most promising tools for accurate and rapid identification of taxa. However, few publications have evaluated the efficiency of DNA barcoding for the large genera of flowering plants. Dendrobium, one of the largest genera of flowering plants, contains many species that are important in horticulture, medicine and biodiversity conservation. Besides, Dendrobium is a notoriously difficult group to identify. DNA barcoding was expected to be a supplementary means for species identification, conservation and future studies in Dendrobium. We assessed the power of 11 candidate barcodes on the basis of 1,698 accessions of 184 Dendrobium species obtained primarily from mainland Asia. Our results indicated that five single barcodes, i.e., ITS, ITS2, matK, rbcL and trnH-psbA, can be easily amplified and sequenced with the currently established primers. Four barcodes, ITS, ITS2, ITS+matK, and ITS2+matK, have distinct barcoding gaps. ITS+matK was the optimal barcode based on all evaluation methods. Furthermore, the efficiency of ITS+matK was verified in four other large genera including Ficus, Lysimachia, Paphiopedilum, and Pedicularis in this study. Therefore, we tentatively recommend the combination of ITS+matK as a core DNA barcode for large flowering plant genera.

  4. Identification of Species in Tripterygium (Celastraceae) Based on DNA Barcoding.

    Science.gov (United States)

    Zhang, Xiaomei; Li, Na; Yao, Yuanyuan; Liang, Xuming; Qu, Xianyou; Liu, Xiang; Zhu, Yingjie; Yang, Dajian; Sun, Wei

    2016-11-01

    Species of genus Tripterygium (Celastraceae) have attracted much attention owing to their excellent effect on treating autoimmune and inflammatory diseases. However, due to high market demand causing overexploitation, natural populations of genus Tripterygium have rapidly declined. Tripterygium medicinal materials are mainly collected from the wild, making the quality of medicinal materials unstable. Additionally, identification of herbal materials from Tripterygium species and their adulterants is difficult based on morphological characters. Therefore, an accurate, convenient, and stability method is urgently needed. In this wok, we developed a DNA barcoding technique to distinguish T. wilfordii HOOK. f., T. hypoglaucum (LÉVL.) HUTCH, and T. regelii SPRAGUE et TAKEDA and their adulterants based on four uniform and standard DNA regions (internal transcribed spacer 2 (ITS2), matK, rbcL, and psbA-trnH). DNA was extracted from 26 locations of fresh leaves. Phylogenetic tree was constructed with Neighbor-Joining (NJ) method, while barcoding gap was analyzed to assess identification efficiency. Compared with the other DNA barcodes applied individually or in combination, ITS2+psbA-trnH was demonstrated as the optimal barcode. T. hypoglaucum and T. wilfordii can be considered as conspecific, while T. regelii was recognized as a separate species. Furthermore, identification of commercial Tripterygium samples was conducted using BLAST against GenBank and Species Identification System for Traditional Chinese Medicine. Our results indicated that DNA barcoding is a convenient, effective, and stability method to identify and distinguish Tripterygium and its adulterants, and could be applied as the quality control for Tripterygium medicinal preparations and monitoring of the medicinal herb trade in markets.

  5. Building a DNA barcode library of Alaska's non-marine arthropods.

    Science.gov (United States)

    Sikes, Derek S; Bowser, Matthew; Morton, John M; Bickford, Casey; Meierotto, Sarah; Hildebrandt, Kyndall

    2017-03-01

    Climate change may result in ecological futures with novel species assemblages, trophic mismatch, and mass extinction. Alaska has a limited taxonomic workforce to address these changes. We are building a DNA barcode library to facilitate a metabarcoding approach to monitoring non-marine arthropods. Working with the Canadian Centre for DNA Barcoding, we obtained DNA barcodes from recently collected and authoritatively identified specimens in the University of Alaska Museum (UAM) Insect Collection and the Kenai National Wildlife Refuge collection. We submitted tissues from 4776 specimens, of which 81% yielded DNA barcodes representing 1662 species and 1788 Barcode Index Numbers (BINs), of primarily terrestrial, large-bodied arthropods. This represents 84% of the species available for DNA barcoding in the UAM Insect Collection. There are now 4020 Alaskan arthropod species represented by DNA barcodes, after including all records in Barcode of Life Data Systems (BOLD) of species that occur in Alaska - i.e., 48.5% of the 8277 Alaskan, non-marine-arthropod, named species have associated DNA barcodes. An assessment of the identification power of the library in its current state yielded fewer species-level identifications than expected, but the results were not discouraging. We believe we are the first to deliberately begin development of a DNA barcode library of the entire arthropod fauna for a North American state or province. Although far from complete, this library will become increasingly valuable as more species are added and costs to obtain DNA sequences fall.

  6. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    Science.gov (United States)

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  7. [Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

    Science.gov (United States)

    Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

    2013-01-01

    Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

  8. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  9. Primer and barcode gap identification and DNA barcode generation for species discrimination in plants

    OpenAIRE

    Deepu Mathew

    2015-01-01

    This book chapter details the protocols for DNA barcoding in plants, starting from DNA isolation, sequencing, sequence annotation using MEGA, till identification of barcode gaps. A good chapter for beginners in plant taxonomy

  10. Patterns of DNA barcode variation in Canadian marine molluscs.

    Science.gov (United States)

    Layton, Kara K S; Martel, André L; Hebert, Paul D N

    2014-01-01

    Molluscs are the most diverse marine phylum and this high diversity has resulted in considerable taxonomic problems. Because the number of species in Canadian oceans remains uncertain, there is a need to incorporate molecular methods into species identifications. A 648 base pair segment of the cytochrome c oxidase subunit I gene has proven useful for the identification and discovery of species in many animal lineages. While the utility of DNA barcoding in molluscs has been demonstrated in other studies, this is the first effort to construct a DNA barcode registry for marine molluscs across such a large geographic area. This study examines patterns of DNA barcode variation in 227 species of Canadian marine molluscs. Intraspecific sequence divergences ranged from 0-26.4% and a barcode gap existed for most taxa. Eleven cases of relatively deep (>2%) intraspecific divergence were detected, suggesting the possible presence of overlooked species. Structural variation was detected in COI with indels found in 37 species, mostly bivalves. Some indels were present in divergent lineages, primarily in the region of the first external loop, suggesting certain areas are hotspots for change. Lastly, mean GC content varied substantially among orders (24.5%-46.5%), and showed a significant positive correlation with nearest neighbour distances. DNA barcoding is an effective tool for the identification of Canadian marine molluscs and for revealing possible cases of overlooked species. Some species with deep intraspecific divergence showed a biogeographic partition between lineages on the Atlantic, Arctic and Pacific coasts, suggesting the role of Pleistocene glaciations in the subdivision of their populations. Indels were prevalent in the barcode region of the COI gene in bivalves and gastropods. This study highlights the efficacy of DNA barcoding for providing insights into sequence variation across a broad taxonomic group on a large geographic scale.

  11. DNA barcoding commercially important fish species of Turkey.

    Science.gov (United States)

    Keskın, Emre; Atar, Hasan H

    2013-09-01

    DNA barcoding was used in the identification of 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. A total of 1765 DNA barcodes using a 654-bp-long fragment of the mitochondrial cytochrome c oxidase subunit I gene were generated for 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. These species belong to 70 genera, 40 families and 19 orders from class Actinopterygii, and all were associated with a distinct DNA barcode. Nine and 12 of the COI barcode clusters represent the first species records submitted to the BOLD and GenBank databases, respectively. All COI barcodes (except sequences of first species records) were matched with reference sequences of expected species, according to morphological identification. Average nucleotide frequencies of the data set were calculated as T = 29.7%, C = 28.2%, A = 23.6% and G = 18.6%. Average pairwise genetic distance among individuals were estimated as 0.32%, 9.62%, 17,90% and 22.40% for conspecific, congeneric, confamilial and within order, respectively. Kimura 2-parameter genetic distance values were found to increase with taxonomic level. For most of the species analysed in our data set, there is a barcoding gap, and an overlap in the barcoding gap exists for only two genera. Neighbour-joining trees were drawn based on DNA barcodes and all the specimens clustered in agreement with their taxonomic classification at species level. Results of this study supported DNA barcoding as an efficient molecular tool for a better monitoring, conservation and management of fisheries. © 2013 John Wiley & Sons Ltd.

  12. Delineating species with DNA barcodes: a case of taxon dependent method performance in moths.

    Directory of Open Access Journals (Sweden)

    Mari Kekkonen

    Full Text Available The accelerating loss of biodiversity has created a need for more effective ways to discover species. Novel algorithmic approaches for analyzing sequence data combined with rapidly expanding DNA barcode libraries provide a potential solution. While several analytical methods are available for the delineation of operational taxonomic units (OTUs, few studies have compared their performance. This study compares the performance of one morphology-based and four DNA-based (BIN, parsimony networks, ABGD, GMYC methods on two groups of gelechioid moths. It examines 92 species of Finnish Gelechiinae and 103 species of Australian Elachistinae which were delineated by traditional taxonomy. The results reveal a striking difference in performance between the two taxa with all four DNA-based methods. OTU counts in the Elachistinae showed a wider range and a relatively low (ca. 65% OTU match with reference species while OTU counts were more congruent and performance was higher (ca. 90% in the Gelechiinae. Performance rose when only monophyletic species were compared, but the taxon-dependence remained. None of the DNA-based methods produced a correct match with non-monophyletic species, but singletons were handled well. A simulated test of morphospecies-grouping performed very poorly in revealing taxon diversity in these small, dull-colored moths. Despite the strong performance of analyses based on DNA barcodes, species delineated using single-locus mtDNA data are best viewed as OTUs that require validation by subsequent integrative taxonomic work.

  13. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  14. An integrated web medicinal materials DNA database: MMDBD (Medicinal Materials DNA Barcode Database

    Directory of Open Access Journals (Sweden)

    But Paul

    2010-06-01

    Full Text Available Abstract Background Thousands of plants and animals possess pharmacological properties and there is an increased interest in using these materials for therapy and health maintenance. Efficacies of the application is critically dependent on the use of genuine materials. For time to time, life-threatening poisoning is found because toxic adulterant or substitute is administered. DNA barcoding provides a definitive means of authentication and for conducting molecular systematics studies. Owing to the reduced cost in DNA authentication, the volume of the DNA barcodes produced for medicinal materials is on the rise and necessitates the development of an integrated DNA database. Description We have developed an integrated DNA barcode multimedia information platform- Medicinal Materials DNA Barcode Database (MMDBD for data retrieval and similarity search. MMDBD contains over 1000 species of medicinal materials listed in the Chinese Pharmacopoeia and American Herbal Pharmacopoeia. MMDBD also contains useful information of the medicinal material, including resources, adulterant information, medical parts, photographs, primers used for obtaining the barcodes and key references. MMDBD can be accessed at http://www.cuhk.edu.hk/icm/mmdbd.htm. Conclusions This work provides a centralized medicinal materials DNA barcode database and bioinformatics tools for data storage, analysis and exchange for promoting the identification of medicinal materials. MMDBD has the largest collection of DNA barcodes of medicinal materials and is a useful resource for researchers in conservation, systematic study, forensic and herbal industry.

  15. BOLDMirror: a global mirror system of DNA barcode data.

    Science.gov (United States)

    Liu, D; Liu, L; Guo, G; Wang, W; Sun, Q; Parani, M; Ma, J

    2013-11-01

    DNA barcoding is a novel concept for taxonomic identification using short, specific genetic markers and has been applied to study a large number of eukaryotes. The huge amount of data output generated by DNA barcoding requires well-organized information systems. Besides the Barcode of Life Data system (BOLD) established in Canada, the mirror system is also important for the international barcode of life project (iBOL). For this purpose, we developed the BOLDMirror, a global mirror system of DNA barcode data. It is open-sourced and can run on the LAMP (Linux + Apache + MySQL + PHP) environment. BOLDMirror has data synchronization, data representation and statistics modules, and also provides spaces to store user operation history. BOLDMirror can be accessed at http://www.boldmirror.net and several countries have used it to setup their site of DNA barcoding. © 2012 John Wiley & Sons Ltd.

  16. DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

    Science.gov (United States)

    Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

    2014-01-01

    Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

  17. A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

    Science.gov (United States)

    Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

    2015-10-30

    Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

  18. Photocleavable DNA Barcoding Antibodies for Multiplexed Protein Analysis in Single Cells.

    Science.gov (United States)

    Ullal, Adeeti V; Weissleder, Ralph

    2015-01-01

    We describe a DNA-barcoded antibody sensing technique for single cell protein analysis in which the barcodes are photocleaved and digitally detected without amplification steps (Ullal et al., Sci Transl Med 6:219, 2014). After photocleaving the unique ~70 mer DNA barcodes we use a fluorescent hybridization technology for detection, similar to what is commonly done for nucleic acid readouts. This protocol offers a simple method for multiplexed protein detection using 100+ antibodies and can be performed on clinical samples as well as single cells.

  19. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  20. Exploring the utility of DNA barcoding in species delimitation of Polypedilum (Tripodura) non-biting midges (Diptera: Chironomidae).

    Science.gov (United States)

    Song, Chao; Wang, Qian; Zhang, Ruilei; Sun, Bingjiao; Wang, Xinhua

    2016-02-16

    In this study, we tested the utility of the mitochondrial gene cytochrome c oxidase subunit 1 (CO1) as the barcode region to deal with taxonomical problems of Polypedilum (Tripodura) non-biting midges (Diptera: Chironomidae). The 114 DNA barcodes representing 27 morphospecies are divided into 33 well separated clusters based on both Neighbor Joining and Maximum Likelihood methods. DNA barcodes revealed an 82% success rate in matching with morphospecies. The selected DNA barcode data support 37-64 operational taxonomic units (OTUs) based on the methods of Automatic Barcode Gap Discovery (ABGD) and Poisson Tree Process (PTP). Furthermore, a priori species based on consistent phenotypic variations were attested by molecular analysis, and a taxonomical misidentification of barcode sequences from GenBank was found. We could not observe a distinct barcode gap but an overlap ranged from 9-12%. Our results supported DNA barcoding as an ideal method to detect cryptic species, delimit sibling species, and associate different life stages in non-biting midges.

  1. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  2. The Barcode of Life Data Portal: Bridging the Biodiversity Informatics Divide for DNA Barcoding

    Science.gov (United States)

    Sarkar, Indra Neil; Trizna, Michael

    2011-01-01

    With the volume of molecular sequence data that is systematically being generated globally, there is a need for centralized resources for data exploration and analytics. DNA Barcode initiatives are on track to generate a compendium of molecular sequence–based signatures for identifying animals and plants. To date, the range of available data exploration and analytic tools to explore these data have only been available in a boutique form—often representing a frustrating hurdle for many researchers that may not necessarily have resources to install or implement algorithms described by the analytic community. The Barcode of Life Data Portal (BDP) is a first step towards integrating the latest biodiversity informatics innovations with molecular sequence data from DNA barcoding. Through establishment of community driven standards, based on discussion with the Data Analysis Working Group (DAWG) of the Consortium for the Barcode of Life (CBOL), the BDP provides an infrastructure for incorporation of existing and next-generation DNA barcode analytic applications in an open forum. PMID:21818249

  3. A laboratory information management system for DNA barcoding workflows

    NARCIS (Netherlands)

    Vu, D.; Eberhardt, U.; Szöke, S.; Groenewald, M.; Robert, V.

    2012-01-01

    This paper presents a laboratory information management system for DNA sequences (LIMS) created and based on the needs of a DNA barcoding project at the CBS-KNAW Fungal Biodiversity Centre (Utrecht, the Netherlands). DNA barcoding is a global initiative for species identification through simple DNA

  4. DNA barcoding as a means for identifying medicinal plants of Pakistan

    International Nuclear Information System (INIS)

    Schori, M.; Showalter, A.M.

    2011-01-01

    DNA barcoding involves the generation of DNA sequencing data from particular genetic regions in an organism and the use of these sequence data to identify or 'barcode' that organism and distinguish it from other species. Here, DNA barcoding is being used to identify several medicinal plants found in Pakistan and distinguished them from other similar species. Several challenges to the successful implementation of plant DNA barcoding are presented and discussed. Despite these challenges, DNA barcoding has the potential to uniquely identify medicinal plants and provide quality control and standardization of the plant material supplied to the pharmaceutical industry. (author)

  5. Detection of tyrosine hydroxylase in dopaminergic neuron cell using gold nanoparticles-based barcode DNA.

    Science.gov (United States)

    An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo

    2013-04-01

    Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.

  6. DNA Barcoding Investigations Bring Biology to Life

    Science.gov (United States)

    Musante, Susan

    2010-01-01

    This article describes how DNA barcoding investigations bring biology to life. Biologists recognize the power of DNA barcoding not just to teach biology through connections to the real world but also to immerse students in the exciting process of science. As an investigator in the Program for the Human Environment at Rockefeller University in New…

  7. DNA barcodes for ecology, evolution, and conservation.

    Science.gov (United States)

    Kress, W John; García-Robledo, Carlos; Uriarte, Maria; Erickson, David L

    2015-01-01

    The use of DNA barcodes, which are short gene sequences taken from a standardized portion of the genome and used to identify species, is entering a new phase of application as more and more investigations employ these genetic markers to address questions relating to the ecology and evolution of natural systems. The suite of DNA barcode markers now applied to specific taxonomic groups of organisms are proving invaluable for understanding species boundaries, community ecology, functional trait evolution, trophic interactions, and the conservation of biodiversity. The application of next-generation sequencing (NGS) technology will greatly expand the versatility of DNA barcodes across the Tree of Life, habitats, and geographies as new methodologies are explored and developed. Published by Elsevier Ltd.

  8. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    Science.gov (United States)

    Zhang, Ai-bing; Feng, Jie; Ward, Robert D; Wan, Ping; Gao, Qiang; Wu, Jun; Zhao, Wei-zhong

    2012-01-01

    Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI) region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS) genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF) to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish) and two representing non-coding ITS barcodes (rust fungi and brown algae). Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ) and Maximum likelihood (ML) methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI) of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40%) for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37%) for 1094 brown algae queries, both using ITS barcodes.

  9. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    Directory of Open Access Journals (Sweden)

    Ai-bing Zhang

    Full Text Available Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish and two representing non-coding ITS barcodes (rust fungi and brown algae. Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ and Maximum likelihood (ML methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40% for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37% for 1094 brown algae queries, both using ITS barcodes.

  10. Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices

    Science.gov (United States)

    Yan, Hao; Labean, Thomas H.; Feng, Liping; Reif, John H.

    2003-07-01

    The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping.

  11. Increasing global participation in genetics research through DNA barcoding.

    Science.gov (United States)

    Adamowicz, Sarah J; Steinke, Dirk

    2015-12-01

    DNA barcoding--the sequencing of short, standardized DNA regions for specimen identification and species discovery--has promised to facilitate rapid access to biodiversity knowledge by diverse users. Here, we advance our opinion that increased global participation in genetics research is beneficial, both to scientists and for science, and explore the premise that DNA barcoding can help to democratize participation in genetics research. We examine publication patterns (2003-2014) in the DNA barcoding literature and compare trends with those in the broader, related domain of genomics. While genomics is the older and much larger field, the number of nations contributing to the published literature is similar between disciplines. Meanwhile, DNA barcoding exhibits a higher pace of growth in the number of publications as well as greater evenness among nations in their proportional contribution to total authorships. This exploration revealed DNA barcoding to be a highly international discipline, with growing participation by researchers in especially biodiverse nations. We briefly consider several of the challenges that may hinder further participation in genetics research, including access to training and molecular facilities as well as policy relating to the movement of genetic resources.

  12. Wolbachia and DNA barcoding insects: patterns, potential, and problems.

    Science.gov (United States)

    Smith, M Alex; Bertrand, Claudia; Crosby, Kate; Eveleigh, Eldon S; Fernandez-Triana, Jose; Fisher, Brian L; Gibbs, Jason; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hind, Katharine; Hrcek, Jan; Huang, Da-Wei; Janda, Milan; Janzen, Daniel H; Li, Yanwei; Miller, Scott E; Packer, Laurence; Quicke, Donald; Ratnasingham, Sujeevan; Rodriguez, Josephine; Rougerie, Rodolphe; Shaw, Mark R; Sheffield, Cory; Stahlhut, Julie K; Steinke, Dirk; Whitfield, James; Wood, Monty; Zhou, Xin

    2012-01-01

    Wolbachia is a genus of bacterial endosymbionts that impacts the breeding systems of their hosts. Wolbachia can confuse the patterns of mitochondrial variation, including DNA barcodes, because it influences the pathways through which mitochondria are inherited. We examined the extent to which these endosymbionts are detected in routine DNA barcoding, assessed their impact upon the insect sequence divergence and identification accuracy, and considered the variation present in Wolbachia COI. Using both standard PCR assays (Wolbachia surface coding protein--wsp), and bacterial COI fragments we found evidence of Wolbachia in insect total genomic extracts created for DNA barcoding library construction. When >2 million insect COI trace files were examined on the Barcode of Life Datasystem (BOLD) Wolbachia COI was present in 0.16% of the cases. It is possible to generate Wolbachia COI using standard insect primers; however, that amplicon was never confused with the COI of the host. Wolbachia alleles recovered were predominantly Supergroup A and were broadly distributed geographically and phylogenetically. We conclude that the presence of the Wolbachia DNA in total genomic extracts made from insects is unlikely to compromise the accuracy of the DNA barcode library; in fact, the ability to query this DNA library (the database and the extracts) for endosymbionts is one of the ancillary benefits of such a large scale endeavor--which we provide several examples. It is our conclusion that regular assays for Wolbachia presence and type can, and should, be adopted by large scale insect barcoding initiatives. While COI is one of the five multi-locus sequence typing (MLST) genes used for categorizing Wolbachia, there is limited overlap with the eukaryotic DNA barcode region.

  13. Species-specific identification from incomplete sampling: applying DNA barcodes to monitoring invasive solanum plants.

    Science.gov (United States)

    Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong

    2013-01-01

    Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.

  14. DNA barcoding for species assignment: the case of Mediterranean marine fishes.

    Directory of Open Access Journals (Sweden)

    Monica Landi

    Full Text Available DNA barcoding enhances the prospects for species-level identifications globally using a standardized and authenticated DNA-based approach. Reference libraries comprising validated DNA barcodes (COI constitute robust datasets for testing query sequences, providing considerable utility to identify marine fish and other organisms. Here we test the feasibility of using DNA barcoding to assign species to tissue samples from fish collected in the central Mediterranean Sea, a major contributor to the European marine ichthyofaunal diversity.A dataset of 1278 DNA barcodes, representing 218 marine fish species, was used to test the utility of DNA barcodes to assign species from query sequences. We tested query sequences against 1 a reference library of ranked DNA barcodes from the neighbouring North East Atlantic, and 2 the public databases BOLD and GenBank. In the first case, a reference library comprising DNA barcodes with reliability grades for 146 fish species was used as diagnostic dataset to screen 486 query DNA sequences from fish specimens collected in the central basin of the Mediterranean Sea. Of all query sequences suitable for comparisons 98% were unambiguously confirmed through complete match with reference DNA barcodes. In the second case, it was possible to assign species to 83% (BOLD-IDS and 72% (GenBank of the sequences from the Mediterranean. Relatively high intraspecific genetic distances were found in 7 species (2.2%-18.74%, most of them of high commercial relevance, suggesting possible cryptic species.We emphasize the discriminatory power of COI barcodes and their application to cases requiring species level resolution starting from query sequences. Results highlight the value of public reference libraries of reliability grade-annotated DNA barcodes, to identify species from different geographical origins. The ability to assign species with high precision from DNA samples of disparate quality and origin has major utility in several

  15. [DNA barcoding and its utility in commonly-used medicinal snakes].

    Science.gov (United States)

    Huang, Yong; Zhang, Yue-yun; Zhao, Cheng-jian; Xu, Yong-li; Gu, Ying-le; Huang, Wen-qi; Lin, Kui; Li, Li

    2015-03-01

    Identification accuracy of traditional Chinese medicine is crucial for the traditional Chinese medicine research, production and application. DNA barcoding based on the mitochondrial gene coding for cytochrome c oxidase subunit I (COI), are more and more used for identification of traditional Chinese medicine. Using universal barcoding primers to sequence, we discussed the feasibility of DNA barcoding method for identification commonly-used medicinal snakes (a total of 109 samples belonging to 19 species 15 genera 6 families). The phylogenetic trees using Neighbor-joining were constructed. The results indicated that the mean content of G + C(46.5%) was lower than that of A + T (53.5%). As calculated by Kimera-2-parameter model, the mean intraspecies genetic distance of Trimeresurus albolabris, Ptyas dhumnades and Lycodon rufozonatus was greater than 2%. Further phylogenetic relationship results suggested that identification of one sample of T. albolabris was erroneous. The identification of some samples of P. dhumnades was also not correct, namely originally P. korros was identified as P. dhumnades. Factors influence on intraspecific genetic distance difference of L. rufozonatus need to be studied further. Therefore, DNA barcoding for identification of medicinal snakes is feasible, and greatly complements the morphological classification method. It is necessary to further study in identification of traditional Chinese medicine.

  16. Plant DNA barcodes can accurately estimate species richness in poorly known floras.

    Science.gov (United States)

    Costion, Craig; Ford, Andrew; Cross, Hugh; Crayn, Darren; Harrington, Mark; Lowe, Andrew

    2011-01-01

    Widespread uptake of DNA barcoding technology for vascular plants has been slow due to the relatively poor resolution of species discrimination (∼70%) and low sequencing and amplification success of one of the two official barcoding loci, matK. Studies to date have mostly focused on finding a solution to these intrinsic limitations of the markers, rather than posing questions that can maximize the utility of DNA barcodes for plants with the current technology. Here we test the ability of plant DNA barcodes using the two official barcoding loci, rbcLa and matK, plus an alternative barcoding locus, trnH-psbA, to estimate the species diversity of trees in a tropical rainforest plot. Species discrimination accuracy was similar to findings from previous studies but species richness estimation accuracy proved higher, up to 89%. All combinations which included the trnH-psbA locus performed better at both species discrimination and richness estimation than matK, which showed little enhanced species discriminatory power when concatenated with rbcLa. The utility of the trnH-psbA locus is limited however, by the occurrence of intraspecific variation observed in some angiosperm families to occur as an inversion that obscures the monophyly of species. We demonstrate for the first time, using a case study, the potential of plant DNA barcodes for the rapid estimation of species richness in taxonomically poorly known areas or cryptic populations revealing a powerful new tool for rapid biodiversity assessment. The combination of the rbcLa and trnH-psbA loci performed better for this purpose than any two-locus combination that included matK. We show that although DNA barcodes fail to discriminate all species of plants, new perspectives and methods on biodiversity value and quantification may overshadow some of these shortcomings by applying barcode data in new ways.

  17. Systematic identification of African Sapindaceae using DNA barcoding

    African Journals Online (AJOL)

    This research aimed at exploring the diversity of Sapindaceae in West and Central Africa with particular emphasis on identification of the plant samples as well as generation of DNA barcodes with a view to sharing the DNA barcode sequence(s) in a public database. These were achieved following standard protocols.

  18. Large-scale DNA Barcode Library Generation for Biomolecule Identification in High-throughput Screens.

    Science.gov (United States)

    Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio

    2017-10-24

    High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.

  19. Pitfalls of establishing DNA barcoding systems in protists: the cryptophyceae as a test case.

    Science.gov (United States)

    Hoef-Emden, Kerstin

    2012-01-01

    A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5'-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene). In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC), have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed.

  20. Pitfalls of establishing DNA barcoding systems in protists: the cryptophyceae as a test case.

    Directory of Open Access Journals (Sweden)

    Kerstin Hoef-Emden

    Full Text Available A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5'-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene. In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC, have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed.

  1. Pitfalls of Establishing DNA Barcoding Systems in Protists: The Cryptophyceae as a Test Case

    Science.gov (United States)

    Hoef-Emden, Kerstin

    2012-01-01

    A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5′-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene). In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC), have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed. PMID:22970104

  2. DNA barcoding as a screening tool for cryptic diversity

    DEFF Research Database (Denmark)

    Huemer, Peter; Karsholt, Ole; Mutanen, Marko

    2014-01-01

    We explore the potential value of DNA barcode divergence for species delimitation in the genus Caryocolum Gregor & Povolný, 1954 (Lepidoptera, Gelechiidae), based on data from 44 European species (including 4 subspecies). Low intraspecific divergence of the DNA barcodes of the mtCOI (cytochrome c...... oxidase 1) gene and/or distinct barcode gaps to the nearest neighbor support species status for all examined nominal taxa. However, in 8 taxa we observed deep splits with a maximum intraspecific barcode divergence beyond a threshold of 3%, thus indicating possible cryptic diversity. The taxonomy...

  3. Critical factors for assembling a high volume of DNA barcodes

    Science.gov (United States)

    Hajibabaei, Mehrdad; deWaard, Jeremy R; Ivanova, Natalia V; Ratnasingham, Sujeevan; Dooh, Robert T; Kirk, Stephanie L; Mackie, Paula M; Hebert, Paul D.N

    2005-01-01

    Large-scale DNA barcoding projects are now moving toward activation while the creation of a comprehensive barcode library for eukaryotes will ultimately require the acquisition of some 100 million barcodes. To satisfy this need, analytical facilities must adopt protocols that can support the rapid, cost-effective assembly of barcodes. In this paper we discuss the prospects for establishing high volume DNA barcoding facilities by evaluating key steps in the analytical chain from specimens to barcodes. Alliances with members of the taxonomic community represent the most effective strategy for provisioning the analytical chain with specimens. The optimal protocols for DNA extraction and subsequent PCR amplification of the barcode region depend strongly on their condition, but production targets of 100K barcode records per year are now feasible for facilities working with compliant specimens. The analysis of museum collections is currently challenging, but PCR cocktails that combine polymerases with repair enzyme(s) promise future success. Barcode analysis is already a cost-effective option for species identification in some situations and this will increasingly be the case as reference libraries are assembled and analytical protocols are simplified. PMID:16214753

  4. The Hemiptera (Insecta) of Canada: Constructing a Reference Library of DNA Barcodes

    Science.gov (United States)

    Gwiazdowski, Rodger A.; Foottit, Robert G.; Maw, H. Eric L.; Hebert, Paul D. N.

    2015-01-01

    DNA barcode reference libraries linked to voucher specimens create new opportunities for high-throughput identification and taxonomic re-evaluations. This study provides a DNA barcode library for about 45% of the recognized species of Canadian Hemiptera, and the publically available R workflow used for its generation. The current library is based on the analysis of 20,851 specimens including 1849 species belonging to 628 genera and 64 families. These individuals were assigned to 1867 Barcode Index Numbers (BINs), sequence clusters that often coincide with species recognized through prior taxonomy. Museum collections were a key source for identified specimens, but we also employed high-throughput collection methods that generated large numbers of unidentified specimens. Many of these specimens represented novel BINs that were subsequently identified by taxonomists, adding barcode coverage for additional species. Our analyses based on both approaches includes 94 species not listed in the most recent Canadian checklist, representing a potential 3% increase in the fauna. We discuss the development of our workflow in the context of prior DNA barcode library construction projects, emphasizing the importance of delineating a set of reference specimens to aid investigations in cases of nomenclatural and DNA barcode discordance. The identification for each specimen in the reference set can be annotated on the Barcode of Life Data System (BOLD), allowing experts to highlight questionable identifications; annotations can be added by any registered user of BOLD, and instructions for this are provided. PMID:25923328

  5. Identification of Neoceratitis asiatica (Becker) (Diptera: Tephritidae) based on morphological characteristics and DNA barcode.

    Science.gov (United States)

    Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong

    2017-12-12

    Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.

  6. The seven deadly sins of DNA barcoding.

    Science.gov (United States)

    Collins, R A; Cruickshank, R H

    2013-11-01

    Despite the broad benefits that DNA barcoding can bring to a diverse range of biological disciplines, a number of shortcomings still exist in terms of the experimental design of studies incorporating this approach. One underlying reason for this lies in the confusion that often exists between species discovery and specimen identification, and this is reflected in the way that hypotheses are generated and tested. Although these aims can be associated, they are quite distinct and require different methodological approaches, but their conflation has led to the frequently inappropriate use of commonly used analytical methods such as neighbour-joining trees, bootstrap resampling and fixed distance thresholds. Furthermore, the misidentification of voucher specimens can also have serious implications for end users of reference libraries such as the Barcode of Life Data Systems, and in this regard we advocate increased diligence in the a priori identification of specimens to be used for this purpose. This commentary provides an assessment of seven deficiencies that we identify as common in the DNA barcoding literature, and outline some potential improvements for its adaptation and adoption towards more reliable and accurate outcomes. © 2012 John Wiley & Sons Ltd.

  7. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  8. Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia

    Directory of Open Access Journals (Sweden)

    Jonathan Marescaux

    2013-12-01

    Full Text Available The zebra mussel (Dreissena polymorpha and the quagga mussel (Dreissena rostriformis bugensis are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit 1 mitochondrial gene (COI is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.

  9. Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia).

    Science.gov (United States)

    Marescaux, Jonathan; Van Doninck, Karine

    2013-12-30

    The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.

  10. Application of DNA barcodes in wildlife conservation in Tropical East Asia.

    Science.gov (United States)

    Wilson, John-James; Sing, Kong-Wah; Lee, Ping-Shin; Wee, Alison K S

    2016-10-01

    Over the past 50 years, Tropical East Asia has lost more biodiversity than any tropical region. Tropical East Asia is a megadiverse region with an acute taxonomic impediment. DNA barcodes are short standardized DNA sequences used for taxonomic purposes and have the potential to lessen the challenges of biodiversity inventory and assessments in regions where they are most needed. We reviewed DNA barcoding efforts in Tropical East Asia relative to other tropical regions. We suggest DNA barcodes (or metabarcodes from next-generation sequencers) may be especially useful for characterizing and connecting species-level biodiversity units in inventories encompassing taxa lacking formal description (particularly arthropods) and in large-scale, minimal-impact approaches to vertebrate monitoring and population assessments through secondary sources of DNA (invertebrate derived DNA and environmental DNA). We suggest interest and capacity for DNA barcoding are slowly growing in Tropical East Asia, particularly among the younger generation of researchers who can connect with the barcoding analogy and understand the need for new approaches to the conservation challenges being faced. © 2016 Society for Conservation Biology.

  11. ITS1: a DNA barcode better than ITS2 in eukaryotes?

    Science.gov (United States)

    Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

    2015-05-01

    A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

  12. Contribution towards the development of a DNA barcode reference ...

    African Journals Online (AJOL)

    DNA barcoding is a widely used molecular approach for species cataloging for unambiguous identification and conservation. In the present study, DNA barcoding of some West African mammals were performed with six new mitochondrial CO1 sequences for Civettictis civetta, Tadarida nigeriae, Orycteropus afer, ...

  13. Neotropical bats: estimating species diversity with DNA barcodes.

    Directory of Open Access Journals (Sweden)

    Elizabeth L Clare

    Full Text Available DNA barcoding using the cytochrome c oxidase subunit 1 gene (COI is frequently employed as an efficient method of species identification in animal life and may also be used to estimate species richness, particularly in understudied faunas. Despite numerous past demonstrations of the efficiency of this technique, few studies have attempted to employ DNA barcoding methodologies on a large geographic scale, particularly within tropical regions. In this study we survey current and potential species diversity using DNA barcodes with a collection of more than 9000 individuals from 163 species of Neotropical bats (order Chiroptera. This represents one of the largest surveys to employ this strategy on any animal group and is certainly the largest to date for land vertebrates. Our analysis documents the utility of this tool over great geographic distances and across extraordinarily diverse habitats. Among the 163 included species 98.8% possessed distinct sets of COI haplotypes making them easily recognizable at this locus. We detected only a single case of shared haplotypes. Intraspecific diversity in the region was high among currently recognized species (mean of 1.38%, range 0-11.79% with respect to birds, though comparable to other bat assemblages. In 44 of 163 cases, well-supported, distinct intraspecific lineages were identified which may suggest the presence of cryptic species though mean and maximum intraspecific divergence were not good predictors of their presence. In all cases, intraspecific lineages require additional investigation using complementary molecular techniques and additional characters such as morphology and acoustic data. Our analysis provides strong support for the continued assembly of DNA barcoding libraries and ongoing taxonomic investigation of bats.

  14. Plant DNA barcodes can accurately estimate species richness in poorly known floras.

    Directory of Open Access Journals (Sweden)

    Craig Costion

    Full Text Available BACKGROUND: Widespread uptake of DNA barcoding technology for vascular plants has been slow due to the relatively poor resolution of species discrimination (∼70% and low sequencing and amplification success of one of the two official barcoding loci, matK. Studies to date have mostly focused on finding a solution to these intrinsic limitations of the markers, rather than posing questions that can maximize the utility of DNA barcodes for plants with the current technology. METHODOLOGY/PRINCIPAL FINDINGS: Here we test the ability of plant DNA barcodes using the two official barcoding loci, rbcLa and matK, plus an alternative barcoding locus, trnH-psbA, to estimate the species diversity of trees in a tropical rainforest plot. Species discrimination accuracy was similar to findings from previous studies but species richness estimation accuracy proved higher, up to 89%. All combinations which included the trnH-psbA locus performed better at both species discrimination and richness estimation than matK, which showed little enhanced species discriminatory power when concatenated with rbcLa. The utility of the trnH-psbA locus is limited however, by the occurrence of intraspecific variation observed in some angiosperm families to occur as an inversion that obscures the monophyly of species. CONCLUSIONS/SIGNIFICANCE: We demonstrate for the first time, using a case study, the potential of plant DNA barcodes for the rapid estimation of species richness in taxonomically poorly known areas or cryptic populations revealing a powerful new tool for rapid biodiversity assessment. The combination of the rbcLa and trnH-psbA loci performed better for this purpose than any two-locus combination that included matK. We show that although DNA barcodes fail to discriminate all species of plants, new perspectives and methods on biodiversity value and quantification may overshadow some of these shortcomings by applying barcode data in new ways.

  15. Identifying Fishes through DNA Barcodes and Microarrays.

    Directory of Open Access Journals (Sweden)

    Marc Kochzius

    2010-09-01

    Full Text Available International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection.This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S, cytochrome b (cyt b, and cytochrome oxidase subunit I (COI for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90% renders the DNA barcoding marker as rather unsuitable for this high-throughput technology.Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

  16. INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

    Science.gov (United States)

    Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

    2016-01-01

    DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

  17. A dual amplification strategy for DNA detection combining bio-barcode assay and metal-enhanced fluorescence modality.

    Science.gov (United States)

    Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na

    2014-11-11

    Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.

  18. Evaluating Ethanol-based Sample Preservation to Facilitate Use of DNA Barcoding in Routine Freshwater Biomonitoring Programs Using Benthic Macroinvertebrates

    Science.gov (United States)

    Molecular methods, such as DNA barcoding, have the potential in enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biom...

  19. DNA barcoding the native flowering plants and conifers of Wales.

    Directory of Open Access Journals (Sweden)

    Natasha de Vere

    Full Text Available We present the first national DNA barcode resource that covers the native flowering plants and conifers for the nation of Wales (1143 species. Using the plant DNA barcode markers rbcL and matK, we have assembled 97.7% coverage for rbcL, 90.2% for matK, and a dual-locus barcode for 89.7% of the native Welsh flora. We have sampled multiple individuals for each species, resulting in 3304 rbcL and 2419 matK sequences. The majority of our samples (85% are from DNA extracted from herbarium specimens. Recoverability of DNA barcodes is lower using herbarium specimens, compared to freshly collected material, mostly due to lower amplification success, but this is balanced by the increased efficiency of sampling species that have already been collected, identified, and verified by taxonomic experts. The effectiveness of the DNA barcodes for identification (level of discrimination is assessed using four approaches: the presence of a barcode gap (using pairwise and multiple alignments, formation of monophyletic groups using Neighbour-Joining trees, and sequence similarity in BLASTn searches. These approaches yield similar results, providing relative discrimination levels of 69.4 to 74.9% of all species and 98.6 to 99.8% of genera using both markers. Species discrimination can be further improved using spatially explicit sampling. Mean species discrimination using barcode gap analysis (with a multiple alignment is 81.6% within 10×10 km squares and 93.3% for 2×2 km squares. Our database of DNA barcodes for Welsh native flowering plants and conifers represents the most complete coverage of any national flora, and offers a valuable platform for a wide range of applications that require accurate species identification.

  20. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    Science.gov (United States)

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  1. Molecular barcoding, DNA from snake venom, and toxinological research: Considerations and concerns.

    Science.gov (United States)

    Powell, Randy L; Reyes, Steven R; Lannutti, Dominic I

    2006-12-15

    The problem of species identification in toxinological research and solutions such as molecular barcoding and DNA extraction from venom samples are addressed. Molecular barcoding is controversial with both perceived advantages and inherent problems. A method of species identification utilizing mitochondrial DNA from venom has been identified. This method could result in deemphasizing the importance of obtaining detailed information on the venom source prior to analysis. Additional concerns include; a cost prohibitive factor, intraspecific venom variation, and venom processing issues. As researchers demand more stringent records and verification, venom suppliers may be prompted to implement improved methods and controls.

  2. Evaluation of the efficacy of twelve mitochondrial protein-coding genes as barcodes for mollusk DNA barcoding.

    Science.gov (United States)

    Yu, Hong; Kong, Lingfeng; Li, Qi

    2016-01-01

    In this study, we evaluated the efficacy of 12 mitochondrial protein-coding genes from 238 mitochondrial genomes of 140 molluscan species as potential DNA barcodes for mollusks. Three barcoding methods (distance, monophyly and character-based methods) were used in species identification. The species recovery rates based on genetic distances for the 12 genes ranged from 70.83 to 83.33%. There were no significant differences in intra- or interspecific variability among the 12 genes. The monophyly and character-based methods provided higher resolution than the distance-based method in species delimitation. Especially in closely related taxa, the character-based method showed some advantages. The results suggested that besides the standard COI barcode, other 11 mitochondrial protein-coding genes could also be potentially used as a molecular diagnostic for molluscan species discrimination. Our results also showed that the combination of mitochondrial genes did not enhance the efficacy for species identification and a single mitochondrial gene would be fully competent.

  3. DNA Barcoding and PBL in an Australian Postsecondary College

    Science.gov (United States)

    Cross, Joseph; Garard, Helen; Currie, Tina

    2018-01-01

    DNA barcoding is increasingly being introduced into biological science educational curricula worldwide. The technique has a number of features that make it ideal for science curricula and particularly for Project-Based Learning (PBL). This report outlines the development of a DNA barcoding project in an Australian TAFE college, which also combined…

  4. BOKP: A DNA Barcode Reference Library for Monitoring Herbal Drugs in the Korean Pharmacopeia

    Directory of Open Access Journals (Sweden)

    Jinxin Liu

    2017-12-01

    Full Text Available Herbal drug authentication is an important task in traditional medicine; however, it is challenged by the limitations of traditional authentication methods and the lack of trained experts. DNA barcoding is conspicuous in almost all areas of the biological sciences and has already been added to the British pharmacopeia and Chinese pharmacopeia for routine herbal drug authentication. However, DNA barcoding for the Korean pharmacopeia still requires significant improvements. Here, we present a DNA barcode reference library for herbal drugs in the Korean pharmacopeia and developed a species identification engine named KP-IDE to facilitate the adoption of this DNA reference library for the herbal drug authentication. Using taxonomy records, specimen records, sequence records, and reference records, KP-IDE can identify an unknown specimen. Currently, there are 6,777 taxonomy records, 1,054 specimen records, 30,744 sequence records (ITS2 and psbA-trnH and 285 reference records. Moreover, 27 herbal drug materials were collected from the Seoul Yangnyeongsi herbal medicine market to give an example for real herbal drugs authentications. Our study demonstrates the prospects of the DNA barcode reference library for the Korean pharmacopeia and provides future directions for the use of DNA barcoding for authenticating herbal drugs listed in other modern pharmacopeias.

  5. Design of 240,000 orthogonal 25mer DNA barcode probes.

    Science.gov (United States)

    Xu, Qikai; Schlabach, Michael R; Hannon, Gregory J; Elledge, Stephen J

    2009-02-17

    DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications.

  6. DNA barcode authentication of saw palmetto herbal dietary supplements.

    Science.gov (United States)

    Little, Damon P; Jeanson, Marc L

    2013-12-17

    Herbal dietary supplements made from saw palmetto (Serenoa repens; Arecaceae) fruit are commonly consumed to ameliorate benign prostate hyperplasia. A novel DNA mini-barcode assay to accurately identify [specificity = 1.00 (95% confidence interval = 0.74-1.00); sensitivity = 1.00 (95% confidence interval = 0.66-1.00); n = 31] saw palmetto dietary supplements was designed from a DNA barcode reference library created for this purpose. The mini-barcodes were used to estimate the frequency of mislabeled saw palmetto herbal dietary supplements on the market in the United States of America. Of the 37 supplements examined, amplifiable DNA could be extracted from 34 (92%). Mini-barcode analysis of these supplements demonstrated that 29 (85%) contain saw palmetto and that 2 (6%) supplements contain related species that cannot be legally sold as herbal dietary supplements in the United States of America. The identity of 3 (9%) supplements could not be conclusively determined.

  7. A laboratory information management system for DNA barcoding workflows.

    Science.gov (United States)

    Vu, Thuy Duong; Eberhardt, Ursula; Szöke, Szániszló; Groenewald, Marizeth; Robert, Vincent

    2012-07-01

    This paper presents a laboratory information management system for DNA sequences (LIMS) created and based on the needs of a DNA barcoding project at the CBS-KNAW Fungal Biodiversity Centre (Utrecht, the Netherlands). DNA barcoding is a global initiative for species identification through simple DNA sequence markers. We aim at generating barcode data for all strains (or specimens) included in the collection (currently ca. 80 k). The LIMS has been developed to better manage large amounts of sequence data and to keep track of the whole experimental procedure. The system has allowed us to classify strains more efficiently as the quality of sequence data has improved, and as a result, up-to-date taxonomic names have been given to strains and more accurate correlation analyses have been carried out.

  8. Identification of processed Chinese medicinal materials using DNA mini-barcoding.

    Science.gov (United States)

    Song, Ming; Dong, Gang-Qiang; Zhang, Ya-Qin; Liu, Xia; Sun, Wei

    2017-07-01

    Most of Chinese medicinal herbs are subjected to traditional processing procedures, including stir-frying, charring, steaming, boiling, and calcining before they are released into dispensaries. The marketing and identification of processed medicinal materials is a growing issue in the marketplace. However, conventional methods of identification have limitations, while DNA mini-barcoding, based on the sequencing of a short-standardized region, has received considerable attention as a new potential means to identify processed medicinal materials. In the present study, six DNA barcode loci including ITS2, psbA-trnH, rbcL, matK, trnL (UAA) intron and its P6 loop, were employed for the authentication of 45 processed samples belonging to 15 species. We evaluated the amplification efficiency of each locus. We also examined the identification accuracy of the potential mini-barcode locus, of trnL (UAA) intron P6 loop. Our results showed that the five primary barcode loci were successfully amplified in only 8.89%-20% of the processed samples, while the amplification rates of the trnL (UAA) intron P6 loop were higher, at 75.56% successful amplification. We compared the mini-barcode sequences with Genbank using the Blast program. The analysis showed that 45.23% samples could be identified to genus level, while only one sample could be identified to the species level. We conclude that trnL (UAA) p6 loop is a candidate mini-barcode that has shown its potential and may become a universal mini-barcode as complementary barcode for authenticity testing and will play an important role in medicinal materials control. Copyright © 2017 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  9. DNA barcoding in the media: does coverage of cool science reflect its social context?

    Science.gov (United States)

    Geary, Janis; Camicioli, Emma; Bubela, Tania

    2016-09-01

    Paul Hebert and colleagues first described DNA barcoding in 2003, which led to international efforts to promote and coordinate its use. Since its inception, DNA barcoding has generated considerable media coverage. We analysed whether this coverage reflected both the scientific and social mandates of international barcoding organizations. We searched newspaper databases to identify 900 English-language articles from 2003 to 2013. Coverage of the science of DNA barcoding was highly positive but lacked context for key topics. Coverage omissions pose challenges for public understanding of the science and applications of DNA barcoding; these included coverage of governance structures and issues related to the sharing of genetic resources across national borders. Our analysis provided insight into how barcoding communication efforts have translated into media coverage; more targeted communication efforts may focus media attention on previously omitted, but important topics. Our analysis is timely as the DNA barcoding community works to establish the International Society for the Barcode of Life.

  10. Assessment of mangroves from Goa, west coast India using DNA barcode.

    Science.gov (United States)

    Saddhe, Ankush Ashok; Jamdade, Rahul Arvind; Kumar, Kundan

    2016-01-01

    Mangroves are salt-tolerant forest ecosystems of tropical and subtropical intertidal regions. They are among most productive, diverse, biologically important ecosystem and inclined toward threatened system. Identification of mangrove species is of critical importance in conserving and utilizing biodiversity, which apparently hindered by a lack of taxonomic expertise. In recent years, DNA barcoding using plastid markers rbcL and matK has been suggested as an effective method to enrich traditional taxonomic expertise for rapid species identification and biodiversity inventories. In the present study, we performed assessment of available 14 mangrove species of Goa, west coast India based on core DNA barcode markers, rbcL and matK. PCR amplification success rate, intra- and inter-specific genetic distance variation and the correct identification percentage were taken into account to assess candidate barcode regions. PCR and sequence success rate were high in rbcL (97.7 %) and matK (95.5 %) region. The two candidate chloroplast barcoding regions (rbcL, matK) yielded barcode gaps. Our results clearly demonstrated that matK locus assigned highest correct identification rates (72.09 %) based on TaxonDNA Best Match criteria. The concatenated rbcL + matK loci were able to adequately discriminate all mangrove genera and species to some extent except those in Rhizophora, Sonneratia and Avicennia. Our study provides the first endorsement of the species resolution among mangroves using plastid genes with few exceptions. Our future work will be focused on evaluation of other barcode markers to delineate complete resolution of mangrove species and identification of putative hybrids.

  11. A DNA Barcode Library for Korean Chironomidae (Insecta: Diptera) and Indexes for Defining Barcode Gap

    Science.gov (United States)

    Kim, Sungmin; Song, Kyo-Hong; Ree, Han-Il; Kim, Won

    2012-01-01

    Non-biting midges (Diptera: Chironomidae) are a diverse population that commonly causes respiratory allergies in humans. Chironomid larvae can be used to indicate freshwater pollution, but accurate identification on the basis of morphological characteristics is difficult. In this study, we constructed a mitochondrial cytochrome c oxidase subunit I (COI)-based DNA barcode library for Korean chironomids. This library consists of 211 specimens from 49 species, including adults and unidentified larvae. The interspecies and intraspecies COI sequence variations were analyzed. Sophisticated indexes were developed in order to properly evaluate indistinct barcode gaps that are created by insufficient sampling on both the interspecies and intraspecies levels and by variable mutation rates across taxa. In a variety of insect datasets, these indexes were useful for re-evaluating large barcode datasets and for defining COI barcode gaps. The COI-based DNA barcode library will provide a rapid and reliable tool for the molecular identification of Korean chironomid species. Furthermore, this reverse-taxonomic approach will be improved by the continuous addition of other speceis’ sequences to the library. PMID:22138764

  12. DNA barcoding commercially important aquatic invertebrates of Turkey.

    Science.gov (United States)

    Keskin, Emre; Atar, Hasan Hüseyin

    2013-08-01

    DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.

  13. Community Phylogenetics: Assessing Tree Reconstruction Methods and the Utility of DNA Barcodes

    Science.gov (United States)

    Boyle, Elizabeth E.; Adamowicz, Sarah J.

    2015-01-01

    Studies examining phylogenetic community structure have become increasingly prevalent, yet little attention has been given to the influence of the input phylogeny on metrics that describe phylogenetic patterns of co-occurrence. Here, we examine the influence of branch length, tree reconstruction method, and amount of sequence data on measures of phylogenetic community structure, as well as the phylogenetic signal (Pagel’s λ) in morphological traits, using Trichoptera larval communities from Churchill, Manitoba, Canada. We find that model-based tree reconstruction methods and the use of a backbone family-level phylogeny improve estimations of phylogenetic community structure. In addition, trees built using the barcode region of cytochrome c oxidase subunit I (COI) alone accurately predict metrics of phylogenetic community structure obtained from a multi-gene phylogeny. Input tree did not alter overall conclusions drawn for phylogenetic signal, as significant phylogenetic structure was detected in two body size traits across input trees. As the discipline of community phylogenetics continues to expand, it is important to investigate the best approaches to accurately estimate patterns. Our results suggest that emerging large datasets of DNA barcode sequences provide a vast resource for studying the structure of biological communities. PMID:26110886

  14. DNA barcoding and traditional taxonomy: an integrated approach for biodiversity conservation.

    Science.gov (United States)

    Sheth, Bhavisha P; Thaker, Vrinda S

    2017-07-01

    Biological diversity is depleting at an alarming rate. Additionally, a vast amount of biodiversity still remains undiscovered. Taxonomy has been serving the purpose of describing, naming, and classifying species for more than 250 years. DNA taxonomy and barcoding have accelerated the rate of this process, thereby providing a tool for conservation practice. DNA barcoding and traditional taxonomy have their own inherent merits and demerits. The synergistic use of both methods, in the form of integrative taxonomy, has the potential to contribute to biodiversity conservation in a pragmatic timeframe and overcome their individual drawbacks. In this review, we discuss the basics of both these methods of biological identification (traditional taxonomy and DNA barcoding), the technical advances in integrative taxonomy, and future trends. We also present a comprehensive compilation of published examples of integrative taxonomy that refer to nine topics within biodiversity conservation. Morphological and molecular species limits were observed to be congruent in ∼41% of the 58 source studies. The majority of the studies highlighted the description of cryptic diversity through the use of molecular data, whereas research areas like endemism, biological invasion, and threatened species were less discussed in the literature.

  15. Mitochondrial heteroplasmy and DNA barcoding in Hawaiian Hylaeus (Nesoprosopis bees (Hymenoptera: Colletidae

    Directory of Open Access Journals (Sweden)

    Magnacca Karl N

    2010-06-01

    Full Text Available Abstract Background The past several years have seen a flurry of papers seeking to clarify the utility and limits of DNA barcoding, particularly in areas such as species discovery and paralogy due to nuclear pseudogenes. Heteroplasmy, the coexistence of multiple mitochondrial haplotypes in a single organism, has been cited as a potentially serious problem for DNA barcoding but its effect on identification accuracy has not been tested. In addition, few studies of barcoding have tested a large group of closely-related species with a well-established morphological taxonomy. In this study we examine both of these issues, by densely sampling the Hawaiian Hylaeus bee radiation. Results Individuals from 21 of the 49 a priori morphologically-defined species exhibited coding sequence heteroplasmy at levels of 1-6% or more. All homoplasmic species were successfully identified by COI using standard methods of analysis, but only 71% of heteroplasmic species. The success rate in identifying heteroplasmic species was increased to 86% by treating polymorphisms as character states rather than ambiguities. Nuclear pseudogenes (numts were also present in four species, and were distinguishable from heteroplasmic sequences by patterns of nucleotide and amino acid change. Conclusions Heteroplasmy significantly decreased the reliability of species identification. In addition, the practical issue of dealing with large numbers of polymorphisms- and resulting increased time and labor required - makes the development of DNA barcode databases considerably more complex than has previously been suggested. The impact of heteroplasmy on the utility of DNA barcoding as a bulk specimen identification tool will depend upon its frequency across populations, which remains unknown. However, DNA barcoding is still likely to remain an important identification tool for those species that are difficult or impossible to identify through morphology, as is the case for the ecologically

  16. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  17. DNA barcoding of Dutch birds

    Directory of Open Access Journals (Sweden)

    Mansour Aliabadian

    2013-12-01

    Full Text Available The mitochondrial cytochrome c-oxidase subunit I (COI can serve as a fast and accurate marker for the identification of animal species, and has been applied in a number of studies on birds. We here sequenced the COI gene for 387 individuals of 147 species of birds from the Netherlands, with 83 species being represented by >2 sequences. The Netherlands occupies a small geographic area and 95% of all samples were collected within a 50 km radius from one another. The intraspecific divergences averaged 0.29% among this assemblage, but most values were lower; the interspecific divergences averaged 9.54%. In all, 95% of species were represented by a unique barcode, with 6 species of gulls and skua (Larus and Stercorariusat least one shared barcode. This is best explained by these species representing recent radiations with ongoing hybridization. In contrast, one species, the Lesser Whitethroat Sylvia curruca showed deep divergences, averaging 5.76% and up to 8.68% between individuals. These possibly represent two distinct taxa, S. curruca and S. blythi, both clearly separated in a haplotype network analysis. Our study adds to a growing body of DNA barcodes that have become available for birds, and shows that a DNA barcoding approach enables to identify known Dutch bird species with a very high resolution. In addition some species were flagged up for further detailed taxonomic investigation, illustrating that even in ornithologically well-known areas such as the Netherlands, more is to be learned about the birds that are present.

  18. Evaluating ethanol-based sample preservation to facilitate use of DNA barcoding in routine freshwater biomonitoring programs using benthic macroinvertebrates.

    Directory of Open Access Journals (Sweden)

    Eric D Stein

    Full Text Available Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI. On average, we obtained successful COI sequences (i.e. either full or partial barcodes for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.

  19. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

    Science.gov (United States)

    Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

    2012-10-01

    The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

  20. On site DNA barcoding by nanopore sequencing.

    Directory of Open Access Journals (Sweden)

    Michele Menegon

    Full Text Available Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet's biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities.

  1. BLOG 2.0: a software system for character-based species classification with DNA Barcode sequences. What it does, how to use it

    NARCIS (Netherlands)

    Weitschek, E.; Velzen, van R.; Felici, G.; Bertolazzi, P.

    2013-01-01

    BLOG (Barcoding with LOGic) is a diagnostic and character-based DNA Barcode analysis method. Its aim is to classify specimens to species based on DNA Barcode sequences and on a supervised machine learning approach, using classification rules that compactly characterize species in terms of DNA

  2. DNA barcoding of Japanese click beetles (Coleoptera, Elateridae).

    Science.gov (United States)

    Oba, Yuichi; Ôhira, Hitoo; Murase, Yukio; Moriyama, Akihiko; Kumazawa, Yoshinori

    2015-01-01

    Click beetles (Coleoptera: Elateridae) represent one of the largest groups of beetle insects. Some click beetles in larval form, known as wireworms, are destructive agricultural pests. Morphological identification of click beetles is generally difficult and requires taxonomic expertise. This study reports on the DNA barcoding of Japanese click beetles to enable their rapid and accurate identification. We collected and assembled 762 cytochrome oxidase subunit I barcode sequences from 275 species, which cover approximately 75% of the common species found on the Japanese main island, Honshu. This barcode library also contains 20 out of the 21 potential pest species recorded in Japan. Our analysis shows that most morphologically identified species form distinct phylogenetic clusters separated from each other by large molecular distances. This supports the general usefulness of the DNA barcoding approach for quick and reliable identification of Japanese elaterid species for environmental impact assessment, agricultural pest control, and biodiversity analysis. On the other hand, the taxonomic boundary in dozens of species did not agree with the boundary of barcode index numbers (a criterion for sequence-based species delimitation). These findings urge taxonomic reinvestigation of these mismatched taxa.

  3. DNA barcoding of Japanese click beetles (Coleoptera, Elateridae.

    Directory of Open Access Journals (Sweden)

    Yuichi Oba

    Full Text Available Click beetles (Coleoptera: Elateridae represent one of the largest groups of beetle insects. Some click beetles in larval form, known as wireworms, are destructive agricultural pests. Morphological identification of click beetles is generally difficult and requires taxonomic expertise. This study reports on the DNA barcoding of Japanese click beetles to enable their rapid and accurate identification. We collected and assembled 762 cytochrome oxidase subunit I barcode sequences from 275 species, which cover approximately 75% of the common species found on the Japanese main island, Honshu. This barcode library also contains 20 out of the 21 potential pest species recorded in Japan. Our analysis shows that most morphologically identified species form distinct phylogenetic clusters separated from each other by large molecular distances. This supports the general usefulness of the DNA barcoding approach for quick and reliable identification of Japanese elaterid species for environmental impact assessment, agricultural pest control, and biodiversity analysis. On the other hand, the taxonomic boundary in dozens of species did not agree with the boundary of barcode index numbers (a criterion for sequence-based species delimitation. These findings urge taxonomic reinvestigation of these mismatched taxa.

  4. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  5. DNA barcoding in Mexico: an introduction.

    Science.gov (United States)

    Elías-Gutiérrez, M; León-Regagnon, V

    2013-11-01

    DNA barcoding has become an important current scientific trend to the understanding of the world biodiversity. In the case of mega-diverse hot spots like Mexico, this technique represents an important tool for taxonomists, allowing them to concentrate in highlighted species by the barcodes instead of analyzing entire sets of specimens. This tendency resulted in the creation of a national network named Mexican Barcode of Life (MEXBOL) which main goals are to train students, and to promote the interaction and collective work among researchers interested in this topic. As a result, the number of records in the Barcode of Life Database (BOLD) for some groups, such as the Mammalia, Actinopterygii, Polychaeta, Branchiopoda, Ostracoda, Maxillopoda, Nematoda, Pinophyta, Ascomycota and Basidiomycota place Mexico among the top ten countries in the generation of these data. This special number presents only few of the many interesting findings in this region of the world, after the use of this technique and its integration with other methodologies. © 2013 John Wiley & Sons Ltd.

  6. Are mini DNA-barcodes sufficiently informative to resolve species ...

    Indian Academy of Sciences (India)

    ... between mini-barcode and the full- length DNA barcode was carried out in Microsoft Excel. (http://www.office.microsoft.com). ..... Received 15 June 2013, in final revised form 5 April 2014; accepted 3 June 2014. Unedited version published ...

  7. DNA barcodes for dragonflies and damselflies (Odonata) of Mindanao, Philippines.

    Science.gov (United States)

    Casas, Princess Angelie S; Sing, Kong-Wah; Lee, Ping-Shin; Nuñeza, Olga M; Villanueva, Reagan Joseph T; Wilson, John-James

    2018-03-01

    Reliable species identification provides a sounder basis for use of species in the order Odonata as biological indicators and for their conservation, an urgent concern as many species are threatened with imminent extinction. We generated 134 COI barcodes from 36 morphologically identified species of Odonata collected from Mindanao Island, representing 10 families and 19 genera. Intraspecific sequence divergences ranged from 0 to 6.7% with four species showing more than 2%, while interspecific sequence divergences ranged from 0.5 to 23.3% with seven species showing less than 2%. Consequently, no distinct gap was observed between intraspecific and interspecific DNA barcode divergences. The numerous islands of the Philippine archipelago may have facilitated rapid speciation in the Odonata and resulted in low interspecific sequence divergences among closely related groups of species. This study contributes DNA barcodes for 36 morphologically identified species of Odonata reported from Mindanao including 31 species with no previous DNA barcode records.

  8. Testing DNA barcodes in closely related species of Curcuma (Zingiberaceae) from Myanmar and China.

    Science.gov (United States)

    Chen, Juan; Zhao, Jietang; Erickson, David L; Xia, Nianhe; Kress, W John

    2015-03-01

    The genus Curcuma L. is commonly used as spices, medicines, dyes and ornamentals. Owing to its economic significance and lack of clear-cut morphological differences between species, this genus is an ideal case for developing DNA barcodes. In this study, four chloroplast DNA regions (matK, rbcL, trnH-psbA and trnL-F) and one nuclear region (ITS2) were generated for 44 Curcuma species and five species from closely related genera, represented by 96 samples. PCR amplification success rate, intra- and inter-specific genetic distance variation and the correct identification percentage were taken into account to assess candidate barcode regions. PCR and sequence success rate were high in matK (89.7%), rbcL (100%), trnH-psbA (100%), trnL-F (95.7%) and ITS2 (82.6%) regions. The results further showed that four candidate chloroplast barcoding regions (matK, rbcL, trnH-psbA and trnL-F) yield no barcode gaps, indicating that the genus Curcuma represents a challenging group for DNA barcoding. The ITS2 region presented large interspecific variation and provided the highest correct identification rates (46.7%) based on BLASTClust method among the five regions. However, the ITS2 only provided 7.9% based on NJ tree method. An increase in discriminatory power needs the development of more variable markers. © 2014 John Wiley & Sons Ltd.

  9. Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

    Directory of Open Access Journals (Sweden)

    Stephane Boyer

    Full Text Available DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI is over 600 base pairs (bp, amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R. This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey DNA from 46 landsnail (predator faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1 when dealing with degraded DNA for which only small fragments can be amplified, (2 for cases where no consensus has yet been reached on the appropriate barcode gene, or (3 to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

  10. Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

    Science.gov (United States)

    Boyer, Stephane; Brown, Samuel D J; Collins, Rupert A; Cruickshank, Robert H; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D

    2012-01-01

    DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

  11. DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species

    Science.gov (United States)

    Min Yu; Lichao Jiao; Juan Guo; Alex C. Wiedenhoeft; Tuo He; Xiaomei Jiang; Yafang Yin

    2017-01-01

    ITS2+trnH-psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens.

  12. Towards writing the encyclopaedia of life: an introduction to DNA barcoding

    Science.gov (United States)

    Savolainen, Vincent; Cowan, Robyn S; Vogler, Alfried P; Roderick, George K; Lane, Richard

    2005-01-01

    An international consortium of major natural history museums, herbaria and other organizations has launched an ambitious project, the ‘Barcode of Life Initiative’, to promote a process enabling the rapid and inexpensive identification of the estimated 10 million species on Earth. DNA barcoding is a diagnostic technique in which short DNA sequence(s) can be used for species identification. The first international scientific conference on Barcoding of Life was held at the Natural History Museum in London in February 2005, and here we review the scientific challenges discussed during this conference and in previous publications. Although still controversial, the scientific benefits of DNA barcoding include: (i) enabling species identification, including any life stage or fragment, (ii) facilitating species discoveries based on cluster analyses of gene sequences (e.g. cox1=CO1, in animals), (iii) promoting development of handheld DNA sequencing technology that can be applied in the field for biodiversity inventories and (iv) providing insight into the diversity of life. PMID:16214739

  13. Integrating DNA barcode data and taxonomic practice: determination, discovery, and description.

    Science.gov (United States)

    Goldstein, Paul Z; DeSalle, Rob

    2011-02-01

    DNA barcodes, like traditional sources of taxonomic information, are potentially powerful heuristics in the identification of described species but require mindful analytical interpretation. The role of DNA barcoding in generating hypotheses of new taxa in need of formal taxonomic treatment is discussed, and it is emphasized that the recursive process of character evaluation is both necessary and best served by understanding the empirical mechanics of the discovery process. These undertakings carry enormous ramifications not only for the translation of DNA sequence data into taxonomic information but also for our comprehension of the magnitude of species diversity and its disappearance. This paper examines the potential strengths and pitfalls of integrating DNA sequence data, specifically in the form of DNA barcodes as they are currently generated and analyzed, with taxonomic practice.

  14. Identification of Fabaceae plants using the DNA barcode matK.

    Science.gov (United States)

    Gao, Ting; Sun, Zhiying; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Ma, Xinye; Chen, Shilin

    2011-01-01

    In this study, we tested the applicability of the core DNA barcode MATK for identifying species within the Fabaceae family. Based on an evaluation of genetic variation, DNA barcoding gaps, and species discrimination power, MATK is a useful barcode for Fabaceae species. Of 1355 plant samples collected from 1079 species belonging to 409 diverse genera, MATK precisely identified approximately 80 % and 96 % of them at the species and genus levels, respectively. Therefore, our research indicates that the MATK region is a valuable marker for plant species within Fabaceae. © Georg Thieme Verlag KG Stuttgart · New York.

  15. Classification of Sharks in the Egyptian Mediterranean Waters Using Morphological and DNA Barcoding Approaches

    Science.gov (United States)

    Moftah, Marie; Abdel Aziz, Sayeda H.; Elramah, Sara; Favereaux, Alexandre

    2011-01-01

    The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?&#Barcoding%20Fish%20%28FishBOL%29). PMID:22087242

  16. Classification of sharks in the Egyptian Mediterranean waters using morphological and DNA barcoding approaches.

    Directory of Open Access Journals (Sweden)

    Marie Moftah

    Full Text Available The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?&#Barcoding%20Fish%20%28FishBOL%29.

  17. How effective are DNA barcodes in the identification of African rainforest trees?

    Science.gov (United States)

    Parmentier, Ingrid; Duminil, Jérôme; Kuzmina, Maria; Philippe, Morgane; Thomas, Duncan W; Kenfack, David; Chuyong, George B; Cruaud, Corinne; Hardy, Olivier J

    2013-01-01

    DNA barcoding of rain forest trees could potentially help biologists identify species and discover new ones. However, DNA barcodes cannot always distinguish between closely related species, and the size and completeness of barcode databases are key parameters for their successful application. We test the ability of rbcL, matK and trnH-psbA plastid DNA markers to identify rain forest trees at two sites in Atlantic central Africa under the assumption that a database is exhaustive in terms of species content, but not necessarily in terms of haplotype diversity within species. We assess the accuracy of identification to species or genus using a genetic distance matrix between samples either based on a global multiple sequence alignment (GD) or on a basic local alignment search tool (BLAST). Where a local database is available (within a 50 ha plot), barcoding was generally reliable for genus identification (95-100% success), but less for species identification (71-88%). Using a single marker, best results for species identification were obtained with trnH-psbA. There was a significant decrease of barcoding success in species-rich clades. When the local database was used to identify the genus of trees from another region and did include all genera from the query individuals but not all species, genus identification success decreased to 84-90%. The GD method performed best but a global multiple sequence alignment is not applicable on trnH-psbA. Barcoding is a useful tool to assign unidentified African rain forest trees to a genus, but identification to a species is less reliable, especially in species-rich clades, even using an exhaustive local database. Combining two markers improves the accuracy of species identification but it would only marginally improve genus identification. Finally, we highlight some limitations of the BLAST algorithm as currently implemented and suggest possible improvements for barcoding applications.

  18. Building a DNA barcode reference library for the true butterflies (Lepidoptera) of Peninsula Malaysia: what about the subspecies?

    Science.gov (United States)

    Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd

    2013-01-01

    The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity.

  19. Building a DNA Barcode Reference Library for the True Butterflies (Lepidoptera) of Peninsula Malaysia: What about the Subspecies?

    Science.gov (United States)

    Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd

    2013-01-01

    The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity. PMID:24282514

  20. Building a DNA barcode reference library for the true butterflies (Lepidoptera of Peninsula Malaysia: what about the subspecies?

    Directory of Open Access Journals (Sweden)

    John-James Wilson

    Full Text Available The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92% and revealed that most subspecies possessed unique DNA barcodes (84%. In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity.

  1. Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

    Science.gov (United States)

    Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2017-09-28

    Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

  2. Testing efficacy of distance and tree-based methods for DNA barcoding of grasses (Poaceae tribe Poeae) in Australia.

    Science.gov (United States)

    Birch, Joanne L; Walsh, Neville G; Cantrill, David J; Holmes, Gareth D; Murphy, Daniel J

    2017-01-01

    In Australia, Poaceae tribe Poeae are represented by 19 genera and 99 species, including economically and environmentally important native and introduced pasture grasses [e.g. Poa (Tussock-grasses) and Lolium (Ryegrasses)]. We used this tribe, which are well characterised in regards to morphological diversity and evolutionary relationships, to test the efficacy of DNA barcoding methods. A reference library was generated that included 93.9% of species in Australia (408 individuals, [Formula: see text] = 3.7 individuals per species). Molecular data were generated for official plant barcoding markers (rbcL, matK) and the nuclear ribosomal internal transcribed spacer (ITS) region. We investigated accuracy of specimen identifications using distance- (nearest neighbour, best-close match, and threshold identification) and tree-based (maximum likelihood, Bayesian inference) methods and applied species discovery methods (automatic barcode gap discovery, Poisson tree processes) based on molecular data to assess congruence with recognised species. Across all methods, success rate for specimen identification of genera was high (87.5-99.5%) and of species was low (25.6-44.6%). Distance- and tree-based methods were equally ineffective in providing accurate identifications for specimens to species rank (26.1-44.6% and 25.6-31.3%, respectively). The ITS marker achieved the highest success rate for specimen identification at both generic and species ranks across the majority of methods. For distance-based analyses the best-close match method provided the greatest accuracy for identification of individuals with a high percentage of "correct" (97.6%) and a low percentage of "incorrect" (0.3%) generic identifications, based on the ITS marker. For tribe Poeae, and likely for other grass lineages, sequence data in the standard DNA barcode markers are not variable enough for accurate identification of specimens to species rank. For recently diverged grass species similar challenges are

  3. Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.

    Science.gov (United States)

    Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar

    2018-06-05

    The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

  4. Detection of Avian Influenza Virus by Fluorescent DNA Barcode-based Immunoassay with Sensitivity Comparable to PCR

    DEFF Research Database (Denmark)

    Cao, Cuong; Dhumpa, Raghuram; Bang, Dang Duong

    2010-01-01

    involves the sandwiching of the target AIV between magnetic immunoprobes and barcode-carrying immunoprobes. Because each barcode-carrying immunoprobe is functionalized with a multitude of fluorophore-DNA barcode strands, many DNA barcodes are released for each positive binding event resulting......In this paper, a coupling of fluorophore-DNA barcode and bead-based immunoassay for detecting avian influenza virus (AIV) with PCR-like sensitivity is reported. The assay is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representative barcodes. The detection...

  5. DNA barcodes for 1/1000 of the animal kingdom.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Landry, Jean-François

    2010-06-23

    This study reports DNA barcodes for more than 1300 Lepidoptera species from the eastern half of North America, establishing that 99.3 per cent of these species possess diagnostic barcode sequences. Intraspecific divergences averaged just 0.43 per cent among this assemblage, but most values were lower. The mean was elevated by deep barcode divergences (greater than 2%) in 5.1 per cent of the species, often involving the sympatric occurrence of two barcode clusters. A few of these cases have been analysed in detail, revealing species overlooked by the current taxonomic system. This study also provided a large-scale test of the extent of regional divergence in barcode sequences, indicating that geographical differentiation in the Lepidoptera of eastern North America is small, even when comparisons involve populations as much as 2800 km apart. The present results affirm that a highly effective system for the identification of Lepidoptera in this region can be built with few records per species because of the limited intra-specific variation. As most terrestrial and marine taxa are likely to possess a similar pattern of population structure, an effective DNA-based identification system can be developed with modest effort.

  6. Identifying insects with incomplete DNA barcode libraries, African fruit flies (Diptera: Tephritidae) as a test case.

    Science.gov (United States)

    Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C; Backeljau, Thierry; De Meyer, Marc

    2012-01-01

    We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods.

  7. FBIS: A regional DNA barcode archival & analysis system for Indian fishes

    Science.gov (United States)

    Nagpure, Naresh Sahebrao; Rashid, Iliyas; Pathak, Ajey Kumar; Singh, Mahender; Singh, Shri Prakash; Sarkar, Uttam Kumar

    2012-01-01

    DNA barcode is a new tool for taxon recognition and classification of biological organisms based on sequence of a fragment of mitochondrial gene, cytochrome c oxidase I (COI). In view of the growing importance of the fish DNA barcoding for species identification, molecular taxonomy and fish diversity conservation, we developed a Fish Barcode Information System (FBIS) for Indian fishes, which will serve as a regional DNA barcode archival and analysis system. The database presently contains 2334 sequence records of COI gene for 472 aquatic species belonging to 39 orders and 136 families, collected from available published data sources. Additionally, it contains information on phenotype, distribution and IUCN Red List status of fishes. The web version of FBIS was designed using MySQL, Perl and PHP under Linux operating platform to (a) store and manage the acquisition (b) analyze and explore DNA barcode records (c) identify species and estimate genetic divergence. FBIS has also been integrated with appropriate tools for retrieving and viewing information about the database statistics and taxonomy. It is expected that FBIS would be useful as a potent information system in fish molecular taxonomy, phylogeny and genomics. Availability The database is available for free at http://mail.nbfgr.res.in/fbis/ PMID:22715304

  8. Identification of Amazonian trees with DNA barcodes.

    Science.gov (United States)

    Gonzalez, Mailyn Adriana; Baraloto, Christopher; Engel, Julien; Mori, Scott A; Pétronelli, Pascal; Riéra, Bernard; Roger, Aurélien; Thébaud, Christophe; Chave, Jérôme

    2009-10-16

    Large-scale plant diversity inventories are critical to develop informed conservation strategies. However, the workload required for classic taxonomic surveys remains high and is particularly problematic for megadiverse tropical forests. Based on a comprehensive census of all trees in two hectares of a tropical forest in French Guiana, we examined whether plant DNA barcoding could contribute to increasing the quality and the pace of tropical plant biodiversity surveys. Of the eight plant DNA markers we tested (rbcLa, rpoC1, rpoB, matK, ycf5, trnL, psbA-trnH, ITS), matK and ITS had a low rate of sequencing success. More critically, none of the plastid markers achieved a rate of correct plant identification greater than 70%, either alone or combined. The performance of all barcoding markers was noticeably low in few species-rich clades, such as the Laureae, and the Sapotaceae. A field test of the approach enabled us to detect 130 molecular operational taxonomic units in a sample of 252 juvenile trees. Including molecular markers increased the identification rate of juveniles from 72% (morphology alone) to 96% (morphology and molecular) of the individuals assigned to a known tree taxon. We conclude that while DNA barcoding is an invaluable tool for detecting errors in identifications and for identifying plants at juvenile stages, its limited ability to identify collections will constrain the practical implementation of DNA-based tropical plant biodiversity programs.

  9. DNA barcodes for bio-surveillance: regulated and economically important arthropod plant pests.

    Science.gov (United States)

    Ashfaq, Muhammad; Hebert, Paul D N

    2016-11-01

    Many of the arthropod species that are important pests of agriculture and forestry are impossible to discriminate morphologically throughout all of their life stages. Some cannot be differentiated at any life stage. Over the past decade, DNA barcoding has gained increasing adoption as a tool to both identify known species and to reveal cryptic taxa. Although there has not been a focused effort to develop a barcode library for them, reference sequences are now available for 77% of the 409 species of arthropods documented on major pest databases. Aside from developing the reference library needed to guide specimen identifications, past barcode studies have revealed that a significant fraction of arthropod pests are a complex of allied taxa. Because of their importance as pests and disease vectors impacting global agriculture and forestry, DNA barcode results on these arthropods have significant implications for quarantine detection, regulation, and management. The current review discusses these implications in light of the presence of cryptic species in plant pests exposed by DNA barcoding.

  10. DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine

    Directory of Open Access Journals (Sweden)

    Fan Yang

    2018-01-01

    Full Text Available Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.

  11. DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine.

    Science.gov (United States)

    Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li; Li, Haifeng

    2018-01-01

    Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.

  12. DNA Barcode Authentication and Library Development for the Wood of Six Commercial Pterocarpus Species: the Critical Role of Xylarium Specimens.

    Science.gov (United States)

    Jiao, Lichao; Yu, Min; Wiedenhoeft, Alex C; He, Tuo; Li, Jianing; Liu, Bo; Jiang, Xiaomei; Yin, Yafang

    2018-01-31

    DNA barcoding has been proposed as a useful tool for forensic wood identification and development of a reliable DNA reference library is an essential first step. Xylaria (wood collections) are potentially enormous data repositories if DNA information could be extracted from wood specimens. In this study, 31 xylarium wood specimens and 8 leaf specimens of six important commercial species of Pterocarpus were selected to investigate the reliability of DNA barcodes for authentication at the species level and to determine the feasibility of building wood DNA barcode reference libraries from xylarium specimens. Four DNA barcodes (ITS2, matK, ndhF-rpl32 and rbcL) and their combination were tested to evaluate their discrimination ability for Pterocarpus species with both TaxonDNA and tree-based analytical methods. The results indicated that the combination barcode of matK + ndhF-rpl32 + ITS2 yielded the best discrimination for the Pterocarpus species studied. The mini-barcode ndhF-rpl32 (167-173 bps) performed well distinguishing P. santalinus from its wood anatomically inseparable species P. tinctorius. Results from this study verified not only the feasibility of building DNA barcode libraries using xylarium wood specimens, but the importance of using wood rather than leaves as the source tissue, when wood is the botanical material to be identified.

  13. Status and prospects of DNA barcoding in medically important parasites and vectors.

    Science.gov (United States)

    Ondrejicka, Danielle A; Locke, Sean A; Morey, Kevin; Borisenko, Alex V; Hanner, Robert H

    2014-12-01

    For over 10 years, DNA barcoding has been used to identify specimens and discern species. Its potential benefits in parasitology were recognized early, but its utility and uptake remain unclear. Here we review studies using DNA barcoding in parasites and vectors affecting humans and find that the technique is accurate (accords with author identifications based on morphology or other markers) in 94-95% of cases, although aspects of DNA barcoding (vouchering, marker implicated) have often been misunderstood. In a newly compiled checklist of parasites, vectors, and hazards, barcodes are available for 43% of all 1403 species and for more than half of 429 species of greater medical importance. This is encouraging coverage that would improve with an active campaign targeting parasites and vectors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. DNA barcode analysis: a comparison of phylogenetic and statistical classification methods.

    Science.gov (United States)

    Austerlitz, Frederic; David, Olivier; Schaeffer, Brigitte; Bleakley, Kevin; Olteanu, Madalina; Leblois, Raphael; Veuille, Michel; Laredo, Catherine

    2009-11-10

    DNA barcoding aims to assign individuals to given species according to their sequence at a small locus, generally part of the CO1 mitochondrial gene. Amongst other issues, this raises the question of how to deal with within-species genetic variability and potential transpecific polymorphism. In this context, we examine several assignation methods belonging to two main categories: (i) phylogenetic methods (neighbour-joining and PhyML) that attempt to account for the genealogical framework of DNA evolution and (ii) supervised classification methods (k-nearest neighbour, CART, random forest and kernel methods). These methods range from basic to elaborate. We investigated the ability of each method to correctly classify query sequences drawn from samples of related species using both simulated and real data. Simulated data sets were generated using coalescent simulations in which we varied the genealogical history, mutation parameter, sample size and number of species. No method was found to be the best in all cases. The simplest method of all, "one nearest neighbour", was found to be the most reliable with respect to changes in the parameters of the data sets. The parameter most influencing the performance of the various methods was molecular diversity of the data. Addition of genetically independent loci--nuclear genes--improved the predictive performance of most methods. The study implies that taxonomists can influence the quality of their analyses either by choosing a method best-adapted to the configuration of their sample, or, given a certain method, increasing the sample size or altering the amount of molecular diversity. This can be achieved either by sequencing more mtDNA or by sequencing additional nuclear genes. In the latter case, they may also have to modify their data analysis method.

  15. DNA barcode analysis: a comparison of phylogenetic and statistical classification methods

    Directory of Open Access Journals (Sweden)

    Leblois Raphael

    2009-11-01

    Full Text Available Abstract Background DNA barcoding aims to assign individuals to given species according to their sequence at a small locus, generally part of the CO1 mitochondrial gene. Amongst other issues, this raises the question of how to deal with within-species genetic variability and potential transpecific polymorphism. In this context, we examine several assignation methods belonging to two main categories: (i phylogenetic methods (neighbour-joining and PhyML that attempt to account for the genealogical framework of DNA evolution and (ii supervised classification methods (k-nearest neighbour, CART, random forest and kernel methods. These methods range from basic to elaborate. We investigated the ability of each method to correctly classify query sequences drawn from samples of related species using both simulated and real data. Simulated data sets were generated using coalescent simulations in which we varied the genealogical history, mutation parameter, sample size and number of species. Results No method was found to be the best in all cases. The simplest method of all, "one nearest neighbour", was found to be the most reliable with respect to changes in the parameters of the data sets. The parameter most influencing the performance of the various methods was molecular diversity of the data. Addition of genetically independent loci - nuclear genes - improved the predictive performance of most methods. Conclusion The study implies that taxonomists can influence the quality of their analyses either by choosing a method best-adapted to the configuration of their sample, or, given a certain method, increasing the sample size or altering the amount of molecular diversity. This can be achieved either by sequencing more mtDNA or by sequencing additional nuclear genes. In the latter case, they may also have to modify their data analysis method.

  16. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala) and a New DNA Mini-Barcode Target.

    Science.gov (United States)

    Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James

    2015-01-01

    Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.

  17. Quantifying Species Diversity with a DNA Barcoding-Based Method: Tibetan Moth Species (Noctuidae) on the Qinghai-Tibetan Plateau

    Science.gov (United States)

    Jin, Qian; Han, Huilin; Hu, XiMin; Li, XinHai; Zhu, ChaoDong; Ho, Simon Y. W.; Ward, Robert D.; Zhang, Ai-bing

    2013-01-01

    With the ongoing loss of biodiversity, there is a great need for fast and effective ways to assess species richness and diversity: DNA barcoding provides a powerful new tool for this. We investigated this approach by focusing on the Tibetan plateau, which is one of the world's top biodiversity hotspots. There have been few studies of its invertebrates, although they constitute the vast majority of the region's diversity. Here we investigated species diversity of the lepidopteran family Noctuidae, across different environmental gradients, using measurements based on traditional morphology as well as on DNA barcoding. The COI barcode showed an average interspecific K2P distance of , which is about four times larger than the mean intraspecific distance (). Using six diversity indices, we did not detect any significant differences in estimated species diversity between measurements based on traditional morphology and on DNA barcoding. Furthermore, we found strong positive correlations between them, indicating that barcode-based measures of species diversity can serve as a good surrogate for morphology-based measures in most situations tested. Eastern communities were found to have significantly higher diversity than Western ones. Among 22 environmental factors tested, we found that three (precipitation of driest month, precipitation of driest quarter, and precipitation of coldest quarter) were significantly correlated with species diversity. Our results indicate that these factors could be the key ecological factors influencing the species diversity of the lepidopteran family Noctuidae on the Tibetan plateau. PMID:23741330

  18. A DNA barcode library for ground beetles of Germany: the genus Amara Bonelli, 1810 (Insecta, Coleoptera, Carabidae)

    Science.gov (United States)

    Raupach, Michael J.; Hannig, Karsten; Moriniére, Jérôme; Hendrich, Lars

    2018-01-01

    Abstract The genus Amara Bonelli, 1810 is a very speciose and taxonomically difficult genus of the Carabidae. The identification of many of the species is accomplished with considerable difficulty, in particular for females and immature stages. In this study the effectiveness of DNA barcoding, the most popular method for molecular species identification, was examined to discriminate various species of this genus from Central Europe. DNA barcodes from 690 individuals and 47 species were analysed, including sequences from previous studies and more than 350 newly generated DNA barcodes. Our analysis revealed unique BINs for 38 species (81%). Interspecific K2P distances below 2.2% were found for three species pairs and one species trio, including haplotype sharing between Amara alpina/Amara torrida and Amara communis/Amara convexior/Amara makolskii. This study represents another step in generating an extensive reference library of DNA barcodes for carabids, highly valuable bioindicators for characterizing disturbances in various habitats. PMID:29853775

  19. DNA Barcodes for Marine Biodiversity: Moving Fast Forward?

    Directory of Open Access Journals (Sweden)

    Adriana E. Radulovici

    2010-03-01

    Full Text Available ‘Biodiversity’ means the variety of life and it can be studied at different levels (genetic, species, ecosystem and scales (spatial and temporal. Last decades showed that marine biodiversity has been severely underestimated at all levels. In order to investigate diversity patterns and underlying processes, there is a need to know what species live in the marine environment. An emerging tool for species identification, DNA barcoding can reliably assign unknown specimens to known species, also flagging potential cryptic species and genetically distant populations. This paper will review the role of DNA barcoding for the study of marine biodiversity at the species level.

  20. Species-level para- and polyphyly in DNA barcode gene trees

    DEFF Research Database (Denmark)

    Mutanen, Marko; Kivelä, Sami M.; Vos, Rutger A.

    2016-01-01

    was paid to accurate species identification to ensure data integrity. We investigated the effects of tree-building method, sampling effort, and other methodological issues, all of which can influence estimates of non-monophyly. We found a 12% incidence of non-monophyly, a value significantly lower than...... between species and gene genealogies, as indicated by situations where conspecific individuals do not form a monophyletic cluster in a gene tree. In two previous reviews, non-monophyly has been reported as being common in mitochondrial DNA gene trees. We developed a novel web service "Monophylizer......" to detect non-monophyly in phylogenetic trees and used it to ascertain the incidence of species non-monophyly in COI (a.k.a. cox1) barcode sequence data from 4977 species and 41,583 specimens of European Lepidoptera, the largest data set of DNA barcodes analyzed from this regard. Particular attention...

  1. Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

    Science.gov (United States)

    Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

    2010-07-01

    In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

  2. DNA barcode of Chaetognatha from Indian waters

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, V.R.; Kidangan, F.X.; Prabhu, R.G.; Bucklin, A.; Nair, S.

    Chaetognatha are the second most abundant zooplankton group in the Indian waters Precise identification of the species is critical for biogeographical studies DNA barcodes using mitochondrial cytochrome c oxidase (COI) of seven dominant...

  3. Forensic identification of CITES protected slimming cactus (Hoodia) using DNA barcoding.

    Science.gov (United States)

    Gathier, Gerard; van der Niet, Timotheus; Peelen, Tamara; van Vugt, Rogier R; Eurlings, Marcel C M; Gravendeel, Barbara

    2013-11-01

    Slimming cactus (Hoodia), found only in southwestern Africa, is a well-known herbal product for losing weight. Consequently, Hoodia extracts are sought-after worldwide despite a CITES Appendix II status. The failure to eradicate illegal trade is due to problems with detecting and identifying Hoodia using morphological and chemical characters. Our aim was to evaluate the potential of molecular identification of Hoodia based on DNA barcoding. Screening of nrITS1 and psbA-trnH DNA sequences from 26 accessions of Ceropegieae resulted in successful identification, while conventional chemical profiling using DLI-MS led to inaccurate detection and identification of Hoodia. The presence of Hoodia in herbal products was also successfully established using DNA sequences. A validation procedure of our DNA barcoding protocol demonstrated its robustness to changes in PCR conditions. We conclude that DNA barcoding is an effective tool for Hoodia detection and identification which can contribute to preventing illegal trade. © 2013 American Academy of Forensic Sciences.

  4. DNA Barcoding of Ichthyoplankton in Hampton Roads Bay Estuary

    Science.gov (United States)

    Wilkins, N.; Rodríguez, Á. E.

    2016-02-01

    Zooplankton is composed of animals that drift within the water column. The study of zooplankton biodiversity and distribution is crucial to understand oceanic ecosystems and anticipate the effects of climate change. In this study our focus is on ichthyoplankton (fish eggs and larvae). Our aim is to employ molecular genetic techniques such as DNA barcoding to begin a detailed characterization of ichthyoplankton diversity, abundance and community structure in the Hampton Roads Bay Estuary (HRBE). A sampling of zooplankton was performed on June 19, 2015. Samples were taken with a 0.5m, 200 µm mesh net in triplicates at two stations: inner shore in the mouth of Jones Creek and 5 miles off Hampton in the lower part of Chesapeake Bay. Physical parameters (dissolved oxygen, salinity, and temperature and water transparency) were measured simultaneously. Species were identified by DNA barcoding using the mitochondrial DNA (mtDNA) of the Cytochrome Oxidase 1 (CO1) gene. Fish eggs were identified from Opistonema oglinum (Atlantic Thread Herring) at the offshore stations while, Anchoa mitchilli was found at both stations. These species are common to the area and as observed, differences in species between stations were found. O. oglinum eggs were found in the offshore stations, which is their reported habitat. A. mitchilli eggs were found in both stations; both known to exhibit a wider salinity tolerance. This work indicates that using mtDNA-CO1 barcoding is suitable to identify ichthyoplankton to the species level and helped validate DNA barcoding as a faster taxonomic approach. The long term objective of this project is to provide taxonomic composition and biodiversity assessment of ichthyoplankton in HRBE. This data will be a reference for broad monitoring programs; for a better understanding and management of ecologically and commercially important species in the HRBE. Monthly samplings will be performed for a year beginning September 2015.

  5. DNA barcoding of the vegetable leafminer Liriomyza sativae Blanchard (Diptera: Agromyzidae) in Bangladesh

    Science.gov (United States)

    DNA barcoding revealed the presence of the polyphagous leafminer pest Liriomyza sativae Blanchard in Bangladesh. DNA barcode sequences for mitochondrial COI were generated for Agromyzidae larvae, pupae and adults collected from field populations across Bangladesh. BLAST sequence similarity searches ...

  6. A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

    Science.gov (United States)

    Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

    2015-07-01

    In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Quantifying species diversity with a DNA barcoding-based method: Tibetan moth species (Noctuidae on the Qinghai-Tibetan Plateau.

    Directory of Open Access Journals (Sweden)

    Qian Jin

    Full Text Available With the ongoing loss of biodiversity, there is a great need for fast and effective ways to assess species richness and diversity: DNA barcoding provides a powerful new tool for this. We investigated this approach by focusing on the Tibetan plateau, which is one of the world's top biodiversity hotspots. There have been few studies of its invertebrates, although they constitute the vast majority of the region's diversity. Here we investigated species diversity of the lepidopteran family Noctuidae, across different environmental gradients, using measurements based on traditional morphology as well as on DNA barcoding. The COI barcode showed an average interspecific K2P distance of 9.45±2.08%, which is about four times larger than the mean intraspecific distance (1.85±3.20%. Using six diversity indices, we did not detect any significant differences in estimated species diversity between measurements based on traditional morphology and on DNA barcoding. Furthermore, we found strong positive correlations between them, indicating that barcode-based measures of species diversity can serve as a good surrogate for morphology-based measures in most situations tested. Eastern communities were found to have significantly higher diversity than Western ones. Among 22 environmental factors tested, we found that three (precipitation of driest month, precipitation of driest quarter, and precipitation of coldest quarter were significantly correlated with species diversity. Our results indicate that these factors could be the key ecological factors influencing the species diversity of the lepidopteran family Noctuidae on the Tibetan plateau.

  8. Assessing universality of DNA barcoding in geographically isolated selected desert medicinal species of Fabaceae and Poaceae

    Science.gov (United States)

    Hussain, Fatma; Ahmed, Nisar; Ghorbani, Abdolbaset

    2018-01-01

    In pursuit of developing fast and accurate species-level molecular identification methods, we tested six DNA barcodes, namely ITS2, matK, rbcLa, ITS2+matK, ITS2+rbcLa, matK+rbcLa and ITS2+matK+rbcLa, for their capacity to identify frequently consumed but geographically isolated medicinal species of Fabaceae and Poaceae indigenous to the desert of Cholistan. Data were analysed by BLASTn sequence similarity, pairwise sequence divergence in TAXONDNA, and phylogenetic (neighbour-joining and maximum-likelihood trees) methods. Comparison of six barcode regions showed that ITS2 has the highest number of variable sites (209/360) for tested Fabaceae and (106/365) Poaceae species, the highest species-level identification (40%) in BLASTn procedure, distinct DNA barcoding gap, 100% correct species identification in BM and BCM functions of TAXONDNA, and clear cladding pattern with high nodal support in phylogenetic trees in both families. ITS2+matK+rbcLa followed ITS2 in its species-level identification capacity. The study was concluded with advocating the DNA barcoding as an effective tool for species identification and ITS2 as the best barcode region in identifying medicinal species of Fabaceae and Poaceae. Current research has practical implementation potential in the fields of pharmaco-vigilance, trade of medicinal plants and biodiversity conservation. PMID:29576968

  9. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala) and a New DNA Mini-Barcode Target

    Science.gov (United States)

    Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James

    2015-01-01

    Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring. PMID:25898278

  10. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala and a New DNA Mini-Barcode Target.

    Directory of Open Access Journals (Sweden)

    Ping-Shin Lee

    Full Text Available Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp DNA mini-barcode could distinguish most mammal species (including separating dark taxa and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.

  11. Identification of Meconopsis species by a DNA barcode sequence ...

    African Journals Online (AJOL)

    Deoxyribonucleic acid (DNA) barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Species identification is necessary for the authentication of traditional plant based medicines. Although a consensus has not been agreed regarding which DNA sequences can be used as ...

  12. DNA Barcoding the Geometrid Fauna of Bavaria (Lepidoptera): Successes, Surprises, and Questions

    Science.gov (United States)

    Hausmann, Axel; Haszprunar, Gerhard; Hebert, Paul D. N.

    2011-01-01

    Background The State of Bavaria is involved in a research program that will lead to the construction of a DNA barcode library for all animal species within its territorial boundaries. The present study provides a comprehensive DNA barcode library for the Geometridae, one of the most diverse of insect families. Methodology/Principal Findings This study reports DNA barcodes for 400 Bavarian geometrid species, 98 per cent of the known fauna, and approximately one per cent of all Bavarian animal species. Although 98.5% of these species possess diagnostic barcode sequences in Bavaria, records from neighbouring countries suggest that species-level resolution may be compromised in up to 3.5% of cases. All taxa which apparently share barcodes are discussed in detail. One case of modest divergence (1.4%) revealed a species overlooked by the current taxonomic system: Eupithecia goossensiata Mabille, 1869 stat.n. is raised from synonymy with Eupithecia absinthiata (Clerck, 1759) to species rank. Deep intraspecific sequence divergences (>2%) were detected in 20 traditionally recognized species. Conclusions/Significance The study emphasizes the effectiveness of DNA barcoding as a tool for monitoring biodiversity. Open access is provided to a data set that includes records for 1,395 geometrid specimens (331 species) from Bavaria, with 69 additional species from neighbouring regions. Taxa with deep intraspecific sequence divergences are undergoing more detailed analysis to ascertain if they represent cases of cryptic diversity. PMID:21423340

  13. Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.

    Science.gov (United States)

    Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe

    2012-01-01

    A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.

  14. A DNA barcode library for ground beetles (Insecta, Coleoptera, Carabidae) of Germany: The genus Bembidion Latreille, 1802 and allied taxa.

    Science.gov (United States)

    Raupach, Michael J; Hannig, Karsten; Morinière, Jérome; Hendrich, Lars

    2016-01-01

    As molecular identification method, DNA barcoding based on partial cytochrome c oxidase subunit 1 (COI) sequences has been proven to be a useful tool for species determination in many insect taxa including ground beetles. In this study we tested the effectiveness of DNA barcodes to discriminate species of the ground beetle genus Bembidion and some closely related taxa of Germany. DNA barcodes were obtained from 819 individuals and 78 species, including sequences from previous studies as well as more than 300 new generated DNA barcodes. We found a 1:1 correspondence between BIN and traditionally recognized species for 69 species (89%). Low interspecific distances with maximum pairwise K2P values below 2.2% were found for three species pairs, including two species pairs with haplotype sharing (Bembidion atrocaeruleum/Bembidion varicolor and Bembidion guttula/Bembidion mannerheimii). In contrast to this, deep intraspecific sequence divergences with distinct lineages were revealed for two species (Bembidion geniculatum/Ocys harpaloides). Our study emphasizes the use of DNA barcodes for the identification of the analyzed ground beetles species and represents an important step in building-up a comprehensive barcode library for the Carabidae in Germany and Central Europe as well.

  15. Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India.

    Science.gov (United States)

    Gaikwad, Swapnil; Warudkar, Ashwin; Shouche, Yogesh

    2017-09-01

    DNA barcoding has emerged as an additional tool for taxonomy and as an aid to taxonomic impediments. Due to their extensive morphological variation, spiders are taxonomically challenging. Therefore, all over the world, attempts are being made to DNA barcode species of spiders. Till now no attempts were made to DNA barcode Indian spiders despite their rich diversity. We have generated DNA barcodes for 60 species (n = 112) of spiders for the first time from India. Although only 17 species were correctly identified at the species level, DNA barcoding correctly discriminated 99% of the species studied here. We have also found high intraspecies nucleotide divergence in Plexippus paykulli suggesting cryptic diversity that needs to be studied in detail. Our study also showed non-specific amplification of the Cytochrome Oxidase I (COI) gene of endosymbiont bacteria Wolbachia. However, these cases are very rare and could be resolved by the use of modified or group specific primers.

  16. Potential efficacy of mitochondrial genes for animal DNA barcoding: a case study using eutherian mammals.

    Science.gov (United States)

    Luo, Arong; Zhang, Aibing; Ho, Simon Yw; Xu, Weijun; Zhang, Yanzhou; Shi, Weifeng; Cameron, Stephen L; Zhu, Chaodong

    2011-01-28

    A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups.

  17. DNA barcoding identifies Argentine fishes from marine and brackish waters.

    Directory of Open Access Journals (Sweden)

    Ezequiel Mabragaña

    Full Text Available BACKGROUND: DNA barcoding has been advanced as a promising tool to aid species identification and discovery through the use of short, standardized gene targets. Despite extensive taxonomic studies, for a variety of reasons the identification of fishes can be problematic, even for experts. DNA barcoding is proving to be a useful tool in this context. However, its broad application is impeded by the need to construct a comprehensive reference sequence library for all fish species. Here, we make a regional contribution to this grand challenge by calibrating the species discrimination efficiency of barcoding among 125 Argentine fish species, representing nearly one third of the known fauna, and examine the utility of these data to address several key taxonomic uncertainties pertaining to species in this region. METHODOLOGY/PRINCIPAL FINDINGS: Specimens were collected and morphologically identified during crusies conducted between 2005 and 2008. The standard BARCODE fragment of COI was amplified and bi-directionally sequenced from 577 specimens (mean of 5 specimens/species, and all specimens and sequence data were archived and interrogated using analytical tools available on the Barcode of Life Data System (BOLD; www.barcodinglife.org. Nearly all species exhibited discrete clusters of closely related haplogroups which permitted the discrimination of 95% of the species (i.e. 119/125 examined while cases of shared haplotypes were detected among just three species-pairs. Notably, barcoding aided the identification of a new species of skate, Dipturus argentinensis, permitted the recognition of Genypterus brasiliensis as a valid species and questions the generic assignment of Paralichthys isosceles. CONCLUSIONS/SIGNIFICANCE: This study constitutes a significant contribution to the global barcode reference sequence library for fishes and demonstrates the utility of barcoding for regional species identification. As an independent assessment of alpha

  18. Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada1

    Science.gov (United States)

    Kuzmina, Maria L.; Braukmann, Thomas W. A.; Fazekas, Aron J.; Graham, Sean W.; Dewaard, Stephanie L.; Rodrigues, Anuar; Bennett, Bruce A.; Dickinson, Timothy A.; Saarela, Jeffery M.; Catling, Paul M.; Newmaster, Steven G.; Percy, Diana M.; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P.; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.

    2017-01-01

    Premise of the study: Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Methods: Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Results: Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Discussion: Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa. PMID:29299394

  19. Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

    Directory of Open Access Journals (Sweden)

    Sylvia Schäffer

    Full Text Available DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher material is often very difficult to (nearly impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

  20. Improving the Conservation of Mediterranean Chondrichthyans: The ELASMOMED DNA Barcode Reference Library.

    Directory of Open Access Journals (Sweden)

    Alessia Cariani

    Full Text Available Cartilaginous fish are particularly vulnerable to anthropogenic stressors and environmental change because of their K-selected reproductive strategy. Accurate data from scientific surveys and landings are essential to assess conservation status and to develop robust protection and management plans. Currently available data are often incomplete or incorrect as a result of inaccurate species identifications, due to a high level of morphological stasis, especially among closely related taxa. Moreover, several diagnostic characters clearly visible in adult specimens are less evident in juveniles. Here we present results generated by the ELASMOMED Consortium, a regional network aiming to sample and DNA-barcode the Mediterranean Chondrichthyans with the ultimate goal to provide a comprehensive DNA barcode reference library. This library will support and improve the molecular taxonomy of this group and the effectiveness of management and conservation measures. We successfully barcoded 882 individuals belonging to 42 species (17 sharks, 24 batoids and one chimaera, including four endemic and several threatened ones. Morphological misidentifications were found across most orders, further confirming the need for a comprehensive DNA barcoding library as a valuable tool for the reliable identification of specimens in support of taxonomist who are reviewing current identification keys. Despite low intraspecific variation among their barcode sequences and reduced samples size, five species showed preliminary evidence of phylogeographic structure. Overall, the ELASMOMED initiative further emphasizes the key role accurate DNA barcoding libraries play in establishing reliable diagnostic species specific features in otherwise taxonomically problematic groups for biodiversity management and conservation actions.

  1. Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

    Science.gov (United States)

    Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

    2016-08-05

    This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

  2. Creation of reference DNA barcode library and authentication of medicinal plant raw drugs used in Ayurvedic medicine.

    Science.gov (United States)

    Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy

    2016-07-18

    Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy

  3. DNA barcodes for Mexican Cactaceae, plants under pressure from wild collecting.

    Science.gov (United States)

    Yesson, Chris; Bárcenas, Rolando T; Hernández, Héctor M; Ruiz-Maqueda, María de la Luz; Prado, Alberto; Rodríguez, Víctor M; Hawkins, Julie A

    2011-09-01

    DNA barcodes could be a useful tool for plant conservation. Of particular importance is the ability to identify unknown plant material, such as from customs seizures of illegally collected specimens. Mexican cacti are an example of a threatened group, under pressure because of wild collection for the xeriscaping trade and private collectors. Mexican cacti also provide a taxonomically and geographically coherent group with which to test DNA barcodes. Here, we sample the matK barcode for 528 species of Cactaceae including approximately 75% of Mexican species and test the utility of the matK region for species-level identification. We find that the matK DNA barcode can be used to identify uniquely 77% of species sampled, and 79-87% of species of particular conservation importance. However, this is far below the desired rate of 95% and there are significant issues for PCR amplification because of the variability of primer sites. Additionally, we test the nuclear ITS regions for the cactus subfamily Opuntioideae and for the genus Ariocarpus (subfamily Cactoideae). We observed higher rates of variation for ITS (86% unique for Opuntioideae sampled) but a much lower PCR success, encountering significant intra-individual polymorphism in Ariocarpus precluding the use of this marker in this taxon. We conclude that the matK region should provide useful information as a DNA barcode for Cactaceae if the problems with primers can be addressed, but matK alone is not sufficiently variable to achieve species-level identification. Additional complementary regions should be investigated as ITS is shown to be unsuitable. © 2011 Blackwell Publishing Ltd.

  4. DNA barcoding amphibians and reptiles.

    Science.gov (United States)

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  5. Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

    Science.gov (United States)

    Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

    2017-11-01

    The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

  6. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species.

    Science.gov (United States)

    Chen, Shilin; Yao, Hui; Han, Jianping; Liu, Chang; Song, Jingyuan; Shi, Linchun; Zhu, Yingjie; Ma, Xinye; Gao, Ting; Pang, Xiaohui; Luo, Kun; Li, Ying; Li, Xiwen; Jia, Xiaocheng; Lin, Yulin; Leon, Christine

    2010-01-07

    The plant working group of the Consortium for the Barcode of Life recommended the two-locus combination of rbcL+matK as the plant barcode, yet the combination was shown to successfully discriminate among 907 samples from 550 species at the species level with a probability of 72%. The group admits that the two-locus barcode is far from perfect due to the low identification rate, and the search is not over. Here, we compared seven candidate DNA barcodes (psbA-trnH, matK, rbcL, rpoC1, ycf5, ITS2, and ITS) from medicinal plant species. Our ranking criteria included PCR amplification efficiency, differential intra- and inter-specific divergences, and the DNA barcoding gap. Our data suggest that the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA represents the most suitable region for DNA barcoding applications. Furthermore, we tested the discrimination ability of ITS2 in more than 6600 plant samples belonging to 4800 species from 753 distinct genera and found that the rate of successful identification with the ITS2 was 92.7% at the species level. The ITS2 region can be potentially used as a standard DNA barcode to identify medicinal plants and their closely related species. We also propose that ITS2 can serve as a novel universal barcode for the identification of a broader range of plant taxa.

  7. DNA barcoding for biosecurity: case studies from the UK plant protection program.

    Science.gov (United States)

    Hodgetts, Jennifer; Ostojá-Starzewski, Jozef C; Prior, Thomas; Lawson, Rebecca; Hall, Jayne; Boonham, Neil

    2016-11-01

    Since its conception, DNA barcoding has seen a rapid uptake within the research community. Nevertheless, as with many new scientific tools, progression towards the point of routine deployment within diagnostic laboratories has been slow. In this paper, we discuss the application of DNA barcoding in the Defra plant health diagnostic laboratories, where DNA barcoding is used primarily for the identification of invertebrate pests. We present a series of case studies that demonstrate the successful application of DNA barcoding but also reveal some potential limitations to expanded use. The regulated plant pest, Bursephalenchus xylophilus, and one of its vectors, Monochamus alternatus, were found in dining chairs. Some traded wood products are potentially high risk, allowing the movement of longhorn beetles; Trichoferus campestris, Leptura quadrifasciata, and Trichoferus holosericeus were found in a wooden cutlery tray, a railway sleeper, and a dining chair, respectively. An outbreak of Meloidogyne fallax was identified in Allium ampeloprasum and in three weed species. Reference sequences for UK native psyllids were generated to enable the development of rapid diagnostics to be used for monitoring following the release of Aphalara itadori as a biological control agent for Fallopia japonica.

  8. Refining DNA Barcoding Coupled High Resolution Melting for Discrimination of 12 Closely Related Croton Species.

    Directory of Open Access Journals (Sweden)

    Maslin Osathanunkul

    Full Text Available DNA barcoding coupled high resolution melting (Bar-HRM is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Croton (Euphorbiaceae, one of the largest genera of plants with over 1,200 species. Seven primer pairs were evaluated (matK, rbcL1, rbcL2, rbcL3, rpoC, trnL and ITS1 from four plastid regions, matK, rbcL, rpoC, and trnL, and the nuclear ribosomal marker ITS1. The primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL1 primer pair gave the lowest resolution. It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Our Bar-HRM results here also provide further support for the hypothesis that both sequence and base composition affect DNA duplex stability.

  9. DNA barcoding and the identification of tree frogs (Amphibia: Anura: Rhacophoridae).

    Science.gov (United States)

    Dang, Ning-Xin; Sun, Feng-Hui; Lv, Yun-Yun; Zhao, Bo-Han; Wang, Ji-Chao; Murphy, Robert W; Wang, Wen-Zhi; Li, Jia-Tang

    2016-07-01

    The DNA barcoding gene COI (cytochrome c oxidase subunit I) effectively identifies many species. Herein, we barcoded 172 individuals from 37 species belonging to nine genera in Rhacophoridae to test if the gene serves equally well to identify species of tree frogs. Phenetic neighbor joining and phylogenetic Bayesian inference were used to construct phylogenetic trees, which resolved all nine genera as monophyletic taxa except for Rhacophorus, two new matrilines for Liuixalus, and Polypedates leucomystax species complex. Intraspecific genetic distances ranged from 0.000 to 0.119 and interspecific genetic distances ranged from 0.015 to 0.334. Within Rhacophorus and Kurixalus, the intra- and interspecific genetic distances did not reveal an obvious barcode gap. Notwithstanding, we found that COI sequences unambiguously identified rhacophorid species and helped to discover likely new cryptic species via the synthesis of genealogical relationships and divergence patterns. Our results supported that COI is an effective DNA barcoding marker for Rhacophoridae.

  10. Use of pyrosequencing and DNA barcodes to monitor variations in Firmicutes and Bacteroidetes communities in the gut microbiota of obese humans

    Directory of Open Access Journals (Sweden)

    Raoult Didier

    2008-12-01

    Full Text Available Abstract Background Recent studies of 16S rRNA genes in the mammalian gut microbiota distinguished a higher Firmicutes/Bacteroidetes ratio in obese individuals compared to lean individuals. This ratio was estimated using a clonal Sanger sequencing approach which is time-consuming and requires laborious data analysis. In contrast, new high-throughput pyrosequencing technology offers an inexpensive alternative to clonal Sanger sequencing and would significantly advance our understanding of obesity via the development of a clinical diagnostic method. Here we present a cost-effective method that combines 16S rRNA pyrosequencing and DNA barcodes of the Firmicutes and Bacteroidetes 16S rRNA genes to determine the Firmicutes/Bacteroidetes ratio in the gut microbiota of obese humans. Results The main result was the identification of DNA barcodes targeting the Firmicutes and Bacteroidetes phyla. These barcodes were validated using previously published 16S rRNA gut microbiota clone libraries. In addition, an accurate F/B ratio was found when the DNA barcodes were applied to short pyrosequencing reads of published gut metagenomes. Finally, the barcodes were utilized to define the F/B ratio of 16S rRNA pyrosequencing data generated from brain abscess pus and cystic fibrosis sputum. Conclusion Using DNA barcodes of Bacteroidetes and Firmicutes 16S rRNA genes combined with pyrosequencing is a cost-effective method for monitoring relevant changes in the relative abundance of Firmicutes and Bacteroidetes bacterial communities in microbial ecosystems.

  11. Barcode of life: Advancing species identification and discovery

    Digital Repository Service at National Institute of Oceanography (India)

    Chandramohan, D.

    -based identification systems and the dwindling pool of taxonomists highlight the need for alternate methods for species identification which should be quick, cost effective and efficient. DNA barcoding emerges as a most favoured alternate method by the researchers..., electronics and computer science. The mission of the CBOL is to develop DNA barcoding as a global standard in taxonomy, rapidly accelerate compiling of DNA barcodes of known and newly discovered plant and animal species, establish a public library...

  12. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  13. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  14. Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada.

    Science.gov (United States)

    Kuzmina, Maria L; Braukmann, Thomas W A; Fazekas, Aron J; Graham, Sean W; Dewaard, Stephanie L; Rodrigues, Anuar; Bennett, Bruce A; Dickinson, Timothy A; Saarela, Jeffery M; Catling, Paul M; Newmaster, Steven G; Percy, Diana M; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R; Zakharov, Evgeny V; Hebert, Paul D N

    2017-12-01

    Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa.

  15. A DNA Barcode Library for North American Pyraustinae (Lepidoptera: Pyraloidea: Crambidae).

    Science.gov (United States)

    Yang, Zhaofu; Landry, Jean-François; Hebert, Paul D N

    2016-01-01

    Although members of the crambid subfamily Pyraustinae are frequently important crop pests, their identification is often difficult because many species lack conspicuous diagnostic morphological characters. DNA barcoding employs sequence diversity in a short standardized gene region to facilitate specimen identifications and species discovery. This study provides a DNA barcode reference library for North American pyraustines based upon the analysis of 1589 sequences recovered from 137 nominal species, 87% of the fauna. Data from 125 species were barcode compliant (>500bp, barcode sharing, creating a total of 155 BINs. Two systems for OTU designation, ABGD and BIN, were examined to check the correspondence between current taxonomy and sequence clusters. The BIN system performed better than ABGD in delimiting closely related species, while OTU counts with ABGD were influenced by the value employed for relative gap width. Different species with low or no interspecific divergence may represent cases of unrecognized synonymy, whereas those with high intraspecific divergence require further taxonomic scrutiny as they may involve cryptic diversity. The barcode library developed in this study will also help to advance understanding of relationships among species of Pyraustinae.

  16. Exploring Canadian Echinoderm Diversity through DNA Barcodes.

    Directory of Open Access Journals (Sweden)

    Kara K S Layton

    Full Text Available DNA barcoding has proven an effective tool for species identification in varied groups of marine invertebrates including crustaceans, molluscs, polychaetes and echinoderms. In this study, we further validate its utility by analyzing almost half of the 300 species of Echinodermata known from Canadian waters. COI sequences from 999 specimens were assigned to 145 BINs. In most cases, species discrimination was straightforward due to the large difference (25-fold between mean intra- (0.48% and inter- (12.0% specific divergence. Six species were flagged for further taxonomic investigation because specimens assigned to them fell into two or three discrete sequence clusters. The potential influence of larval dispersal capacity and glacial events on patterns of genetic diversity is discussed for 19 trans-oceanic species. Although additional research is needed to clarify biogeographic patterns and resolve taxonomic questions, this study represents an important step in the assembly of a DNA barcode library for all Canadian echinoderms, a valuable resource for future biosurveillance programs.

  17. Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

    Science.gov (United States)

    Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R

    2016-11-05

    DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Detection of proteins using a colorimetric bio-barcode assay.

    Science.gov (United States)

    Nam, Jwa-Min; Jang, Kyung-Jin; Groves, Jay T

    2007-01-01

    The colorimetric bio-barcode assay is a red-to-blue color change-based protein detection method with ultrahigh sensitivity. This assay is based on both the bio-barcode amplification method that allows for detecting miniscule amount of targets with attomolar sensitivity and gold nanoparticle-based colorimetric DNA detection method that allows for a simple and straightforward detection of biomolecules of interest (here we detect interleukin-2, an important biomarker (cytokine) for many immunodeficiency-related diseases and cancers). The protocol is composed of the following steps: (i) conjugation of target capture molecules and barcode DNA strands onto silica microparticles, (ii) target capture with probes, (iii) separation and release of barcode DNA strands from the separated probes, (iv) detection of released barcode DNA using DNA-modified gold nanoparticle probes and (v) red-to-blue color change analysis with a graphic software. Actual target detection and quantification steps with premade probes take approximately 3 h (whole protocol including probe preparations takes approximately 3 days).

  19. Applications of three DNA barcodes in assorting intertidal red macroalgal flora in Qingdao, China

    Science.gov (United States)

    Zhao, Xiaobo; Pang, Shaojun; Shan, Tifeng; Liu, Feng

    2013-03-01

    This study is part of the endeavor to construct a comprehensive DNA barcoding database for common seaweeds in China. Identifications of red seaweeds, which have simple morphology and anatomy, are sometimes difficult solely depending on morphological characteristics. In recent years, DNA barcode technique has become a more and more effective tool to help solve some of the taxonomic difficulties. Some DNA markers such as COI (cytochrome oxidase subunit I) are proposed as standardized DNA barcodes for all seaweed species. In this study, COI, UPA (universal plastid amplicon, domain V of 23S rRNA), and ITS (nuclear internal transcribed spacer) were employed to analyze common species of intertidal red seaweeds in Qingdao (119.3°-121°E, 35.35°-37.09°N). The applicability of using one or a few combined barcodes to identify red seaweed species was tested. The results indicated that COI is a sensitive marker at species level. However, not all the tested species gave PCR amplification products due to lack of the universal primers. The second barcode UPA had effective universal primers but needed to be tested for the effectiveness of resolving closely related species. More than one ITS sequence types were found in some species in this investigation, which might lead to confusion in further analysis. Therefore ITS sequence is not recommended as a universal barcode for seaweeds identification.

  20. Accelerated construction of a regional DNA-barcode reference library: Caddisflies (Trichoptera) in the Great Smoky Mountains National Park

    Science.gov (United States)

    Zhou, X.; Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S.; Etnier, D.A.; Ruiter, D.; DeWalt, R.E.; Jacobus, L.M.; Hebert, P.D.N.

    2011-01-01

    Deoxyribonucleic acid (DNA) barcoding is an effective tool for species identification and lifestage association in a wide range of animal taxa. We developed a strategy for rapid construction of a regional DNA-barcode reference library and used the caddisflies (Trichoptera) of the Great Smoky Mountains National Park (GSMNP) as a model. Nearly 1000 cytochrome c oxidase subunit I (COI) sequences, representing 209 caddisfly species previously recorded from GSMNP, were obtained from the global Trichoptera Barcode of Life campaign. Most of these sequences were collected from outside the GSMNP area. Another 645 COI sequences, representing 80 species, were obtained from specimens collected in a 3-d bioblitz (short-term, intense sampling program) in GSMNP. The joint collections provided barcode coverage for 212 species, 91% of the GSMNP fauna. Inclusion of samples from other localities greatly expedited construction of the regional DNA-barcode reference library. This strategy increased intraspecific divergence and decreased average distances to nearest neighboring species, but the DNA-barcode library was able to differentiate 93% of the GSMNP Trichoptera species examined. Global barcoding projects will aid construction of regional DNA-barcode libraries, but local surveys make crucial contributions to progress by contributing rare or endemic species and full-length barcodes generated from high-quality DNA. DNA taxonomy is not a goal of our present work, but the investigation of COI divergence patterns in caddisflies is providing new insights into broader biodiversity patterns in this group and has directed attention to various issues, ranging from the need to re-evaluate species taxonomy with integrated morphological and molecular evidence to the necessity of an appropriate interpretation of barcode analyses and its implications in understanding species diversity (in contrast to a simple claim for barcoding failure).

  1. Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

    Science.gov (United States)

    Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

  2. Next-generation detection of antigen-responsive T cells using DNA barcode-labeled peptide-major histocompatibility complex I multimers

    DEFF Research Database (Denmark)

    Bentzen, Amalie Kai; Marquard, Andrea Marion; Lyngaa, Rikke Birgitte

    2016-01-01

    sample using >1000 different peptide-MHC multimers labeled with individual DNA barcodes.After isolation of MHC multimer binding T cells their recognition are revealed by amplification andsequencing of the MHC multimer-associated DNA barcodes. The relative frequency of the sequencedDNA barcodes...... originating from a given peptide-MHC motif relates to the size of the antigenresponsiveT cell population. We have demonstrated the use of large panels of >1000 DNA barcodedMHC multimers for detection of rareT cell populations of virus and cancer-restricted origin in various tissues and compared...

  3. Accelerating plant DNA barcode reference library construction using herbarium specimens: improved experimental techniques.

    Science.gov (United States)

    Xu, Chao; Dong, Wenpan; Shi, Shuo; Cheng, Tao; Li, Changhao; Liu, Yanlei; Wu, Ping; Wu, Hongkun; Gao, Peng; Zhou, Shiliang

    2015-11-01

    A well-covered reference library is crucial for successful identification of species by DNA barcoding. The biggest difficulty in building such a reference library is the lack of materials of organisms. Herbarium collections are potentially an enormous resource of materials. In this study, we demonstrate that it is likely to build such reference libraries using the reconstructed (self-primed PCR amplified) DNA from the herbarium specimens. We used 179 rosaceous specimens to test the effects of DNA reconstruction, 420 randomly sampled specimens to estimate the usable percentage and another 223 specimens of true cherries (Cerasus, Rosaceae) to test the coverage of usable specimens to the species. The barcode rbcLb (the central four-sevenths of rbcL gene) and matK was each amplified in two halves and sequenced on Roche GS 454 FLX+. DNA from the herbarium specimens was typically shorter than 300 bp. DNA reconstruction enabled amplification fragments of 400-500 bp without bringing or inducing any sequence errors. About one-third of specimens in the national herbarium of China (PE) were proven usable after DNA reconstruction. The specimens in PE cover all Chinese true cherry species and 91.5% of vascular species listed in Flora of China. It is very possible to build well-covered reference libraries for DNA barcoding of vascular species in China. As exemplified in this study, DNA reconstruction and DNA-labelled next-generation sequencing can accelerate the construction of local reference libraries. By putting the local reference libraries together, a global library for DNA barcoding becomes closer to reality. © 2015 John Wiley & Sons Ltd.

  4. Assessing DNA Barcodes for Species Identification in North American Reptiles and Amphibians in Natural History Collections.

    Science.gov (United States)

    Chambers, E Anne; Hebert, Paul D N

    2016-01-01

    High rates of species discovery and loss have led to the urgent need for more rapid assessment of species diversity in the herpetofauna. DNA barcoding allows for the preliminary identification of species based on sequence divergence. Prior DNA barcoding work on reptiles and amphibians has revealed higher biodiversity counts than previously estimated due to cases of cryptic and undiscovered species. Past studies have provided DNA barcodes for just 14% of the North American herpetofauna, revealing the need for expanded coverage. This study extends the DNA barcode reference library for North American herpetofauna, assesses the utility of this approach in aiding species delimitation, and examines the correspondence between current species boundaries and sequence clusters designated by the BIN system. Sequences were obtained from 730 specimens, representing 274 species (43%) from the North American herpetofauna. Mean intraspecific divergences were 1% and 3%, while average congeneric sequence divergences were 16% and 14% in amphibians and reptiles, respectively. BIN assignments corresponded with current species boundaries in 79% of amphibians, 100% of turtles, and 60% of squamates. Deep divergences (>2%) were noted in 35% of squamate and 16% of amphibian species, and low divergences (reptiles and 23% of amphibians, patterns reflected in BIN assignments. Sequence recovery declined with specimen age, and variation in recovery success was noted among collections. Within collections, barcodes effectively flagged seven mislabeled tissues, and barcode fragments were recovered from five formalin-fixed specimens. This study demonstrates that DNA barcodes can effectively flag errors in museum collections, while BIN splits and merges reveal taxa belonging to deeply diverged or hybridizing lineages. This study is the first effort to compile a reference library of DNA barcodes for herpetofauna on a continental scale.

  5. Using DNA barcoding to assess Caribbean reef fish biodiversity: expanding taxonomic and geographic coverage.

    Directory of Open Access Journals (Sweden)

    Lee A Weigt

    Full Text Available This paper represents a DNA barcode data release for 3,400 specimens representing 521 species of fishes from 6 areas across the Caribbean and western central Atlantic regions (FAO Region 31. Merged with our prior published data, the combined efforts result in 3,964 specimens representing 572 species of marine fishes and constitute one of the most comprehensive DNA barcoding "coverages" for a region reported to date. The barcode data are providing new insights into Caribbean shorefish diversity, allowing for more and more accurate DNA-based identifications of larvae, juveniles, and unknown specimens. Examples are given correcting previous work that was erroneous due to database incompleteness.

  6. PCR-free quantitative detection of genetically modified organism from raw materials – A novel electrochemiluminescence-based bio-barcode method

    Science.gov (United States)

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.

    2018-01-01

    Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909

  7. A single-laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance.

    Science.gov (United States)

    Handy, Sara M; Deeds, Jonathan R; Ivanova, Natalia V; Hebert, Paul D N; Hanner, Robert H; Ormos, Andrea; Weigt, Lee A; Moore, Michelle M; Yancy, Haile F

    2011-01-01

    The U.S. Food and Drug Administration is responsible for ensuring that the nation's food supply is safe and accurately labeled. This task is particularly challenging in the case of seafood where a large variety of species are marketed, most of this commodity is imported, and processed product is difficult to identify using traditional morphological methods. Reliable species identification is critical for both foodborne illness investigations and for prevention of deceptive practices, such as those where species are intentionally mislabeled to circumvent import restrictions or for resale as species of higher value. New methods that allow accurate and rapid species identifications are needed, but any new methods to be used for regulatory compliance must be both standardized and adequately validated. "DNA barcoding" is a process by which species discriminations are achieved through the use of short, standardized gene fragments. For animals, a fragment (655 base pairs starting near the 5' end) of the cytochrome c oxidase subunit 1 mitochondrial gene has been shown to provide reliable species level discrimination in most cases. We provide here a protocol with single-laboratory validation for the generation of DNA barcodes suitable for the identification of seafood products, specifically fish, in a manner that is suitable for FDA regulatory use.

  8. Detection of HIV-1 p24 Gag in plasma by a nanoparticle-based bio-barcode-amplification method.

    Science.gov (United States)

    Kim, Eun-Young; Stanton, Jennifer; Korber, Bette T M; Krebs, Kendall; Bogdan, Derek; Kunstman, Kevin; Wu, Samuel; Phair, John P; Mirkin, Chad A; Wolinsky, Steven M

    2008-06-01

    Detection of HIV-1 in patients is limited by the sensitivity and selectivity of available tests. The nanotechnology-based bio-barcode-amplification method offers an innovative approach to detect specific HIV-1 antigens from diverse HIV-1 subtypes. We evaluated the efficacy of this protein-detection method in detecting HIV-1 in men enrolled in the Chicago component of the Multicenter AIDS Cohort Study (MACS). The method relies on magnetic microparticles with antibodies that specifically bind the HIV-1 p24 Gag protein and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the microparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes (hundreds per target) were identified by a nanoparticle-based detection method that does not rely on PCR. Of 112 plasma samples from HIV-1-infected subjects, 111 were positive for HIV-1 p24 Gag protein (range: 0.11-71.5 ng/ml of plasma) by the bio-barcode-amplification method. HIV-1 p24 Gag protein was detected in only 23 out of 112 men by the conventional ELISA. A total of 34 uninfected subjects were negative by both tests. Thus, the specificity of the bio-barcode-amplification method was 100% and the sensitivity 99%. The bio-barcode-amplification method detected HIV-1 p24 Gag protein in plasma from all study subjects with less than 200 CD4(+) T cells/microl of plasma (100%) and 19 out of 20 (95%) HIV-1-infected men who had less than 50 copies/ml of plasma of HIV-1 RNA. In a separate group of 60 diverse international isolates, representative of clades A, B, C and D and circulating recombinant forms CRF01_AE and CRF02_AG, the bio-barcode-amplification method identified the presence of virus correctly. The bio-barcode-amplification method was superior to the conventional ELISA assay for the detection of HIV-1 p24 Gag protein in plasma with a breadth of coverage for diverse

  9. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  10. DNA Barcoding the Canadian Arctic Flora: Core Plastid Barcodes (rbcL + matK) for 490 Vascular Plant Species

    Science.gov (United States)

    Saarela, Jeffery M.; Sokoloff, Paul C.; Gillespie, Lynn J.; Consaul, Laurie L.; Bull, Roger D.

    2013-01-01

    Accurate identification of Arctic plant species is critical for understanding potential climate-induced changes in their diversity and distributions. To facilitate rapid identification we generated DNA barcodes for the core plastid barcode loci (rbcL and matK) for 490 vascular plant species, representing nearly half of the Canadian Arctic flora and 93% of the flora of the Canadian Arctic Archipelago. Sequence recovery was higher for rbcL than matK (93% and 81%), and rbcL was easier to recover than matK from herbarium specimens (92% and 77%). Distance-based and sequence-similarity analyses of combined rbcL + matK data discriminate 97% of genera, 56% of species, and 7% of infraspecific taxa. There is a significant negative correlation between the number of species sampled per genus and the percent species resolution per genus. We characterize barcode variation in detail in the ten largest genera sampled (Carex, Draba, Festuca, Pedicularis, Poa, Potentilla, Puccinellia, Ranunculus, Salix, and Saxifraga) in the context of their phylogenetic relationships and taxonomy. Discrimination with the core barcode loci in these genera ranges from 0% in Salix to 85% in Carex. Haplotype variation in multiple genera does not correspond to species boundaries, including Taraxacum, in which the distribution of plastid haplotypes among Arctic species is consistent with plastid variation documented in non-Arctic species. Introgression of Poa glauca plastid DNA into multiple individuals of P. hartzii is problematic for identification of these species with DNA barcodes. Of three supplementary barcode loci (psbA–trnH, psbK–psbI, atpF–atpH) collected for a subset of Poa and Puccinellia species, only atpF–atpH improved discrimination in Puccinellia, compared with rbcL and matK. Variation in matK in Vaccinium uliginosum and rbcL in Saxifraga oppositifolia corresponds to variation in other loci used to characterize the phylogeographic histories of these Arctic-alpine species. PMID

  11. DNA barcoding of odonates from the Upper Plata basin: Database creation and genetic diversity estimation.

    Directory of Open Access Journals (Sweden)

    Ricardo Koroiva

    Full Text Available We present a DNA barcoding study of Neotropical odonates from the Upper Plata basin, Brazil. A total of 38 species were collected in a transition region of "Cerrado" and Atlantic Forest, both regarded as biological hotspots, and 130 cytochrome c oxidase subunit I (COI barcodes were generated for the collected specimens. The distinct gap between intraspecific (0-2% and interspecific variation (15% and above in COI, and resulting separation of Barcode Index Numbers (BIN, allowed for successful identification of specimens in 94% of cases. The 6% fail rate was due to a shared BIN between two separate nominal species. DNA barcoding, based on COI, thus seems to be a reliable and efficient tool for identifying Neotropical odonate specimens down to the species level. These results underscore the utility of DNA barcoding to aid specimen identification in diverse biological hotspots, areas that require urgent action regarding taxonomic surveys and biodiversity conservation.

  12. Analyzing mosquito (Diptera: culicidae diversity in Pakistan by DNA barcoding.

    Directory of Open Access Journals (Sweden)

    Muhammad Ashfaq

    Full Text Available Although they are important disease vectors mosquito biodiversity in Pakistan is poorly known. Recent epidemics of dengue fever have revealed the need for more detailed understanding of the diversity and distributions of mosquito species in this region. DNA barcoding improves the accuracy of mosquito inventories because morphological differences between many species are subtle, leading to misidentifications.Sequence variation in the barcode region of the mitochondrial COI gene was used to identify mosquito species, reveal genetic diversity, and map the distribution of the dengue-vector species in Pakistan. Analysis of 1684 mosquitoes from 491 sites in Punjab and Khyber Pakhtunkhwa during 2010-2013 revealed 32 species with the assemblage dominated by Culex quinquefasciatus (61% of the collection. The genus Aedes (Stegomyia comprised 15% of the specimens, and was represented by six taxa with the two dengue vector species, Ae. albopictus and Ae. aegypti, dominant and broadly distributed. Anopheles made up another 6% of the catch with An. subpictus dominating. Barcode sequence divergence in conspecific specimens ranged from 0-2.4%, while congeneric species showed from 2.3-17.8% divergence. A global haplotype analysis of disease-vectors showed the presence of multiple haplotypes, although a single haplotype of each dengue-vector species was dominant in most countries. Geographic distribution of Ae. aegypti and Ae. albopictus showed the later species was dominant and found in both rural and urban environments.As the first DNA-based analysis of mosquitoes in Pakistan, this study has begun the construction of a barcode reference library for the mosquitoes of this region. Levels of genetic diversity varied among species. Because of its capacity to differentiate species, even those with subtle morphological differences, DNA barcoding aids accurate tracking of vector populations.

  13. Identifying the true oysters (Bivalvia: Ostreidae) with mitochondrial phylogeny and distance-based DNA barcoding.

    Science.gov (United States)

    Liu, Jun; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong

    2011-09-01

    Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis. © 2011 Blackwell Publishing Ltd.

  14. DNA barcodes identify Central Asian Colias butterflies (Lepidoptera, Pieridae).

    Science.gov (United States)

    Laiho, Juha; Ståhls, Gunilla

    2013-12-30

    A majority of the known Colias species (Lepidoptera: Pieridae, Coliadinae) occur in the mountainous regions of Central-Asia, vast areas that are hard to access, rendering the knowledge of many species limited due to the lack of extensive sampling. Two gene regions, the mitochondrial COI 'barcode' region and the nuclear ribosomal protein RpS2 gene region were used for exploring the utility of these DNA markers for species identification. A comprehensive sampling of COI barcodes for Central Asian Colias butterflies showed that the barcodes facilitated identification of most of the included species. Phylogenetic reconstruction based on parsimony and Neighbour-Joining recovered most species as monophyletic entities. For the RpS2 gene region species-specific sequences were registered for some of the included Colias spp. Nevertheless, this gene region was not deemed useful as additional molecular 'barcode'. A parsimony analysis of the combined COI and RpS2 data did not support the current subgeneric classification based on morphological characteristics.

  15. Building-Up of a DNA Barcode Library for True Bugs (Insecta: Hemiptera: Heteroptera) of Germany Reveals Taxonomic Uncertainties and Surprises

    Science.gov (United States)

    Raupach, Michael J.; Hendrich, Lars; Küchler, Stefan M.; Deister, Fabian; Morinière, Jérome; Gossner, Martin M.

    2014-01-01

    During the last few years, DNA barcoding has become an efficient method for the identification of species. In the case of insects, most published DNA barcoding studies focus on species of the Ephemeroptera, Trichoptera, Hymenoptera and especially Lepidoptera. In this study we test the efficiency of DNA barcoding for true bugs (Hemiptera: Heteroptera), an ecological and economical highly important as well as morphologically diverse insect taxon. As part of our study we analyzed DNA barcodes for 1742 specimens of 457 species, comprising 39 families of the Heteroptera. We found low nucleotide distances with a minimum pairwise K2P distance 2.2% were detected for 16 traditionally recognized and valid species. With a successful identification rate of 91.5% (418 species) our study emphasizes the use of DNA barcodes for the identification of true bugs and represents an important step in building-up a comprehensive barcode library for true bugs in Germany and Central Europe as well. Our study also highlights the urgent necessity of taxonomic revisions for various taxa of the Heteroptera, with a special focus on various species of the Miridae. In this context we found evidence for on-going hybridization events within various taxonomically challenging genera (e.g. Nabis Latreille, 1802 (Nabidae), Lygus Hahn, 1833 (Miridae), Phytocoris Fallén, 1814 (Miridae)) as well as the putative existence of cryptic species (e.g. Aneurus avenius (Duffour, 1833) (Aradidae) or Orius niger (Wolff, 1811) (Anthocoridae)). PMID:25203616

  16. The Use of DNA Barcoding in Identification and Conservation of Rosewood (Dalbergia spp.)

    DEFF Research Database (Denmark)

    Hartvig, Ida; Czako, Mihaly; Kjaer, Erik Dahl

    2015-01-01

    efforts of Dalbergia species in Indochina. We used the recommended rbcL, matK and ITS barcoding markers on 95 samples covering 31 species of Dalbergia, and tested their discrimination ability with both traditional distance-based as well as different model-based machine learning methods. We specifically......The genus Dalbergia contains many valuable timber species threatened by illegal logging and deforestation, but knowledge on distributions and threats is often limited and accurate species identification difficult. The aim of this study was to apply DNA barcoding methods to support conservation...

  17. DNA barcoding of the ichthyofauna of Taal Lake, Philippines.

    Science.gov (United States)

    Aquilino, Sean V L; Tango, Jazzlyn M; Fontanilla, Ian K C; Pagulayan, Roberto C; Basiao, Zubaida U; Ong, Perry S; Quilang, Jonas P

    2011-07-01

    This study represents the first molecular survey of the ichthyofauna of Taal Lake and the first DNA barcoding attempt in Philippine fishes. Taal Lake, the third largest lake in the Philippines, is considered a very important fisheries resource and is home to the world's only freshwater sardine, Sardinella tawilis. However, overexploitation and introduction of exotic fishes have caused a massive decline in the diversity of native species as well as in overall productivity of the lake. In this study, 118 individuals of 23 native, endemic and introduced fishes of Taal Lake were barcoded using the partial DNA sequence of the mitochondrial cytochrome c oxidase subunit I (COI) gene. These species belong to 21 genera, 17 families and 9 orders. Divergence of sequences within and between species was determined using Kimura 2-parameter (K2P) distance model, and a neighbour-joining tree was generated with 1000 bootstrap replications using the K2P model. All COI sequences for each of the 23 species were clearly discriminated among genera. The average within species, within genus, within family and within order percent genetic divergence was 0.60%, 11.07%, 17.67% and 24.08%, respectively. Our results provide evidence that COI DNA barcodes are effective for the rapid and accurate identification of fishes and for identifying certain species that need further taxonomic investigation. © 2011 Blackwell Publishing Ltd.

  18. Establishing a community-wide DNA barcode library as a new tool for arctic research.

    Science.gov (United States)

    Wirta, H; Várkonyi, G; Rasmussen, C; Kaartinen, R; Schmidt, N M; Hebert, P D N; Barták, M; Blagoev, G; Disney, H; Ertl, S; Gjelstrup, P; Gwiazdowicz, D J; Huldén, L; Ilmonen, J; Jakovlev, J; Jaschhof, M; Kahanpää, J; Kankaanpää, T; Krogh, P H; Labbee, R; Lettner, C; Michelsen, V; Nielsen, S A; Nielsen, T R; Paasivirta, L; Pedersen, S; Pohjoismäki, J; Salmela, J; Vilkamaa, P; Väre, H; von Tschirnhaus, M; Roslin, T

    2016-05-01

    DNA sequences offer powerful tools for describing the members and interactions of natural communities. In this study, we establish the to-date most comprehensive library of DNA barcodes for a terrestrial site, including all known macroscopic animals and vascular plants of an intensively studied area of the High Arctic, the Zackenberg Valley in Northeast Greenland. To demonstrate its utility, we apply the library to identify nearly 20 000 arthropod individuals from two Malaise traps, each operated for two summers. Drawing on this material, we estimate the coverage of previous morphology-based species inventories, derive a snapshot of faunal turnover in space and time and describe the abundance and phenology of species in the rapidly changing arctic environment. Overall, 403 terrestrial animal and 160 vascular plant species were recorded by morphology-based techniques. DNA barcodes (CO1) offered high resolution in discriminating among the local animal taxa, with 92% of morphologically distinguishable taxa assigned to unique Barcode Index Numbers (BINs) and 93% to monophyletic clusters. For vascular plants, resolution was lower, with 54% of species forming monophyletic clusters based on barcode regions rbcLa and ITS2. Malaise catches revealed 122 BINs not detected by previous sampling and DNA barcoding. The insect community was dominated by a few highly abundant taxa. Even closely related taxa differed in phenology, emphasizing the need for species-level resolution when describing ongoing shifts in arctic communities and ecosystems. The DNA barcode library now established for Zackenberg offers new scope for such explorations, and for the detailed dissection of interspecific interactions throughout the community. © 2015 John Wiley & Sons Ltd.

  19. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    Science.gov (United States)

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2017-06-15

    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  20. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    NARCIS (Netherlands)

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de G.S.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.; Houbraken, J.; Quaedvlieg, W.; Stielow, B.; Vu, T.D.; Walther, G.

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it

  1. DNA barcodes and citizen science provoke a diversity reappraisal for the "ring" butterflies of Peninsular Malaysia (Ypthima: Satyrinae: Nymphalidae: Lepidoptera).

    Science.gov (United States)

    Jisming-See, Shi-Wei; Sing, Kong-Wah; Wilson, John-James

    2016-10-01

    The "rings" belonging to the genus Ypthima are amongst the most common butterflies in Peninsular Malaysia. However, the species can be difficult to tell apart, with keys relying on minor and often non-discrete ring characters found on the hindwing. Seven species have been reported from Peninsular Malaysia, but this is thought to be an underestimate of diversity. DNA barcodes of 165 individuals, and wing and genital morphology, were examined to reappraise species diversity of this genus in Peninsular Malaysia. DNA barcodes collected during citizen science projects-School Butterfly Project and Peninsular Malaysia Butterfly Count-recently conducted in Peninsular Malaysia were included. The new DNA barcodes formed six groups with different Barcode Index Numbers (BINs) representing four species reported in Peninsular Malaysia. When combined with public DNA barcodes from the Barcode Of Life Datasystems, several taxonomic issues arose. We consider the taxon Y. newboldi, formerly treated as a subspecies of Y. baldus, as a distinct species. DNA barcodes also supported an earlier suggestion that Y. nebulosa is a synonym under Y. horsfieldii humei. Two BINs of the genus Ypthima comprising DNA barcodes collected during citizen science projects did not correspond to any species previously reported in Peninsular Malaysia.

  2. A comparative analysis of DNA barcode microarray feature size

    Directory of Open Access Journals (Sweden)

    Smith Andrew M

    2009-10-01

    Full Text Available Abstract Background Microarrays are an invaluable tool in many modern genomic studies. It is generally perceived that decreasing the size of microarray features leads to arrays with higher resolution (due to greater feature density, but this increase in resolution can compromise sensitivity. Results We demonstrate that barcode microarrays with smaller features are equally capable of detecting variation in DNA barcode intensity when compared to larger feature sizes within a specific microarray platform. The barcodes used in this study are the well-characterized set derived from the Yeast KnockOut (YKO collection used for screens of pooled yeast (Saccharomyces cerevisiae deletion mutants. We treated these pools with the glycosylation inhibitor tunicamycin as a test compound. Three generations of barcode microarrays at 30, 8 and 5 μm features sizes independently identified the primary target of tunicamycin to be ALG7. Conclusion We show that the data obtained with 5 μm feature size is of comparable quality to the 30 μm size and propose that further shrinking of features could yield barcode microarrays with equal or greater resolving power and, more importantly, higher density.

  3. Machine Learned Replacement of N-Labels for Basecalled Sequences in DNA Barcoding.

    Science.gov (United States)

    Ma, Eddie Y T; Ratnasingham, Sujeevan; Kremer, Stefan C

    2018-01-01

    This study presents a machine learning method that increases the number of identified bases in Sanger Sequencing. The system post-processes a KB basecalled chromatogram. It selects a recoverable subset of N-labels in the KB-called chromatogram to replace with basecalls (A,C,G,T). An N-label correction is defined given an additional read of the same sequence, and a human finished sequence. Corrections are added to the dataset when an alignment determines the additional read and human agree on the identity of the N-label. KB must also rate the replacement with quality value of in the additional read. Corrections are only available during system training. Developing the system, nearly 850,000 N-labels are obtained from Barcode of Life Datasystems, the premier database of genetic markers called DNA Barcodes. Increasing the number of correct bases improves reference sequence reliability, increases sequence identification accuracy, and assures analysis correctness. Keeping with barcoding standards, our system maintains an error rate of percent. Our system only applies corrections when it estimates low rate of error. Tested on this data, our automation selects and recovers: 79 percent of N-labels from COI (animal barcode); 80 percent from matK and rbcL (plant barcodes); and 58 percent from non-protein-coding sequences (across eukaryotes).

  4. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Science.gov (United States)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  5. DNA barcoding of medicinal plant material for identification

    Science.gov (United States)

    Because of the increasing demand for herbal remedies and for authentication of the source material, it is vital to provide a single database containing information about authentic plant materials and their potential adulterants. The database should provide DNA barcodes for data retrieval and similar...

  6. Molecular species identification with rich floristic sampling: DNA barcoding the pteridophyte flora of Japan.

    Directory of Open Access Journals (Sweden)

    Atsushi Ebihara

    Full Text Available BACKGROUND: DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. METHODOLOGY/PRINCIPAL FINDINGS: The Japanese pteridophyte flora (733 taxa including subspecies and varieties was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0% taxa for rbcL and 617 (84.2% taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52% was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially

  7. DNA barcoding of the Lemnaceae, a family of aquatic monocots

    Directory of Open Access Journals (Sweden)

    Wang Wenqin

    2010-09-01

    Full Text Available Abstract Background Members of the aquatic monocot family Lemnaceae (commonly called duckweeds represent the smallest and fastest growing flowering plants. Their highly reduced morphology and infrequent flowering result in a dearth of characters for distinguishing between the nearly 38 species that exhibit these tiny, closely-related and often morphologically similar features within the same family of plants. Results We developed a simple and rapid DNA-based molecular identification system for the Lemnaceae based on sequence polymorphisms. We compared the barcoding potential of the seven plastid-markers proposed by the CBOL (Consortium for the Barcode of Life plant-working group to discriminate species within the land plants in 97 accessions representing 31 species from the family of Lemnaceae. A Lemnaceae-specific set of PCR and sequencing primers were designed for four plastid coding genes (rpoB, rpoC1, rbcL and matK and three noncoding spacers (atpF-atpH, psbK-psbI and trnH-psbA based on the Lemna minor chloroplast genome sequence. We assessed the ease of amplification and sequencing for these markers, examined the extent of the barcoding gap between intra- and inter-specific variation by pairwise distances, evaluated successful identifications based on direct sequence comparison of the "best close match" and the construction of a phylogenetic tree. Conclusions Based on its reliable amplification, straightforward sequence alignment, and rates of DNA variation between species and within species, we propose that the atpF-atpH noncoding spacer could serve as a universal DNA barcoding marker for species-level identification of duckweeds.

  8. Gold Nanoparticles-Based Barcode Analysis for Detection of Norepinephrine.

    Science.gov (United States)

    An, Jeung Hee; Lee, Kwon-Jai; Choi, Jeong-Woo

    2016-02-01

    Nanotechnology-based bio-barcode amplification analysis offers an innovative approach for detecting neurotransmitters. We evaluated the efficacy of this method for detecting norepinephrine in normal and oxidative-stress damaged dopaminergic cells. Our approach use a combination of DNA barcodes and bead-based immunoassays for detecting neurotransmitters with surface-enhanced Raman spectroscopy (SERS), and provides polymerase chain reaction (PCR)-like sensitivity. This method relies on magnetic Dynabeads containing antibodies and nanoparticles that are loaded both with DNA barcords and with antibodies that can sandwich the target protein captured by the Dynabead-bound antibodies. The aggregate sandwich structures are magnetically separated from the solution and treated to remove the conjugated barcode DNA. The DNA barcodes are then identified by SERS and PCR analysis. The concentration of norepinephrine in dopaminergic cells can be readily detected using the bio-barcode assay, which is a rapid, high-throughput screening tool for detecting neurotransmitters.

  9. Utility of DNA barcoding for rapid and accurate assessment of bat diversity in Malaysia in the absence of formally described species.

    Science.gov (United States)

    Wilson, J-J; Sing, K-W; Halim, M R A; Ramli, R; Hashim, R; Sofian-Azirun, M

    2014-02-19

    Bats are important flagship species for biodiversity research; however, diversity in Southeast Asia is considerably underestimated in the current checklists and field guides. Incorporation of DNA barcoding into surveys has revealed numerous species-level taxa overlooked by conventional methods. Inclusion of these taxa in inventories provides a more informative record of diversity, but is problematic as these species lack formal description. We investigated how frequently documented, but undescribed, bat taxa are encountered in Peninsular Malaysia. We discuss whether a barcode library provides a means of recognizing and recording these taxa across biodiversity inventories. Tissue was sampled from bats trapped at Pasir Raja, Dungun Terengganu, Peninsular Malaysia. The DNA was extracted and the COI barcode region amplified and sequenced. We identified 9 species-level taxa within our samples, based on analysis of the DNA barcodes. Six specimens matched to four previously documented taxa considered candidate species but currently lacking formal taxonomic status. This study confirms the high diversity of bats within Peninsular Malaysia (9 species in 13 samples) and demonstrates how DNA barcoding allows for inventory and documentation of known taxa lacking formal taxonomic status.

  10. Assessment of four molecular markers as potential DNA barcodes for red algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta).

    Science.gov (United States)

    Tan, Ji; Lim, Phaik-Eem; Phang, Siew-Moi; Hong, Dang Diem; Sunarpi, H; Hurtado, Anicia Q

    2012-01-01

    DNA barcoding has been a major advancement in the field of taxonomy, seeing much effort put into the barcoding of wide taxa of organisms, macro and microalgae included. The mitochondrial-encoded cox1 and plastid-encoded rbcL has been proposed as potential DNA barcodes for rhodophytes, but are yet to be tested on the commercially important carrageenophytes Kappaphycus and Eucheuma. This study gauges the effectiveness of four markers, namely the mitochondrial cox1, cox2, cox2-3 spacer and the plastid rbcL in DNA barcoding on selected Kappaphycus and Eucheuma from Southeast Asia. Marker assessments were performed using established distance and tree-based identification criteria from earlier studies. Barcoding patterns on a larger scale were simulated by empirically testing on the commonly used cox2-3 spacer. The phylogeny of these rhodophytes was also briefly described. In this study, the cox2 marker which satisfies the prerequisites of DNA barcodes was found to exhibit moderately high interspecific divergences with no intraspecific variations, thus a promising marker for the DNA barcoding of Kappaphycus and Eucheuma. However, the already extensively used cox2-3 spacer was deemed to be in overall more appropriate as a DNA barcode for these two genera. On a wider scale, cox1 and rbcL were still better DNA barcodes across the rhodophyte taxa when practicality and cost-efficiency were taken into account. The phylogeny of Kappaphycus and Eucheuma were generally similar to those earlier reported. Still, the application of DNA barcoding has demonstrated our relatively poor taxonomic comprehension of these seaweeds, thus suggesting more in-depth efforts in taxonomic restructuring as well as establishment.

  11. DNA barcoding: a tool for standardization of herbal medicinal products (HMPS) of lamiaceae from pakistan

    International Nuclear Information System (INIS)

    Zahra, N.B.; Shinwari, Z.K.

    2016-01-01

    There has been a considerable interest worldwide in traditional and alternative medicine, particularly herbal products over the past few decades but the adulteration or contamination of herbal medicinal products (HMPs) is a potential threat to consumer safety. The fact highlights the importance of an effective and accurate science integrated method for taxonomic identification of the medicinal plants and their HMPs. DNA barcoding is a molecular technique which has made it possible to identify the herbs and to find the adulterants in HMPs. The current study was designed on DNA barcoding of medicinal plants of family Lamiaceae for their correct identification and to fix the problem of adulteration for protecting consumers from health risks associated with product substitution and contamination. Many Lamiaceae species are used as traditional medicines, as culinary herbs, spices and as source of essential oils. HMPs representing 32 Lamiaceae plant samples were purchased/collected from three herbal stores (Pansar stores) in Islamabad and a herbal pharmaceutical industry. We selected three plastid loci rbcL, matK and psbA-trnH to barcode these HMPs. MEGABLAST sequence comparison was performed to verify the taxonomic identity of the samples. We found four mislabeled samples and two product substitutions. The overall amplification success for rbcL and matK was 87% and 81% while psbA-trnH showed 69%. matK and psbA-trnH were able to distinguish the species relatively better with 40% success rate than rbcL (16%). On the whole we generated a total of 22 genus-level barcodes (78%) and 12 species-level barcodes (44%). The species-level identification was considerably low due to insufficient reference data and selection of plastid markers. Therefore, it is recommended to develop herbal barcode library for adequate availability of reference sequence data and addition of nuclear markers. DNA barcoding can help the regulatory authorities to devise a mechanism for quality control and

  12. Our love-hate relationship with DNA barcodes, the Y2K problem, and the search for next generation barcodes

    Directory of Open Access Journals (Sweden)

    Jeffrey M. Marcus

    2018-01-01

    Full Text Available DNA barcodes are very useful for species identification especially when identification by traditional morphological characters is difficult. However, the short mitochondrial and chloroplast barcodes currently in use often fail to distinguish between closely related species, are prone to lateral transfer, and provide inadequate phylogenetic resolution, particularly at deeper nodes. The deficiencies of short barcode identifiers are similar to the deficiencies of the short year identifiers that caused the Y2K problem in computer science. The resolution of the Y2K problem was to increase the size of the year identifiers. The performance of conventional mitochondrial COI barcodes for phylogenetics was compared with the performance of complete mitochondrial genomes and nuclear ribosomal RNA repeats obtained by genome skimming for a set of caddisfly taxa (Insect Order Trichoptera. The analysis focused on Trichoptera Family Hydropsychidae, the net-spinning caddisflies, which demonstrates many of the frustrating limitations of current barcodes. To conduct phylogenetic comparisons, complete mitochondrial genomes (15 kb each and nuclear ribosomal repeats (9 kb each from six caddisfly species were sequenced, assembled, and are reported for the first time. These sequences were analyzed in comparison with eight previously published trichopteran mitochondrial genomes and two triochopteran rRNA repeats, plus outgroup sequences from sister clade Lepidoptera (butterflies and moths. COI trees were not well-resolved, had low bootstrap support, and differed in topology from prior phylogenetic analyses of the Trichoptera. Phylogenetic trees based on mitochondrial genomes or rRNA repeats were well-resolved with high bootstrap support and were largely congruent with each other. Because they are easily sequenced by genome skimming, provide robust phylogenetic resolution at various phylogenetic depths, can better distinguish between closely related species, and (in the

  13. Identifying the ichthyoplankton of a coral reef using DNA barcodes.

    Science.gov (United States)

    Hubert, Nicolas; Espiau, Benoit; Meyer, Christopher; Planes, Serge

    2015-01-01

    Marine fishes exhibit spectacular phenotypic changes during their ontogeny, and the identification of their early stages is challenging due to the paucity of diagnostic morphological characters at the species level. Meanwhile, the importance of early life stages in dispersal and connectivity has recently experienced an increasing interest in conservation programmes for coral reef fishes. This study aims at assessing the effectiveness of DNA barcoding for the automated identification of coral reef fish larvae through large-scale ecosystemic sampling. Fish larvae were mainly collected using bongo nets and light traps around Moorea between September 2008 and August 2010 in 10 sites distributed in open waters. Fish larvae ranged from 2 to 100 mm of total length, with the most abundant individuals being <5 mm. Among the 505 individuals DNA barcoded, 373 larvae (i.e. 75%) were identified to the species level. A total of 106 species were detected, among which 11 corresponded to pelagic and bathypelagic species, while 95 corresponded to species observed at the adult stage on neighbouring reefs. This study highlights the benefits and pitfalls of using standardized molecular systems for species identification and illustrates the new possibilities enabled by DNA barcoding for future work on coral reef fish larval ecology. © 2014 John Wiley & Sons Ltd.

  14. Incorporating trnH-psbA to the core DNA barcodes improves significantly species discrimination within southern African Combretaceae

    Directory of Open Access Journals (Sweden)

    Jephris Gere

    2013-12-01

    Full Text Available Recent studies indicate that the discriminatory power of the core DNA barcodes (rbcLa + matK for land plants may have been overestimated since their performance have been tested only on few closely related species. In this study we focused mainly on how the addition of complementary barcodes (nrITS and trnH-psbA to the core barcodes will affect the performance of the core barcodes in discriminating closely related species from family to section levels. In general, we found that the core barcodes performed poorly compared to the various combinations tested. Using multiple criteria, we finally advocated for the use of the core + trnH-psbA as potential DNA barcode for the family Combretaceae at least in southern Africa. Our results also indicate that the success of DNA barcoding in discriminating closely related species may be related to evolutionary and possibly the biogeographic histories of the taxonomic group tested.

  15. DNA barcode of coastal alga ( Chlorella sorokiniana ) from Ago ...

    African Journals Online (AJOL)

    Five different loci 18S, UPA, rbcl, ITS and tufA were tested for their use as deoxyribonucleic acid (DNA) barcode in this study. Although the UPA primers were designed to amplify all phototrophic algae and cyanobacteria, UPA and 18S did not amplified at all for the genus Chlorella while ITS1, ITS2 rDNA and rbcL markers ...

  16. Profiling nematode communities in unmanaged flowerbed and agricultural field soils in Japan by DNA barcode sequencing.

    Directory of Open Access Journals (Sweden)

    Hisashi Morise

    Full Text Available Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU rDNA fragments were directly amplified from each of 68 (flowerbed samples and 48 (field samples isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs, indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis.

  17. Profiling Nematode Communities in Unmanaged Flowerbed and Agricultural Field Soils in Japan by DNA Barcode Sequencing

    Science.gov (United States)

    Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko

    2012-01-01

    Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767

  18. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  19. DNA Barcoding for Species Identification of Insect Skins: A Test on Chironomidae (Diptera) Pupal Exuviae

    Science.gov (United States)

    Ekrem, Torbjørn; Stur, Elisabeth

    2017-01-01

    Abstract Chironomidae (Diptera) pupal exuviae samples are commonly used for biological monitoring of aquatic habitats. DNA barcoding has proved useful for species identification of chironomid life stages containing cellular tissue, but the barcoding success of chironomid pupal exuviae is unknown. We assessed whether standard DNA barcoding could be efficiently used for species identification of chironomid pupal exuviae when compared with morphological techniques and if there were differences in performance between temperate and tropical ecosystems, subfamilies, and tribes. PCR, sequence, and identification success differed significantly between geographic regions and taxonomic groups. For Norway, 27 out of 190 (14.2%) of pupal exuviae resulted in high-quality chironomid sequences that match species. For Costa Rica, 69 out of 190 (36.3%) Costa Rican pupal exuviae resulted in high-quality sequences, but none matched known species. Standard DNA barcoding of chironomid pupal exuviae had limited success in species identification of unknown specimens due to contaminations and lack of matching references in available barcode libraries, especially from Costa Rica. Therefore, we recommend future biodiversity studies that focus their efforts on understudied regions, to simultaneously use morphological and molecular identification techniques to identify all life stages of chironomids and populate the barcode reference library with identified sequences.

  20. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  1. Assembling and auditing a comprehensive DNA barcode reference library for European marine fishes.

    Science.gov (United States)

    Oliveira, L M; Knebelsberger, T; Landi, M; Soares, P; Raupach, M J; Costa, F O

    2016-12-01

    A large-scale comprehensive reference library of DNA barcodes for European marine fishes was assembled, allowing the evaluation of taxonomic uncertainties and species genetic diversity that were otherwise hidden in geographically restricted studies. A total of 4118 DNA barcodes were assigned to 358 species generating 366 Barcode Index Numbers (BIN). Initial examination revealed as much as 141 BIN discordances (more than one species in each BIN). After implementing an auditing and five-grade (A-E) annotation protocol, the number of discordant species BINs was reduced to 44 (13% grade E), while concordant species BINs amounted to 271 (78% grades A and B) and 14 other had insufficient data (grade D). Fifteen species displayed comparatively high intraspecific divergences ranging from 2·6 to 18·5% (grade C), which is biologically paramount information to be considered in fish species monitoring and stock assessment. On balance, this compilation contributed to the detection of 59 European fish species probably in need of taxonomic clarification or re-evaluation. The generalized implementation of an auditing and annotation protocol for reference libraries of DNA barcodes is recommended. © 2016 The Fisheries Society of the British Isles.

  2. Molecular Authentication of the Traditional Medicinal Plant "Lakshman Booti" (Smithia conferta Sm.) and Its Adulterants through DNA Barcoding.

    Science.gov (United States)

    Umdale, Suraj D; Kshirsagar, Parthraj R; Lekhak, Manoj M; Gaikwad, Nikhil B

    2017-07-01

    Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as "Lakshman booti" in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton . leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine. This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique. Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted. The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psb A- trn H (10.9%) and rbc L (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species. ITS is the most applicable barcode for molecular authentication of S. conferta , and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia. The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta . Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psb A- trn H: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase

  3. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  4. Application of DNA Barcodes in Asian Tropical Trees--A Case Study from Xishuangbanna Nature Reserve, Southwest China.

    Science.gov (United States)

    Huang, Xiao-cui; Ci, Xiu-qin; Conran, John G; Li, Jie

    2015-01-01

    Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH-psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH-psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6-58.1%) and genus (72.8-76.2%) identification. With trnH-psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7-28.5% and 31.6-35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the

  5. Building a Plant DNA Barcode Reference Library for a Diverse Tropical Flora: An Example from Queensland, Australia

    Directory of Open Access Journals (Sweden)

    Craig M. Costion

    2016-02-01

    Full Text Available A foundation for a DNA barcode reference library for the tropical plants of Australia is presented here. A total of 1572 DNA barcode sequences are compiled from 848 tropical Queensland species. The dataset represents 35% of the total flora of Queensland’s Wet Tropics Bioregion, 57% of its tree species and 28% of the shrub species. For approximately half of the sampled species, we investigated the occurrence of infraspecific molecular variation in DNA barcode loci rbcLa, matK, and the trnH-psbA intergenic spacer region across previously recognized biogeographic barriers. We found preliminary support for the notion that DNA barcode reference libraries can be used as a tool for inferring biogeographic patterns at regional scales. It is expected that this dataset will find applications in taxonomic, ecological, and applied conservation research.

  6. Barcoded DNA-tag reporters for multiplex cis-regulatory analysis.

    Directory of Open Access Journals (Sweden)

    Jongmin Nam

    Full Text Available Cis-regulatory DNA sequences causally mediate patterns of gene expression, but efficient experimental analysis of these control systems has remained challenging. Here we develop a new version of "barcoded" DNA-tag reporters, "Nanotags" that permit simultaneous quantitative analysis of up to 130 distinct cis-regulatory modules (CRMs. The activities of these reporters are measured in single experiments by the NanoString RNA counting method and other quantitative procedures. We demonstrate the efficiency of the Nanotag method by simultaneously measuring hourly temporal activities of 126 CRMs from 46 genes in the developing sea urchin embryo, otherwise a virtually impossible task. Nanotags are also used in gene perturbation experiments to reveal cis-regulatory responses of many CRMs at once. Nanotag methodology can be applied to many research areas, ranging from gene regulatory networks to functional and evolutionary genomics.

  7. Phylogenetic reconstruction and DNA barcoding for closely related pine moth species (Dendrolimus) in China with multiple gene markers.

    Science.gov (United States)

    Dai, Qing-Yan; Gao, Qiang; Wu, Chun-Sheng; Chesters, Douglas; Zhu, Chao-Dong; Zhang, Ai-Bing

    2012-01-01

    Unlike distinct species, closely related species offer a great challenge for phylogeny reconstruction and species identification with DNA barcoding due to their often overlapping genetic variation. We tested a sibling species group of pine moth pests in China with a standard cytochrome c oxidase subunit I (COI) gene and two alternative internal transcribed spacer (ITS) genes (ITS1 and ITS2). Five different phylogenetic/DNA barcoding analysis methods (Maximum likelihood (ML)/Neighbor-joining (NJ), "best close match" (BCM), Minimum distance (MD), and BP-based method (BP)), representing commonly used methodology (tree-based and non-tree based) in the field, were applied to both single-gene and multiple-gene analyses. Our results demonstrated clear reciprocal species monophyly for three relatively distant related species, Dendrolimus superans, D. houi, D. kikuchii, as recovered by both single and multiple genes while the phylogenetic relationship of three closely related species, D. punctatus, D. tabulaeformis, D. spectabilis, could not be resolved with the traditional tree-building methods. Additionally, we find the standard COI barcode outperforms two nuclear ITS genes, whatever the methods used. On average, the COI barcode achieved a success rate of 94.10-97.40%, while ITS1 and ITS2 obtained a success rate of 64.70-81.60%, indicating ITS genes are less suitable for species identification in this case. We propose the use of an overall success rate of species identification that takes both sequencing success and assignation success into account, since species identification success rates with multiple-gene barcoding system were generally overestimated, especially by tree-based methods, where only successfully sequenced DNA sequences were used to construct a phylogenetic tree. Non-tree based methods, such as MD, BCM, and BP approaches, presented advantages over tree-based methods by reporting the overall success rates with statistical significance. In addition, our

  8. Phylogenetic reconstruction and DNA barcoding for closely related pine moth species (Dendrolimus in China with multiple gene markers.

    Directory of Open Access Journals (Sweden)

    Qing-Yan Dai

    Full Text Available Unlike distinct species, closely related species offer a great challenge for phylogeny reconstruction and species identification with DNA barcoding due to their often overlapping genetic variation. We tested a sibling species group of pine moth pests in China with a standard cytochrome c oxidase subunit I (COI gene and two alternative internal transcribed spacer (ITS genes (ITS1 and ITS2. Five different phylogenetic/DNA barcoding analysis methods (Maximum likelihood (ML/Neighbor-joining (NJ, "best close match" (BCM, Minimum distance (MD, and BP-based method (BP, representing commonly used methodology (tree-based and non-tree based in the field, were applied to both single-gene and multiple-gene analyses. Our results demonstrated clear reciprocal species monophyly for three relatively distant related species, Dendrolimus superans, D. houi, D. kikuchii, as recovered by both single and multiple genes while the phylogenetic relationship of three closely related species, D. punctatus, D. tabulaeformis, D. spectabilis, could not be resolved with the traditional tree-building methods. Additionally, we find the standard COI barcode outperforms two nuclear ITS genes, whatever the methods used. On average, the COI barcode achieved a success rate of 94.10-97.40%, while ITS1 and ITS2 obtained a success rate of 64.70-81.60%, indicating ITS genes are less suitable for species identification in this case. We propose the use of an overall success rate of species identification that takes both sequencing success and assignation success into account, since species identification success rates with multiple-gene barcoding system were generally overestimated, especially by tree-based methods, where only successfully sequenced DNA sequences were used to construct a phylogenetic tree. Non-tree based methods, such as MD, BCM, and BP approaches, presented advantages over tree-based methods by reporting the overall success rates with statistical significance. In

  9. Identification of fungal DNA barcode targets and PCR primers based on Pfam protein families and taxonomic hierarchy

    NARCIS (Netherlands)

    Lewis, C.T.; Bilkhu, S.; Robert, V.; Eberhardt, U.; Szoke, S.; Seifert, K.A.; Lévesque, C.A.

    2011-01-01

    Abstract: DNA barcoding is the application of DNA sequences of standardized genetic markers for the identification of eukaryotic organisms. We attempted to identify alternative candidate barcode gene targets for the fungal biota from available fungal genomes using a taxonomy-aware processing

  10. Evaluation of DNA barcode candidates for the discrimination of Artemisia L.

    Science.gov (United States)

    Liu, Geyu; Ning, Huixia; Ayidaerhan, Nurbolati; Aisa, Haji Akber

    2017-11-01

    Because of the very similar morphologies and wide diversity of Artemisia L. varieties, they are difficult to identify, and there have been many arguments about the systematic classification Artemisia L., especially concerning the division of species. DNA barcode technology is used to rapidly identify species based on standard short DNA sequences. To evaluate seven candidate DNA barcodes (ITS, ITS2, psbA-trnH, rbcL, matK, rpoB, and rpoC1) regarding their ability to identify closely related species of the Artemisia genus in Xinjiang. The corresponding PCR amplification efficiency, detectable genetic divergence, identification efficiency and phylogenetic tree were assessed. We found that the internal transcribed spacer (ITS) region exhibited the highest interspecific divergence, which was significantly higher than the observed intraspecific variation and showed the highest identification efficiency, followed by ITS2, psbA-trnH and, finally, rpoB. matK, rbcL, and rpoC1 performed poorly in this evaluation. ITS, ITS2, and psbA-trnH were able to perfectly identify the tested species Artemisia annua, A. absinthium, A. rupestris, A. tonurnefortiana, A. austriaca, A. dracunculus, A. vulgaris, and A. macrocephala. Therefore, we propose the ITS, ITS2, and psbA-trnH regions as promising DNA barcodes for the closely related species of Artemisia L. in Xinjiang.

  11. Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller.

    Science.gov (United States)

    Xu, Chang; Nezami Ranjbar, Mohammad R; Wu, Zhong; DiCarlo, John; Wang, Yexun

    2017-01-03

    Detection of DNA mutations at very low allele fractions with high accuracy will significantly improve the effectiveness of precision medicine for cancer patients. To achieve this goal through next generation sequencing, researchers need a detection method that 1) captures rare mutation-containing DNA fragments efficiently in the mix of abundant wild-type DNA; 2) sequences the DNA library extensively to deep coverage; and 3) distinguishes low level true variants from amplification and sequencing errors with high accuracy. Targeted enrichment using PCR primers provides researchers with a convenient way to achieve deep sequencing for a small, yet most relevant region using benchtop sequencers. Molecular barcoding (or indexing) provides a unique solution for reducing sequencing artifacts analytically. Although different molecular barcoding schemes have been reported in recent literature, most variant calling has been done on limited targets, using simple custom scripts. The analytical performance of barcode-aware variant calling can be significantly improved by incorporating advanced statistical models. We present here a highly efficient, simple and scalable enrichment protocol that integrates molecular barcodes in multiplex PCR amplification. In addition, we developed smCounter, an open source, generic, barcode-aware variant caller based on a Bayesian probabilistic model. smCounter was optimized and benchmarked on two independent read sets with SNVs and indels at 5 and 1% allele fractions. Variants were called with very good sensitivity and specificity within coding regions. We demonstrated that we can accurately detect somatic mutations with allele fractions as low as 1% in coding regions using our enrichment protocol and variant caller.

  12. The role of DNA barcodes in understanding and conservation of mammal diversity in southeast Asia.

    Directory of Open Access Journals (Sweden)

    Charles M Francis

    Full Text Available BACKGROUND: Southeast Asia is recognized as a region of very high biodiversity, much of which is currently at risk due to habitat loss and other threats. However, many aspects of this diversity, even for relatively well-known groups such as mammals, are poorly known, limiting ability to develop conservation plans. This study examines the value of DNA barcodes, sequences of the mitochondrial COI gene, to enhance understanding of mammalian diversity in the region and hence to aid conservation planning. METHODOLOGY AND PRINCIPAL FINDINGS: DNA barcodes were obtained from nearly 1900 specimens representing 165 recognized species of bats. All morphologically or acoustically distinct species, based on classical taxonomy, could be discriminated with DNA barcodes except four closely allied species pairs. Many currently recognized species contained multiple barcode lineages, often with deep divergence suggesting unrecognized species. In addition, most widespread species showed substantial genetic differentiation across their distributions. Our results suggest that mammal species richness within the region may be underestimated by at least 50%, and there are higher levels of endemism and greater intra-specific population structure than previously recognized. CONCLUSIONS: DNA barcodes can aid conservation and research by assisting field workers in identifying species, by helping taxonomists determine species groups needing more detailed analysis, and by facilitating the recognition of the appropriate units and scales for conservation planning.

  13. DNA Barcoding the Medusozoa using mtCOI

    Science.gov (United States)

    Ortman, Brian D.; Bucklin, Ann; Pagès, Francesc; Youngbluth, Marsh

    2010-12-01

    The Medusozoa are a clade within the Cnidaria comprising the classes Hydrozoa, Scyphozoa, and Cubozoa. Identification of medusozoan species is challenging, even for taxonomic experts, due to their fragile forms and complex, morphologically-distinct life history stages. In this study 231 sequences for a portion of the mitochondrial Cytochrome Oxidase I (mtCOI) gene were obtained from 95 species of Medusozoans including; 84 hydrozoans (61 siphonophores, eight anthomedusae, four leptomedusae, seven trachymedusae, and four narcomedusae), 10 scyphozoans (three coronatae, four semaeostomae, two rhizostomae, and one stauromedusae), and one cubozoan. This region of mtCOI has been used as a DNA barcode (i.e., a molecular character for species recognition and discrimination) for a diverse array of taxa, including some Cnidaria. Kimura 2-parameter (K2P) genetic distances between sequence variants within species ranged from 0 to 0.057 (mean 0.013). Within the 13 genera for which multiple species were available, K2P distance between congeneric species ranged from 0.056 to 0.381. A cluster diagram generated by Neighbor Joining (NJ) using K2P distances reliably clustered all barcodes of the same species with ≥99% bootstrap support, ensuring accurate identification of species. Intra- and inter-specific variation of the mtCOI gene for the Medusozoa are appropriate for this gene to be used as a DNA barcode for species-level identification, but not for phylogenetic analysis or taxonomic classification of unknown sequences at higher taxonomic levels. This study provides a set of molecular tools that can be used to address questions of speciation, biodiversity, life-history, and population boundaries in the Medusozoa.

  14. DNA barcoding for molecular identification of Demodex based on mitochondrial genes.

    Science.gov (United States)

    Hu, Li; Yang, YuanJun; Zhao, YaE; Niu, DongLing; Yang, Rui; Wang, RuiLing; Lu, Zhaohui; Li, XiaoQi

    2017-12-01

    There has been no widely accepted DNA barcode for species identification of Demodex. In this study, we attempted to solve this issue. First, mitochondrial cox1-5' and 12S gene fragments of Demodex folloculorum, D. brevis, D. canis, and D. caprae were amplified, cloned, and sequenced for the first time; intra/interspecific divergences were computed and phylogenetic trees were reconstructed. Then, divergence frequency distribution plots of those two gene fragments were drawn together with mtDNA cox1-middle region and 16S obtained in previous studies. Finally, their identification efficiency was evaluated by comparing barcoding gap. Results indicated that 12S had the higher identification efficiency. Specifically, for cox1-5' region of the four Demodex species, intraspecific divergences were less than 2.0%, and interspecific divergences were 21.1-31.0%; for 12S, intraspecific divergences were less than 1.4%, and interspecific divergences were 20.8-26.9%. The phylogenetic trees demonstrated that the four Demodex species clustered separately, and divergence frequency distribution plot showed that the largest intraspecific divergence of 12S (1.4%) was less than cox1-5' region (2.0%), cox1-middle region (3.1%), and 16S (2.8%). The barcoding gap of 12S was 19.4%, larger than cox1-5' region (19.1%), cox1-middle region (11.3%), and 16S (13.0%); the interspecific divergence span of 12S was 6.2%, smaller than cox1-5' region (10.0%), cox1-middle region (14.1%), and 16S (11.4%). Moreover, 12S has a moderate length (517 bp) for sequencing at once. Therefore, we proposed mtDNA 12S was more suitable than cox1 and 16S to be a DNA barcode for classification and identification of Demodex at lower category level.

  15. Meta-barcoding of 'dirt' DNA from soil reflects vertebrate biodiversity

    DEFF Research Database (Denmark)

    Andersen, Kenneth; Bird, Karen Lise; Rasmussen, Morten

    2012-01-01

    DNA molecules originating from animals and plants can be retrieved directly from sediments and have been used for reconstructing both contemporary and past ecosystems. However, the extent to which such 'dirt' DNA reflects taxonomic richness and structural diversity remains contentious. Here, we...... couple second generation high-throughput sequencing with 16S mitochondrial DNA (mtDNA) meta-barcoding, to explore the accuracy and sensitivity of 'dirt' DNA as an indicator of vertebrate diversity, from soil sampled at safari parks, zoological gardens and farms with known species compositions. PCR...

  16. DNA barcoding of a new record of epi-endophytic green algae ...

    Indian Academy of Sciences (India)

    2014-07-13

    Jul 13, 2014 ... red algae Laurencia obtusa collected from India. DNA barcodes at ... nuisance for algal pure culture, and a number of techniques were developed to get ... Asian countries for promoting sea urchin larval settlement and metamorphosis ... vacuum-dried, and subsequently bidirectional DNA se- quencing was ...

  17. Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada.

    Science.gov (United States)

    Braukmann, Thomas W A; Kuzmina, Maria L; Sills, Jesse; Zakharov, Evgeny V; Hebert, Paul D N

    2017-01-01

    Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is

  18. Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding.

    Science.gov (United States)

    Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy

    2017-02-01

    Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.

  19. DNA Barcoding of Malagasy Rosewoods: Towards a Molecular Identification of CITES-Listed Dalbergia Species.

    Science.gov (United States)

    Hassold, Sonja; Lowry, Porter P; Bauert, Martin R; Razafintsalama, Annick; Ramamonjisoa, Lolona; Widmer, Alex

    2016-01-01

    Illegal selective logging of tropical timber is of increasing concern worldwide. Madagascar is a biodiversity hotspot and home to some of the world's most sought after tropical timber species. Malagasy rosewoods belong to the genus Dalbergia (Fabaceae), which is highly diverse and has a pantropical distribution, but these timber species are among the most threatened as a consequence of intensive illegal selective logging and deforestation. Reliable identification of Dalbergia species from Madagascar is important for law enforcement but is almost impossible without fertile plant material, which is often unavailable during forest inventories or when attempting to identify logged trees of cut wood. DNA barcoding has been promoted as a promising tool for species identification in such cases. In this study we tested whether DNA barcoding with partial sequences of three plastid markers (matK, rbcL and trnL (UAA)) can distinguish between Dalbergia from Madagascar and from other areas of its distributional range, and whether Malagasy species can be distinguished from one another. Phylogenetic analyses revealed that the Malagasy Dalbergia species studied form two monophyletic groups, each containing two subgroups, only one of which corresponds to a single species. We characterized diagnostic polymorphisms in the three DNA barcoding markers that allow rapid discrimination between Dalbergia from Madagascar and from other areas of its distribution range. Species identification success based on individual barcoding markers or combinations was poor, whereas subgroup identification success was much higher (up to 98%), revealing both the value and limitations of a DNA barcoding approach for the identification of closely related Malagasy rosewoods.

  20. Generalized DNA Barcode Design Based on Hamming Codes

    NARCIS (Netherlands)

    Bystrykh, Leonid V.

    2012-01-01

    The diversity and scope of multiplex parallel sequencing applications is steadily increasing. Critically, multiplex parallel sequencing applications methods rely on the use of barcoded primers for sample identification, and the quality of the barcodes directly impacts the quality of the resulting

  1. The practical evaluation of DNA barcode efficacy.

    Science.gov (United States)

    Spouge, John L; Mariño-Ramírez, Leonardo

    2012-01-01

    This chapter describes a workflow for measuring the efficacy of a barcode in identifying species. First, assemble individual sequence databases corresponding to each barcode marker. A controlled collection of taxonomic data is preferable to GenBank data, because GenBank data can be problematic, particularly when comparing barcodes based on more than one marker. To ensure proper controls when evaluating species identification, specimens not having a sequence in every marker database should be discarded. Second, select a computer algorithm for assigning species to barcode sequences. No algorithm has yet improved notably on assigning a specimen to the species of its nearest neighbor within a barcode database. Because global sequence alignments (e.g., with the Needleman-Wunsch algorithm, or some related algorithm) examine entire barcode sequences, they generally produce better species assignments than local sequence alignments (e.g., with BLAST). No neighboring method (e.g., global sequence similarity, global sequence distance, or evolutionary distance based on a global alignment) has yet shown a notable superiority in identifying species. Finally, "the probability of correct identification" (PCI) provides an appropriate measurement of barcode efficacy. The overall PCI for a data set is the average of the species PCIs, taken over all species in the data set. This chapter states explicitly how to calculate PCI, how to estimate its statistical sampling error, and how to use data on PCR failure to set limits on how much improvements in PCR technology can improve species identification.

  2. DNA barcoding discriminates freshwater fishes from southeastern Nigeria and provides river system-level phylogeographic resolution within some species.

    Science.gov (United States)

    Nwani, Christopher D; Becker, Sven; Braid, Heather E; Ude, Emmanuel F; Okogwu, Okechukwu I; Hanner, Robert

    2011-10-01

    Fishes are the main animal protein source for human beings and play a vital role in aquatic ecosystems and food webs. Fish identification can be challenging, especially in the tropics (due to high diversity), and this is particularly true for larval forms or fragmentary remains. DNA barcoding, which uses the 5' region of the mitochondrial cytochrome c oxidase subunit I (COI) as a target gene, is an efficient method for standardized species-level identification for biodiversity assessment and conservation, pending the establishment of reference sequence libraries. In this study, fishes were collected from three rivers in southeastern Nigeria, identified morphologically, and imaged digitally. DNA was extracted, PCR-amplified, and the standard barcode region was bidirectionally sequenced for 363 individuals belonging to 70 species in 38 genera. All specimen provenance data and associated sequence information were recorded in the barcode of life data systems (BOLD; www.barcodinglife.org ). Analytical tools on BOLD were used to assess the performance of barcoding to identify species. Using neighbor-joining distance comparison, the average genetic distance was 60-fold higher between species than within species, as pairwise genetic distance estimates averaged 10.29% among congeners and only 0.17% among conspecifics. Despite low levels of divergence within species, we observed river system-specific haplotype partitioning within eight species (11.4% of all species). Our preliminary results suggest that DNA barcoding is very effective for species identification of Nigerian freshwater fishes.

  3. DNA barcode detects high genetic structure within neotropical bird species.

    Directory of Open Access Journals (Sweden)

    Erika Sendra Tavares

    Full Text Available BACKGROUND: Towards lower latitudes the number of recognized species is not only higher, but also phylogeographic subdivision within species is more pronounced. Moreover, new genetically isolated populations are often described in recent phylogenies of Neotropical birds suggesting that the number of species in the region is underestimated. Previous COI barcoding of Argentinean bird species showed more complex patterns of regional divergence in the Neotropical than in the North American avifauna. METHODS AND FINDINGS: Here we analyzed 1,431 samples from 561 different species to extend the Neotropical bird barcode survey to lower latitudes, and detected even higher geographic structure within species than reported previously. About 93% (520 of the species were identified correctly from their DNA barcodes. The remaining 41 species were not monophyletic in their COI sequences because they shared barcode sequences with closely related species (N = 21 or contained very divergent clusters suggestive of putative new species embedded within the gene tree (N = 20. Deep intraspecific divergences overlapping with among-species differences were detected in 48 species, often with samples from large geographic areas and several including multiple subspecies. This strong population genetic structure often coincided with breaks between different ecoregions or areas of endemism. CONCLUSIONS: The taxonomic uncertainty associated with the high incidence of non-monophyletic species and discovery of putative species obscures studies of historical patterns of species diversification in the Neotropical region. We showed that COI barcodes are a valuable tool to indicate which taxa would benefit from more extensive taxonomic revisions with multilocus approaches. Moreover, our results support hypotheses that the megadiversity of birds in the region is associated with multiple geographic processes starting well before the Quaternary and extending to more recent

  4. PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.

    Science.gov (United States)

    Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R

    2017-10-01

    High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.

  5. Multi-locus DNA barcoding identifies matK as a suitable marker for species identification in Hibiscus L.

    Science.gov (United States)

    Poovitha, Sundar; Stalin, Nithaniyal; Balaji, Raju; Parani, Madasamy

    2016-12-01

    The genus Hibiscus L. includes several taxa of medicinal value and species used for the extraction of natural dyes. These applications require the use of authentic plant materials. DNA barcoding is a molecular method for species identification, which helps in reliable authentication by using one or more DNA barcode marker. In this study, we have collected 44 accessions, representing 16 species of Hibiscus, distributed in the southern peninsular India, to evaluate the discriminatory power of the two core barcodes rbcLa and matK together with the suggested additional regions trnH-psbA and ITS2. No intraspecies divergence was observed among the accessions studied. Interspecies divergence was 0%-9.6% with individual markers, which increased to 0%-12.5% and 0.8%-20.3% when using two- and three-marker combinations, respectively. Differentiation of all the species of Hibiscus was possible with the matK DNA barcode marker. Also, in two-marker combinations, only those combinations with matK differentiated all the species. Though all the three-marker combinations showed 100% species differentiation, species resolution was consistently better when the matK marker formed part of the combination. These results clearly showed that matK is more suitable when compared to rbcLa, trnH-psbA, and ITS2 for species identification in Hibiscus.

  6. DNA barcoding for conservation, seed banking and ecological restoration of Acacia in the Midwest of Western Australia.

    Science.gov (United States)

    Nevill, Paul G; Wallace, Mark J; Miller, Joseph T; Krauss, Siegfried L

    2013-11-01

    We used DNA barcoding to address an important conservation issue in the Midwest of Western Australia, working on Australia's largest genus of flowering plant. We tested whether or not currently recommended plant DNA barcoding regions (matK and rbcL) were able to discriminate Acacia taxa of varying phylogenetic distances, and ultimately identify an ambiguously labelled seed collection from a mine-site restoration project. Although matK successfully identified the unknown seed as the rare and conservation priority listed A. karina, and was able to resolve six of the eleven study species, this region was difficult to amplify and sequence. In contrast, rbcL was straightforward to recover and align, but could not determine the origin of the seed and only resolved 3 of the 11 species. Other chloroplast regions (rpl32-trnL, psbA-trnH, trnL-F and trnK) had mixed success resolving the studied taxa. In general, species were better resolved in multilocus data sets compared to single-locus data sets. We recommend using the formal barcoding regions supplemented with data from other plastid regions, particularly rpl32-trnL, for barcoding in Acacia. Our study demonstrates the novel use of DNA barcoding for seed identification and illustrates the practical potential of DNA barcoding for the growing discipline of restoration ecology. © 2013 John Wiley & Sons Ltd.

  7. DNA barcode identification of Podocarpaceae--the second largest conifer family.

    Science.gov (United States)

    Little, Damon P; Knopf, Patrick; Schulz, Christian

    2013-01-01

    We have generated matK, rbcL, and nrITS2 DNA barcodes for 320 specimens representing all 18 extant genera of the conifer family Podocarpaceae. The sample includes 145 of the 198 recognized species. Comparative analyses of sequence quality and species discrimination were conducted on the 159 individuals from which all three markers were recovered (representing 15 genera and 97 species). The vast majority of sequences were of high quality (B 30 = 0.596-0.989). Even the lowest quality sequences exceeded the minimum requirements of the BARCODE data standard. In the few instances that low quality sequences were generated, the responsible mechanism could not be discerned. There were no statistically significant differences in the discriminatory power of markers or marker combinations (p = 0.05). The discriminatory power of the barcode markers individually and in combination is low (56.7% of species at maximum). In some instances, species discrimination failed in spite of ostensibly useful variation being present (genotypes were shared among species), but in many cases there was simply an absence of sequence variation. Barcode gaps (maximum intraspecific p-distance > minimum interspecific p-distance) were observed in 50.5% of species when all three markers were considered simultaneously. The presence of a barcode gap was not predictive of discrimination success (p = 0.02) and there was no statistically significant difference in the frequency of barcode gaps among markers (p = 0.05). In addition, there was no correlation between number of individuals sampled per species and the presence of a barcode gap (p = 0.27).

  8. Adhoc: an R package to calculate ad hoc distance thresholds for DNA barcoding identification

    Directory of Open Access Journals (Sweden)

    Gontran Sonet

    2013-12-01

    Full Text Available Identification by DNA barcoding is more likely to be erroneous when it is based on a large distance between the query (the barcode sequence of the specimen to identify and its best match in a reference barcode library. The number of such false positive identifications can be decreased by setting a distance threshold above which identification has to be rejected. To this end, we proposed recently to use an ad hoc distance threshold producing identifications with an estimated relative error probability that can be fixed by the user (e.g. 5%. Here we introduce two R functions that automate the calculation of ad hoc distance thresholds for reference libraries of DNA barcodes. The scripts of both functions, a user manual and an example file are available on the JEMU website (http://jemu.myspecies.info/computer-programs as well as on the comprehensive R archive network (CRAN, http://cran.r-project.org.

  9. A DNA barcoding approach to characterize pollen collected by honeybees.

    Directory of Open Access Journals (Sweden)

    Andrea Galimberti

    Full Text Available In the present study, we investigated DNA barcoding effectiveness to characterize honeybee pollen pellets, a food supplement largely used for human nutrition due to its therapeutic properties. We collected pollen pellets using modified beehives placed in three zones within an alpine protected area (Grigna Settentrionale Regional Park, Italy. A DNA barcoding reference database, including rbcL and trnH-psbA sequences from 693 plant species (104 sequenced in this study was assembled. The database was used to identify pollen collected from the hives. Fifty-two plant species were identified at the molecular level. Results suggested rbcL alone could not distinguish among congeneric plants; however, psbA-trnH identified most of the pollen samples at the species level. Substantial variability in pollen composition was observed between the highest elevation locality (Alpe Moconodeno, characterized by arid grasslands and a rocky substrate, and the other two sites (Cornisella and Ortanella at lower altitudes. Pollen from Ortanella and Cornisella showed the presence of typical deciduous forest species; however in samples collected at Ortanella, pollen of the invasive Lonicera japonica, and the ornamental Pelargonium x hortorum were observed. Our results indicated pollen composition was largely influenced by floristic local biodiversity, plant phenology, and the presence of alien flowering species. Therefore, pollen molecular characterization based on DNA barcoding might serve useful to beekeepers in obtaining honeybee products with specific nutritional or therapeutic characteristics desired by food market demands.

  10. [The species traceability of the ultrafine powder and the cell wall-broken powder of herbal medicine based on DNA barcoding].

    Science.gov (United States)

    Xiang, Li; Tang, Huan; Cheng, Jin-le; Chen, Yi-long; Deng, Wen; Zheng, Xia-sheng; Lai, Zhi-tian; Chen, Shi-lin

    2015-12-01

    Ultrafine powder and cell wall-broken powder of herbal medicine lack of the morphological characters and microscopic identification features. This makes it hard to identify herb's authenticity with traditional methods. We tested ITS2 sequence as DNA barcode in identification of herbal medicine in ultrafine powder and cell wall-broken powder in this study. We extracted genomic DNAs of 93 samples of 31 representative herbal medicines (28 species), which include whole plant, roots and bulbs, stems, leaves, flowers, fruits and seeds. The ITS2 sequences were amplified and sequenced bidirectionally. The ITS2 sequences were identified using Basic Local Alignment Search Tool (BLAST) method in the GenBank database and DNA barcoding system to identify the herbal medicine. The genetic distance was analyzed using the Kimura 2-parameter (K2P) model and the Neighbor-joining (NJ) phylogenetic tree was constructed using MEGA 6.0. The results showed that DNA can be extracted successfully from 93 samples and high quality ITS2 sequences can be amplified. All 31 herbal medicines can get correct identification via BLAST method. The ITS2 sequences of raw material medicines, ultrafine powder and cell wall-broken powder have same sequence in 26 herbal medicines, while the ITS2 sequences in other 5 herbal medicines exhibited variation. The maximum intraspecific genetic-distances of each species were all less than the minimum interspecific genetic distances. ITS2 sequences of each species are all converged to their standard DNA barcodes using NJ method. Therefore, using ITS2 barcode can accurately and effectively distinguish ultrafine powder and cell wall-broken powder of herbal medicine. It provides a new molecular method to identify ultrafine powder and cell wall-broken powder of herbal medicine in the quality control and market supervision.

  11. Untangling taxonomy: a DNA barcode reference library for Canadian spiders.

    Science.gov (United States)

    Blagoev, Gergin A; deWaard, Jeremy R; Ratnasingham, Sujeevan; deWaard, Stephanie L; Lu, Liuqiong; Robertson, James; Telfer, Angela C; Hebert, Paul D N

    2016-01-01

    Approximately 1460 species of spiders have been reported from Canada, 3% of the global fauna. This study provides a DNA barcode reference library for 1018 of these species based upon the analysis of more than 30,000 specimens. The sequence results show a clear barcode gap in most cases with a mean intraspecific divergence of 0.78% vs. a minimum nearest-neighbour (NN) distance averaging 7.85%. The sequences were assigned to 1359 Barcode index numbers (BINs) with 1344 of these BINs composed of specimens belonging to a single currently recognized species. There was a perfect correspondence between BIN membership and a known species in 795 cases, while another 197 species were assigned to two or more BINs (556 in total). A few other species (26) were involved in BIN merges or in a combination of merges and splits. There was only a weak relationship between the number of specimens analysed for a species and its BIN count. However, three species were clear outliers with their specimens being placed in 11-22 BINs. Although all BIN splits need further study to clarify the taxonomic status of the entities involved, DNA barcodes discriminated 98% of the 1018 species. The present survey conservatively revealed 16 species new to science, 52 species new to Canada and major range extensions for 426 species. However, if most BIN splits detected in this study reflect cryptic taxa, the true species count for Canadian spiders could be 30-50% higher than currently recognized. © 2015 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  12. A “Rosetta Stone” for metazoan zooplankton: DNA barcode analysis of species diversity of the Sargasso Sea (Northwest Atlantic Ocean)

    Science.gov (United States)

    Bucklin, Ann; Ortman, Brian D.; Jennings, Robert M.; Nigro, Lisa M.; Sweetman, Christopher J.; Copley, Nancy J.; Sutton, Tracey; Wiebe, Peter H.

    2010-12-01

    Species diversity of the metazoan holozooplankton assemblage of the Sargasso Sea, Northwest Atlantic Ocean, was examined through coordinated morphological taxonomic identification of species and DNA sequencing of a ˜650 base-pair region of mitochondrial cytochrome oxidase I (mtCOI) as a DNA barcode (i.e., short sequence for species recognition and discrimination). Zooplankton collections were made from the surface to 5,000 meters during April, 2006 on the R/V R.H. Brown. Samples were examined by a ship-board team of morphological taxonomists; DNA barcoding was carried out in both ship-board and land-based DNA sequencing laboratories. DNA barcodes were determined for a total of 297 individuals of 175 holozooplankton species in four phyla, including: Cnidaria (Hydromedusae, 4 species; Siphonophora, 47); Arthropoda (Amphipoda, 10; Copepoda, 34; Decapoda, 9; Euphausiacea, 10; Mysidacea, 1; Ostracoda, 27); and Mollusca (Cephalopoda, 8; Heteropoda, 6; Pteropoda, 15); and Chaetognatha (4). Thirty species of fish (Teleostei) were also barcoded. For all seven zooplankton groups for which sufficient data were available, Kimura-2-Parameter genetic distances were significantly lower between individuals of the same species (mean=0.0114; S.D. 0.0117) than between individuals of different species within the same group (mean=0.3166; S.D. 0.0378). This difference, known as the barcode gap, ensures that mtCOI sequences are reliable characters for species identification for the oceanic holozooplankton assemblage. In addition, DNA barcodes allow recognition of new or undescribed species, reveal cryptic species within known taxa, and inform phylogeographic and population genetic studies of geographic variation. The growing database of "gold standard" DNA barcodes serves as a Rosetta Stone for marine zooplankton, providing the key for decoding species diversity by linking species names, morphology, and DNA sequence variation. In light of the pivotal position of zooplankton in ocean

  13. Improved protocols to accelerate the assembly of DNA barcode reference libraries for freshwater zooplankton.

    Science.gov (United States)

    Elías-Gutiérrez, Manuel; Valdez-Moreno, Martha; Topan, Janet; Young, Monica R; Cohuo-Colli, José Angel

    2018-03-01

    Currently, freshwater zooplankton sampling and identification methodologies have remained virtually unchanged since they were first established in the beginning of the XX century. One major contributing factor to this slow progress is the limited success of modern genetic methodologies, such as DNA barcoding, in several of the main groups. This study demonstrates improved protocols which enable the rapid assessment of most animal taxa inhabiting any freshwater system by combining the use of light traps, careful fixation at low temperatures using ethanol, and zooplankton-specific primers. We DNA-barcoded 2,136 specimens from a diverse array of taxonomic assemblages (rotifers, mollusks, mites, crustaceans, insects, and fishes) from several Canadian and Mexican lakes with an average sequence success rate of 85.3%. In total, 325 Barcode Index Numbers (BINs) were detected with only three BINs (two cladocerans and one copepod) shared between Canada and Mexico, suggesting a much narrower distribution range of freshwater zooplankton than previously thought. This study is the first to broadly explore the metazoan biodiversity of freshwater systems with DNA barcodes to construct a reference library that represents the first step for future programs which aim to monitor ecosystem health, track invasive species, or improve knowledge of the ecology and distribution of freshwater zooplankton.

  14. Calibrating snakehead diversity with DNA barcodes: expanding taxonomic coverage to enable identification of potential and established invasive species.

    Directory of Open Access Journals (Sweden)

    Natasha R Serrao

    Full Text Available Detecting and documenting the occurrence of invasive species outside their native range requires tools to support their identification. This can be challenging for taxa with diverse life stages and/or problematic or unresolved morphological taxonomies. DNA barcoding provides a potent method for identifying invasive species, as it allows for species identification at all life stages, including fragmentary remains. It also provides an efficient interim taxonomic framework for quantifying cryptic genetic diversity by parsing barcode sequences into discontinuous haplogroup clusters (typical of reproductively isolated species and labelling them with unique alphanumeric identifiers. Snakehead fishes are a diverse group of opportunistic predators endemic to Asia and Africa that may potentially pose significant threats as aquatic invasive species. At least three snakehead species (Channa argus, C. maculata, and C. marulius are thought to have entered North America through the aquarium and live-food fish markets, and have established populations, yet their origins remain unclear. The objectives of this study were to assemble a library of DNA barcode sequences derived from expert identified reference specimens in order to determine the identity and aid invasion pathway analysis of the non-indigenous species found in North America using DNA barcodes. Sequences were obtained from 121 tissue samples representing 25 species and combined with public records from GenBank for a total of 36 putative species, which then partitioned into 49 discrete haplogroups. Multiple divergent clusters were observed within C. gachua, C. marulius, C. punctata and C. striata suggesting the potential presence of cryptic species diversity within these lineages. Our findings demonstrate that DNA barcoding is a valuable tool for species identification in challenging and under-studied taxonomic groups such as snakeheads, and provides a useful framework for inferring invasion pathway

  15. Project Description: DNA Barcodes of Bird Species in the National Museum of Natural History, Smithsonian Institution, USA

    Directory of Open Access Journals (Sweden)

    David Schindel

    2011-12-01

    Full Text Available The Division of Birds, National Museum of Natural History, Smithsonian Institution in Washington, DC, has obtained and released DNA barcodes for 2,808 frozen tissue samples. Of the 1,403 species represented by these samples, 1,147 species have not been barcoded previously. This data release increases the number of bird species with standard barcodes by 91%. These records meet the data standard of the Consortium for the Barcode of Life and they have the reserved keyword BARCODE in GenBank. The data are now available on GenBank and the Barcode of Life Data Systems.

  16. Starting a DNA barcode reference library for shallow water polychaetes from the southern European Atlantic coast.

    Science.gov (United States)

    Lobo, Jorge; Teixeira, Marcos A L; Borges, Luisa M S; Ferreira, Maria S G; Hollatz, Claudia; Gomes, Pedro T; Sousa, Ronaldo; Ravara, Ascensão; Costa, Maria H; Costa, Filipe O

    2016-01-01

    Annelid polychaetes have been seldom the focus of dedicated DNA barcoding studies, despite their ecological relevance and often dominance, particularly in soft-bottom estuarine and coastal marine ecosystems. Here, we report the first assessment of the performance of DNA barcodes in the discrimination of shallow water polychaete species from the southern European Atlantic coast, focusing on specimens collected in estuaries and coastal ecosystems of Portugal. We analysed cytochrome oxidase I DNA barcodes (COI-5P) from 164 specimens, which were assigned to 51 morphospecies. To our data set from Portugal, we added available published sequences selected from the same species, genus or family, to inspect for taxonomic congruence among studies and collection location. The final data set comprised 290 specimens and 79 morphospecies, which generated 99 Barcode Index Numbers (BINs) within Barcode of Life Data Systems (BOLD). Among these, 22 BINs were singletons, 47 other BINs were concordant, confirming the initial identification based on morphological characters, and 30 were discordant, most of which consisted on multiple BINs found for the same morphospecies. Some of the most prominent cases in the latter category include Hediste diversicolor (O.F. Müller, 1776) (7), Eulalia viridis (Linnaeus, 1767) (2) and Owenia fusiformis (delle Chiaje, 1844) (5), all of them reported from Portugal and frequently used in ecological studies as environmental quality indicators. Our results for these species showed discordance between molecular lineages and morphospecies, or added additional relatively divergent lineages. The potential inaccuracies in environmental assessments, where underpinning polychaete species diversity is poorly resolved or clarified, demand additional and extensive investigation of the DNA barcode diversity in this group, in parallel with alpha taxonomy efforts. © 2015 John Wiley & Sons Ltd.

  17. DNA barcode analysis of butterfly species from Pakistan points towards regional endemism.

    Science.gov (United States)

    Ashfaq, Muhammad; Akhtar, Saleem; Khan, Arif M; Adamowicz, Sarah J; Hebert, Paul D N

    2013-09-01

    DNA barcodes were obtained for 81 butterfly species belonging to 52 genera from sites in north-central Pakistan to test the utility of barcoding for their identification and to gain a better understanding of regional barcode variation. These species represent 25% of the butterfly fauna of Pakistan and belong to five families, although the Nymphalidae were dominant, comprising 38% of the total specimens. Barcode analysis showed that maximum conspecific divergence was 1.6%, while there was 1.7-14.3% divergence from the nearest neighbour species. Barcode records for 55 species showed Barcode of Life Data Systems (BOLD), but only 26 of these cases involved specimens from neighbouring India and Central Asia. Analysis revealed that most species showed little incremental sequence variation when specimens from other regions were considered, but a threefold increase was noted in a few cases. There was a clear gap between maximum intraspecific and minimum nearest neighbour distance for all 81 species. Neighbour-joining cluster analysis showed that members of each species formed a monophyletic cluster with strong bootstrap support. The barcode results revealed two provisional species that could not be clearly linked to known taxa, while 24 other species gained their first coverage. Future work should extend the barcode reference library to include all butterfly species from Pakistan as well as neighbouring countries to gain a better understanding of regional variation in barcode sequences in this topographically and climatically complex region. © 2013 The Authors. Molecular Ecology Resources published by John Wiley & Sons Ltd.

  18. Barcode van DNA. Democratisering van de taxonomie door digitaal identificatiesysteem

    NARCIS (Netherlands)

    Bakker, F.T.

    2011-01-01

    Het herkennen van biologische soorten aan de hand van een gestandaardiseerde DNA-barcode heeft de laatste tijd een enorme vlucht genomen. Gedreven door aan de ene kant de biodiversiteitscrises en de mogelijke global change, en aan de andere kant zowel razendsnelle technologische vooruitgang als ook

  19. DNA Barcoding Evaluation and Its Taxonomic Implications in the Recently Evolved Genus Oberonia Lindl. (Orchidaceae in China

    Directory of Open Access Journals (Sweden)

    Yuling Li

    2016-12-01

    Full Text Available The orchid genus Oberonia Lindl., is a taxonomically complex genus characterized by recent species radiations and many closely related species. All Oberonia species are under conservation as listed in the CITES and the IUCN Red List Categories and Criteria. Given its difficulties in taxonomy and conservation status, Oberonia is an excellent model for developing DNA barcodes. Three analytical methods and five DNA barcoding regions (rbcL, matK, trnH-psbA, ITS and ITS2 were evaluated on 127 individuals representing 40 species and 1 variety of Oberonia from China. All the three plastid candidates tested (rbcL, matK and trnH-psbA have a lower discriminatory power than the nuclear regions (ITS and ITS2, and ITS had the highest resolution rate (82.14%. Two to four combinations of these gene sets were not better than the ITS alone, but when considering modes of inheritance, rbcL+ITS and matK+ITS were the best barcodes for identifying Oberonia species. Furthermore, the present barcoding system has many new insights in the current Oberonia taxonomy, such as correcting species identification, resolving taxonomic uncertainties, and the underlying presence of new or cryptic species in a genus with a complex speciation history.

  20. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  1. A regional approach to plant DNA barcoding provides high species resolution of sedges (Carex and Kobresia, Cyperaceae) in the Canadian Arctic Archipelago.

    Science.gov (United States)

    Clerc-Blain, Jessica L E; Starr, Julian R; Bull, Roger D; Saarela, Jeffery M

    2010-01-01

    Previous research on barcoding sedges (Carex) suggested that basic searches within a global barcoding database would probably not resolve more than 60% of the world's some 2000 species. In this study, we take an alternative approach and explore the performance of plant DNA barcoding in the Carex lineage from an explicitly regional perspective. We characterize the utility of a subset of the proposed protein-coding and noncoding plastid barcoding regions (matK, rpoB, rpoC1, rbcL, atpF-atpH, psbK-psbI) for distinguishing species of Carex and Kobresia in the Canadian Arctic Archipelago, a clearly defined eco-geographical region representing 1% of the Earth's landmass. Our results show that matK resolves the greatest number of species of any single-locus (95%), and when combined in a two-locus barcode, it provides 100% species resolution in all but one combination (matK + atpFH) during unweighted pair-group method with arithmetic mean averages (UPGMA) analyses. Noncoding regions were equally or more variable than matK, but as single markers they resolve substantially fewer taxa than matK alone. When difficulties with sequencing and alignment due to microstructural variation in noncoding regions are also considered, our results support other studies in suggesting that protein-coding regions are more practical as barcoding markers. Plastid DNA barcodes are an effective identification tool for species of Carex and Kobresia in the Canadian Arctic Archipelago, a region where the number of co-existing closely related species is limited. We suggest that if a regional approach to plant DNA barcoding was applied on a global scale, it could provide a solution to the generally poor species resolution seen in previous barcoding studies. © 2009 Blackwell Publishing Ltd.

  2. DNA barcoding and molecular systematics of the benthic and demersal organisms of the CEAMARC survey

    Science.gov (United States)

    Dettai, Agnes; Adamowizc, Sarah J.; Allcock, Louise; Arango, Claudia P.; Barnes, David K. A.; Barratt, Iain; Chenuil, Anne; Couloux, Arnaud; Cruaud, Corinne; David, Bruno; Denis, Françoise; Denys, Gael; Díaz, Angie; Eléaume, Marc; Féral, Jean-Pierre; Froger, Aurélie; Gallut, Cyril; Grant, Rachel; Griffiths, Huw J.; Held, Christoph; Hemery, Lenaïg G.; Hosie, Graham; Kuklinski, Piotr; Lecointre, Guillaume; Linse, Katrin; Lozouet, Pierre; Mah, Christopher; Monniot, Françoise; Norman, Mark D.; O'Hara, Timothy; Ozouf-Costaz, Catherine; Piedallu, Claire; Pierrat, Benjamin; Poulin, Elie; Puillandre, Nicolas; Riddle, Martin; Samadi, Sarah; Saucède, Thomas; Schubart, Christoph; Smith, Peter J.; Stevens, Darren W.; Steinke, Dirk; Strugnell, Jan M.; Tarnowska, K.; Wadley, Victoria; Ameziane, Nadia

    2011-08-01

    The Dumont d’Urville Sea (East Antarctic region) has been less investigated for DNA barcoding and molecular taxonomy than other parts of the Southern Ocean, such as the Ross Sea and the Antarctic Peninsula. The Collaborative East Antarctic MARine Census (CEAMARC) took place in this area during the austral summer of 2007-2008. The Australian vessel RSV Aurora Australis collected very diverse samples of demersal and benthic organisms. The specimens were sorted centrally, and then distributed to taxonomic experts for molecular and morphological taxonomy and identification, especially barcoding. The COI sequences generated from CEAMARC material provide a sizeable proportion of the Census of Antarctic Marine Life barcodes although the studies are still ongoing, and represent the only source of sequences for a number of species. Barcoding appears to be a valuable method for identification within most groups, despite low divergences and haplotype sharing in a few species, and it is also useful as a preliminary taxonomic exploration method. Several new species are being described. CEAMARC samples have already provided new material for phylogeographic and phylogenetic studies in cephalopods, pycnogonids, teleost fish, crinoids and sea urchins, helping these studies to provide a better insight in the patterns of evolution in the Southern Ocean.

  3. DNA barcoding as a tool for coral reef conservation

    Science.gov (United States)

    Neigel, J.; Domingo, A.; Stake, J.

    2007-09-01

    DNA Barcoding (DBC) is a method for taxonomic identification of animals that is based entirely on the 5' portion of the mitochondrial gene, cytochrome oxidase subunit I ( COI-5). It can be especially useful for identification of larval forms or incomplete specimens lacking diagnostic morphological characters. DBC can also facilitate the discovery of species and in defining “molecular taxonomic units” in problematic groups. However, DBC is not a panacea for coral reef taxonomy. In two of the most ecologically important groups on coral reefs, the Anthozoa and Porifera, COI-5 sequences have diverged too little to be diagnostic for all species. Other problems for DBC include paraphyly in mitochondrial gene trees and lack of differentiation between hybrids and their maternal ancestors. DBC also depends on the availability of databases of COI-5 sequences, which are still in early stages of development. A global effort to barcode all fish species has demonstrated the importance of large-scale coordination and is yielding promising results. Whether or not COI-5 by itself is sufficient for species assignments has become a contentious question; it is generally advantageous to use sequences from multiple loci.

  4. DNA barcoding and morphological identification of neotropical ichthyoplankton from the Upper Paraná and São Francisco.

    Science.gov (United States)

    Becker, R A; Sales, N G; Santos, G M; Santos, G B; Carvalho, D C

    2015-07-01

    The identification of fish larvae from two neotropical hydrographic basins using traditional morphological taxonomy and DNA barcoding revealed no conflicting results between the morphological and barcode identification of larvae. A lower rate (25%) of correct morphological identification of eggs as belonging to migratory or non-migratory species was achieved. Accurate identification of ichthyoplankton by DNA barcoding is an important tool for fish reproductive behaviour studies, correct estimation of biodiversity by detecting eggs from rare species, as well as defining environmental and management strategies for fish conservation in the neotropics. © 2015 The Fisheries Society of the British Isles.

  5. [Identification of Tibetan medicine "Dida" of Gentianaceae using DNA barcoding].

    Science.gov (United States)

    Liu, Chuan; Zhang, Yu-Xin; Liu, Yue; Chen, Yi-Long; Fan, Gang; Xiang, Li; Xu, Jiang; Zhang, Yi

    2016-02-01

    The ITS2 barcode was used toidentify Tibetan medicine "Dida", and tosecure its quality and safety in medication. A total of 13 species, 151 experimental samples for the study from the Tibetan Plateau, including Gentianaceae Swertia, Halenia, Gentianopsis, Comastoma, Lomatogonium ITS2 sequences were amplified, and purified PCR products were sequenced. Sequence assembly and consensus sequence generation were performed using the CodonCode Aligner V3.7.1. The Kimura 2-Parameter (K2P) distances were calculated using MEGA 6.0. The neighbor-joining (NJ) phylogenetic trees were constructed. There are 31 haplotypes among 231 bp after alignment of all ITS2 sequence haplotypes, and the average G±C content of 61.40%. The NJ tree strongly supported that every species clustered into their own clade and high identification success rate, except that Swertia bifolia and Swertia wolfangiana could not be distinguished from each other based on the sequence divergences. DNA barcoding could be used as a fast and accurate identification method to distinguish Tibetan medicine "Dida" to ensure its safe use. Copyright© by the Chinese Pharmaceutical Association.

  6. DNA BARCODING IKAN HIAS INTRODUKSI

    Directory of Open Access Journals (Sweden)

    Melta Rini Fahmi

    2017-05-01

    ilmu pengetahuan. Species identification becomes a new challenge in the management of ornamental fish either for cultivation, or for conservation proposes. The objective of this study was to identify currently existing introduced ornamental fish in Indonesian farmers and markets using DNA barcodes COI gene. Fish samples were collected from farmers and importers of ornamental fish in Bandung and Jakarta. Total genome was extracted from caudal fin tissue using the column method. Amplification of the target gene was done by using FishF1, FishF2, FishR1, and FishR2 primers. DNA sequence was aligned with the sequences from genbank by BLAST program. Species identification was decided through the phylogenetic tree and similarity index with genbank sequences. The results showed that all of tested samples fall into five groups; Synodontis consisted of five species, Corydoras four species, Phseudoplatystoma four species, Botia three species, and Leporinus three species with 99-100 boostrap value. Sequence similarity index showed around 11 species have 99%-100% similarity index with sequence data on genbank which are Synodontis decorus, Synodontis eupterus, Synodontis greshoffi, Botia kubotai, Botia lohachata, Rasbora erythromicron, Corydoras aeneus, Gyrinocheilus aymonieri, Eigenmannia virescens, Leporinus affinis, Phractocephalus hemioliopterus. Two species were identified as hybridization product (interbreeding including leopard catfish (100% identical with Pseudoplatystoma faciatum and the leopard Synodontis (100% identical with Synodontis notatus. Analysis of nucleotide diagnostic showed Synodontis decora has seven nucleotides diagnostic, Synodontis tanganyicae 10 nucleotides, Synodontis euterus 13 nucleotides,  Synodontis notatus four nucleotides, and Synodontis grashoffi 14 nucleotides. The correct identification of fish species is a useful tool for aquaculture, global marketing, management or conservation, and academic/scientific purpose.

  7. Integrating a comprehensive DNA barcode reference library with a global map of yews (Taxus L.) for forensic identification.

    Science.gov (United States)

    Liu, Jie; Milne, Richard I; Möller, Michael; Zhu, Guang-Fu; Ye, Lin-Jiang; Luo, Ya-Huang; Yang, Jun-Bo; Wambulwa, Moses Cheloti; Wang, Chun-Neng; Li, De-Zhu; Gao, Lian-Ming

    2018-05-22

    Rapid and accurate identification of endangered species is a critical component of bio-surveillance and conservation management, and potentially policing illegal trades. However, this is often not possible using traditional taxonomy, especially where only small or pre-processed parts of plants are available. Reliable identification can be achieved via a comprehensive DNA barcode reference library, accompanied by precise distribution data. However, these require extensive sampling at spatial and taxonomic scales, which has rarely been achieved for cosmopolitan taxa. Here we construct a comprehensive DNA barcode reference library, and generate distribution maps using species distribution modeling (SDM), for all 15 Taxus species worldwide. We find that trnL-trnF is the ideal barcode for Taxus: it can distinguish all Taxus species, and in combination with ITS identify hybrids. Among five analysis methods tested, NJ was the most effective. Among 4151 individuals screened for trnL-trnF, 73 haplotypes were detected, all species-specific and some population private. Taxonomical, geographical and genetic dimensions of sampling strategy were all found to affect the comprehensiveness of the resulting DNA barcode library. Maps from SDM showed that most species had allopatric distributions, except three in the Sino-Himalayan region. Using the barcode library and distribution map data, two unknown forensic samples were identified to species (and in one case, population) level, and another was determined as a putative interspecific hybrid. This integrated species identification system for Taxus can be used for bio-surveillance, conservation management and to monitor and prosecute illegal trade. Similar identification systems are recommended for other IUCN- and -CITES listed taxa. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  8. A DNA barcode library for Germany's mayflies, stoneflies and caddisflies (Ephemeroptera, Plecoptera and Trichoptera).

    Science.gov (United States)

    Morinière, Jérôme; Hendrich, Lars; Balke, Michael; Beermann, Arne J; König, Tobias; Hess, Monika; Koch, Stefan; Müller, Reinhard; Leese, Florian; Hebert, Paul D N; Hausmann, Axel; Schubart, Christoph D; Haszprunar, Gerhard

    2017-11-01

    Mayflies, stoneflies and caddisflies (Ephemeroptera, Plecoptera and Trichoptera) are prominent representatives of aquatic macroinvertebrates, commonly used as indicator organisms for water quality and ecosystem assessments. However, unambiguous morphological identification of EPT species, especially their immature life stages, is a challenging, yet fundamental task. A comprehensive DNA barcode library based upon taxonomically well-curated specimens is needed to overcome the problematic identification. Once available, this library will support the implementation of fast, cost-efficient and reliable DNA-based identifications and assessments of ecological status. This study represents a major step towards a DNA barcode reference library as it covers for two-thirds of Germany's EPT species including 2,613 individuals belonging to 363 identified species. As such, it provides coverage for 38 of 44 families (86%) and practically all major bioindicator species. DNA barcode compliant sequences (≥500 bp) were recovered from 98.74% of the analysed specimens. Whereas most species (325, i.e., 89.53%) were unambiguously assigned to a single Barcode Index Number (BIN) by its COI sequence, 38 species (18 Ephemeroptera, nine Plecoptera and 11 Trichoptera) were assigned to a total of 89 BINs. Most of these additional BINs formed nearest neighbour clusters, reflecting the discrimination of geographical subclades of a currently recognized species. BIN sharing was uncommon, involving only two species pairs of Ephemeroptera. Interestingly, both maximum pairwise and nearest neighbour distances were substantially higher for Ephemeroptera compared to Plecoptera and Trichoptera, possibly indicating older speciation events, stronger positive selection or faster rate of molecular evolution. © 2017 John Wiley & Sons Ltd.

  9. A checklist of the bats of Peninsular Malaysia and progress towards a DNA barcode reference library.

    Science.gov (United States)

    Lim, Voon-Ching; Ramli, Rosli; Bhassu, Subha; Wilson, John-James

    2017-01-01

    Several published checklists of bat species have covered Peninsular Malaysia as part of a broader region and/or in combination with other mammal groups. Other researchers have produced comprehensive checklists for specific localities within the peninsula. To our knowledge, a comprehensive checklist of bats specifically for the entire geopolitical region of Peninsular Malaysia has never been published, yet knowing which species are present in Peninsular Malaysia and their distributions across the region are crucial in developing suitable conservation plans. Our literature search revealed that 110 bat species have been documented in Peninsular Malaysia; 105 species have precise locality records while five species lack recent and/or precise locality records. We retrieved 18 species from records dated before the year 2000 and seven species have only ever been recorded once. Our search of Barcode of Life Datasystems (BOLD) found that 86 (of the 110) species have public records of which 48 species have public DNA barcodes available from bats sampled in Peninsular Malaysia. Based on Neighbour-Joining tree analyses and the allocation of DNA barcodes to Barcode Index Number system (BINs) by BOLD, several DNA barcodes recorded under the same species name are likely to represent distinct taxa. We discuss these cases in detail and highlight the importance of further surveys to determine the occurences and resolve the taxonomy of particular bat species in Peninsular Malaysia, with implications for conservation priorities.

  10. Detection of plant-based adulterants in turmeric powder using DNA barcoding.

    Science.gov (United States)

    Parvathy, V A; Swetha, V P; Sheeja, T E; Sasikumar, B

    2015-01-01

    In its powdered form, turmeric [Curcuma longa L. (Zingiberaceae)], a spice of medical importance, is often adulterated lowering its quality. The study sought to detect plant-based adulterants in traded turmeric powder using DNA barcoding. Accessions of Curcuma longa L., Curcuma zedoaria Rosc. (Zingiberaceae), and cassava starch served as reference samples. Three barcoding loci, namely ITS, rbcL, and matK, were used for PCR amplification of the reference samples and commercial samples representing 10 different companies. PCR success rate, sequencing efficiency, occurrence of SNPs, and BLAST analysis were used to assess the potential of the barcoding loci in authenticating the traded samples of turmeric. The PCR and sequencing success of the loci rbcL and ITS were found to be 100%, whereas matK showed no amplification. ITS proved to be the ideal locus because it showed greater variability than rbcL in discriminating the Curcuma species. The presence of C. zedoaria could be detected in one of the samples whereas cassava starch, wheat, barley, and rye in other two samples although the label claimed nothing other than turmeric powder in the samples. Unlabeled materials in turmeric powder are considered as adulterants or fillers, added to increase the bulk weight and starch content of the commodity for economic gains. These adulterants pose potential health hazards to consumers who are allergic to these plants, lowering the product's medicinal value and belying the claim that the product is gluten free. The study proved DNA barcoding as an efficient tool for testing the integrity and the authenticity of commercial products of turmeric.

  11. Forensic botany II, DNA barcode for land plants: Which markers after the international agreement?

    Science.gov (United States)

    Ferri, G; Corradini, B; Ferrari, F; Santunione, A L; Palazzoli, F; Alu', M

    2015-03-01

    The ambitious idea of using a short piece of DNA for large-scale species identification (DNA barcoding) is already a powerful tool for scientists and the application of this standard technique seems promising in a range of fields including forensic genetics. While DNA barcoding enjoyed a remarkable success for animal identification through cytochrome c oxidase I (COI) analysis, the attempts to identify a single barcode for plants remained a vain hope for a longtime. From the beginning, the Consortium for the Barcode of Life (CBOL) showed a lack of agreement on a core plant barcode, reflecting the diversity of viewpoints. Different research groups advocated various markers with divergent set of criteria until the recent publication by the CBOL-Plant Working Group. After a four-year effort, in 2009 the International Team concluded to agree on standard markers promoting a multilocus solution (rbcL and matK), with 70-75% of discrimination to the species level. In 2009 our group firstly proposed the broad application of DNA barcoding principles as a tool for identification of trace botanical evidence through the analysis of two chloroplast loci (trnH-psbA and trnL-trnF) in plant species belonging to local flora. Difficulties and drawbacks that were encountered included a poor coverage of species in specific databases and the lack of authenticated reference sequences for the selected markers. Successful preliminary results were obtained providing an approach to progressively identify unknown plant specimens to a given taxonomic rank, usable by any non-specialist botanist or in case of a shortage of taxonomic expertise. Now we considered mandatory to update and to compare our previous findings with the new selected plastid markers (matK+rbcL), taking into account forensic requirements. Features of all the four loci (the two previously analyzed trnH-psbA+trnL-trnF and matK+rbcL) were compared singly and in multilocus solutions to assess the most suitable combination for

  12. Barcode server: a visualization-based genome analysis system.

    Directory of Open Access Journals (Sweden)

    Fenglou Mao

    Full Text Available We have previously developed a computational method for representing a genome as a barcode image, which makes various genomic features visually apparent. We have demonstrated that this visual capability has made some challenging genome analysis problems relatively easy to solve. We have applied this capability to a number of challenging problems, including (a identification of horizontally transferred genes, (b identification of genomic islands with special properties and (c binning of metagenomic sequences, and achieved highly encouraging results. These application results inspired us to develop this barcode-based genome analysis server for public service, which supports the following capabilities: (a calculation of the k-mer based barcode image for a provided DNA sequence; (b detection of sequence fragments in a given genome with distinct barcodes from those of the majority of the genome, (c clustering of provided DNA sequences into groups having similar barcodes; and (d homology-based search using Blast against a genome database for any selected genomic regions deemed to have interesting barcodes. The barcode server provides a job management capability, allowing processing of a large number of analysis jobs for barcode-based comparative genome analyses. The barcode server is accessible at http://csbl1.bmb.uga.edu/Barcode.

  13. Identification of species and materia medica within Angelica L. (Umbelliferae) based on phylogeny inferred from DNA barcodes.

    Science.gov (United States)

    Yuan, Qing-Jun; Zhang, Bin; Jiang, Dan; Zhang, Wen-Jing; Lin, Tsai-Yun; Wang, Nian-He; Chiou, Shu-Jiau; Huang, Lu-Qi

    2015-03-01

    DNA barcodes have been increasingly used in authentication of medicinal plants, while their wide application in materia medica is limited in their accuracy due to incomplete sampling of species and absence of identification for materia medica. In this study, 95 leaf accessions of 23 species (including one variety) and materia medica of three Pharmacopoeia-recorded species of Angelica in China were collected to evaluate the effectiveness of four DNA barcodes (rbcL, matK, trnH-psbA and ITS). Our results showed that ITS provided the best discriminatory power by resolving 17 species as monophyletic lineages without shared alleles and exhibited the largest barcoding gap among the four single barcodes. The phylogenetic analysis of ITS showed that Levisticum officinale and Angelica sinensis were sister taxa, which indicates that L. officinale should be considered as a species of Angelica. The combination of ITS + rbcL + matK + trnH-psbA performed slight better discriminatory power than ITS, recovering 23 species without shared alleles and 19 species as monophyletic clades in ML tree. Authentication of materia medica using ITS revealed that the decoction pieces of A. sinensis and A. biserrata were partially adulterated with those of L. officinale, and the temperature around 80 °C processing A. dahurica decoction pieces obviously reduced the efficiency of PCR and sequencing. The examination of two cultivated varieties of A. dahurica from different localities indicated that the four DNA barcodes are inefficient for discriminating geographical authenticity of conspecific materia medica. This study provides an empirical paradigm in identification of medicinal plants and their materia medica using DNA barcodes. © 2014 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  14. DNA barcoding coupled to HRM analysis as a new and simple tool for the authentication of Gadidae fish species.

    Science.gov (United States)

    Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel

    2017-09-01

    This work aimed to exploit the use of DNA mini-barcodes combined with high resolution melting (HRM) for the authentication of gadoid species: Atlantic cod (Gadus morhua), Pacific cod (Gadus macrocephalus), Alaska pollock (Theragra chalcogramma) and saithe (Pollachius virens). Two DNA barcode regions, namely cytochrome c oxidase subunit I (COI) and cytochrome b (cytb), were analysed in silico to identify genetic variability among the four species and used, subsequently, to develop a real-time PCR method coupled with HRM analysis. The cytb mini-barcode enabled best discrimination of the target species with a high level of confidence (99.3%). The approach was applied successfully to identify gadoid species in 30 fish-containing foods, 30% of which were not as declared on the label. Herein, a novel approach for rapid, simple and cost-effective discrimination/clustering, as a tool to authenticate Gadidae fish species, according to their genetic relationship, is proposed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  16. Establishing a community-wide DNA barcode library as a new tool for arctic research

    DEFF Research Database (Denmark)

    Wirta, H.; Várkonyi, G.; Rasmussen, C.

    2016-01-01

    DNA sequences offer powerful tools for describing the members and interactions of natural communities. In this study, we establish the to-date most comprehensive library of DNA barcodes for a terrestrial site, including all known macroscopic animals and vascular plants of an intensively studied...... area of the High Arctic, the Zackenberg Valley in Northeast Greenland. To demonstrate its utility, we apply the library to identify nearly 20 000 arthropod individuals from two Malaise traps, each operated for two summers. Drawing on this material, we estimate the coverage of previous morphology...... ongoing shifts in arctic communities and ecosystems. The DNA barcode library now established for Zackenberg offers new scope for such explorations, and for the detailed dissection of interspecific interactions throughout the community....

  17. The D1-D2 region of the large subunit ribosomal DNA as barcode for ciliates.

    Science.gov (United States)

    Stoeck, T; Przybos, E; Dunthorn, M

    2014-05-01

    Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our planet and are an essential component for ecosystem function, processes and stability. Accurate identification of these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists. To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic distance analyses, we identified a D1-D2 sequence divergence of DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL barcode for ciliated protists. © 2013 John Wiley & Sons Ltd.

  18. A DNA barcode library of the beetle reference collection (Insecta: Coleoptera in the National Science Museum, Korea

    Directory of Open Access Journals (Sweden)

    Sang Woo Jung

    2016-06-01

    Full Text Available Coleoptera is a group of insects that are most diverse among insect resources. Although used as indicator species and applied in developing new drugs, it is difficult to identify them quickly. Since the development of a method using mitochondrial DNA information for identification, studies have been conducted in Korea to swiftly and accurately identify species. The National Science Museum of Korea (NSMK has been collecting and morphologically identifying domestic reference insects since 2013, and building a database of DNA barcodes with digital images. The NSMK completed construction of a database of digital images and DNA barcodes of 60 beetle species in the Korean National Research Information System. A total of 179 specimens and 60 species were used for the analysis, and the averages of intraspecific and interspecific variations were 0.70±0.45% and 26.34±6.01%, respectively, with variation rates ranging from 0% to 1.45% and 9.83% to 56.23%, respectively.

  19. DNA barcode data accurately assign higher spider taxa

    Directory of Open Access Journals (Sweden)

    Jonathan A. Coddington

    2016-07-01

    Full Text Available The use of unique DNA sequences as a method for taxonomic identification is no longer fundamentally controversial, even though debate continues on the best markers, methods, and technology to use. Although both existing databanks such as GenBank and BOLD, as well as reference taxonomies, are imperfect, in best case scenarios “barcodes” (whether single or multiple, organelle or nuclear, loci clearly are an increasingly fast and inexpensive method of identification, especially as compared to manual identification of unknowns by increasingly rare expert taxonomists. Because most species on Earth are undescribed, a complete reference database at the species level is impractical in the near term. The question therefore arises whether unidentified species can, using DNA barcodes, be accurately assigned to more inclusive groups such as genera and families—taxonomic ranks of putatively monophyletic groups for which the global inventory is more complete and stable. We used a carefully chosen test library of CO1 sequences from 49 families, 313 genera, and 816 species of spiders to assess the accuracy of genus and family-level assignment. We used BLAST queries of each sequence against the entire library and got the top ten hits. The percent sequence identity was reported from these hits (PIdent, range 75–100%. Accurate assignment of higher taxa (PIdent above which errors totaled less than 5% occurred for genera at PIdent values >95 and families at PIdent values ≥ 91, suggesting these as heuristic thresholds for accurate generic and familial identifications in spiders. Accuracy of identification increases with numbers of species/genus and genera/family in the library; above five genera per family and fifteen species per genus all higher taxon assignments were correct. We propose that using percent sequence identity between conventional barcode sequences may be a feasible and reasonably accurate method to identify animals to family/genus. However

  20. Bridging two scholarly islands enriches both: COI DNA barcodes for species identification versus human mitochondrial variation for the study of migrations and pathologies.

    Science.gov (United States)

    Thaler, David S; Stoeckle, Mark Y

    2016-10-01

    DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.

  1. Chemical and genetic discrimination of Cistanches Herba based on UPLC-QTOF/MS and DNA barcoding.

    Science.gov (United States)

    Zheng, Sihao; Jiang, Xue; Wu, Labin; Wang, Zenghui; Huang, Linfang

    2014-01-01

    Cistanches Herba (Rou Cong Rong), known as "Ginseng of the desert", has a striking curative effect on strength and nourishment, especially in kidney reinforcement to strengthen yang. However, the two plant origins of Cistanches Herba, Cistanche deserticola and Cistanche tubulosa, vary in terms of pharmacological action and chemical components. To discriminate the plant origin of Cistanches Herba, a combined method system of chemical and genetic--UPLC-QTOF/MS technology and DNA barcoding--were firstly employed in this study. The results indicated that three potential marker compounds (isomer of campneoside II, cistanoside C, and cistanoside A) were obtained to discriminate the two origins by PCA and OPLS-DA analyses. DNA barcoding enabled to differentiate two origins accurately. NJ tree showed that two origins clustered into two clades. Our findings demonstrate that the two origins of Cistanches Herba possess different chemical compositions and genetic variation. This is the first reported evaluation of two origins of Cistanches Herba, and the finding will facilitate quality control and its clinical application.

  2. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

    Science.gov (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  3. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago.

    Science.gov (United States)

    Vasconcelos, Raquel; Montero-Mendieta, Santiago; Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador

    2016-01-01

    Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework.

  4. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago.

    Directory of Open Access Journals (Sweden)

    Raquel Vasconcelos

    Full Text Available Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot and the conservation interest of its reptile fauna (94% endemics, we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs, cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework.

  5. EXPRESS METHOD OF BARCODE GENERATION FROM FACIAL IMAGES

    Directory of Open Access Journals (Sweden)

    G. A. Kukharev

    2014-03-01

    Full Text Available In the paper a method of generating of standard type linear barcodes from facial images is proposed. The method is based on use of the histogram of facial image brightness, averaging the histogram on a limited number of intervals, quantization of results in a range of decimal numbers from 0 to 9 and table conversion into the final barcode. The proposed solution is computationally low-cost and not requires the use of specialized software on image processing that allows generating of facial barcodes in mobile systems, and thus the proposed method can be interpreted as an express method. Results of tests on the Face94 and CUHK Face Sketch FERET Databases showed that the proposed method is a new solution for use in the real-world practice and ensures the stability of generated barcodes in changes of scale, pose and mirroring of a facial image, and also changes of a facial expression and shadows on faces from local lighting. The proposed method is based on generating of a standard barcode directly from the facial image, and thus contains the subjective information about a person's face.

  6. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family.

    Science.gov (United States)

    Gao, Ting; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Liu, Chang; Chen, Shilin

    2010-10-26

    Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels.

  7. Validating DNA barcodes: A non-destructive extraction protocol enables simultaneous vouchering of DNA and morphological vouchers

    Science.gov (United States)

    Morphology-based keys support accurate identification of many taxa. However, identification can be difficult for taxa that are not well studied, very small, members of cryptic species complexes, or represented by immature stages. For such cases, DNA barcodes may provide diagnostic characters. Ecolog...

  8. Insect barcode information system.

    Science.gov (United States)

    Pratheepa, Maria; Jalali, Sushil Kumar; Arokiaraj, Robinson Silvester; Venkatesan, Thiruvengadam; Nagesh, Mandadi; Panda, Madhusmita; Pattar, Sharath

    2014-01-01

    Insect Barcode Information System called as Insect Barcode Informática (IBIn) is an online database resource developed by the National Bureau of Agriculturally Important Insects, Bangalore. This database provides acquisition, storage, analysis and publication of DNA barcode records of agriculturally important insects, for researchers specifically in India and other countries. It bridges a gap in bioinformatics by integrating molecular, morphological and distribution details of agriculturally important insects. IBIn was developed using PHP/My SQL by using relational database management concept. This database is based on the client- server architecture, where many clients can access data simultaneously. IBIn is freely available on-line and is user-friendly. IBIn allows the registered users to input new information, search and view information related to DNA barcode of agriculturally important insects.This paper provides a current status of insect barcode in India and brief introduction about the database IBIn. http://www.nabg-nbaii.res.in/barcode.

  9. An Asiatic Chironomid in Brazil: morphology, DNA barcode and bionomics

    Directory of Open Access Journals (Sweden)

    Gizelle Amora

    2015-07-01

    Full Text Available In most freshwater ecosystems, aquatic insects are dominant in terms of diversity; however, there is a disproportionately low number of records of alien species when compared to other freshwater organisms. The Chironomidae is one aquatic insect family that includes some examples of alien species around the world. During a study on aquatic insects in Amazonas state (Brazil, we collected specimens of Chironomidae that are similar, at the morphological level, to Chironomus kiiensis Tokunaga and Chironomus striatipennis Kieffer, both with distributions restricted to Asia. The objectives of this study were to provide morphological information on this Chironomus population, to investigate its identity using DNA barcoding and, to provide bionomic information about this species. Chironomus DNA barcode data were obtained from GenBank and Barcode of Life Data Systems (BOLD and, together with our data, were analyzed using the neighbor-joining method with 1000 bootstrap replicates and the genetic distances were estimated using the Kimura-2-parameter. At the morphological level, the Brazilian population cannot be distinguished either from C. striatipennis or C. kiiensis, configuring a species complex but, at the molecular level our studied population is placed in a clade together with C. striatipennis, from South Korea. Bionomic characteristics of the Brazilian Chironomus population differ from the ones of C. kiiensis from Japan, the only species in this species complex with bionomic information available. The Brazilian Chironomus population has a smaller size, the double of the number of eggs and inhabits oligotrophic water, in artificial container. In the molecular analysis, populations of C. striatipennis and C. kiiensis are placed in a clade, formed by two groups: Group A (which includes populations from both named species, from different Asiatic regions and our Brazilian population and Group B (with populations of C. kiiensis from Japan and South Korea

  10. DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

    Science.gov (United States)

    Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

    2018-04-01

    Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

  11. How many species and under what names? Using DNA barcoding and GenBank data for west Central African amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Jessica L Deichmann

    the taxonomy of complex groups. Our methods provide an example of how non-taxonomists and parataxonomists working in understudied parts of the world with limited geographic sampling and comparative morphological material can use DNA barcoding and publicly available sequence data (GenBank to rapidly identify the number of species and assign tentative names to aid in urgent conservation management actions and contribute to taxonomic resolution.

  12. Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians

    Directory of Open Access Journals (Sweden)

    Chiari Ylenia

    2005-03-01

    Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.

  13. Feasibility of using microbeads with holographic barcodes to track DNA specimens in the clinical molecular laboratory

    Directory of Open Access Journals (Sweden)

    Jason D. Merker

    2013-07-01

    Full Text Available We demonstrate the feasibility of using glass microbeads with a holographic barcode identifier to track DNA specimens in the molecular pathology laboratory. These beads can be added to peripheral blood specimens and are carried through automated DNA extraction protocols that use magnetic glass particles. We found that an adequate number of microbeads are consistently carried over during genomic DNA extraction to allow specimen identification, that the beads do not interfere with the performance of several different molecular assays, and that the beads and genomic DNA remain stable when stored together under regular storage conditions in the molecular pathology laboratory. The beads function as an internal, easily readable specimen barcode. This approach may be useful for identifying DNA specimens and reducing errors associated with molecular laboratory testing.

  14. Mapping biodiversity and setting conservation priorities for SE Queensland's rainforests using DNA barcoding.

    Science.gov (United States)

    Shapcott, Alison; Forster, Paul I; Guymer, Gordon P; McDonald, William J F; Faith, Daniel P; Erickson, David; Kress, W John

    2015-01-01

    Australian rainforests have been fragmented due to past climatic changes and more recently landscape change as a result of clearing for agriculture and urban spread. The subtropical rainforests of South Eastern Queensland are significantly more fragmented than the tropical World Heritage listed northern rainforests and are subject to much greater human population pressures. The Australian rainforest flora is relatively taxonomically rich at the family level, but less so at the species level. Current methods to assess biodiversity based on species numbers fail to adequately capture this richness at higher taxonomic levels. We developed a DNA barcode library for the SE Queensland rainforest flora to support a methodology for biodiversity assessment that incorporates both taxonomic diversity and phylogenetic relationships. We placed our SE Queensland phylogeny based on a three marker DNA barcode within a larger international rainforest barcode library and used this to calculate phylogenetic diversity (PD). We compared phylo- diversity measures, species composition and richness and ecosystem diversity of the SE Queensland rainforest estate to identify which bio subregions contain the greatest rainforest biodiversity, subregion relationships and their level of protection. We identified areas of highest conservation priority. Diversity was not correlated with rainforest area in SE Queensland subregions but PD was correlated with both the percent of the subregion occupied by rainforest and the diversity of regional ecosystems (RE) present. The patterns of species diversity and phylogenetic diversity suggest a strong influence of historical biogeography. Some subregions contain significantly more PD than expected by chance, consistent with the concept of refugia, while others were significantly phylogenetically clustered, consistent with recent range expansions.

  15. Barcoding and border biosecurity: identifying cyprinid fishes in the aquarium trade.

    Directory of Open Access Journals (Sweden)

    Rupert A Collins

    Full Text Available Poorly regulated international trade in ornamental fishes poses risks to both biodiversity and economic activity via invasive alien species and exotic pathogens. Border security officials need robust tools to confirm identifications, often requiring hard-to-obtain taxonomic literature and expertise. DNA barcoding offers a potentially attractive tool for quarantine inspection, but has yet to be scrutinised for aquarium fishes. Here, we present a barcoding approach for ornamental cyprinid fishes by: (1 expanding current barcode reference libraries; (2 assessing barcode congruence with morphological identifications under numerous scenarios (e.g. inclusion of GenBank data, presence of singleton species, choice of analytical method; and (3 providing supplementary information to identify difficult species.We sampled 172 ornamental cyprinid fish species from the international trade, and provide data for 91 species currently unrepresented in reference libraries (GenBank/Bold. DNA barcodes were found to be highly congruent with our morphological assignments, achieving success rates of 90-99%, depending on the method used (neighbour-joining monophyly, bootstrap, nearest neighbour, GMYC, percent threshold. Inclusion of data from GenBank (additional 157 spp. resulted in a more comprehensive library, but at a cost to success rate due to the increased number of singleton species. In addition to DNA barcodes, our study also provides supporting data in the form of specimen images, morphological characters, taxonomic bibliography, preserved vouchers, and nuclear rhodopsin sequences. Using this nuclear rhodopsin data we also uncovered evidence of interspecific hybridisation, and highlighted unrecognised diversity within popular aquarium species, including the endangered Indian barb Puntius denisonii.We demonstrate that DNA barcoding provides a highly effective biosecurity tool for rapidly identifying ornamental fishes. In cases where DNA barcodes are unable to

  16. Effectiveness of ITS and sub-regions as DNA barcode markers for the identification of Basidiomycota (Fungi).

    Science.gov (United States)

    Badotti, Fernanda; de Oliveira, Francislon Silva; Garcia, Cleverson Fernando; Vaz, Aline Bruna Martins; Fonseca, Paula Luize Camargos; Nahum, Laila Alves; Oliveira, Guilherme; Góes-Neto, Aristóteles

    2017-02-23

    Fungi are among the most abundant and diverse organisms on Earth. However, a substantial amount of the species diversity, relationships, habitats, and life strategies of these microorganisms remain to be discovered and characterized. One important factor hindering progress is the difficulty in correctly identifying fungi. Morphological and molecular characteristics have been applied in such tasks. Later, DNA barcoding has emerged as a new method for the rapid and reliable identification of species. The nrITS region is considered the universal barcode of Fungi, and the ITS1 and ITS2 sub-regions have been applied as metabarcoding markers. In this study, we performed a large-scale analysis of all the available Basidiomycota sequences from GenBank. We carried out a rigorous trimming of the initial dataset based in methodological principals of DNA Barcoding. Two different approaches (PCI and barcode gap) were used to determine the performance of the complete ITS region and sub-regions. For most of the Basidiomycota genera, the three genomic markers performed similarly, i.e., when one was considered a good marker for the identification of a genus, the others were also; the same results were observed when the performance was insufficient. However, based on barcode gap analyses, we identified genomic markers that had a superior identification performance than the others and genomic markers that were not indicated for the identification of some genera. Notably, neither the complete ITS nor the sub-regions were useful in identifying 11 of the 113 Basidiomycota genera. The complex phylogenetic relationships and the presence of cryptic species in some genera are possible explanations of this limitation and are discussed. Knowledge regarding the efficiency and limitations of the barcode markers that are currently used for the identification of organisms is crucial because it benefits research in many areas. Our study provides information that may guide researchers in choosing

  17. Assessment of a GM-crop impact on soil systems using the DNA barcode-based tool for nematode community analysis

    NARCIS (Netherlands)

    Vonk JA; Mulder C; Vervoort MTW; Brolsma KM; Posthuma L; de Goede RGM; LER

    2012-01-01

    Het RIVM heeft met de Universiteit Wageningen (WUR) een nieuwe techniek ontwikkeld waarmee de kwaliteit van de bodem nauwkeuriger kan worden vastgesteld, de zogeheten nematode DNA-barcode tool. Deze moleculaire methode levert sneller gedetailleerdere informatie over verstoringen van een goede

  18. Ecological niche modelling and nDNA sequencing support a new, morphologically cryptic beetle species unveiled by DNA barcoding.

    Science.gov (United States)

    Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

    2011-02-09

    DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.

  19. Mini-DNA barcode in identification of the ornamental fish: A case study from Northeast India.

    Science.gov (United States)

    Dhar, Bishal; Ghosh, Sankar Kumar

    2017-09-05

    The ornamental fishes were exported under the trade names or generic names, thus creating problems in species identification. In this regard, DNA barcoding could effectively elucidate the actual species status. However, the problem arises if the specimen is having taxonomic disputes, falsified by trade/generic names, etc., On the other hand, barcoding the archival museum specimens would be of greater benefit to address such issues as it would create firm, error-free reference database for rapid identification of any species. This can be achieved only by generating short sequences as DNA from chemically preserved are mostly degraded. Here we aimed to identify a short stretch of informative sites within the full-length barcode segment, capable of delineating diverse group of ornamental fish species, commonly traded from NE India. We analyzed 287 full-length barcode sequences from the major fish orders and compared the interspecific K2P distance with nucleotide substitutions patterns and found a strong correlation of interspecies distance with transversions (0.95, pbarcode. The proposed segment was compared with the full-length barcodes and found to delineate the species effectively. Successful PCR amplification and sequencing of the 171bp segment using designed primers for different orders validated it as mini-barcodes for ornamental fishes. Thus, our findings would be helpful in strengthening the global database with the sequence of archived fish species as well as an effective identification tool of the traded ornamental fish species, as a less time consuming, cost effective field-based application. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family

    Directory of Open Access Journals (Sweden)

    Liu Chang

    2010-10-01

    Full Text Available Abstract Background Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. Results The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. Conclusions ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels.

  1. DNA barcoding of authentic and substitute samples of herb of the family Asparagaceae and Asclepiadaceae based on the ITS2 region

    Directory of Open Access Journals (Sweden)

    Padmalatha S Rai

    2012-01-01

    Full Text Available Background : Herbal drugs used to treat illness according to Ayurveda are often misidentified or adulterated with similar plant materials. Objective: To aid taxonomical identification, we used DNA barcoding to evaluate authentic and substitute samples of herb and phylogenetic relationship of four medicinal plants of family Asparagaceace and Asclepiadaceae. Materials and Methods : DNA extracted from dry root samples of two authentic and two substitutes of four specimens belonging to four species were subjected to polymerase chain reaction (PCR and DNA sequencing. Primers for nuclear DNA (nu ITS2 and plastid DNA (matK and rpoC1 were used for PCR and sequence analysis was performed by Clustal W. The intraspecific variation and interspecific divergence were calculated using MEGA V 4.0. Statistical Analysis : Kimura′s two parameter model, neighbor joining and bootstrapping methods were used in this work. Results: The result indicates the efficiency of amplification for ITS2 candidate DNA barcodes was 100% for four species tested. The average interspecific divergence is 0.12 and intraspecific variation was 0.232 in the case of two Asparagaceae species. In two Asclepiadaceae species, average interspecific divergence and intraspecific variation were 0.178 and 0.004 respectively. Conclusions: Our findings show that the ITS2 region can effectively discriminate Asparagus racemosus and Hemidesmus indicus from its substitute samples and hence can resolve species admixtures in raw samples. The ITS2 region may be used as one of the standard DNA barcodes to identify closely related species of family Asclepiadaceae but was noninformative for Asparagaceae species suggesting a need for the development of new markers for each family. More detailed studies involving more species and substitutes are warranted.

  2. DNA Barcoding through Quaternary LDPC Codes.

    Science.gov (United States)

    Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

    2015-01-01

    For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

  3. DNA Barcoding through Quaternary LDPC Codes.

    Directory of Open Access Journals (Sweden)

    Elizabeth Tapia

    Full Text Available For many parallel applications of Next-Generation Sequencing (NGS technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH or have intrinsic poor error correcting abilities (Hamming. Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9 at the expense of a rate of read losses just in the order of 10(-6.

  4. Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library

    Directory of Open Access Journals (Sweden)

    Kuzmina Maria L

    2012-11-01

    Full Text Available Abstract Background Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK and a supplemental ribosomal DNA (ITS2 marker for a well-studied flora near Churchill, Manitoba. Results This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years. ITS2 worked equally well for the fresh and herbarium material (89% and 88%. However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples. A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69% was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Conclusions Our results

  5. Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library.

    Science.gov (United States)

    Kuzmina, Maria L; Johnson, Karen L; Barron, Hannah R; Hebert, Paul Dn

    2012-11-28

    Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK) and a supplemental ribosomal DNA (ITS2) marker for a well-studied flora near Churchill, Manitoba. This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years). ITS2 worked equally well for the fresh and herbarium material (89% and 88%). However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples). A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69%) was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Our results provided fast and cost-effective solution to create a

  6. DNA barcoding analysis of more than 9 000 yeast isolates contributes to quantitative thresholds for yeast species and genera delimitation

    NARCIS (Netherlands)

    Vu, D; Groenewald, M; Szöke, S; Cardinali, G; Eberhardt, U; Stielow, B; de Vries, M; Verkleij, G J M; Crous, P W; Boekhout, T; Robert, V

    DNA barcoding is a global initiative for species identification through sequencing of short DNA sequence markers. Sequences of two loci, ITS and LSU, were generated as barcode data for all (ca. 9k) yeast strains included in the CBS collection, originally assigned to ca. 2 000 species. Taxonomic

  7. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  8. Identifying earthworms (Oligochaeta, Megadrili of the Southern Kuril Islands using DNA barcodes

    Directory of Open Access Journals (Sweden)

    Shekhovtsov, S. V.

    2018-01-01

    Full Text Available he Kuril Islands are a volcanic archipelago located between Hokkaido and Kamchatka. In this study we investigated earthworm fauna of three of the Southern Kuril Islands, Kunashir, Shikotan, and Yuri, using both morphological analysis and DNA barcoding. Our results highlight the potential of DNA barcoding for studying earthworm fauna: while previous studies reported only six earthworm species and subspecies on the Southern Kurils, we detected 15 genetic clusters. Six of them correspond to European cosmopolites; six, to Asian species, and three, to unidentified species. While no European earthworms were found on Yuri that is uninhabited since WWII, they dominated on larger and inhabited Kunashir and Shikotan, suggesting that they are recent invaders. Of the six Asian species, five had cox1 sequences identical or very closely related to published sequences from the mainland or the Japanese islands and thus are recent invaders.

  9. Chemical and genetic discrimination of Cistanches Herba based on UPLC-QTOF/MS and DNA barcoding.

    Directory of Open Access Journals (Sweden)

    Sihao Zheng

    Full Text Available Cistanches Herba (Rou Cong Rong, known as "Ginseng of the desert", has a striking curative effect on strength and nourishment, especially in kidney reinforcement to strengthen yang. However, the two plant origins of Cistanches Herba, Cistanche deserticola and Cistanche tubulosa, vary in terms of pharmacological action and chemical components. To discriminate the plant origin of Cistanches Herba, a combined method system of chemical and genetic--UPLC-QTOF/MS technology and DNA barcoding--were firstly employed in this study. The results indicated that three potential marker compounds (isomer of campneoside II, cistanoside C, and cistanoside A were obtained to discriminate the two origins by PCA and OPLS-DA analyses. DNA barcoding enabled to differentiate two origins accurately. NJ tree showed that two origins clustered into two clades. Our findings demonstrate that the two origins of Cistanches Herba possess different chemical compositions and genetic variation. This is the first reported evaluation of two origins of Cistanches Herba, and the finding will facilitate quality control and its clinical application.

  10. DNA barcoding based on plastid matK and RNA polymerase for assessing the genetic identity of date (Phoenix dactylifera L.) cultivars.

    Science.gov (United States)

    Enan, M R; Ahamed, A

    2014-02-14

    The cultivated date palm is the most agriculturally important species of the Arecaceae family. The standard chloroplast DNA barcode for land plants recommended by the Consortium for the Barcode of Life plant working group needs to be evaluated for a wide range of plant species. Therefore, we assessed the potential of the matK and rpoC1 markers for the authentication of date cultivars. There is not one universal method to authenticate date cultivars. In this study, 11 different date cultivars were sequenced and analyzed for matK and rpoC1 genes by using bioinformatic tools to establish a cultivar-specific molecular monogram. The chloroplast matK marker was more informative than the rpoC1 chloroplast DNA markers. Phylogenetic trees were constructed on the basis of the matK and rpoC1 sequences, and the results suggested that matK alone or in combination with rpoC1 can be used for determining the levels of genetic variation and for barcoding.

  11. DNA barcode of Parodontidae species from the La Plata river basin - applying new data to clarify taxonomic problems

    Directory of Open Access Journals (Sweden)

    Elisangela Bellafronte

    Full Text Available In the past years, DNA barcoding has emerged as a quick, accurate and efficient tool to identify species. Considering the difficulty in identifying some Parodontidae species from the La Plata basin and the absence of molecular data for the group, we aimed to test the effectiveness of DNA barcoding and discuss the importance of using different approaches to solve taxonomic problems. Eight species were analyzed with partial sequences of Cytochrome c oxidase I. The mean intraspecific K2P genetic distance was 0.04% compared to 4.2% for mean interspecific K2P genetic distance. The analyses of distance showed two pairs of species with K2P genetic divergence lower than 2%, but enough to separate these species. Apareiodon sp. and A. ibitiensis, considered as the same species by some authors, showed 4.2% genetic divergence, reinforcing their are different species. Samples of A. affinis from the Uruguay and Paraguay rivers presented 0.3% genetic divergence, indicating a close relationship between them. However, these samples diverged 6.1% from the samples of the upper Paraná River, indicating that the latter represents a potentially new species. The results showed the effectiveness of the DNA barcoding method in identifying the analyzed species, which, together with the morphological and cytogenetic available data, help species identification.

  12. Barcode DNA length polymorphisms vs fatty acid profiling for adulteration detection in olive oil.

    Science.gov (United States)

    Uncu, Ali Tevfik; Uncu, Ayse Ozgur; Frary, Anne; Doganlar, Sami

    2017-04-15

    The aim of this study was to compare the performance of a DNA-barcode assay with fatty acid profile analysis to authenticate the botanical origin of olive oil. To achieve this aim, we performed a PCR-capillary electrophoresis (PCR-CE) approach on olive oil: seed oil blends using the plastid trnL (UAA) intron barcode. In parallel to genomic analysis, we subjected the samples to gas chromatography analysis of fatty acid composition. While the PCR-CE assay proved equally efficient as gas chromatography analysis in detecting adulteration with soybean, palm, rapeseed, sunflower, sesame, cottonseed and peanut oils, it was superior to the widely utilized analytical chemistry approach in revealing the adulterant species and detecting small quantities of corn and safflower oils in olive oil. Moreover, the DNA-based test correctly identified all tested olive oil: hazelnut oil blends whereas it was not feasible to detect hazelnut oil adulteration through fatty acid profile analysis. Thus, the present research has shown the feasibility of a PCR-CE barcode assay to detect adulteration in olive oil. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Identification of scleractinian coral recruits using fluorescent censusing and DNA barcoding techniques.

    Directory of Open Access Journals (Sweden)

    Chia-Min Hsu

    Full Text Available The identification of coral recruits has been problematic due to a lack of definitive morphological characters being available for higher taxonomic resolution. In this study, we tested whether fluorescent detection of coral recruits used in combinations of different DNA-barcoding markers (cytochrome oxidase I gene [COI], open reading frame [ORF], and nuclear Pax-C intron [PaxC] could be useful for increasing the resolution of coral spat identification in ecological studies. One hundred and fifty settlement plates were emplaced at nine sites on the fringing reefs of Kenting National Park in southern Taiwan between April 2011 and September 2012. A total of 248 living coral spats and juveniles (with basal areas ranging from 0.21 to 134.57 mm(2 were detected on the plates with the aid of fluorescent light and collected for molecular analyses. Using the COI DNA barcoding technique, 90.3% (224/248 of coral spats were successfully identified into six genera, including Acropora, Isopora, Montipora, Pocillopora, Porites, and Pavona. PaxC further separated I. cuneata and I. palifera of Isopora from Acropora, and ORF successfully identified the species of Pocillopora (except P. meandrina and P. eydouxi. Moreover, other cnidarian species such as actinarians, zoanthids, and Millepora species were visually found using fluorescence and identified by COI DNA barcoding. This combination of existing approaches greatly improved the taxonomic resolution of early coral life stages, which to date has been mainly limited to the family level based on skeletal identification. Overall, this study suggests important improvements for the identification of coral recruits in ecological studies.

  14. Identification of scleractinian coral recruits using fluorescent censusing and DNA barcoding techniques.

    Science.gov (United States)

    Hsu, Chia-Min; de Palmas, Stéphane; Kuo, Chao-Yang; Denis, Vianney; Chen, Chaolun Allen

    2014-01-01

    The identification of coral recruits has been problematic due to a lack of definitive morphological characters being available for higher taxonomic resolution. In this study, we tested whether fluorescent detection of coral recruits used in combinations of different DNA-barcoding markers (cytochrome oxidase I gene [COI], open reading frame [ORF], and nuclear Pax-C intron [PaxC]) could be useful for increasing the resolution of coral spat identification in ecological studies. One hundred and fifty settlement plates were emplaced at nine sites on the fringing reefs of Kenting National Park in southern Taiwan between April 2011 and September 2012. A total of 248 living coral spats and juveniles (with basal areas ranging from 0.21 to 134.57 mm(2)) were detected on the plates with the aid of fluorescent light and collected for molecular analyses. Using the COI DNA barcoding technique, 90.3% (224/248) of coral spats were successfully identified into six genera, including Acropora, Isopora, Montipora, Pocillopora, Porites, and Pavona. PaxC further separated I. cuneata and I. palifera of Isopora from Acropora, and ORF successfully identified the species of Pocillopora (except P. meandrina and P. eydouxi). Moreover, other cnidarian species such as actinarians, zoanthids, and Millepora species were visually found using fluorescence and identified by COI DNA barcoding. This combination of existing approaches greatly improved the taxonomic resolution of early coral life stages, which to date has been mainly limited to the family level based on skeletal identification. Overall, this study suggests important improvements for the identification of coral recruits in ecological studies.

  15. Molecular identification of birds: performance of distance-based DNA barcoding in three genes to delimit parapatric species.

    Directory of Open Access Journals (Sweden)

    Mansour Aliabadian

    Full Text Available DNA barcoding based on the mitochondrial cytochrome oxidase subunit I gene (cox1 or COI has been successful in species identification across a wide array of taxa but in some cases failed to delimit the species boundaries of closely allied allopatric species or of hybridising sister species.In this study we extend the sample size of prior studies in birds for cox1 (2776 sequences, 756 species and target especially species that are known to occur parapatrically, and/or are known to hybridise, on a Holarctic scale. In order to obtain a larger set of taxa (altogether 2719 species, we include also DNA sequences of two other mitochondrial genes: cytochrome b (cob (4614 sequences, 2087 species and 16S (708 sequences, 498 species. Our results confirm the existence of a wide gap between intra- and interspecies divergences for both cox1 and cob, and indicate that distance-based DNA barcoding provides sufficient information to identify and delineate bird species in 98% of all possible pairwise comparisons. This DNA barcoding gap was not statistically influenced by the number of individuals sequenced per species. However, most of the hybridising parapatric species pairs have average divergences intermediate between intraspecific and interspecific distances for both cox1 and cob.DNA barcoding, if used as a tool for species discovery, would thus fail to identify hybridising parapatric species pairs. However, most of them can probably still assigned to known species by character-based approaches, although development of complementary nuclear markers will be necessary to account for mitochondrial introgression in hybridising species.

  16. Integrating DNA barcodes and morphology for species delimitation in the Corynoneura group (Diptera: Chironomidae: Orthocladiinae).

    Science.gov (United States)

    Silva, F L; Wiedenbrug, S

    2014-02-01

    In this study, we use DNA barcodes for species delimitation to solve taxonomic conflicts in 86 specimens of 14 species belonging to the Corynoneura group (Diptera: Chironomidae: Orthocladiinae), from the Atlantic Forest, Brazil. Molecular analysis of cytochrome c-oxidase subunit I (COI) gene sequences supported 14 cohesive species groups, of which two similar groups were subsequently associated with morphological variation at the pupal stage. Eleven species previously described based on morphological criteria were linked to DNA markers. Furthermore, there is the possibility that there may be cryptic species within the Corynoneura group, since one group of species presented internal grouping, although no morphological divergence was observed. Our results support DNA-barcoding as an excellent tool for species delimitation in groups where taxonomy by means of morphology is difficult or even impossible.

  17. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. DNA barcoding as a useful tool in the systematic study of wild bees of the tribe Augochlorini (Hymenoptera: Halictidae).

    Science.gov (United States)

    González-Vaquero, Rocío Ana; Roig-Alsina, Arturo; Packer, Laurence

    2016-10-01

    Special care is needed in the delimitation and identification of halictid bee species, which are renowned for being morphologically monotonous. Corynura Spinola and Halictillus Moure (Halictidae: Augochlorini) contain species that are key elements in southern South American ecosystems. These bees are very difficult to identify due to close morphological similarity among species and high sexual dimorphism. We analyzed 170 barcode-compliant COI sequences from 19 species. DNA barcodes were useful to confirm gender associations and to detect two new cryptic species. Interspecific distances were significantly higher than those reported for other bees. Maximum intraspecific divergence was less than 1% in 14 species. Barcode index numbers (BINs) were useful to identify putative species that need further study. More than one BIN was assigned to five species. The name Corynura patagonica (Cockerell) probably refers to two cryptic species. The results suggest that Corynura and Halictillus species can be identified using DNA barcodes. The sequences of the species included in this study can be used as a reference to assess the identification of unknown specimens. This study provides additional support for the use of DNA barcodes in bee taxonomy and the identification of specimens, which is particularly relevant in insects of ecological importance such as pollinators.

  19. Beyond the colours: discovering hidden diversity in the Nymphalidae of the Yucatan Peninsula in Mexico through DNA barcoding.

    Directory of Open Access Journals (Sweden)

    Blanca R Prado

    Full Text Available BACKGROUND: Recent studies have demonstrated the utility of DNA barcoding in the discovery of overlooked species and in the connection of immature and adult stages. In this study, we use DNA barcoding to examine diversity patterns in 121 species of Nymphalidae from the Yucatan Peninsula in Mexico. Our results suggest the presence of cryptic species in 8 of these 121 taxa. As well, the reference database derived from the analysis of adult specimens allowed the identification of nymphalid caterpillars providing new details on host plant use. METHODOLOGY/PRINCIPAL FINDINGS: We gathered DNA barcode sequences from 857 adult Nymphalidae representing 121 different species. This total includes four species (Adelpha iphiclus, Adelpha malea, Hamadryas iphtime and Taygetis laches that were initially overlooked because of their close morphological similarity to other species. The barcode results showed that each of the 121 species possessed a diagnostic array of barcode sequences. In addition, there was evidence of cryptic taxa; seven species included two barcode clusters showing more than 2% sequence divergence while one species included three clusters. All 71 nymphalid caterpillars were identified to a species level by their sequence congruence to adult sequences. These caterpillars represented 16 species, and included Hamadryas julitta, an endemic species from the Yucatan Peninsula whose larval stages and host plant (Dalechampia schottii, also endemic to the Yucatan Peninsula were previously unknown. CONCLUSIONS/SIGNIFICANCE: This investigation has revealed overlooked species in a well-studied museum collection of nymphalid butterflies and suggests that there is a substantial incidence of cryptic species that await full characterization. The utility of barcoding in the rapid identification of caterpillars also promises to accelerate the assembly of information on life histories, a particularly important advance for hyperdiverse tropical insect

  20. Beyond the Colours: Discovering Hidden Diversity in the Nymphalidae of the Yucatan Peninsula in Mexico through DNA Barcoding

    Science.gov (United States)

    Prado, Blanca R.; Pozo, Carmen; Valdez-Moreno, Martha; Hebert, Paul D. N.

    2011-01-01

    Background Recent studies have demonstrated the utility of DNA barcoding in the discovery of overlooked species and in the connection of immature and adult stages. In this study, we use DNA barcoding to examine diversity patterns in 121 species of Nymphalidae from the Yucatan Peninsula in Mexico. Our results suggest the presence of cryptic species in 8 of these 121 taxa. As well, the reference database derived from the analysis of adult specimens allowed the identification of nymphalid caterpillars providing new details on host plant use. Methodology/Principal Findings We gathered DNA barcode sequences from 857 adult Nymphalidae representing 121 different species. This total includes four species (Adelpha iphiclus, Adelpha malea, Hamadryas iphtime and Taygetis laches) that were initially overlooked because of their close morphological similarity to other species. The barcode results showed that each of the 121 species possessed a diagnostic array of barcode sequences. In addition, there was evidence of cryptic taxa; seven species included two barcode clusters showing more than 2% sequence divergence while one species included three clusters. All 71 nymphalid caterpillars were identified to a species level by their sequence congruence to adult sequences. These caterpillars represented 16 species, and included Hamadryas julitta, an endemic species from the Yucatan Peninsula whose larval stages and host plant (Dalechampia schottii, also endemic to the Yucatan Peninsula) were previously unknown. Conclusions/Significance This investigation has revealed overlooked species in a well-studied museum collection of nymphalid butterflies and suggests that there is a substantial incidence of cryptic species that await full characterization. The utility of barcoding in the rapid identification of caterpillars also promises to accelerate the assembly of information on life histories, a particularly important advance for hyperdiverse tropical insect assemblages. PMID:22132140

  1. Developing a DNA barcode library for perciform fishes in the South China Sea: Species identification, accuracy and cryptic diversity.

    Science.gov (United States)

    Hou, Gang; Chen, Wei-Tao; Lu, Huo-Sheng; Cheng, Fei; Xie, Song-Guang

    2018-01-01

    DNA barcodes were studied for 1,353 specimens representing 272 morphological species belonging to 149 genera and 55 families of Perciformes from the South China Sea (SCS). The average Kimura 2-parameter (K2P) distances within species, genera and families were 0.31%, 8.71% and 14.52%, respectively. A neighbour-joining (NJ) tree, Bayesian inference (BI) and maximum-likelihood (ML) trees and Automatic Barcode Gap Discovery (ABGD) revealed 260, 253 and 259 single-species-representing clusters, respectively. Barcoding gap analysis (BGA) demonstrated that barcode gaps were present for 178 of 187 species analysed with multiple specimens (95.2%), with the minimum interspecific distance to the nearest neighbour larger than the maximum intraspecific distance. A group of three Thunnus species (T. albacares, T. obesus and T. tonggol), a pair of Gerres species (G. oyena and G. japonicus), a pair of Istiblennius species (I. edentulous and I. lineatus) and a pair of Uranoscopus species (U. oligolepis and U. kaianus) were observed with low interspecific distances and overlaps between intra- and interspecific genetic distances. Three species (Apogon ellioti, Naucrates ductor and Psenopsis anomala) showed deep intraspecific divergences and generated two lineages each, suggesting the possibility of cryptic species. Our results demonstrated that DNA barcodes are highly reliable for delineating species of Perciformes in the SCS. The DNA barcode library established in this study will shed light on further research on the diversity of Perciformes in the SCS. © 2017 John Wiley & Sons Ltd.

  2. Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny.

    Science.gov (United States)

    Yu, Xiang-Qin; Drew, Bryan T; Yang, Jun-Bo; Gao, Lian-Ming; Li, De-Zhu

    2017-01-01

    Schima is an ecologically and economically important woody genus in tea family (Theaceae). Unresolved species delimitations and phylogenetic relationships within Schima limit our understanding of the genus and hinder utilization of the genus for economic purposes. In the present study, we conducted comparative analysis among the complete chloroplast (cp) genomes of 11 Schima species. Our results indicate that Schima cp genomes possess a typical quadripartite structure, with conserved genomic structure and gene order. The size of the Schima cp genome is about 157 kilo base pairs (kb). They consistently encode 114 unique genes, including 80 protein-coding genes, 30 tRNAs, and 4 rRNAs, with 17 duplicated in the inverted repeat (IR). These cp genomes are highly conserved and do not show obvious expansion or contraction of the IR region. The percent variability of the 68 coding and 93 noncoding (>150 bp) fragments is consistently less than 3%. The seven most widely touted DNA barcode regions as well as one promising barcode candidate showed low sequence divergence. Eight mutational hotspots were identified from the 11 cp genomes. These hotspots may potentially be useful as specific DNA barcodes for species identification of Schima. The 58 cpSSR loci reported here are complementary to the microsatellite markers identified from the nuclear genome, and will be leveraged for further population-level studies. Phylogenetic relationships among the 11 Schima species were resolved with strong support based on the cp genome data set, which corresponds well with the species distribution pattern. The data presented here will serve as a foundation to facilitate species identification, DNA barcoding and phylogenetic reconstructions for future exploration of Schima.

  3. Assessment of a GM-crop impact on soil systems using the DNA barcode-based tool for nematode community analysis

    NARCIS (Netherlands)

    Vonk, J.A.; Mulder, C.; Vervoort, M.T.W.; Brolsma, K.M.; Posthuma, L.; Goede, de R.G.M.

    2012-01-01

    The RIVM has developed with the Wageningen University (WUR) a new technique by which the soil quality can be determined accurately, the so-called nematode DNA barcode tool. This molecular method provides faster and more detailed information about disturbances in soil quality and the possible causes.

  4. DNA barcoding of Arctic Ocean holozooplankton for species identification and recognition

    Science.gov (United States)

    Bucklin, Ann; Hopcroft, Russell R.; Kosobokova, Ksenia N.; Nigro, Lisa M.; Ortman, Brian D.; Jennings, Robert M.; Sweetman, Christopher J.

    2010-01-01

    Zooplankton species diversity and distribution are important measures of environmental change in the Arctic Ocean, and may serve as 'rapid-responders' of climate-induced changes in this fragile ecosystem. The scarcity of taxonomists hampers detailed and up-to-date monitoring of these patterns for the rarer and more problematic species. DNA barcodes (short DNA sequences for species recognition and discovery) provide an alternative approach to accurate identification of known species, and can speed routine analysis of zooplankton samples. During 2004-2008, zooplankton samples were collected during cruises to the central Arctic Ocean and Chukchi Sea. A ˜700 base-pair region of the mitochondrial cytochrome oxidase I (mtCOI) gene was amplified and sequenced for 82 identified specimens of 41 species, including cnidarians (six hydrozoans, one scyphozoan), arthropod crustaceans (five amphipods, 24 copepods, one decapod, and one euphausiid); two chaetognaths; and one nemertean. Phylogenetic analysis used the Neighbor-Joining algorithm with Kimura-2-Parameter (K-2-P) distances, with 1000-fold bootstrapping. K-2-P genetic distances between individuals of the same species ranged from 0.0 to 0.2; genetic distances between species ranged widely from 0.1 to 0.7. The mtCOI gene tree showed monophyly (at 100% bootstrap value) for each of the 26 species for which more than one individual was analyzed. Of seven genera for which more than one species was analyzed, four were shown to be monophyletic; three genera were not resolved. At higher taxonomic levels, only the crustacean order Copepoda was resolved, with bootstrap value of 83%. The mtCOI barcodes accurately discriminated and identified known species of 10 taxonomic groups of Arctic Ocean holozooplankton. A comprehensive DNA barcode database for the estimated 300 described species of Arctic holozooplankton will allow rapid assessment of species diversity and distribution in this climate-vulnerable ocean ecosystem.

  5. Spiders (Araneae) of Churchill, Manitoba: DNA barcodes and morphology reveal high species diversity and new Canadian records.

    Science.gov (United States)

    Blagoev, Gergin A; Nikolova, Nadya I; Sobel, Crystal N; Hebert, Paul D N; Adamowicz, Sarah J

    2013-11-26

    Arctic ecosystems, especially those near transition zones, are expected to be strongly impacted by climate change. Because it is positioned on the ecotone between tundra and boreal forest, the Churchill area is a strategic locality for the analysis of shifts in faunal composition. This fact has motivated the effort to develop a comprehensive biodiversity inventory for the Churchill region by coupling DNA barcoding with morphological studies. The present study represents one element of this effort; it focuses on analysis of the spider fauna at Churchill. 198 species were detected among 2704 spiders analyzed, tripling the count for the Churchill region. Estimates of overall diversity suggest that another 10-20 species await detection. Most species displayed little intraspecific sequence variation (maximum Churchill, but the other species represents a range extension from the USA. The first description of the female of S. monticola was also presented. As well, one probable new species of Alopecosa (Lycosidae) was recognized. This study provides the first comprehensive DNA barcode reference library for the spider fauna of any region. Few cryptic species of spiders were detected, a result contrasting with the prevalence of undescribed species in several other terrestrial arthropod groups at Churchill. Because most (97.5%) sequence clusters at COI corresponded with a named taxon, DNA barcoding reliably identifies spiders in the Churchill fauna. The capacity of DNA barcoding to enable the identification of otherwise taxonomically ambiguous specimens (juveniles, females) also represents a major advance for future monitoring efforts on this group.

  6. The Use of DNA Barcoding in Identification of Genetic Diversity of ...

    African Journals Online (AJOL)

    In this study, for the first time, the use of DNA barcoding was used in identification of the genetic diversity of fish in Ugwu-omu Nike River, Enugu State, Nigeria. The fish were collected and placed in an aquarium and later transported to the Biotechnology laboratory of Godfrey Okoye University. The fish collection was ...

  7. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  8. Efficacy of the core DNA barcodes in identifying processed and poorly conserved plant materials commonly used in South African traditional medicine

    Directory of Open Access Journals (Sweden)

    Ledile Mankga

    2013-12-01

    Full Text Available Medicinal plants cover a broad range of taxa, which may be phylogenetically less related but morphologically very similar. Such morphological similarity between species may lead to misidentification and inappropriate use. Also the substitution of a medicinal plant by a cheaper alternative (e.g. other non-medicinal plant species, either due to misidentification, or deliberately to cheat consumers, is an issue of growing concern. In this study, we used DNA barcoding to identify commonly used medicinal plants in South Africa. Using the core plant barcodes, matK and rbcLa, obtained from processed and poorly conserved materials sold at the muthi traditional medicine market, we tested efficacy of the barcodes in species discrimination. Based on genetic divergence, PCR amplification efficiency and BLAST algorithm, we revealed varied discriminatory potentials for the DNA barcodes. In general, the barcodes exhibited high discriminatory power, indicating their effectiveness in verifying the identity of the most common plant species traded in South African medicinal markets. BLAST algorithm successfully matched 61% of the queries against a reference database, suggesting that most of the information supplied by sellers at traditional medicinal markets in South Africa is correct. Our findings reinforce the utility of DNA barcoding technique in limiting false identification that can harm public health.

  9. Application of DNA barcoding in biodiversity studies of shallow-water octocorals: molecular proxies agree with morphological estimates of species richness in Palau

    Science.gov (United States)

    McFadden, C. S.; Brown, A. S.; Brayton, C.; Hunt, C. B.; van Ofwegen, L. P.

    2014-06-01

    The application of DNA barcoding to anthozoan cnidarians has been hindered by their slow rates of mitochondrial gene evolution and the failure to identify alternative molecular markers that distinguish species reliably. Among octocorals, however, multilocus barcodes can distinguish up to 70 % of morphospecies, thereby facilitating the identification of species that are ecologically important but still very poorly known taxonomically. We tested the ability of these imperfect DNA barcodes to estimate species richness in a biodiversity survey of the shallow-water octocoral fauna of Palau using multilocus ( COI, mtMutS, 28S rDNA) sequences obtained from 305 specimens representing 38 genera of octocorals. Numbers and identities of species were estimated independently (1) by a taxonomic expert using morphological criteria and (2) by assigning sequences to molecular operational taxonomic units (MOTUs) using predefined genetic distance thresholds. Estimated numbers of MOTUs ranged from 73 to 128 depending on the barcode and distance threshold applied, bracketing the estimated number of 118 morphospecies. Concordance between morphospecies identifications and MOTUs ranged from 71 to 75 % and differed little among barcodes. For the speciose and ecologically dominant genus Sinularia, however, we were able to identify 95 % of specimens correctly simply by comparing mtMutS sequences and in situ photographs of colonies to an existing vouchered database. Because we lack a clear understanding of species boundaries in most of these taxa, numbers of morphospecies and MOTUs are both estimates of the true species diversity, and we cannot currently determine which is more accurate. Our results suggest, however, that the two methods provide comparable estimates of species richness for shallow-water Indo-Pacific octocorals. Use of molecular barcodes in biodiversity surveys will facilitate comparisons of species richness and composition among localities and over time, data that do not

  10. DNA Barcode Analysis of Thrips (Thysanoptera) Diversity in Pakistan Reveals Cryptic Species Complexes.

    Science.gov (United States)

    Iftikhar, Romana; Ashfaq, Muhammad; Rasool, Akhtar; Hebert, Paul D N

    2016-01-01

    Although thrips are globally important crop pests and vectors of viral disease, species identifications are difficult because of their small size and inconspicuous morphological differences. Sequence variation in the mitochondrial COI-5' (DNA barcode) region has proven effective for the identification of species in many groups of insect pests. We analyzed barcode sequence variation among 471 thrips from various plant hosts in north-central Pakistan. The Barcode Index Number (BIN) system assigned these sequences to 55 BINs, while the Automatic Barcode Gap Discovery detected 56 partitions, a count that coincided with the number of monophyletic lineages recognized by Neighbor-Joining analysis and Bayesian inference. Congeneric species showed an average of 19% sequence divergence (range = 5.6% - 27%) at COI, while intraspecific distances averaged 0.6% (range = 0.0% - 7.6%). BIN analysis suggested that all intraspecific divergence >3.0% actually involved a species complex. In fact, sequences for three major pest species (Haplothrips reuteri, Thrips palmi, Thrips tabaci), and one predatory thrips (Aeolothrips intermedius) showed deep intraspecific divergences, providing evidence that each is a cryptic species complex. The study compiles the first barcode reference library for the thrips of Pakistan, and examines global haplotype diversity in four important pest thrips.

  11. Capacity for DNA-barcode based taxonomy in support of Great Lakes biological monitoring

    Science.gov (United States)

    Enumerating organisms collected via nets and sediment grabs is a mainstay of aquatic ecology. Since morphological taxonomy can require considerable resources and expertise, DNA barcode-based identification of mixed-organism samples offers a valuable tool in support of biological...

  12. Efficient distinction of invasive aquatic plant species from non-invasive related species using DNA barcoding.

    Science.gov (United States)

    Ghahramanzadeh, R; Esselink, G; Kodde, L P; Duistermaat, H; van Valkenburg, J L C H; Marashi, S H; Smulders, M J M; van de Wiel, C C M

    2013-01-01

    Biological invasions are regarded as threats to global biodiversity. Among invasive aliens, a number of plant species belonging to the genera Myriophyllum, Ludwigia and Cabomba, and to the Hydrocharitaceae family pose a particular ecological threat to water bodies. Therefore, one would try to prevent them from entering a country. However, many related species are commercially traded, and distinguishing invasive from non-invasive species based on morphology alone is often difficult for plants in a vegetative stage. In this regard, DNA barcoding could become a good alternative. In this study, 242 samples belonging to 26 species from 10 genera of aquatic plants were assessed using the chloroplast loci trnH-psbA, matK and rbcL. Despite testing a large number of primer sets and several PCR protocols, the matK locus could not be amplified or sequenced reliably and therefore was left out of the analysis. Using the other two loci, eight invasive species could be distinguished from their respective related species, a ninth one failed to produce sequences of sufficient quality. Based on the criteria of universal application, high sequence divergence and level of species discrimination, the trnH-psbA noncoding spacer was the best performing barcode in the aquatic plant species studied. Thus, DNA barcoding may be helpful with enforcing a ban on trade of such invasive species, such as is already in place in the Netherlands. This will become even more so once DNA barcoding would be turned into machinery routinely operable by a nonspecialist in botany and molecular genetics. © 2012 Blackwell Publishing Ltd.

  13. DNA barcodes reveal that the widespread European tortricid moth Phalonidia manniana (Lepidoptera: Tortricidae) is a mixture of two species

    DEFF Research Database (Denmark)

    Mutanen, Marko; Aarvik, Leif; Huemer, Peter

    2012-01-01

    During efforts to generate DNA barcodes for all North European Lepidoptera, Phalonidia manniana (Fischer von Röslerstamm, 1839) was found to comprise two genetically distinct clusters. Morphological investigation further supports the existence of two distinct taxa, P. manniana and P. udana Guenée......, 1845, sp. rev. Their biologies also differ, P. manniana feeding in stems of Mentha and Lycopus (Lamiaceae) and P. udana feeding in stems of Lysimachia thyrsiflora and L. vulgaris (Primulaceae). We provide re-descriptions of both taxa and DNA barcodes for North European Phalonidia and Gynnidomorpha....... Phalonidia tolli Razowski, 1960, syn. nov., is considered a junior synonym of Pudana. Phalonidia udana is widely distributed in the North Palaearctic, whereas it seems to be rare or missing in large parts of Central Europe. The study demonstrates the usefulness of DNA barcoding in revealing cryptic species....

  14. Species-level para- and polyphyly in DNA barcode gene trees: strong operational bias in European Lepidoptera

    NARCIS (Netherlands)

    Mutanen, M.; Kivelä, S.M.; Vos, R.A.; Doorenweerd, C.; Ratnasingham, S.; Hausmann, A.; Huemer, P.; Dinca, V.; Nieukerken, van E.J.; Lopez-Vaamonde, C.; Vila, R.; Aarvik, L.; Decaëns, T.; Efetov, K.A.; Hebert, P.D.N.; Johnsen, A.; Karsholt, O.; Pentinsaari, M.; Rougerie, R.; Segerer, A.; Tarmann, G.; Zahiri, R.; Godfray, H.C.J.

    2016-01-01

    The proliferation of DNA data is revolutionizing all fields of systematic research. DNA barcode sequences, now available for millions of specimens and several hundred thousand species, are increasingly used in algorithmic species delimitations. This is complicated by occasional incongruences between

  15. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  16. Non-Gaussian Distribution of DNA Barcode Extension In Nanochannels Using High-throughput Imaging

    Science.gov (United States)

    Sheats, Julian; Reinhart, Wesley; Reifenberger, Jeff; Gupta, Damini; Muralidhar, Abhiram; Cao, Han; Dorfman, Kevin

    2015-03-01

    We present experimental data for the extension of internal segments of highly confined DNA using a high-­throughput experimental setup. Barcode­-labeled E. coli genomic DNA molecules were imaged at a high areal density in square nanochannels with sizes ranging from 40 nm to 51 nm in width. Over 25,000 molecules were used to obtain more than 1,000,000 measurements for genomic distances between 2,500 bp and 100,000 bp. The distribution of extensions has positive excess kurtosis and is skew­ left due to weak backfolding in the channel. As a result, the two Odijk theories for the chain extension and variance bracket the experimental data. We compared to predictions of a harmonic approximation for the confinement free energy and show that it produces a substantial error in the variance. These results suggest an inherent error associated with any statistical analysis of barcoded DNA that relies on harmonic models for chain extension. Present address: Department of Chemical and Biological Engineering, Princeton University.

  17. Distribution of distances between DNA barcode labels in nanochannels close to the persistence length

    Science.gov (United States)

    Reinhart, Wesley F.; Reifenberger, Jeff G.; Gupta, Damini; Muralidhar, Abhiram; Sheats, Julian; Cao, Han; Dorfman, Kevin D.

    2015-02-01

    We obtained experimental extension data for barcoded E. coli genomic DNA molecules confined in nanochannels from 40 nm to 51 nm in width. The resulting data set consists of 1 627 779 measurements of the distance between fluorescent probes on 25 407 individual molecules. The probability density for the extension between labels is negatively skewed, and the magnitude of the skewness is relatively insensitive to the distance between labels. The two Odijk theories for DNA confinement bracket the mean extension and its variance, consistent with the scaling arguments underlying the theories. We also find that a harmonic approximation to the free energy, obtained directly from the probability density for the distance between barcode labels, leads to substantial quantitative error in the variance of the extension data. These results suggest that a theory for DNA confinement in such channels must account for the anharmonic nature of the free energy as a function of chain extension.

  18. The neotype barcode of the cotton aphid (Hemiptera: Aphididae: Aphis gossypii Glover, 1877) and a proposal for type barcodes

    Science.gov (United States)

    A type barcode is a DNA barcode unequivocally tied to an authoritatively identified specimen, preferably the primary type specimen. Type barcodes are analogous, albeit subordinate, to type specimens, providing a stable reference to which other barcodes can be compared. We here designate and describe...

  19. Suitable DNA Barcoding for Identification and Supervision of Piper kadsura in Chinese Medicine Markets.

    Science.gov (United States)

    Yu, Ning; Gu, Hong; Wei, Yulong; Zhu, Ning; Wang, Yanli; Zhang, Haiping; Zhu, Yue; Zhang, Xin; Ma, Chao; Sun, Aidong

    2016-09-12

    Piper kadsura is a vine-like medicinal plant which is widely used in clinical treatment. However, P. kadsura is often substituted by other materials in the markets, thereby causing health risks. In this study, 38 P. kadsura samples and eight sequences from GenBank, including a closely-related species and common adulterants were collected. This study aimed to identify an effective DNA barcode from four popular DNA loci for P. kadsura authentication. The success rates of PCR amplification, sequencing, and sequence acquisition of matK were 10.5%, 75%, and 7.9%, respectively; for rbcL they were 89.5%, 8.8%, and 7.9%, respectively; ITS2 rates were 86.8%, 3.0%, and 2.6%, respectively, while for psbA-trnH they were all 100%, which is much higher than for the other three loci. The sequences were aligned using Muscle, genetic distances were computed using MEGA 5.2.2, and barcoding gap was performed using TAXON DNA. Phylogenetic analysis showed that psbA-trnH could clearly distinguish P. kadsura from its closely related species and the common adulterant. psbA-trnH was then used to evaluate the fake proportions of P. kadsura. Results showed that 18.4% of P. kadsura samples were fake, indicating that adulterant species exist in the Chinese markets. Two-dimensional DNA barcoding imaging of P. kadsura was conducted, which was beneficial to the management of P. kadsura. We conclude that the psbA-trnH region is a powerful tool for P. kadsura identification and supervision in the current medicine markets.

  20. How DNA barcoding can be more effective in microalgae identification: a case of cryptic diversity revelation in Scenedesmus (Chlorophyceae).

    Science.gov (United States)

    Zou, Shanmei; Fei, Cong; Wang, Chun; Gao, Zhan; Bao, Yachao; He, Meilin; Wang, Changhai

    2016-11-09

    Microalgae identification is extremely difficult. The efficiency of DNA barcoding in microalgae identification involves ideal gene markers and approaches employed, which however, is still under the way. Although Scenedesmus has obtained much research in producing lipids its identification is difficult. Here we present a comprehensive coalescent, distance and character-based DNA barcoding for 118 Scenedesmus strains based on rbcL, tufA, ITS and 16S. The four genes, and their combined data rbcL + tufA + ITS + 16S, rbcL + tufA and ITS + 16S were analyzed by all of GMYC, P ID, PTP, ABGD, and character-based barcoding respectively. It was apparent that the three combined gene data showed a higher proportion of resolution success than the single gene. In comparison, the GMYC and PTP analysis produced more taxonomic lineages. The ABGD generated various resolution in discrimination among the single and combined data. The character-based barcoding was proved to be the most effective approach for species discrimination in both single and combined data which produced consistent species identification. All the integrated results recovered 11 species, five out of which were revealed as potential cryptic species. We suggest that the character-based DNA barcoding together with other approaches based on multiple genes and their combined data could be more effective in microalgae diversity revelation.

  1. Evaluating the Feasibility of Five Candidate DNA Barcoding Loci for Philippine Lasianthus Jack (Lasiantheae: Rubiaceae).

    Science.gov (United States)

    Arshed, Muhammad Jefte C; Valdez, Marcos B; Alejandro, Grecebio Jonathan D

    2017-01-01

    The pantropical genus Lasianthus Jack is identified for high phenotypic plasticity making traditional taxonomic identification difficult. Having some members with important medicinal properties, a precise complimentary identification through DNA barcoding is needed for species delineation. In this study, 12 samples representing six Philippine Lasianthus species were used to determine the most efficient barcoding loci among the cpDNA markers ( mat K, rbc L, rps 16, and trn T-F) and nrDNA (ITS) based on the criteria of universality, discriminatory power, and resolution of species. The results revealed that ITS has the recommended primer universality, greatest interspecific divergences, and average resolution of species. Among the cpDNA markers, mat K and rbc L are recommended but with minimal resolution of species. While trn T-F showed moderate interspecific variations and resolution of Lasianthus species, rps 16 has the lowest interspecific divergence and resolution of species. Consequently, ITS is the potential ideal DNA barcode for Lasianthus species. ITS, mat K, and rps 16 markers have the excellent amplification and sequence qualityITS marker has the highest interspecific divergence with the maximum values, followed by mat K, rbc L, trn T-F, and rps 16, respectivelyAll markers except rps 16 yielded average resolution to Lasianthus speciesITS marker is the most ideal locus in terms of excellent universality, high interspecific discriminatory ability, and average species resolution. Abbreviations used: ITS: Internal Transcribe Spacer, mat K: maturase K, rbc L: ribulose-1,5-biphospahte-carboxylase, rps 16: ribosomal protein 16 small subunit gene.

  2. DNA barcode assessment of Ceramiales (Rhodophyta) in the intertidal zone of the northwestern Yellow Sea

    Science.gov (United States)

    Du, Guoying; Wu, Feifei; Guo, Hao; Xue, Hongfan; Mao, Yunxiang

    2015-05-01

    A total of 142 specimens of Ceramiales (Rhodophyta) were collected each month from October 2011 to November 2012 in the intertidal zone of the northwestern Yellow Sea. These specimens covered 21 species, 14 genera, and four families. Cluster analyses show that the specimens had a high diversity for the three DNA markers, namely, partial large subunit rRNA gene (LSU), universal plastid amplicon (UPA), and partial mitochondrial cytochrome c oxidase subunit I gene (COI). No intraspecific divergence was found in our collection for these markers, except for a 1-3 bp divergence in the COI of Ceramium kondoi, Symphyocladia latiuscula, and Neosiphonia japonica. Because short DNA markers were used, the phylogenetic relationships of higher taxonomic levels were hard to evaluate with poor branch support. More than half species of our collection failed to find their matched sequences owing to shortage information of DNA barcodes for macroalgae in GenBank or BOLD (Barcode of Life Data) Systems. Three specimens were presumed as Heterosiphonia crispella by cluster analyses on DNA barcodes assisted by morphological identification, which was the first record in the investigated area, implying that it might be a cryptic or invasive species in the coastal area of northwestern Yellow Sea. In the neighbor-joining trees of all three DNA markers, Heterosiphonia japonica converged with Dasya spp. and was distant from the other Heterosiphonia spp., implying that H. japonica had affinities to the genus Dasya. The LSU and UPA markers amplified and sequenced easier than the COI marker across the Ceramiales species, but the COI had a higher ability to discriminate between species.

  3. Discovering hidden biodiversity: the use of complementary monitoring of fish diet based on DNA barcoding in freshwater ecosystems.

    Science.gov (United States)

    Jo, Hyunbin; Ventura, Marc; Vidal, Nicolas; Gim, Jeong-Soo; Buchaca, Teresa; Barmuta, Leon A; Jeppesen, Erik; Joo, Gea-Jae

    2016-01-01

    Ecological monitoring contributes to the understanding of complex ecosystem functions. The diets of fish reflect the surrounding environment and habitats and may, therefore, act as useful integrating indicators of environmental status. It is, however, often difficult to visually identify items in gut contents to species level due to digestion of soft-bodied prey beyond visual recognition, but new tools rendering this possible are now becoming available. We used a molecular approach to determine the species identities of consumed diet items of an introduced generalist feeder, brown trout (Salmo trutta), in 10 Tasmanian lakes and compared the results with those obtained from visual quantification of stomach contents. We obtained 44 unique taxa (OTUs) belonging to five phyla, including seven classes, using the barcode of life approach from cytochrome oxidase I (COI). Compared with visual quantification, DNA analysis showed greater accuracy, yielding a 1.4-fold higher number of OTUs. Rarefaction curve analysis showed saturation of visually inspected taxa, while the curves from the DNA barcode did not saturate. The OTUs with the highest proportions of haplotypes were the families of terrestrial insects Formicidae, Chrysomelidae, and Torbidae and the freshwater Chironomidae. Haplotype occurrence per lake was negatively correlated with lake depth and transparency. Nearly all haplotypes were only found in one fish gut from a single lake. Our results indicate that DNA barcoding of fish diets is a useful and complementary method for discovering hidden biodiversity.

  4. DNA barcoding reveals cryptic diversity within commercially exploited Indo-Malay Carangidae (Teleosteii: Perciformes.

    Directory of Open Access Journals (Sweden)

    Tun Nurul Aimi Mat Jaafar

    Full Text Available BACKGROUND: DNA barcodes, typically focusing on the cytochrome oxidase I gene (COI in many animals, have been used widely as a species-identification tool. The ability of DNA barcoding to distinguish species from a range of taxa and to reveal cryptic species has been well documented. Despite the wealth of DNA barcode data for fish from many temperate regions, there are relatively few available from the Southeast Asian region. Here, we target the marine fish Family Carangidae, one of the most commercially-important families from the Indo-Malay Archipelago (IMA, to produce an initial reference DNA barcode library. METHODOLOGY/PRINCIPAL FINDINGS: Here, a 652 bp region of COI was sequenced for 723 individuals from 36 putative species of Family Carangidae distributed within IMA waters. Within the newly-generated dataset, three described species exhibited conspecific divergences up to ten times greater (4.32-4.82% than mean estimates (0.24-0.39%, indicating a discrepancy with assigned morphological taxonomic identification, and the existence of cryptic species. Variability of the mitochondrial DNA COI region was compared within and among species to evaluate the COI region's suitability for species identification. The trend in range of mean K2P distances observed was generally in accordance with expectations based on taxonomic hierarchy: 0% to 4.82% between individuals within species, 0% to 16.4% between species within genera, and 8.64% to 25.39% between genera within families. The average Kimura 2-parameter (K2P distance between individuals, between species within genera, and between genera within family were 0.37%, 10.53% and 16.56%, respectively. All described species formed monophyletic clusters in the Neighbour-joining phylogenetic tree, although three species representing complexes of six potential cryptic species were detected in Indo-Malay Carangidae; Atule mate, Selar crumenophthalmus and Seriolina nigrofasciata. CONCLUSION/SIGNIFICANCE: This

  5. Barcoding of fresh water fishes from Pakistan.

    Science.gov (United States)

    Karim, Asma; Iqbal, Asad; Akhtar, Rehan; Rizwan, Muhammad; Amar, Ali; Qamar, Usman; Jahan, Shah

    2016-07-01

    DNA bar-coding is a taxonomic method that uses small genetic markers in organisms' mitochondrial DNA (mt DNA) for identification of particular species. It uses sequence diversity in a 658-base pair fragment near the 5' end of the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene as a tool for species identification. DNA barcoding is more accurate and reliable method as compared with the morphological identification. It is equally useful in juveniles as well as adult stages of fishes. The present study was conducted to identify three farm fish species of Pakistan (Cyprinus carpio, Cirrhinus mrigala, and Ctenopharyngodon idella) genetically. All of them belonged to family cyprinidae. CO1 gene was amplified. PCR products were sequenced and analyzed by bioinformatic software. Conspecific, congenric, and confamilial k2P nucleotide divergence was estimated. From these findings, it was concluded that the gene sequence, CO1, may serve as milestone for the identification of related species at molecular level.

  6. Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

    Science.gov (United States)

    Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

    2009-05-01

    DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

  7. Highly sensitive detection of ESR1 mutations in cell-free DNA from patients with metastatic breast cancer using molecular barcode sequencing.

    Science.gov (United States)

    Masunaga, Nanae; Kagara, Naofumi; Motooka, Daisuke; Nakamura, Shota; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo

    2018-01-01

    We aimed to develop a highly sensitive method to detect ESR1 mutations in cell-free DNA (cfDNA) using next-generation sequencing with molecular barcode (MB-NGS) targeting the hotspot segment (c.1600-1713). The sensitivity of MB-NGS was tested using serially diluted ESR1 mutant DNA and then cfDNA samples from 34 patients with metastatic breast cancer were analyzed with MB-NGS. The results of MB-NGS were validated in comparison with conventional NGS and droplet digital PCR (ddPCR). MB-NGS showed a higher sensitivity (0.1%) than NGS without barcode (1%) by reducing background errors. Of the cfDNA samples from 34 patients with metastatic breast cancer, NGS without barcode revealed seven mutations in six patients (17.6%) and MB-NGS revealed six additional mutations including three mutations not reported in the COSMIC database of breast cancer, resulting in total 13 ESR1 mutations in ten patients (29.4%). Regarding the three hotspot mutations, all the patients with mutations detected by MB-NGS had identical mutations detected by droplet digital PCR (ddPCR), and mutant allele frequency correlated very well between both (r = 0.850, p < 0.01). Moreover, all the patients without these mutations by MB-NGS were found to have no mutations by ddPCR. In conclusion, MB-NGS could successfully detect ESR1 mutations in cfDNA with a higher sensitivity of 0.1% than conventional NGS and was considered as clinically useful as ddPCR.

  8. DNA barcoding facilitates associations and diagnoses for Trichoptera larvae of the Churchill (Manitoba, Canada) area.

    Science.gov (United States)

    Ruiter, David E; Boyle, Elizabeth E; Zhou, Xin

    2013-02-20

    The North American Trichoptera larvae are poorly known at the species level, despite their importance in the understanding of freshwater fauna and critical use in biomonitoring. This study focused on morphological diagnoses for larvae occurring in the Churchill, Manitoba area, representing the largest larval association effort for the caddisflies at any given locality thus far. The current DNA barcode reference library of Trichoptera (available on the Barcode of Life Data Systems) was utilized to provide larval-adult associations. The present study collected an additional 23 new species records for the Churchill area, increasing the total Trichoptera richness to 91 species. We were able to associate 62 larval taxa, comprising 68.1% of the Churchill area Trichoptera taxa. This endeavor to identify immature life stage for the caddisflies enabled the development of morphological diagnoses, production of photographs and an appropriate taxonomic key to facilitate larval species analyses in the area. The use of DNA for associations of unknown larvae with known adults proved rapid and successful. This method should accelerate the state-of-knowledge for North American Trichoptera larvae as well as other taxonomic lineages. The morphological analysis should be useful for determination of material from the Churchill area.

  9. DNA barcode identification of commercial fish sold in Mexican markets.

    Science.gov (United States)

    Sarmiento-Camacho, Stephanie; Valdez-Moreno, Martha

    2018-04-24

    The substitution of high-value fish species for those of lower value is common practice. Although numerous studies have addressed this issue, few have been conducted in Mexico. In this study, we sought to identify fresh fillets of fish, sharks, and rays using DNA barcodes. We analyzed material from "La Viga" in Mexico City, and other markets located on the Gulf and Caribbean coasts of Mexico. From 134 samples, we obtained sequences from 129, identified to 9 orders, 28 families, 38 genera, and 44 species. The most common species were Seriola dumerili, Pangasianodon hypophthalmus, Carcharhinus falciformis, Carcharhinus brevipinna, and Hypanus americanus. Pangasianodon hypophthalmus was most commonly used as a substitute for higher-value species. The substitution rate was 18% of the total. A review of the conservation status of the specimens identified against the IUNC list enabled us to establish that some species marketed in Mexico are threatened: Makaira nigricans, Lachnolaimus maximus, Hyporthodus flavolimbatus, and Isurus oxyrinchus are classified as vulnerable; Lopholatilus chamaeleonticeps and Sphyrna lewini are endangered; and the status of Hyporthodus nigritus is critical. These results will demonstrate to the Mexican authorities that DNA barcoding is a reliable tool for species identification, even when morphological identification is difficult or impossible.

  10. O potencial do DNA barcode na identificação de espécies de aves neotropicais

    OpenAIRE

    Priscila Fernanda Mussi Gonçalves

    2009-01-01

    O presente trabalho foi organizado em cinco capítulos. No primeiro é apresentada uma breve revisão da bibliografia relacionada ao DNA barcode, apontando as aplicações e os limites desse marcador. Os resultados obtidos são apresentados nos três capítulos subsequentes. O segundo capítulo teve como objetivo avaliar o potencial do método de DNA barcoding na distinção de 783 amostras de 228 espécies diferentes de aves neotropicais de 16 ordens baseado na diferença dos valores de divergências intra...

  11. Mapping Biodiversity and Setting Conservation Priorities for SE Queensland’s Rainforests Using DNA Barcoding

    Science.gov (United States)

    Shapcott, Alison; Forster, Paul I.; Guymer, Gordon P.; McDonald, William J. F.; Faith, Daniel P.; Erickson, David; Kress, W. John

    2015-01-01

    Australian rainforests have been fragmented due to past climatic changes and more recently landscape change as a result of clearing for agriculture and urban spread. The subtropical rainforests of South Eastern Queensland are significantly more fragmented than the tropical World Heritage listed northern rainforests and are subject to much greater human population pressures. The Australian rainforest flora is relatively taxonomically rich at the family level, but less so at the species level. Current methods to assess biodiversity based on species numbers fail to adequately capture this richness at higher taxonomic levels. We developed a DNA barcode library for the SE Queensland rainforest flora to support a methodology for biodiversity assessment that incorporates both taxonomic diversity and phylogenetic relationships. We placed our SE Queensland phylogeny based on a three marker DNA barcode within a larger international rainforest barcode library and used this to calculate phylogenetic diversity (PD). We compared phylo- diversity measures, species composition and richness and ecosystem diversity of the SE Queensland rainforest estate to identify which bio subregions contain the greatest rainforest biodiversity, subregion relationships and their level of protection. We identified areas of highest conservation priority. Diversity was not correlated with rainforest area in SE Queensland subregions but PD was correlated with both the percent of the subregion occupied by rainforest and the diversity of regional ecosystems (RE) present. The patterns of species diversity and phylogenetic diversity suggest a strong influence of historical biogeography. Some subregions contain significantly more PD than expected by chance, consistent with the concept of refugia, while others were significantly phylogenetically clustered, consistent with recent range expansions. PMID:25803607

  12. Joining inventory by parataxonomists with DNA barcoding of a large complex tropical conserved wildland in northwestern Costa Rica.

    Directory of Open Access Journals (Sweden)

    Daniel H Janzen

    Full Text Available BACKGROUND: The many components of conservation through biodiversity development of a large complex tropical wildland, Area de Conservacion Guanacaste (ACG, thrive on knowing what is its biodiversity and natural history. For 32 years a growing team of Costa Rican parataxonomists has conducted biodiversity inventory of ACG caterpillars, their food plants, and their parasitoids. In 2003, DNA barcoding was added to the inventory process. METHODOLOGY/PRINCIPAL FINDINGS: We describe some of the salient consequences for the parataxonomists of barcoding becoming part of a field biodiversity inventory process that has centuries of tradition. From the barcoding results, the parataxonomists, as well as other downstream users, gain a more fine-scale and greater understanding of the specimens they find, rear, photograph, database and deliver. The parataxonomists also need to adjust to collecting more specimens of what appear to be the "same species"--cryptic species that cannot be distinguished by eye or even food plant alone--while having to work with the name changes and taxonomic uncertainty that comes with discovering that what looked like one species may be many. CONCLUSIONS/SIGNIFICANCE: These career parataxonomists, despite their lack of formal higher education, have proven very capable of absorbing and working around the additional complexity and requirements for accuracy and detail that are generated by adding barcoding to the field base of the ACG inventory. In the process, they have also gained a greater understanding of the fine details of phylogeny, relatedness, evolution, and species-packing in their own tropical complex ecosytems. There is no reason to view DNA barcoding as incompatible in any way with tropical biodiversity inventory as conducted by parataxonomists. Their year-round on-site inventory effort lends itself well to the sampling patterns and sample sizes needed to build a thorough barcode library. Furthermore, the biological

  13. DNA barcoding and evaluation of genetic diversity in Cyprinidae fish in the midstream of the Yangtze River.

    Science.gov (United States)

    Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni

    2016-05-01

    The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.

  14. DNA barcoding reveals the diversity of sharks in Guyana coastal markets

    Directory of Open Access Journals (Sweden)

    Matthew A. Kolmann

    2017-12-01

    Full Text Available ABSTRACT A fundamental challenge for both sustainable fisheries and biodiversity protection in the Neotropics is the accurate determination of species identity. The biodiversity of the coastal sharks of Guyana is poorly understood, but these species are subject to both artisanal fishing as well as harvesting by industrialized offshore fleets. To determine what species of sharks are frequently caught and consumed along the coastline of Guyana, we used DNA barcoding to identify market specimens. We sequenced the mitochondrial co1 gene for 132 samples collected from six markets, and compared our sequences to those available in the Barcode of Life Database (BOLD and GenBank. Nearly 30% of the total sample diversity was represented by two species of Hammerhead Sharks (Sphyrna mokarran and S. lewini, both listed as Endangered by the International Union for Conservation of Nature (IUCN. Other significant portions of the samples included Sharpnose Sharks (23% - Rhizoprionodon spp., considered Vulnerable in Brazilian waters due to unregulated gillnet fisheries, and the Smalltail Shark (17% - Carcharhinus porosus. We found that barcoding provides efficient and accurate identification of market specimens in Guyana, making this study the first in over thirty years to address Guyana’s coastal shark biodiversity.

  15. Testing DNA barcode performance in 1000 species of European lepidoptera: large geographic distances have small genetic impacts.

    Science.gov (United States)

    Huemer, Peter; Mutanen, Marko; Sefc, Kristina M; Hebert, Paul D N

    2014-01-01

    This study examines the performance of DNA barcodes (mt cytochrome c oxidase 1 gene) in the identification of 1004 species of Lepidoptera shared by two localities (Finland, Austria) that are 1600 km apart. Maximum intraspecific distances for the pooled data were less than 2% for 880 species (87.6%), while deeper divergence was detected in 124 species. Despite such variation, the overall DNA barcode library possessed diagnostic COI sequences for 98.8% of the taxa. Because a reference library based on Finnish specimens was highly effective in identifying specimens from Austria, we conclude that barcode libraries based on regional sampling can often be effective for a much larger area. Moreover, dispersal ability (poor, good) and distribution patterns (disjunct, fragmented, continuous, migratory) had little impact on levels of intraspecific geographic divergence. Furthermore, the present study revealed that, despite the intensity of past taxonomic work on European Lepidoptera, nearly 20% of the species shared by Austria and Finland require further work to clarify their status. Particularly discordant BIN (Barcode Index Number) cases should be checked to ascertain possible explanatory factors such as incorrect taxonomy, hybridization, introgression, and Wolbachia infections.

  16. Testing DNA barcode performance in 1000 species of European lepidoptera: large geographic distances have small genetic impacts.

    Directory of Open Access Journals (Sweden)

    Peter Huemer

    Full Text Available This study examines the performance of DNA barcodes (mt cytochrome c oxidase 1 gene in the identification of 1004 species of Lepidoptera shared by two localities (Finland, Austria that are 1600 km apart. Maximum intraspecific distances for the pooled data were less than 2% for 880 species (87.6%, while deeper divergence was detected in 124 species. Despite such variation, the overall DNA barcode library possessed diagnostic COI sequences for 98.8% of the taxa. Because a reference library based on Finnish specimens was highly effective in identifying specimens from Austria, we conclude that barcode libraries based on regional sampling can often be effective for a much larger area. Moreover, dispersal ability (poor, good and distribution patterns (disjunct, fragmented, continuous, migratory had little impact on levels of intraspecific geographic divergence. Furthermore, the present study revealed that, despite the intensity of past taxonomic work on European Lepidoptera, nearly 20% of the species shared by Austria and Finland require further work to clarify their status. Particularly discordant BIN (Barcode Index Number cases should be checked to ascertain possible explanatory factors such as incorrect taxonomy, hybridization, introgression, and Wolbachia infections.

  17. Use of rbcL and trnL-F as a two-locus DNA barcode for identification of NW-European ferns: an ecological perspective

    NARCIS (Netherlands)

    Groot, de G.A.; During, H.J.; Maas, J.W.; Schneider, H.; Erkens, R.H.J.

    2011-01-01

    Although consensus has now been reached on a general two-locus DNA barcode for land plants, the selected combination of markers (rbcL + matK) is not applicable for ferns at the moment. Yet especially for ferns, DNA barcoding is potentially of great value since fern gametophytes—while playing an

  18. Highly sensitive electrochemical detection of human telomerase activity based on bio-barcode method.

    Science.gov (United States)

    Li, Ying; Liu, Bangwei; Li, Xia; Wei, Qingli

    2010-07-15

    In the present study, an electrochemical method for highly sensitive detection of human telomerase activity was developed based on bio-barcode amplification assay. Telomerase was extracted from HeLa cells, then the extract was mixed with telomerase substrate (TS) primer to perform extension reaction. The extension product was hybridized with the capture DNA immobilized on the Au electrode and then reacted with the signal DNA on Au nanoparticles to form a sandwich hybridization mode. Electrochemical signals were generated by chronocoulometric interrogation of [Ru(NH(3))(6)](3+) that quantitatively binds to the DNA on Au nanoparticles via electrostatic interaction. This method can detect the telomerase activity from as little as 10 cultured cancer cells without the polymerase chain reaction (PCR) amplification of telomerase extension product. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  19. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  20. [Identification and analysis of Corydalis boweri, Meconopsis horridula and their close related species of the same genus by using ITS2 DNA barcode].

    Science.gov (United States)

    Dou, Rong-kun; Bi, Zhen-fei; Bai, Rui-xue; Ren, Yao-yao; Tan, Rui; Song, Liang-ke; Li, Di-qiang; Mao, Can-quan

    2015-04-01

    The study is aimed to ensure the quality and safety of medicinal plants by using ITS2 DNA barcode technology to identify Corydalis boweri, Meconopsis horridula and their close related species. The DNA of 13 herb samples including C. boweri and M. horridula from Lhasa of Tibet was extracted, ITS PCR were amplified and sequenced. Both assembled and web downloaded 71 ITS2 sequences were removed of 5. 8S and 28S. Multiple sequence alignment was completed and the intraspecific and interspecific genetic distances were calculated by MEGA 5.0, while the neighbor-joining phylogenetic trees were constructed. We also predicted the ITS2 secondary structure of C. boweri, M. horridula and their close related species. The results showed that ITS2 as DNA barcode was able to identify C. boweri, M. horridula as well as well as their close related species effectively. The established based on ITS2 barcode method provides the regular and safe detection technology for identification of C. boweri, M. horridula and their close related species, adulterants and counterfeits, in order to ensure their quality control, safe medication, reasonable development and utilization.

  1. A transcontinental challenge--a test of DNA barcode performance for 1,541 species of Canadian Noctuoidea (Lepidoptera.

    Directory of Open Access Journals (Sweden)

    Reza Zahiri

    Full Text Available This study provides a first, comprehensive, diagnostic use of DNA barcodes for the Canadian fauna of noctuoids or "owlet" moths (Lepidoptera: Noctuoidea based on vouchered records for 1,541 species (99.1% species coverage, and more than 30,000 sequences. When viewed from a Canada-wide perspective, DNA barcodes unambiguously discriminate 90% of the noctuoid species recognized through prior taxonomic study, and resolution reaches 95.6% when considered at a provincial scale. Barcode sharing is concentrated in certain lineages with 54% of the cases involving 1.8% of the genera. Deep intraspecific divergence exists in 7.7% of the species, but further studies are required to clarify whether these cases reflect an overlooked species complex or phylogeographic variation in a single species. Non-native species possess higher Nearest-Neighbour (NN distances than native taxa, whereas generalist feeders have lower NN distances than those with more specialized feeding habits. We found high concordance between taxonomic names and sequence clusters delineated by the Barcode Index Number (BIN system with 1,082 species (70% assigned to a unique BIN. The cases of discordance involve both BIN mergers and BIN splits with 38 species falling into both categories, most likely reflecting bidirectional introgression. One fifth of the species are involved in a BIN merger reflecting the presence of 158 species sharing their barcode sequence with at least one other taxon, and 189 species with low, but diagnostic COI divergence. A very few cases (13 involved species whose members fell into both categories. Most of the remaining 140 species show a split into two or three BINs per species, while Virbia ferruginosa was divided into 16. The overall results confirm that DNA barcodes are effective for the identification of Canadian noctuoids. This study also affirms that BINs are a strong proxy for species, providing a pathway for a rapid, accurate estimation of animal diversity.

  2. Specific PCR Identification between Peucedanum praeruptorum and Angelica decursiva and Identification between Them and Adulterant Using DNA Barcode.

    Science.gov (United States)

    Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian

    2017-01-01

    The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a

  3. How many loci does it take to DNA barcode a crocus?

    Science.gov (United States)

    Seberg, Ole; Petersen, Gitte

    2009-01-01

    DNA barcoding promises to revolutionize the way taxonomists work, facilitating species identification by using small, standardized portions of the genome as substitutes for morphology. The concept has gained considerable momentum in many animal groups, but the higher plant world has been largely recalcitrant to the effort. In plants, efforts are concentrated on various regions of the plastid genome, but no agreement exists as to what kinds of regions are ideal, though most researchers agree that more than one region is necessary. One reason for this discrepancy is differences in the tests that are used to evaluate the performance of the proposed regions. Most tests have been made in a floristic setting, where the genetic distance and therefore the level of variation of the regions between taxa is large, or in a limited set of congeneric species. Here we present the first in-depth coverage of a large taxonomic group, all 86 known species (except two doubtful ones) of crocus. Even six average-sized barcode regions do not identify all crocus species. This is currently an unrealistic burden in a barcode context. Whereas most proposed regions work well in a floristic context, the majority will--as is the case in crocus--undoubtedly be less efficient in a taxonomic setting. However, a reasonable but less than perfect level of identification may be reached--even in a taxonomic context. The time is ripe for selecting barcode regions in plants, and for prudent examination of their utility. Thus, there is no reason for the plant community to hold back the barcoding effort by continued search for the Holy Grail. We must acknowledge that an emerging system will be far from perfect, fraught with problems and work best in a floristic setting.

  4. DNA barcoding of Rhodiola (crassulaceae: a case study on a group of recently diversified medicinal plants from the Qinghai-Tibetan Plateau.

    Directory of Open Access Journals (Sweden)

    Jian-Qiang Zhang

    Full Text Available DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences - rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS - for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau.

  5. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  6. Multiplexing clonality: combining RGB marking and genetic barcoding

    Science.gov (United States)

    Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris

    2014-01-01

    RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916

  7. Forensic identification of Indian snakeroot (Rauvolfia serpentina Benth. ex Kurz) using DNA barcoding.

    Science.gov (United States)

    Eurlings, Marcel C M; Lens, Frederic; Pakusza, Csilla; Peelen, Tamara; Wieringa, Jan J; Gravendeel, Barbara

    2013-05-01

    Indian snakeroot (Rauvolfia serpentina) is a valuable forest product, root extracts of which are used as an antihypertensive drug. Increasing demand led to overharvesting in the wild. Control of international trade is hampered by the inability to identify root samples to the species level. We therefore evaluated the potential of molecular identification by searching for species-specific DNA polymorphisms. We found two species-specific indels in the rps16 intron region for R. serpentina. Our DNA barcoding method was tested for its specificity, reproducibility, sensitivity and stability. We included samples of various tissues and ages, which had been treated differently for preservation. DNA extractions were tested in a range of amplification settings and dilutions. Species-specific rps16 intron sequences were obtained from 79 herbarium accessions and one confiscated root, encompassing 39 different species. Our results demonstrate that molecular analysis provides new perspectives for forensic identification of Indian snakeroot. © 2013 American Academy of Forensic Sciences.

  8. DNA barcodes for soil animal taxonomy Código de barras de DNA para a taxonomia de animais do solo

    Directory of Open Access Journals (Sweden)

    Rodolphe Rougerie

    2009-08-01

    Full Text Available The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15% of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.A biodiversidade das comunidades do solo continua muito pouco conhecida e entendida. A biologia do solo é fortemente afetada pela crise taxonômica, e a maior parte dos grupos de animais dessa biota sofre forte impedimento taxonômico. O objetivo deste trabalho foi determinar como o código de barras de DNA - um método novo que usa uma etiqueta microgenômica para identificação e discriminação de espécies - permite uma melhor avaliação da taxonomia da biota edáfica. Foram analisadas 1.152 sequências de códigos de barras de dois grupos principais de animais, colêmbolos e minhocas, que apresentaram ampla amostragem taxonômica e geográfica. Além de refletir fortemente o impedimento taxonômico de

  9. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  10. Advances in the use of DNA barcodes to build a community phylogeny for tropical trees in a Puerto Rican forest dynamics plot.

    Directory of Open Access Journals (Sweden)

    W John Kress

    2010-11-01

    Full Text Available Species number, functional traits, and phylogenetic history all contribute to characterizing the biological diversity in plant communities. The phylogenetic component of diversity has been particularly difficult to quantify in species-rich tropical tree assemblages. The compilation of previously published (and often incomplete data on evolutionary relationships of species into a composite phylogeny of the taxa in a forest, through such programs as Phylomatic, has proven useful in building community phylogenies although often of limited resolution. Recently, DNA barcodes have been used to construct a robust community phylogeny for nearly 300 tree species in a forest dynamics plot in Panama using a supermatrix method. In that study sequence data from three barcode loci were used to generate a well-resolved species-level phylogeny.Here we expand upon this earlier investigation and present results on the use of a phylogenetic constraint tree to generate a community phylogeny for a diverse, tropical forest dynamics plot in Puerto Rico. This enhanced method of phylogenetic reconstruction insures the congruence of the barcode phylogeny with broadly accepted hypotheses on the phylogeny of flowering plants (i.e., APG III regardless of the number and taxonomic breadth of the taxa sampled. We also compare maximum parsimony versus maximum likelihood estimates of community phylogenetic relationships as well as evaluate the effectiveness of one- versus two- versus three-gene barcodes in resolving community evolutionary history.As first demonstrated in the Panamanian forest dynamics plot, the results for the Puerto Rican plot illustrate that highly resolved phylogenies derived from DNA barcode sequence data combined with a constraint tree based on APG III are particularly useful in comparative analysis of phylogenetic diversity and will enhance research on the interface between community ecology and evolution.

  11. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Czech Academy of Sciences Publication Activity Database

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; Miller, A.N.; Wingfield, M. J.; Aime, M.C.; An, K.D.; Bai, F.Y.; Barreto, R.W.; Bergeron, M.J.; Blackwell, M.; Boekhout, T.; Bogale, M.; Boonyuen, N.; Burgaz, A.R.; Buyck, B.; Cai, L.; Cai, Q.; Cardinali, G.; Chaverri, P.; Coppins, B.J.; Crespo, A.; Cubas, P.; Cummings, C.; Damm, U.; de Beer, Z.W.; de Hoog, G.S.; Del-Prado, R.; Dentinger, B.; Dieguez-Uribeondo, J.; Divakar, P.K.; Douglas, B.; Duenas, M.; Duong, T.A.; Eberhardt, U.; Edwards, J.E.; Elshahed, M.S.; Fliegerová, Kateřina; Furtado, M.; Garcia, M.A.; Ge, Z.W.; Griffith, G.W.; Griffiths, K.; Groenewald, J.Z.; Groenewald, M.; Grube, M.; Gryzenhout, M.; Guo, L.D.; Hagen, F.; Hambleton, S.; Hamelin, R.C.; Hansen, K.; Harrold, P.; Heller, G.; Herrera, C.; Hirayama, K.; Hirooka, Y.; Ho, H.M.; Hoffmann, K.; Hofstetter, V.; Hognabba, F.; Hollingsworth, P.M.; Hong, S.B.; Hosaka, K.; Houbraken, J.; Hughes, K.; Huhtinen, S.; Hyde, K.D.; James, T.; Johnson, E.M.; Johnson, J.E.; Johnston, P.R.; Jones, E.B.; Kelly, L.J.; Kirk, P.M.; Knapp, D.G.; Koljalg, U.; Kovacs, G.M.; Kurtzman, C.P.; Landvik, S.; Leavitt, S.D.; Liggenstoffer, A.S.; Liimatainen, K.; Lombard, L.; Luangsa-Ard, J.J.; Lumbsch, H.T.; Maganti, H.; Maharachchikumbura, S.S.; Martin, M.P.; May, T.W.; McTaggart, A.R.; Methven, A.S.; Meyer, W.; Moncalvo, J.M.; Mongkolsamrit, S.; Nagy, L.G.; Nilsson, R.H.; Niskanen, T.; Nyilasi, I.; Okada, G.; Okane, I.; Olariaga, I.; Otte, J.; Papp, T.; Park, D.; Petkovits, T.; Pino-Bodas, R.; Quaedvlieg, W.; Raja, H.A.; Redecker, D.; Rintoul, T.; Ruibal, C.; Sarmiento-Ramirez, J.M.; Schmitt, I.; Schussler, A.; Shearer, C.; Sotome, K.; Stefani, F.O.; Stenroos, S.; Stielow, B.; Stockinger, H.; Suetrong, S.; Suh, S.O.; Sung, G.H.; Suzuki, M.; Tanaka, K.; Tedersoo, L.; Telleria, M.T.; Tretter, E.; Untereiner, W.A.; Urbina, H.; Vagvolgyi, C.; Vialle, A.; Vu, T.D.; Walther, G.; Wang, Q.M.; Wang, Y.; Weir, B.S.; Weiss, M.; White, M.M.; Xu, J.; Yahr, R.; Yang, Z.L.; Yurkov, A.; Zamora, J.C.; Zhang, N.; Zhuang, W.Y.; Schindel, D.

    2012-01-01

    Roč. 109, č. 16 (2012), s. 6241-6246 ISSN 0027-8424 Institutional research plan: CEZ:AV0Z50450515 Keywords : DNA barcoding * fungal biodiversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.737, year: 2012

  12. Study on Phylogenetic Status of Javan Plover Bird (Charadrius, Charadriidae, Charadriiformes through DNA Barcoding Analysis

    Directory of Open Access Journals (Sweden)

    Hidayat Ashari

    2017-04-01

    Full Text Available Javan Plover named Charadrius javanicus is taxonomically under controversy and phylogenetically unresolved yet. Through an analysis of DNA barcode, this study aims (1 to confirm whether Javan Plover is separated species named Charadrius javanicus or a subspecies of C. alexandrinus which named C. a. javanicus and (2 to determine a relationship within this genus. Totally 666 bp DNA sequences of COI barcode gene were analyzed.  The results showed that a sequence divergence between Javan Plover and C. alexandrinus alexandrinus was only 1.2%, while sequence divergences between C.a.alexandrinus and others species, or between Javan Plover and others species were ranged from 9-12%.  Neighbour-joining (NJ and maximum-parsimony (MP analyses showed that all individuals of both Javan Plover and Kenith Plover were clustered together, and supported by 99 % and 100 % of bootstrap value in NJ and MP, respectively. This study tends to support the previous findings that Javan Plover was not a separated species named C. javanicus, but it was as a subspecies of C. alexandrinus; named C. a. javanicus. There were two groups of Plover in this study; (C. leschenaultii and C. javanicus + C.a.alexandrinus, and (C.dubius and C. melodus + C. semipalmatus. DNA barcoding analysis can give certainty taxonomic status of the bird. Then, this study has implication as a basic data that can be used to provide and support the planning of Javan plover conservation programs. 

  13. Species identification of medicinal pteridophytes by a DNA barcode marker, the chloroplast psbA-trnH intergenic region.

    Science.gov (United States)

    Ma, Xin-Ye; Xie, Cai-Xiang; Liu, Chang; Song, Jing-Yuan; Yao, Hui; Luo, Kun; Zhu, Ying-Jie; Gao, Ting; Pang, Xiao-Hui; Qian, Jun; Chen, Shi-Lin

    2010-01-01

    Medicinal pteridophytes are an important group used in traditional Chinese medicine; however, there is no simple and universal way to differentiate various species of this group by morphological traits. A novel technology termed "DNA barcoding" could discriminate species by a standard DNA sequence with universal primers and sufficient variation. To determine whether DNA barcoding would be effective for differentiating pteridophyte species, we first analyzed five DNA sequence markers (psbA-trnH intergenic region, rbcL, rpoB, rpoC1, and matK) using six chloroplast genomic sequences from GeneBank and found psbA-trnH intergenic region the best candidate for availability of universal primers. Next, we amplified the psbA-trnH region from 79 samples of medicinal pteridophyte plants. These samples represented 51 species from 24 families, including all the authentic pteridophyte species listed in the Chinese pharmacopoeia (2005 version) and some commonly used adulterants. We found that the sequence of the psbA-trnH intergenic region can be determined with both high polymerase chain reaction (PCR) amplification efficiency (94.1%) and high direct sequencing success rate (81.3%). Combined with GeneBank data (54 species cross 12 pteridophyte families), species discriminative power analysis showed that 90.2% of species could be separated/identified successfully by the TaxonGap method in conjunction with the Basic Local Alignment Search Tool 1 (BLAST1) method. The TaxonGap method results further showed that, for 37 out of 39 separable species with at least two samples each, between-species variation was higher than the relevant within-species variation. Thus, the psbA-trnH intergenic region is a suitable DNA marker for species identification in medicinal pteridophytes.

  14. DNA Barcode Identification of Freshwater Snails in the Family Bithyniidae from Thailand

    Science.gov (United States)

    Kulsantiwong, Jutharat; Prasopdee, Sattrachai; Ruangsittichai, Jiraporn; Ruangjirachuporn, Wipaporn; Boonmars, Thidarut; Viyanant, Vithoon; Pierossi, Paola; Hebert, Paul D. N.; Tesana, Smarn

    2013-01-01

    Freshwater snails in the family Bithyniidae are the first intermediate host for Southeast Asian liver fluke (Opisthorchis viverrini), the causative agent of opisthorchiasis. Unfortunately, the subtle morphological characters that differentiate species in this group are not easily discerned by non-specialists. This is a serious matter because the identification of bithyniid species is a fundamental prerequisite for better understanding of the epidemiology of this disease. Because DNA barcoding, the analysis of sequence diversity in the 5’ region of the mitochondrial COI gene, has shown strong performance in other taxonomic groups, we decided to test its capacity to resolve 10 species/ subspecies of bithyniids from Thailand. Our analysis of 217 specimens indicated that COI sequences delivered species-level identification for 9 of 10 currently recognized species. The mean intraspecific divergence of COI was 2.3% (range 0-9.2 %), whereas sequence divergences between congeneric species averaged 8.7% (range 0-22.2 %). Although our results indicate that DNA barcoding can differentiate species of these medically-important snails, we also detected evidence for the presence of one overlooked species and one possible case of synonymy. PMID:24223896

  15. Quantitative phenotyping via deep barcode sequencing.

    Science.gov (United States)

    Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

    2009-10-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

  16. Comparison of four species-delimitation methods applied to a DNA barcode data set of insect larvae for use in routine bioassessment for use in routine bioassessment

    Science.gov (United States)

    Species delimitation (grouping individuals into distinct taxonomic groups) is an essential part of evolutionary, conservation, and molecular ecology. Deoxyribonucleic acid (DNA) barcodes, short fragments of the cytochrome c oxidase subunit I (COI) gene, are being used in environm...

  17. The internal transcribed spacer (ITS region and trnH-psbA [corrected] are suitable candidate loci for DNA barcoding of tropical tree species of India.

    Directory of Open Access Journals (Sweden)

    Abhinandan Mani Tripathi

    Full Text Available DNA barcoding as a tool for species identification has been successful in animals and other organisms, including certain groups of plants. The exploration of this new tool for species identification, particularly in tree species, is very scanty from biodiversity-rich countries like India. rbcL and matK are standard barcode loci while ITS, and trnH-psbA are considered as supplementary loci for plants.Plant barcode loci, namely, rbcL, matK, ITS, trnH-psbA, and the recently proposed ITS2, were tested for their efficacy as barcode loci using 300 accessions of tropical tree species. We tested these loci for PCR, sequencing success, and species discrimination ability using three methods. rbcL was the best locus as far as PCR and sequencing success rate were concerned, but not for the species discrimination ability of tropical tree species. ITS and trnH-psbA were the second best loci in PCR and sequencing success, respectively. The species discrimination ability of ITS ranged from 24.4 percent to 74.3 percent and that of trnH-psbA was 25.6 percent to 67.7 percent, depending upon the data set and the method used. matK provided the least PCR success, followed by ITS2 (59. 0%. Species resolution by ITS2 and rbcL ranged from 9.0 percent to 48.7 percent and 13.2 percent to 43.6 percent, respectively. Further, we observed that the NCBI nucleotide database is poorly represented by the sequences of barcode loci studied here for tree species.Although a conservative approach of a success rate of 60-70 percent by both ITS and trnH-psbA may not be considered as highly successful but would certainly help in large-scale biodiversity inventorization, particularly for tropical tree species, considering the standard success rate of plant DNA barcode program reported so far. The recommended matK and rbcL primers combination may not work in tropical tree species as barcode markers.

  18. DNA barcode sequencing from old type specimens as a tool in taxonomy: a case study in the diverse genus Eois (Lepidoptera: Geometridae.

    Directory of Open Access Journals (Sweden)

    Patrick Strutzenberger

    Full Text Available In this study we report on the sequencing of the COI barcode region from 96 historical specimens (92 type specimens +4 non-types of Eois. Eois is a diverse clade of tropical geometrid moths and is the target of a number of ongoing studies on life-histories, phylogeny, co-evolution with host plants or parasitoids, and diversity patterns across temporal and spatial dimensions. The unequivocal application of valid names is crucial for all aspects of biodiversity research as well as monitoring and conservation efforts. The availability of barcodes from historical type specimens has the potential to facilitate the much-needed acceleration of species description. We performed non-destructive DNA extraction on the abdomens of Eois specimens between 79 and 157 years of age. We used six primer combinations (recovering between 109 and 130 bp each to target the full-length barcode sequence of each specimen. We were able to obtain sequences for 91 of 96 specimens (success rate 94.8%. Sequence length ranged from 121 bp to full barcode sequences (658 bp, the average sequence length was ~500 bp. We detected a moderately strong and statistically significant negative correlation between specimen age and total sequence length, which is in agreement with expectations. The abdomen proved to be an exceedingly valuable source of DNA in old specimens of Lepidoptera. Barcode sequences obtained in this study are currently being used in an effort towards a step-wise taxonomic revision of Eois. We encourage that DNA barcodes obtained from types specimens should be included in all species descriptions and revisions whenever feasible.

  19. Identification of common horsetail (Equisetum arvense L.; Equisetaceae) using Thin Layer Chromatography versus DNA barcoding

    DEFF Research Database (Denmark)

    Saslis Lagoudakis, Haris; Bruun-Lund, Sam; Iwanycki, Natalie Eva

    2015-01-01

    collections and commercial herbal products. We find that both methods can discriminate between the two species and positively identify E. arvense. The TLC-test is more cost- and time-efficient, but DNA barcoding is more powerful in determining the identity of adulterant species. Our study shows that, although....... palustre L. that can produce toxic alkaloids. As morphology-based identification is often difficult or impossible, the identification of processed material can be aided by molecular techniques. In this study, we explore two molecular identification techniques as methods of testing the purity these products...

  20. Identification and reassessment of the specific status of some tropical freshwater midges (Diptera: Chironomidae) using DNA barcode data.

    Science.gov (United States)

    Pramual, Pairot; Simwisat, Kusumart; Martin, Jon

    2016-01-28

    Chironomidae are a highly diverse group of insects. Members of this family are often included in programs monitoring the health of freshwater ecosystems. However, a difficulty in morphological identification, particularly of larval stages is the major obstacle to this application. In this study, we tested the efficiency of mitochondrial cytochrome c oxidase I (COI) sequences as the DNA barcoding region for species identification of Chironomidae in Thailand. The results revealed 14 species with a high success rate (>90%) for the correct species identification, which suggests the potential usefulness of the technique. However, some morphological species possess high (>3%) intraspecific genetic divergence that suggests these species could be species complexes and need further morphological or cytological examination. Sequence-based species delimitation analyses indicated that most specimens identified as Chironomus kiiensis, Tokunaga 1936, in Japan are conspecific with C. striatipennis, Kieffer 1912, although a small number form a separate cluster. A review of the descriptions of Kiefferulus tainanus (Kieffer 1912) and its junior synonym, K. biroi (Kieffer 1918), following our results, suggests that this synonymy is probably not correct and that K. tainanus occurs in Japan, China and Singapore, while K. biroi occurs in India and Thailand. Our results therefore revealed the usefulness of DNA barcoding for correct species identification of Chironomidae, particularly the immature stages. In addition, DNA barcodes could also uncover hidden diversity that can guide further taxonomic study, and offer a more efficient way to identify species than morphological analysis where large numbers of specimens are involved, provided the identifications of DNA barcodes in the databases are correct. Our studies indicate that this is not the case, and we identify cases of misidentifications for C. flaviplumus, Tokunaga 1940 and K. tainanus.

  1. Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products

    Directory of Open Access Journals (Sweden)

    Botti Sara

    2010-08-01

    Full Text Available Abstract Background DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Results Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. Conclusions The described method is largely independent of the degree of degradation of DNA source and can thus be applied to

  2. Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products.

    Science.gov (United States)

    Botti, Sara; Giuffra, Elisabetta

    2010-08-23

    DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce) and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. The described method is largely independent of the degree of degradation of DNA source and can thus be applied to processed seafood. Moreover, the method is highly flexible

  3. Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera.

    Science.gov (United States)

    Mutanen, Marko; Kivelä, Sami M; Vos, Rutger A; Doorenweerd, Camiel; Ratnasingham, Sujeevan; Hausmann, Axel; Huemer, Peter; Dincă, Vlad; van Nieukerken, Erik J; Lopez-Vaamonde, Carlos; Vila, Roger; Aarvik, Leif; Decaëns, Thibaud; Efetov, Konstantin A; Hebert, Paul D N; Johnsen, Arild; Karsholt, Ole; Pentinsaari, Mikko; Rougerie, Rodolphe; Segerer, Andreas; Tarmann, Gerhard; Zahiri, Reza; Godfray, H Charles J

    2016-11-01

    The proliferation of DNA data is revolutionizing all fields of systematic research. DNA barcode sequences, now available for millions of specimens and several hundred thousand species, are increasingly used in algorithmic species delimitations. This is complicated by occasional incongruences between species and gene genealogies, as indicated by situations where conspecific individuals do not form a monophyletic cluster in a gene tree. In two previous reviews, non-monophyly has been reported as being common in mitochondrial DNA gene trees. We developed a novel web service "Monophylizer" to detect non-monophyly in phylogenetic trees and used it to ascertain the incidence of species non-monophyly in COI (a.k.a. cox1) barcode sequence data from 4977 species and 41,583 specimens of European Lepidoptera, the largest data set of DNA barcodes analyzed from this regard. Particular attention was paid to accurate species identification to ensure data integrity. We investigated the effects of tree-building method, sampling effort, and other methodological issues, all of which can influence estimates of non-monophyly. We found a 12% incidence of non-monophyly, a value significantly lower than that observed in previous studies. Neighbor joining (NJ) and maximum likelihood (ML) methods yielded almost equal numbers of non-monophyletic species, but 24.1% of these cases of non-monophyly were only found by one of these methods. Non-monophyletic species tend to show either low genetic distances to their nearest neighbors or exceptionally high levels of intraspecific variability. Cases of polyphyly in COI trees arising as a result of deep intraspecific divergence are negligible, as the detected cases reflected misidentifications or methodological errors. Taking into consideration variation in sampling effort, we estimate that the true incidence of non-monophyly is ∼23%, but with operational factors still being included. Within the operational factors, we separately assessed the

  4. The utility of mtDNA and rDNA for barcoding and phylogeny of plant-parasitic nematodes from Longidoridae (Nematoda, Enoplea).

    Science.gov (United States)

    Palomares-Rius, J E; Cantalapiedra-Navarrete, C; Archidona-Yuste, A; Subbotin, S A; Castillo, P

    2017-09-07

    The traditional identification of plant-parasitic nematode species by morphology and morphometric studies is very difficult because of high morphological variability that can lead to considerable overlap of many characteristics and their ambiguous interpretation. For this reason, it is essential to implement approaches to ensure accurate species identification. DNA barcoding aids in identification and advances species discovery. This study sought to unravel the use of the mitochondrial marker cytochrome c oxidase subunit 1 (coxI) as barcode for Longidoridae species identification, and as a phylogenetic marker. The results showed that mitochondrial and ribosomal markers could be used as barcoding markers, except for some species from the Xiphinema americanum group. The ITS1 region showed a promising role in barcoding for species identification because of the clear molecular variability among species. Some species presented important molecular variability in coxI. The analysis of the newly provided sequences and the sequences deposited in GenBank showed plausible misidentifications, and the use of voucher species and topotype specimens is a priority for this group of nematodes. The use of coxI and D2 and D3 expansion segments of the 28S rRNA gene did not clarify the phylogeny at the genus level.

  5. Identification of exotic North American crayfish in Europe by DNA barcoding

    Directory of Open Access Journals (Sweden)

    Filipová L.

    2011-05-01

    Full Text Available Several alien crayfish of North American origin have become established in Europe in recent decades, but their identification is often confusing. Our aim was to verify the taxonomic status of their European populations by DNA barcoding. We sequenced the cytochrome c oxidase subunit I (COI gene fragment of individuals representing all American crayfish known from European waters, and compared the results with reference sequences from North America. Our results confirm the morphological identification of Orconectes juvenilis from a population in eastern France, and of the marbled crayfish (Marmorkrebs, i.e., a parthenogenetic form of Procambarus fallax, from south-western Germany. Sequences of most individuals of presumed Procambarus acutus from the Netherlands were similar to American P. cf. acutus, but one was divergent, closer to a sequence of a reference individual of P. cf. zonangulus. However, divergences among three American P. cf. zonangulus samples were also high, comparable to interspecific variation within cambarid species complexes. The divergence between O. immunis from Europe and America also reached values corresponding to those observed among distinct Orconectes species. Genetic variation in the American range of these crayfish should therefore be further studied. Our study shows that DNA barcoding is useful for the rapid and accurate identification of exotic crayfish in Europe, and also provides insights into overall variation within these taxa.

  6. DNA barcoding and isolation of vertically transmitted ascomycetes in sorghum from Burkina Faso

    DEFF Research Database (Denmark)

    Stokholm, Michaela S.; Wulff, Ednar Gadelha; Zida, Elisabeth P.

    2016-01-01

    -day-old seedlings was analyzed by 18S ribosomal DNA (rDNA) amplicon sequencing. More than 99% of the fungal rDNA was found to originate from ascomycetes. The distribution of ascomycetes at species level was subsequently analyzed by barcoding of ITS2 rDNA. Eighteen Operational Taxonomic Units (OTUs) were identified......Molecular identification of fungal taxa commonly transmitted through seeds of sorghum in Western Africa is lacking. In the present study, farm-saved seeds, collected from four villages in Northern Burkina Faso, were surface sterilized and the distribution of fungal DNA in seeds and seven...... samples collected in Central Burkina Faso confirming a common occurrence. E. sorghinum was highly predominant in seedlings both measured by DNA analysis and by isolation. The dominance of E. sorghinum was particularly strong in roots from poorly growing seedlings. Pathogenicity of E. sorghinum isolates...

  7. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  8. Universal Plant DNA Barcode Loci May Not Work in Complex Groups: A Case Study with Indian Berberis Species

    Science.gov (United States)

    Roy, Sribash; Tyagi, Antariksh; Shukla, Virendra; Kumar, Anil; Singh, Uma M.; Chaudhary, Lal Babu; Datt, Bhaskar; Bag, Sumit K.; Singh, Pradhyumna K.; Nair, Narayanan K.; Husain, Tariq; Tuli, Rakesh

    2010-01-01

    Background The concept of DNA barcoding for species identification has gained considerable momentum in animals because of fairly successful species identification using cytochrome oxidase I (COI). In plants, matK and rbcL have been proposed as standard barcodes. However, barcoding in complex genera is a challenging task. Methodology and Principal Findings We investigated the species discriminatory power of four reportedly most promising plant DNA barcoding loci (one from nuclear genome- ITS, and three from plastid genome- trnH-psbA, rbcL and matK) in species of Indian Berberis L. (Berberidaceae) and two other genera, Ficus L. (Moraceae) and Gossypium L. (Malvaceae). Berberis species were delineated using morphological characters. These characters resulted in a well resolved species tree. Applying both nucleotide distance and nucleotide character-based approaches, we found that none of the loci, either singly or in combinations, could discriminate the species of Berberis. ITS resolved all the tested species of Ficus and Gossypium and trnH-psbA resolved 82% of the tested species in Ficus. The highly regarded matK and rbcL could not resolve all the species. Finally, we employed amplified fragment length polymorphism test in species of Berberis to determine their relationships. Using ten primer pair combinations in AFLP, the data demonstrated incomplete species resolution. Further, AFLP analysis showed that there was a tendency of the Berberis accessions to cluster according to their geographic origin rather than species affiliation. Conclusions/Significance We reconfirm the earlier reports that the concept of universal barcode in plants may not work in a number of genera. Our results also suggest that the matK and rbcL, recommended as universal barcode loci for plants, may not work in all the genera of land plants. Morphological, geographical and molecular data analyses of Indian species of Berberis suggest probable reticulate evolution and thus barcode markers may

  9. Universal plant DNA barcode loci may not work in complex groups: a case study with Indian berberis species.

    Directory of Open Access Journals (Sweden)

    Sribash Roy

    Full Text Available BACKGROUND: The concept of DNA barcoding for species identification has gained considerable momentum in animals because of fairly successful species identification using cytochrome oxidase I (COI. In plants, matK and rbcL have been proposed as standard barcodes. However, barcoding in complex genera is a challenging task. METHODOLOGY AND PRINCIPAL FINDINGS: We investigated the species discriminatory power of four reportedly most promising plant DNA barcoding loci (one from nuclear genome--ITS, and three from plastid genome--trnH-psbA, rbcL and matK in species of Indian Berberis L. (Berberidaceae and two other genera, Ficus L. (Moraceae and Gossypium L. (Malvaceae. Berberis species were delineated using morphological characters. These characters resulted in a well resolved species tree. Applying both nucleotide distance and nucleotide character-based approaches, we found that none of the loci, either singly or in combinations, could discriminate the species of Berberis. ITS resolved all the tested species of Ficus and Gossypium and trnH-psbA resolved 82% of the tested species in Ficus. The highly regarded matK and rbcL could not resolve all the species. Finally, we employed amplified fragment length polymorphism test in species of Berberis to determine their relationships. Using ten primer pair combinations in AFLP, the data demonstrated incomplete species resolution. Further, AFLP analysis showed that there was a tendency of the Berberis accessions to cluster according to their geographic origin rather than species affiliation. CONCLUSIONS/SIGNIFICANCE: We reconfirm the earlier reports that the concept of universal barcode in plants may not work in a number of genera. Our results also suggest that the matK and rbcL, recommended as universal barcode loci for plants, may not work in all the genera of land plants. Morphological, geographical and molecular data analyses of Indian species of Berberis suggest probable reticulate evolution and thus

  10. Plant DNA barcodes and assessment of phylogenetic community structure of a tropical mixed dipterocarp forest in Brunei Darussalam (Borneo)

    Science.gov (United States)

    Abu Salim, Kamariah; Chase, Mark W.; Dexter, Kyle G.; Pennington, R. Toby; Tan, Sylvester; Kaye, Maria Ellen; Samuel, Rosabelle

    2017-01-01

    DNA barcoding is a fast and reliable tool to assess and monitor biodiversity and, via community phylogenetics, to investigate ecological and evolutionary processes that may be responsible for the community structure of forests. In this study, DNA barcodes for the two widely used plastid coding regions rbcL and matK are used to contribute to identification of morphologically undetermined individuals, as well as to investigate phylogenetic structure of tree communities in 70 subplots (10 × 10m) of a 25-ha forest-dynamics plot in Brunei (Borneo, Southeast Asia). The combined matrix (rbcL + matK) comprised 555 haplotypes (from ≥154 genera, 68 families and 25 orders sensu APG, Angiosperm Phylogeny Group, 2016), making a substantial contribution to tree barcode sequences from Southeast Asia. Barcode sequences were used to reconstruct phylogenetic relationships using maximum likelihood, both with and without constraining the topology of taxonomic orders to match that proposed by the Angiosperm Phylogeny Group. A third phylogenetic tree was reconstructed using the program Phylomatic to investigate the influence of phylogenetic resolution on results. Detection of non-random patterns of community assembly was determined by net relatedness index (NRI) and nearest taxon index (NTI). In most cases, community assembly was either random or phylogenetically clustered, which likely indicates the importance to community structure of habitat filtering based on phylogenetically correlated traits in determining community structure. Different phylogenetic trees gave similar overall results, but the Phylomatic tree produced greater variation across plots for NRI and NTI values, presumably due to noise introduced by using an unresolved phylogenetic tree. Our results suggest that using a DNA barcode tree has benefits over the traditionally used Phylomatic approach by increasing precision and accuracy and allowing the incorporation of taxonomically unidentified individuals into analyses

  11. Plant DNA barcodes and assessment of phylogenetic community structure of a tropical mixed dipterocarp forest in Brunei Darussalam (Borneo.

    Directory of Open Access Journals (Sweden)

    Jacqueline Heckenhauer

    Full Text Available DNA barcoding is a fast and reliable tool to assess and monitor biodiversity and, via community phylogenetics, to investigate ecological and evolutionary processes that may be responsible for the community structure of forests. In this study, DNA barcodes for the two widely used plastid coding regions rbcL and matK are used to contribute to identification of morphologically undetermined individuals, as well as to investigate phylogenetic structure of tree communities in 70 subplots (10 × 10m of a 25-ha forest-dynamics plot in Brunei (Borneo, Southeast Asia. The combined matrix (rbcL + matK comprised 555 haplotypes (from ≥154 genera, 68 families and 25 orders sensu APG, Angiosperm Phylogeny Group, 2016, making a substantial contribution to tree barcode sequences from Southeast Asia. Barcode sequences were used to reconstruct phylogenetic relationships using maximum likelihood, both with and without constraining the topology of taxonomic orders to match that proposed by the Angiosperm Phylogeny Group. A third phylogenetic tree was reconstructed using the program Phylomatic to investigate the influence of phylogenetic resolution on results. Detection of non-random patterns of community assembly was determined by net relatedness index (NRI and nearest taxon index (NTI. In most cases, community assembly was either random or phylogenetically clustered, which likely indicates the importance to community structure of habitat filtering based on phylogenetically correlated traits in determining community structure. Different phylogenetic trees gave similar overall results, but the Phylomatic tree produced greater variation across plots for NRI and NTI values, presumably due to noise introduced by using an unresolved phylogenetic tree. Our results suggest that using a DNA barcode tree has benefits over the traditionally used Phylomatic approach by increasing precision and accuracy and allowing the incorporation of taxonomically unidentified individuals

  12. Intraspecific diversity of Monochamus saltuarius (Gebler based on DNA barcode analysis

    Directory of Open Access Journals (Sweden)

    Jun Hyoung Jeon

    2015-12-01

    Full Text Available Monochamus saltuarius has a morphological polymorphism, but there is no standard phenotype to distinguish the differences in M. saltuarius species. To investigate molecular diversity of M. saltuarius, mitochondrial cytochrome c oxidase I 5’ sequence were analyzed against specimens collected from Chungbuk, Gyeonggi, and Gangwon province. The DNA barcode results showed that the specimens make two groups with a 1.68%–3.1% K2P distance, but cannot find a specific phenotype difference among the specimens.

  13. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  14. Spatial heterogeneity in the Mediterranean Biodiversity Hotspot affects barcoding accuracy of its freshwater fishes.

    Science.gov (United States)

    Geiger, M F; Herder, F; Monaghan, M T; Almada, V; Barbieri, R; Bariche, M; Berrebi, P; Bohlen, J; Casal-Lopez, M; Delmastro, G B; Denys, G P J; Dettai, A; Doadrio, I; Kalogianni, E; Kärst, H; Kottelat, M; Kovačić, M; Laporte, M; Lorenzoni, M; Marčić, Z; Özuluğ, M; Perdices, A; Perea, S; Persat, H; Porcelotti, S; Puzzi, C; Robalo, J; Šanda, R; Schneider, M; Šlechtová, V; Stoumboudi, M; Walter, S; Freyhof, J

    2014-11-01

    Incomplete knowledge of biodiversity remains a stumbling block for conservation planning and even occurs within globally important Biodiversity Hotspots (BH). Although technical advances have boosted the power of molecular biodiversity assessments, the link between DNA sequences and species and the analytics to discriminate entities remain crucial. Here, we present an analysis of the first DNA barcode library for the freshwater fish fauna of the Mediterranean BH (526 spp.), with virtually complete species coverage (498 spp., 98% extant species). In order to build an identification system supporting conservation, we compared species determination by taxonomists to multiple clustering analyses of DNA barcodes for 3165 specimens. The congruence of barcode clusters with morphological determination was strongly dependent on the method of cluster delineation, but was highest with the general mixed Yule-coalescent (GMYC) model-based approach (83% of all species recovered as GMYC entity). Overall, genetic morphological discontinuities suggest the existence of up to 64 previously unrecognized candidate species. We found reduced identification accuracy when using the entire DNA-barcode database, compared with analyses on databases for individual river catchments. This scale effect has important implications for barcoding assessments and suggests that fairly simple identification pipelines provide sufficient resolution in local applications. We calculated Evolutionarily Distinct and Globally Endangered scores in order to identify candidate species for conservation priority and argue that the evolutionary content of barcode data can be used to detect priority species for future IUCN assessments. We show that large-scale barcoding inventories of complex biotas are feasible and contribute directly to the evaluation of conservation priorities. © 2014 John Wiley & Sons Ltd.

  15. Meta-barcoding of 'dirt' DNA from soil reflects vertebrate biodiversity.

    Science.gov (United States)

    Andersen, Kenneth; Bird, Karen Lise; Rasmussen, Morten; Haile, James; Breuning-Madsen, Henrik; Kjaer, Kurt H; Orlando, Ludovic; Gilbert, M Thomas P; Willerslev, Eske

    2012-04-01

    DNA molecules originating from animals and plants can be retrieved directly from sediments and have been used for reconstructing both contemporary and past ecosystems. However, the extent to which such 'dirt' DNA reflects taxonomic richness and structural diversity remains contentious. Here, we couple second generation high-throughput sequencing with 16S mitochondrial DNA (mtDNA) meta-barcoding, to explore the accuracy and sensitivity of 'dirt' DNA as an indicator of vertebrate diversity, from soil sampled at safari parks, zoological gardens and farms with known species compositions. PCR amplification was successful in the full pH range of the investigated soils (6.2 ± 0.2 to 8.3 ± 0.2), but inhibition was detected in extracts from soil of high organic content. DNA movement (leaching) through strata was evident in some sporadic cases and is influenced by soil texture and structure. We find that DNA from the soil surface reflects overall taxonomic richness and relative biomass of individual species. However, one species that was recently introduced was not detected. Furthermore, animal behaviour was shown to influence DNA deposition rates. The approach potentially provides a quick methodological alternative to classical ecological surveys of biodiversity, and most reliable results are obtained with spatial sample replicates, while relative amounts of soil processed per site is of less importance. © 2011 Blackwell Publishing Ltd.

  16. Species composition and diversity of fish larvae in the Subtropical Convergence Zone of the Sargasso Sea from morphology and DNA barcoding

    DEFF Research Database (Denmark)

    Ayala, Daniel Jiro; Munk, Peter; Riemann, Lasse

    2016-01-01

    . In order to evaluate spatial variability of larval fish in the region, we examined species diversity, composition and abundances at eight stations in the Subtropical Convergence Zone (STCZ) using morphological identification and DNA barcoding. From a total of approximately 3500 specimens collected...... of the strong environmental gradients. Common eel species were concentrated between the fronts whereas common myctophids were of highest abundance at the outer edges of the fronts. The abundances of most species were generally enhanced in the vicinity of the fronts. The use of combined morphological and DNA-barcoding...

  17. DNA barcoding of Rhododendron (Ericaceae), the largest Chinese plant genus in biodiversity hotspots of the Himalaya-Hengduan Mountains.

    Science.gov (United States)

    Yan, Li-Jun; Liu, Jie; Möller, Michael; Zhang, Lin; Zhang, Xue-Mei; Li, De-Zhu; Gao, Lian-Ming

    2015-07-01

    The Himalaya-Hengduan Mountains encompass two global biodiversity hotspots with high levels of biodiversity and endemism. This area is one of the diversification centres of the genus Rhododendron, which is recognized as one of the most taxonomically challenging plant taxa due to recent adaptive radiations and rampant hybridization. In this study, four DNA barcodes were evaluated on 531 samples representing 173 species of seven sections of four subgenera in Rhododendron, with a high sampling density from the Himalaya-Hengduan Mountains employing three analytical methods. The varied approaches (nj, pwg and blast) had different species identification powers with blast performing best. With the pwg analysis, the discrimination rates for single barcodes varied from 12.21% to 25.19% with ITS biodiversity for the large genus Rhododendron in the biodiversity hotspots of the Himalaya-Hengduan Mountains. © 2014 John Wiley & Sons Ltd.

  18. Calcinea of the Red Sea: providing a DNA barcode inventory with description of four new species

    KAUST Repository

    Voigt, Oliver; Erpenbeck, Dirk; Gonzá lez-Pech, Rá ul A.; Al-Aidaroos, Ali M.; Berumen, Michael L.; Wö rheide, Gert

    2017-01-01

    The Red Sea is a biodiversity hotspot with a considerable percentage of endemic species for many marine animals. Little is known about the diversity and distribution of calcareous sponges (Porifera, Class Calcarea) in this marginal sea. Here we analysed calcareous sponges of the subclass Calcinea that were collected between 2009 and 2013 at 20 localities in the Red Sea, ranging from the Gulf of Aqaba in the north to the Farasan Islands in the south, to document the species of this region. For this, we applied an integrative approach: We defined OTUs based on the analyses of a recently suggested standard DNA marker, the LSU C-region. The analysis was complemented with a second marker, the internal transcribed spacer, for selected specimens. Ten OTUs were identified. Specimens of each OTU were morphologically examined with spicule preparations and histological sections. Accordingly, our ten OTUs represent ten species, which cover taxonomically a broad range of the subclass. By combining molecular and morphological data, we describe four new species from the Red Sea: Soleneiscus hamatus sp. nov., Ernstia arabica sp. nov., Clathrina rotundata sp. nov., and Clathrina rowi sp. nov.. One additional small specimen was closely related to “Clathrina” adusta, but due to the small size it could not be properly analysed morphologically. By providing the DNA sequences for the morphologically documented specimens in the Sponge Barcoding Database (www.spongebarcoding.org) we facilitate future DNA-assisted species identification of Red Sea Calcinea, even for small or incomplete samples, which would be insufficient for morphological identification. Application of DNA barcode methods in the subclass will help to further investigate the distribution of Calcinea in the Red Sea and adjacent regions.

  19. Calcinea of the Red Sea: providing a DNA barcode inventory with description of four new species

    KAUST Repository

    Voigt, Oliver

    2017-03-29

    The Red Sea is a biodiversity hotspot with a considerable percentage of endemic species for many marine animals. Little is known about the diversity and distribution of calcareous sponges (Porifera, Class Calcarea) in this marginal sea. Here we analysed calcareous sponges of the subclass Calcinea that were collected between 2009 and 2013 at 20 localities in the Red Sea, ranging from the Gulf of Aqaba in the north to the Farasan Islands in the south, to document the species of this region. For this, we applied an integrative approach: We defined OTUs based on the analyses of a recently suggested standard DNA marker, the LSU C-region. The analysis was complemented with a second marker, the internal transcribed spacer, for selected specimens. Ten OTUs were identified. Specimens of each OTU were morphologically examined with spicule preparations and histological sections. Accordingly, our ten OTUs represent ten species, which cover taxonomically a broad range of the subclass. By combining molecular and morphological data, we describe four new species from the Red Sea: Soleneiscus hamatus sp. nov., Ernstia arabica sp. nov., Clathrina rotundata sp. nov., and Clathrina rowi sp. nov.. One additional small specimen was closely related to “Clathrina” adusta, but due to the small size it could not be properly analysed morphologically. By providing the DNA sequences for the morphologically documented specimens in the Sponge Barcoding Database (www.spongebarcoding.org) we facilitate future DNA-assisted species identification of Red Sea Calcinea, even for small or incomplete samples, which would be insufficient for morphological identification. Application of DNA barcode methods in the subclass will help to further investigate the distribution of Calcinea in the Red Sea and adjacent regions.

  20. DNA barcoding unmasks overlooked diversity improving knowledge on the composition and origins of the Churchill algal flora.

    Science.gov (United States)

    Saunders, Gary W; McDevit, Daniel C

    2013-03-16

    Sampling expeditions to Churchill in the Canadian subarctic were completed with the aim of compiling a molecular-assisted survey of the macroalgal flora (seaweeds) for comparison to published accounts for this area, which are based on morphological identifications. Further, because the Churchill region was covered by ice until recently (~10,000 before present), the current algal flora has had to migrate from adjacent waters into that region. We used our DNA barcode data to predict the relative contribution of the North Atlantic and North Pacific floras (Likely Source Region) in repopulating the Churchill region following the most recent glacial retreat. We processed 422 collections representing ~50 morpho-species, which is the approximate number reported for this region, and generated DNA barcode data for 346 of these. In contrast to the morpho-species count, we recovered 57 genetic groups indicating overlooked species (this despite failing to generate barcode data for six of the ~50 morpho-species). However, we additionally uncovered numerous inconsistencies between the species that are currently listed in the Churchill flora (again as a result of overlooked species diversity, but combined with taxonomic confusion) and those identified following our molecular analyses including eight new records and another 17 genetic complexes in need of further study. Based on a comparison of DNA barcode data from the Churchill flora to collections from the contiguous Atlantic and Pacific floras we estimate that minimally 21% (possibly as much as 44%) of the Churchill flora was established by migration from the Pacific region with the balance of species arriving from the Atlantic (predominantly North American populations) following the last glacial retreat. Owing to difficulties associated with the morphological identification of macroalgae, our results indicate that current comprehension of the Canadian Arctic flora is weak. We consider that morphology-based field

  1. Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2018-01-01

    DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

  2. DNA barcoding in a biodiversity hot spot: potential value for the identification of Malagasy Euphorbia L. listed in CITES Appendices I and II.

    Science.gov (United States)

    Aubriot, Xavier; Lowry, Porter P; Cruaud, Corinne; Couloux, Arnaud; Haevermans, Thomas

    2013-01-01

    The island of Madagascar is a key hot spot for the genus Euphorbia, with at least 170 native species, almost all endemic. Threatened by habitat loss and illegal collection of wild plants, nearly all Malagasy Euphorbia are listed in CITES Appendices I and II. The absence of a reliable taxonomic revision makes it particularly difficult to identify these plants, even when fertile, and thereby compromises the application of CITES regulations. DNA barcoding, which can facilitate species-level identification irrespective of developmental stage and the presence of flowers or fruits, may be a promising tool for monitoring and controlling trade involving threatened species. In this study, we test the potential value of barcoding on 41 Euphorbia species representative of the genus in Madagascar, using the two widely adopted core barcode markers (matK and rbcL), along with two additional DNA regions, nuclear internal transcribed spacer (ITS) and the chloroplastic intergenic spacer psbA-trnH. For each marker and for selected marker combinations, inter- and intraspecific distance estimates and species discrimination rates are calculated. Results using just the 'official' barcoding markers yield overlapping inter- and intraspecific ranges and species discrimination rates below 60%. When ITS is used, whether alone or in combination with the core markers, species discrimination increases to nearly 100%, whereas the addition of psbA-trnH produces less satisfactory results. This study, the first ever to test barcoding on the large, commercially important genus Euphorbia shows that this method could be developed into a powerful identification tool and thereby contribute to more effective application of CITES regulations. © 2012 Blackwell Publishing Ltd.

  3. DNA Barcoding of Birds at a Migratory Hotspot in Eastern Turkey Highlights Continental Phylogeographic Relationships.

    Directory of Open Access Journals (Sweden)

    Raşit Bilgin

    Full Text Available The combination of habitat loss, climate change, direct persecution, introduced species and other components of the global environmental crisis has resulted in a rapid loss of biodiversity, including species, population and genetic diversity. Birds, which inhabit a wide spectrum of different habitat types, are particularly sensitive to and indicative of environmental changes. The Caucasus endemic bird area, part of which covers northeastern Turkey, is one of the world's key regions harboring a unique bird community threatened with habitat loss. More than 75% of all bird species native to Turkey have been recorded in this region, in particular along the Kars-Iğdır migratory corridor, stopover, wintering and breeding sites along the Aras River, whose wetlands harbor at least 264 bird species. In this study, DNA barcoding technique was used for evaluating the genetic diversity of land bird species of Aras River Bird Paradise at the confluence of Aras River and Iğdır Plains key biodiversity areas. Seventy three COI sequences from 33 common species and 26 different genera were newly generated and used along with 301 sequences that were retrieved from the Barcoding of Life Database (BOLD. Using the sequences obtained in this study, we made global phylogeographic comparisons to define four categories of species, based on barcoding suitability, intraspecific divergence and taxonomy. Our findings indicate that the landbird community of northeastern Turkey has a genetical signature mostly typical of northern Palearctic bird communities while harboring some unique variations. The study also provides a good example of how DNA barcoding can build upon its primary mission of species identification and use available data to integrate genetic variation investigated at the local scale into a global framework. However, the rich bird community of the Aras River wetlands is highly threatened with the imminent construction of the Tuzluca Dam by the government.

  4. Cytogenetic and DNA barcoding reveals high divergence within the trahira, Hoplias malabaricus (Characiformes: Erythrinidae from the lower Amazon River

    Directory of Open Access Journals (Sweden)

    Diego Ferreira Marques

    Full Text Available Molecular and cytogenetic data have provided evidence of cryptic speciation in the widespread South American trahira, Hoplias malabaricus. In the present study, karyotypes and DNA barcode sequences of specimens from seven populations inhabiting the lower Amazon River were analyzed in order to characterize the levels of genetic divergence within a single karyomorph. All the specimens presented karyotypes with 2n = 40 chromosomes (20m+20sm that were consistent with the species' C karyomorph. The DNA barcodes revealed six haplogroups, with clear divergence between populations from Brazil and Argentina. The results support the species complex hypothesis and indicate that a single karyomorph of H. malabaricus may harbor more than one species

  5. Revisiting the ichthyodiversity of Java and Bali through DNA barcodes: taxonomic coverage, identification accuracy, cryptic diversity and identification of exotic species.

    Science.gov (United States)

    Dahruddin, Hadi; Hutama, Aditya; Busson, Frédéric; Sauri, Sopian; Hanner, Robert; Keith, Philippe; Hadiaty, Renny; Hubert, Nicolas

    2017-03-01

    Among the 899 species of freshwater fishes reported from Sundaland biodiversity hotspot, nearly 50% are endemics. The functional integrity of aquatic ecosystems is currently jeopardized by human activities, and landscape conversion led to the decline of fish populations in several part of Sundaland, particularly in Java. The inventory of the Javanese ichthyofauna has been discontinuous, and the taxonomic knowledge is scattered in the literature. This study provides a DNA barcode reference library for the inland fishes of Java and Bali with the aim to streamline the inventory of fishes in this part of Sundaland. Owing to the lack of available checklist for estimating the taxonomic coverage of this study, a checklist was compiled based on online catalogues. A total of 95 sites were visited, and a library including 1046 DNA barcodes for 159 species was assembled. Nearest neighbour distance was 28-fold higher than maximum intraspecific distance on average, and a DNA barcoding gap was observed. The list of species with DNA barcodes displayed large discrepancies with the checklist compiled here as only 36% (i.e. 77 species) and 60% (i.e. 24 species) of the known species were sampled in Java and Bali, respectively. This result was contrasted by a high number of new occurrences and the ceiling of the accumulation curves for both species and genera. These results highlight the poor taxonomic knowledge of this ichthyofauna, and the apparent discrepancy between present and historical occurrence data is to be attributed to species extirpations, synonymy and misidentifications in previous studies. © 2016 John Wiley & Sons Ltd.

  6. DNA Barcodes of the animal species occurring in Italy under the European “Habitats Directive” (92/43/EEC: a reference library for the Italian National Biodiversity Network

    Directory of Open Access Journals (Sweden)

    Donatella Cesaroni

    2017-11-01

    Full Text Available The present paper reports the development of a public project addressed to build up and publish a DNA barcode reference library for the animal species occurring in Italy listed in the II, IV and V Annexes of the “Habitats Directive” 92/43/EEC. DNA barcoding is a global standard, namely a procedure based on a gene sequence located in a standardized genome region as a diagnostic biomarker for species. DNA barcodes data have been either produced in our laboratories or collected from the literature and international gene databases. They were subsequently used to assemble a database containing both genetic data and information related to the origin of the data. This project represents the first pilot store of DNA sequence data built-in interoperability within the portal of the National Network of Biodiversity of the Italian Ministry of the Environment. The archive, called "DNA Barcode Database of Italian Nature 2000 animal species" (owned by the Zoology and Evolutionary Biology group at Tor Vergata University, was implemented in a relational DBMS with a free license program (PostgreSQL v9.3.4, mapped using the schema ABCD and the extension DNA, and then made interoperable using the software BioCASE (v3.6.0.

  7. Integrating early detection with DNA barcoding: species identification of a non-native monitor lizard (Squamata: Varanidae) carcass in Mississippi, U.S.A.

    Science.gov (United States)

    Reed, Robert N.; Hopken, Matthew W.; Steen, David A.; Falk, Bryan G.; Piaggio, Antoinette J.

    2016-01-01

    Early detection of invasive species is critical to increasing the probability of successful management. At the primary stage of an invasion, invasive species are easier to control as the population is likely represented by just a few individuals. Detection of these first few individuals can be challenging, particularly if they are cryptic or otherwise characterized by low detectability. The engagement of members of the public may be critical to early detection as there are far more citizen s on the landscape than trained biologists. However, it can be difficult to assess the credibility of public reporting, especially when a diagnostic digital image or a physical specimen in good condition are lacking. DNA barcoding can be used for verification when morphological identification of a specimen is not possible or uncertain (i.e., degraded or partial specimen). DNA barcoding relies on obtaining a DNA sequence from a relatively small fragment of mitochondrial DNA and comparing it to a database of sequences containing a variety of expertly identified species. He rein we report the successful identification of a degraded specimen of a non-native, potentially invasive reptile species (Varanus niloticus) via DNA barcoding, after discovery and reporting by a member of the public.

  8. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

    Science.gov (United States)

    Kress, W John; Erickson, David L

    2007-06-06

    A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

  9. Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size.

    Directory of Open Access Journals (Sweden)

    Peng-Cheng Yao

    Full Text Available Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P < 0.01. These results suggest that increasing the sample size in specialist habitats can improve measurements of intraspecific genetic diversity, and will have a positive effect on the application of the DNA barcodes in widely distributed species. The results of random sampling showed that when sample size reached 11 for Chloris virgata, Chenopodium glaucum, and Dysphania ambrosioides, 13 for Setaria viridis, and 15 for Eleusine indica, Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11-15.

  10. DNA barcoding applied to ex situ tropical amphibian conservation programme reveals cryptic diversity in captive populations.

    Science.gov (United States)

    Crawford, Andrew J; Cruz, Catalina; Griffith, Edgardo; Ross, Heidi; Ibáñez, Roberto; Lips, Karen R; Driskell, Amy C; Bermingham, Eldredge; Crump, Paul

    2013-11-01

    Amphibians constitute a diverse yet still incompletely characterized clade of vertebrates, in which new species are still being discovered and described at a high rate. Amphibians are also increasingly endangered, due in part to disease-driven threats of extinctions. As an emergency response, conservationists have begun ex situ assurance colonies for priority species. The abundance of cryptic amphibian diversity, however, may cause problems for ex situ conservation. In this study we used a DNA barcoding approach to survey mitochondrial DNA (mtDNA) variation in captive populations of 10 species of Neotropical amphibians maintained in an ex situ assurance programme at El Valle Amphibian Conservation Center (EVACC) in the Republic of Panama. We combined these mtDNA sequences with genetic data from presumably conspecific wild populations sampled from across Panama, and applied genetic distance-based and character-based analyses to identify cryptic lineages. We found that three of ten species harboured substantial cryptic genetic diversity within EVACC, and an additional three species harboured cryptic diversity among wild populations, but not in captivity. Ex situ conservation efforts focused on amphibians are therefore vulnerable to an incomplete taxonomy leading to misidentification among cryptic species. DNA barcoding may therefore provide a simple, standardized protocol to identify cryptic diversity readily applicable to any amphibian community. © 2012 John Wiley & Sons Ltd.

  11. DNA barcoding implicates 23 species and four orders as potential pollinators of Chinese knotweed (Persicaria chinensis) in Peninsular Malaysia.

    Science.gov (United States)

    Wong, M-M; Lim, C-L; Wilson, J-J

    2015-08-01

    Chinese knotweed (Persicaria chinensis) is of ecological and economic importance as a high-risk invasive species and a traditional medicinal herb. However, the insects associated with P. chinensis pollination have received scant attention. As a widespread invasive plant we would expect P. chinensis to be associated with a diverse group of insect pollinators, but lack of taxonomic identification capacity is an impediment to confirm this expectation. In the present study we aimed to elucidate the insect pollinators of P. chinensis in peninsular Malaysia using DNA barcoding. Forty flower visitors, representing the range of morphological diversity observed, were captured at flowers at Ulu Kali, Pahang, Malaysia. Using Automated Barcode Gap Discovery, 17 morphospecies were assigned to 23 species representing at least ten families and four orders. Using the DNA barcode library (BOLD) 30% of the species could be assigned a species name, and 70% could be assigned a genus name. The insects visiting P. chinensis were broadly similar to those previously reported as visiting Persicaria japonica, including honey bees (Apis), droneflies (Eristalis), blowflies (Lucilia) and potter wasps (Eumedes), but also included thrips and ants.

  12. Evaluation of six candidate DNA barcode loci for identification of five important invasive grasses in eastern Australia.

    Directory of Open Access Journals (Sweden)

    Aisuo Wang

    Full Text Available Invasive grass weeds reduce farm productivity, threaten biodiversity, and increase weed control costs. Identification of invasive grasses from native grasses has generally relied on the morphological examination of grass floral material. DNA barcoding may provide an alternative means to identify co-occurring native and invasive grasses, particularly during early growth stages when floral characters are unavailable for analysis. However, there are no universal loci available for grass barcoding. We herein evaluated the utility of six candidate loci (atpF intron, matK, ndhK-ndhC, psbE-petL, ETS and ITS for barcode identification of several economically important invasive grass species frequently found among native grasses in eastern Australia. We evaluated these loci in 66 specimens representing five invasive grass species (Chloris gayana, Eragrostis curvula, Hyparrhenia hirta, Nassella neesiana, Nassella trichotoma and seven native grass species. Our results indicated that, while no single locus can be universally used as a DNA barcode for distinguishing the grass species examined in this study, two plastid loci (atpF and matK showed good distinguishing power to separate most of the taxa examined, and could be used as a dual locus to distinguish several of the invasive from the native species. Low PCR success rates were evidenced among two nuclear loci (ETS and ITS, and few species were amplified at these loci, however ETS was able to genetically distinguish the two important invasive Nassella species. Multiple loci analyses also suggested that ETS played a crucial role in allowing identification of the two Nassella species in the multiple loci combinations.

  13. Exploring the Utility of Partial Cytochrome c Oxidase Subunit 1 for DNA Barcoding of Gobies

    Directory of Open Access Journals (Sweden)

    Hyung-Bae Jeon

    2012-10-01

    Full Text Available Gobiids are hyperdiverse compared with other teleost groups, with about 2,000 species occurring in marine, freshwater, and blackish habitats, and they show a remarkable variety of morphologies and ecology. Testing the effectiveness of DNA barcodes on species that have emerged as a result of radiation remains a major challenge in evolutionary biology. Here, we used the cytochrome c oxidase subunit 1 (COI sequences from 144 species of gobies and related species to evaluate the performance of distance-based DNA barcoding and to conduct a phylogenetic analysis. The average intra-genus genetic distance was considerably higher than that obtained in previous studies. Additionally, the interspecific divergence at higher taxonomic levels was not significantly different from that at the intragenus level, suggesting that congeneric gobies possess substantial interspecific sequence divergence in their COI gene. However, levels of intragenus divergence varied greatly among genera, and we do not provide sufficient evidence for using COI for cryptic species delimitation. Significantly more nucleotide changes were observed at the third codon position than that at the first and the second codons, revealing that extensive variation in COI reflects synonymous changes and little protein level variation. Despite clear signatures in several genera, the COI sequences did resolve genealogical relationships in the phylogenetic analysis well. Our results support the validity of COI barcoding for gobiid species identification, but the utilization of more gene regions will assist to offer a more robust gobiid species phylogeny.

  14. Who's there? - First morphological and DNA barcoding catalogue of the shallow Hawai'ian sponge fauna.

    Science.gov (United States)

    Núñez Pons, Laura; Calcinai, Barbara; Gates, Ruth D

    2017-01-01

    The sponge fauna has been largely overlooked in the Archipelago of Hawai'i, notwithstanding the paramount role of this taxon in marine ecosystems. The lack of knowledge about Porifera populations inhabiting the Hawai'ian reefs limits the development of ecological studies aimed at understanding the functioning of these marine systems. Consequently, this project addresses this gap by describing the most representative sponge species in the shallow waters of the enigmatic bay of Kane'ohe Bay, in O'ahu Island. A total of 30 species (28 demosponges and two calcareous sponges) living associated to the reef structures are here reported. Six of these species are new records to the Hawai'ian Porifera catalogue and are suspected to be recent introductions to these islands. Morphological descriptions of the voucher specimens are provided, along with sequencing data of two partitions involving the mitochondrial cytochrome oxidase subunit 1 (COI) marker and a fragment covering partial (18S and 28S) and full (ITS-1, 5.8S and ITS-2) nuclear ribosomal genes. Species delimitations based on genetic distances were calculated to valitate how taxonomic assignments from DNA barcoding aligned with morphological identifications. Of the 60 sequences submitted to GenBank ~88% are the first sequencing records for the corresponding species and genetic marker. This work compiles the first catalogue combining morphological characters with DNA barcoding of Hawai'ian sponges, and contributes to the repository of public databases through the Sponge Barcoding Project initiative.

  15. Who's there? - First morphological and DNA barcoding catalogue of the shallow Hawai'ian sponge fauna.

    Directory of Open Access Journals (Sweden)

    Laura Núñez Pons

    Full Text Available The sponge fauna has been largely overlooked in the Archipelago of Hawai'i, notwithstanding the paramount role of this taxon in marine ecosystems. The lack of knowledge about Porifera populations inhabiting the Hawai'ian reefs limits the development of ecological studies aimed at understanding the functioning of these marine systems. Consequently, this project addresses this gap by describing the most representative sponge species in the shallow waters of the enigmatic bay of Kane'ohe Bay, in O'ahu Island. A total of 30 species (28 demosponges and two calcareous sponges living associated to the reef structures are here reported. Six of these species are new records to the Hawai'ian Porifera catalogue and are suspected to be recent introductions to these islands. Morphological descriptions of the voucher specimens are provided, along with sequencing data of two partitions involving the mitochondrial cytochrome oxidase subunit 1 (COI marker and a fragment covering partial (18S and 28S and full (ITS-1, 5.8S and ITS-2 nuclear ribosomal genes. Species delimitations based on genetic distances were calculated to valitate how taxonomic assignments from DNA barcoding aligned with morphological identifications. Of the 60 sequences submitted to GenBank ~88% are the first sequencing records for the corresponding species and genetic marker. This work compiles the first catalogue combining morphological characters with DNA barcoding of Hawai'ian sponges, and contributes to the repository of public databases through the Sponge Barcoding Project initiative.

  16. High-throughput discovery of T cell epitopes in type 1 diabetes using DNA barcode labelledpeptide-MHC multimers

    DEFF Research Database (Denmark)

    Lyngaa, Rikke Birgitte; Bentzen, Amalie Kai; Overgaard, A. Julie

    2016-01-01

    applying a novel technology where the selection of MHC-multimer binding T cells is followed by amplification and sequencing of MHC multimer-associated DNA barcodes revealing their recognition. This technique enables simultaneous detection of >1000 specificities. Identifying post translational modifications...

  17. Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data.

    Science.gov (United States)

    Mulcahy, Daniel G; Lee, Justin L; Miller, Aryeh H; Chand, Mia; Thura, Myint Kyaw; Zug, George R

    2018-01-01

    Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent potentially

  18. Filling the BINs of life: Report of an amphibian and reptile survey of the Tanintharyi (Tenasserim) Region of Myanmar, with DNA barcode data

    Science.gov (United States)

    Mulcahy, Daniel G.; Lee, Justin L.; Miller, Aryeh H.; Chand, Mia; Thura, Myint Kyaw; Zug, George R.

    2018-01-01

    Abstract Despite threats of species extinctions, taxonomic crises, and technological advances in genomics and natural history database informatics, we are still distant from cataloguing all of the species of life on earth. Amphibians and reptiles are no exceptions; in fact new species are described nearly every day and many species face possible extinction. The number of described species continues to climb as new areas of the world are explored and as species complexes are examined more thoroughly. The use of DNA barcoding provides a mechanism for rapidly estimating the number of species at a given site and has the potential to record all of the species of life on Earth. Though DNA barcoding has its caveats, it can be useful to estimate the number of species in a more systematic and efficient manner, to be followed in combination with more traditional, morphology-based identifications and species descriptions. Herein, we report the results of a voucher-based herpetological expedition to the Tanintharyi (Tenasserim) Region of Myanmar, enhanced with DNA barcode data. Our main surveys took place in the currently proposed Tanintharyi National Park. We combine our results with photographs and observational data from the Chaung-nauk-pyan forest reserve. Additionally, we provide the first checklist of amphibians and reptiles of the region, with species based on the literature and museum. Amphibians, anurans in particular, are one of the most poorly known groups of vertebrates in terms of taxonomy and the number of known species, particularly in Southeast Asia. Our rapid-assessment program combined with DNA barcoding and use of Barcode Index Numbers (BINs) of voucher specimens reveals the depth of taxonomic diversity in the southern Tanintharyi herpetofauna even though only a third of the potential amphibians and reptiles were seen. A total of 51 putative species (one caecilian, 25 frogs, 13 lizards, 10 snakes, and two turtles) were detected, several of which represent

  19. Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size.

    Science.gov (United States)

    Yao, Peng-Cheng; Gao, Hai-Yan; Wei, Ya-Nan; Zhang, Jian-Hang; Chen, Xiao-Yong; Li, Hong-Qing

    2017-01-01

    Environmental conditions in coastal salt marsh habitats have led to the development of specialist genetic adaptations. We evaluated six DNA barcode loci of the 53 species of Poaceae and 15 species of Chenopodiaceae from China's coastal salt marsh area and inland area. Our results indicate that the optimum DNA barcode was ITS for coastal salt-tolerant Poaceae and matK for the Chenopodiaceae. Sampling strategies for ten common species of Poaceae and Chenopodiaceae were analyzed according to optimum barcode. We found that by increasing the number of samples collected from the coastal salt marsh area on the basis of inland samples, the number of haplotypes of Arundinella hirta, Digitaria ciliaris, Eleusine indica, Imperata cylindrica, Setaria viridis, and Chenopodium glaucum increased, with a principal coordinate plot clearly showing increased distribution points. The results of a Mann-Whitney test showed that for Digitaria ciliaris, Eleusine indica, Imperata cylindrica, and Setaria viridis, the distribution of intraspecific genetic distances was significantly different when samples from the coastal salt marsh area were included (P Imperata cylindrica and Chenopodium album, average intraspecific distance tended to reach stability. These results indicate that the sample size for DNA barcode of globally distributed species should be increased to 11-15.

  20. Mapping DNA damage-dependent genetic interactions in yeast via party mating and barcode fusion genetics.

    Science.gov (United States)

    Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P

    2018-05-28

    Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  1. Barcode extension for analysis and reconstruction of structures

    Science.gov (United States)

    Myhrvold, Cameron; Baym, Michael; Hanikel, Nikita; Ong, Luvena L.; Gootenberg, Jonathan S.; Yin, Peng

    2017-03-01

    Collections of DNA sequences can be rationally designed to self-assemble into predictable three-dimensional structures. The geometric and functional diversity of DNA nanostructures created to date has been enhanced by improvements in DNA synthesis and computational design. However, existing methods for structure characterization typically image the final product or laboriously determine the presence of individual, labelled strands using gel electrophoresis. Here we introduce a new method of structure characterization that uses barcode extension and next-generation DNA sequencing to quantitatively measure the incorporation of every strand into a DNA nanostructure. By quantifying the relative abundances of distinct DNA species in product and monomer bands, we can study the influence of geometry and sequence on assembly. We have tested our method using 2D and 3D DNA brick and DNA origami structures. Our method is general and should be extensible to a wide variety of DNA nanostructures.

  2. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  3. Molecular Identification of Dendrobium Species (Orchidaceae) Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study.

    Science.gov (United States)

    Feng, Shangguo; Jiang, Yan; Wang, Shang; Jiang, Mengying; Chen, Zhe; Ying, Qicai; Wang, Huizhong

    2015-09-11

    The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae). For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  4. Molecular Identification of Dendrobium Species (Orchidaceae Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study

    Directory of Open Access Journals (Sweden)

    Shangguo Feng

    2015-09-01

    Full Text Available The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae. For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  5. DNA barcoding of perennial fruit tree species of agronomic interest in the genus Annona (Annonaceae

    Directory of Open Access Journals (Sweden)

    Nerea eLarranaga

    2015-07-01

    Full Text Available The DNA barcode initiative aims to establish a universal protocol using short genetic sequences to discriminate among animal and plant species. Although many markers have been proposed to become the barcode of plants, the Consortium for the Barcode of Life (CBOL Plant Working Group recommended using as a core the combination of two portions of plastid coding region, rbcL and matK. In this paper, specific markers based on matK sequences were developed for 7 closely related Annona species of agronomic interest (Annona cherimola, A. reticulata, A. squamosa, A. muricata, A. macroprophyllata, A. glabra and A. purpurea and the discrimination power of both rbcL and matK was tested using also sequences of the genus Annona available in the Barcode of Life Database (BOLD data systems. The specific sequences developed allowed the discrimination among all those species tested. Moreover, the primers generated were validated in six additional species of the genus (A. liebmanniana, A. longiflora, A. montana, A. senegalensis, A. emarginata and A. neosalicifolia and in an interspecific hybrid (A. cherimola x A. squamosa. The development of a fast, reliable and economic approach for species identification in these underutilized subtropical fruit crops in a very initial state of domestication is of great importance in order to optimize genetic resource management.

  6. Epinotia cinereana (Haworth, 1811) bona sp., a Holarctic tortricid distinct from E. nisella (Clerck, 1759) (Lepidoptera: Tortricidae: Eucosmini) as evidenced by DNA barcodes, morphology and life history

    DEFF Research Database (Denmark)

    Mutanen, Marko; Aarvik, Leif; Landry, Jean-Francois

    2012-01-01

    DNA barcodes of European tortricid moths identified as Epinotia nisella (Clerck, 1759) were found to comprise two genetically distinct clusters. These coincided with E. nisella and E. cinereana (Haworth, 1811) (sp. rev.), the latter having been considered a synonym of the former for several decades....... Comparing these DNA barcodes with those of North American Epinotia showed that both species are Holarctic. The North American Proteopteryx criddleana Kearfott, 1907 is a new junior synonym of E. cinereana (syn. nov.). The two species also show distinct differences in male and female genitalia. North...... American populations of both species show moderate differences in barcodes from their respective European populations but there are no morphological differences correlated with the intraspecific barcode clusters. Tortrix petrana Hübner, 1813 is considered as a junior synonym of E. cinereana (syn. rev...

  7. A comprehensive DNA barcode database for Central European beetles with a focus on Germany: adding more than 3500 identified species to BOLD.

    Science.gov (United States)

    Hendrich, Lars; Morinière, Jérôme; Haszprunar, Gerhard; Hebert, Paul D N; Hausmann, Axel; Köhler, Frank; Balke, Michael

    2015-07-01

    Beetles are the most diverse group of animals and are crucial for ecosystem functioning. In many countries, they are well established for environmental impact assessment, but even in the well-studied Central European fauna, species identification can be very difficult. A comprehensive and taxonomically well-curated DNA barcode library could remedy this deficit and could also link hundreds of years of traditional knowledge with next generation sequencing technology. However, such a beetle library is missing to date. This study provides the globally largest DNA barcode reference library for Coleoptera for 15 948 individuals belonging to 3514 well-identified species (53% of the German fauna) with representatives from 97 of 103 families (94%). This study is the first comprehensive regional test of the efficiency of DNA barcoding for beetles with a focus on Germany. Sequences ≥500 bp were recovered from 63% of the specimens analysed (15 948 of 25 294) with short sequences from another 997 specimens. Whereas most specimens (92.2%) could be unambiguously assigned to a single known species by sequence diversity at CO1, 1089 specimens (6.8%) were assigned to more than one Barcode Index Number (BIN), creating 395 BINs which need further study to ascertain if they represent cryptic species, mitochondrial introgression, or simply regional variation in widespread species. We found 409 specimens (2.6%) that shared a BIN assignment with another species, most involving a pair of closely allied species as 43 BINs were involved. Most of these taxa were separated by barcodes although sequence divergences were low. Only 155 specimens (0.97%) show identical or overlapping clusters. © 2014 John Wiley & Sons Ltd.

  8. The first initiative of DNA barcoding of ornamental plants from Egypt and potential applications in horticulture industry.

    Science.gov (United States)

    O Elansary, Hosam; Ashfaq, Muhammad; Ali, Hayssam M; Yessoufou, Kowiyou

    2017-01-01

    DNA barcoding relies on short and standardized gene regions to identify species. The agricultural and horticultural applications of barcoding such as for marketplace regulation and copyright protection remain poorly explored. This study examines the effectiveness of the standard plant barcode markers (matK and rbcL) for the identification of plant species in private and public nurseries in northern Egypt. These two markers were sequenced from 225 specimens of 161 species and 62 plant families of horticultural importance. The sequence recovery was similar for rbcL (96.4%) and matK (84%), but the number of specimens assigned correctly to the respective genera and species was lower for rbcL (75% and 29%) than matK (85% and 40%). The combination of rbcL and matK brought the number of correct generic and species assignments to 83.4% and 40%, respectively. Individually, the efficiency of both markers varied among different plant families; for example, all palm specimens (Arecaceae) were correctly assigned to species while only one individual of Asteraceae was correctly assigned to species. Further, barcodes reliably assigned ornamental horticultural and medicinal plants correctly to genus while they showed a lower or no success in assigning these plants to species and cultivars. For future, we recommend the combination of a complementary barcode (e.g. ITS or trnH-psbA) with rbcL + matK to increase the performance of taxa identification. By aiding species identification of horticultural crops and ornamental palms, the analysis of the barcode regions will have large impact on horticultural industry.

  9. Candidate DNA Barcode Tags Combined With High Resolution Melting (Bar-HRM) Curve Analysis for Authentication of Senna alexandrina Mill. With Validation in Crude Drugs.

    Science.gov (United States)

    Mishra, Priyanka; Shukla, Ashutosh K; Sundaresan, Velusamy

    2018-01-01

    Senna alexandrina (Fabaceae) is a globally recognized medicinal plant for its laxative properties as well as the only source of sennosides, and is highly exported bulk herb from India. Its major procurement is exclusively from limited cultivation, which leads to risks of deliberate or unintended adulteration. The market raw materials are in powdered or finished product form, which lead to difficulties in authentication. Here, DNA barcode tags based on chloroplast genes ( rbcL and matK ) and intergenic spacers ( psbA-trnH and ITS ) were developed for S. alexandrina along with the allied species. The ability and performance of the ITS1 region to discriminate among the Senna species resulted in the present proposal of the ITS1 tags as successful barcode. Further, these tags were coupled with high-resolution melting (HRM) curve analysis in a real-time PCR genotyping method to derive Bar-HRM (Barcoding-HRM) assays. Suitable HRM primer sets were designed through SNP detection and mutation scanning in genomic signatures of Senna species. The melting profiles of S. alexandrina and S . italica subsp. micrantha were almost identical and the remaining five species were clearly separated so that they can be differentiated by HRM method. The sensitivity of the method was utilized to authenticate market samples [Herbal Sample Assays (HSAs)]. HSA01 ( S. alexandrina crude drug sample from Bangalore) and HSA06 ( S. alexandrina crude drug sample from Tuticorin, Tamil Nadu, India) were found to be highly contaminated with S . italica subsp. micrantha . Species admixture samples mixed in varying percentage was identified sensitively with detection of contamination as low as 1%. The melting profiles of PCR amplicons are clearly distinct, which enables the authentic differentiation of species by the HRM method. This study reveals that DNA barcoding coupled with HRM is an efficient molecular tool to authenticate Senna herbal products in the market for quality control in the drug supply

  10. Candidate DNA Barcode Tags Combined With High Resolution Melting (Bar-HRM Curve Analysis for Authentication of Senna alexandrina Mill. With Validation in Crude Drugs

    Directory of Open Access Journals (Sweden)

    Priyanka Mishra

    2018-03-01

    Full Text Available Senna alexandrina (Fabaceae is a globally recognized medicinal plant for its laxative properties as well as the only source of sennosides, and is highly exported bulk herb from India. Its major procurement is exclusively from limited cultivation, which leads to risks of deliberate or unintended adulteration. The market raw materials are in powdered or finished product form, which lead to difficulties in authentication. Here, DNA barcode tags based on chloroplast genes (rbcL and matK and intergenic spacers (psbA-trnH and ITS were developed for S. alexandrina along with the allied species. The ability and performance of the ITS1 region to discriminate among the Senna species resulted in the present proposal of the ITS1 tags as successful barcode. Further, these tags were coupled with high-resolution melting (HRM curve analysis in a real-time PCR genotyping method to derive Bar-HRM (Barcoding-HRM assays. Suitable HRM primer sets were designed through SNP detection and mutation scanning in genomic signatures of Senna species. The melting profiles of S. alexandrina and S. italica subsp. micrantha were almost identical and the remaining five species were clearly separated so that they can be differentiated by HRM method. The sensitivity of the method was utilized to authenticate market samples [Herbal Sample Assays (HSAs]. HSA01 (S. alexandrina crude drug sample from Bangalore and HSA06 (S. alexandrina crude drug sample from Tuticorin, Tamil Nadu, India were found to be highly contaminated with S. italica subsp. micrantha. Species admixture samples mixed in varying percentage was identified sensitively with detection of contamination as low as 1%. The melting profiles of PCR amplicons are clearly distinct, which enables the authentic differentiation of species by the HRM method. This study reveals that DNA barcoding coupled with HRM is an efficient molecular tool to authenticate Senna herbal products in the market for quality control in the drug

  11. Illegal trade of regulated and protected aquatic species in the Philippines detected by DNA barcoding.

    Science.gov (United States)

    Asis, Angelli Marie Jacynth M; Lacsamana, Joanne Krisha M; Santos, Mudjekeewis D

    2016-01-01

    Illegal trade has greatly affected marine fish stocks, decreasing fish populations worldwide. Despite having a number of aquatic species being regulated, illegal trade still persists through the transport of dried or processed products and juvenile species trafficking. In this regard, accurate species identification of illegally traded marine fish stocks by DNA barcoding is deemed to be a more efficient method in regulating and monitoring trade than by morphological means which is very difficult due to the absence of key morphological characters in juveniles and processed products. Here, live juvenile eels (elvers) and dried products of sharks and rays confiscated for illegal trade were identified. Twenty out of 23 (87%) randomly selected "elvers" were identified as Anguilla bicolor pacifica and 3 (13%) samples as Anguilla marmorata. On the other hand, 4 out of 11 (36%) of the randomly selected dried samples of sharks and rays were Manta birostris. The rest of the samples were identified as Alopias pelagicus, Taeniura meyeni, Carcharhinus falciformis, Himantura fai and Mobula japonica. These results confirm that wild juvenile eels and species of manta rays are still being caught in the country regardless of its protected status under Philippine and international laws. It is evident that the illegal trade of protected aquatic species is happening in the guise of dried or processed products thus the need to put emphasis on strengthening conservation measures. This study aims to underscore the importance of accurate species identification in such cases of illegal trade and the effectivity of DNA barcoding as a tool to do this.

  12. Tetrodotoxin detection and species identification of pufferfish in retail roasted fish fillet by DNA barcoding in China.

    Science.gov (United States)

    Li, Nan; Shen, Qing; Wang, Jiahui; Han, Chunhui; Ji, Rong; Li, Fengqin; Jiang, Tao

    2015-01-01

    This study identifies the pufferfish species and detects tetrodotoxin (TTX) in roasted fish fillet samples collected in Beijing, Qingdao and Xiamen, China. The cytochrome c oxidase I (COI) gene was used as the target gene for identification of the pufferfish species in the samples. Enzyme-linked immunosorbent assay (ELISA) screened the TTX levels in samples that had been detected as containing pufferfish by DNA barcode. A total of 125 samples were identified by DNA barcodes; 32 (26%) samples contained pufferfish composition and, among them, 26 (81%) were the highly toxic species Lagocephalus lunaris. All 32 samples containing the pufferfish composition were positive for TTX with levels ranging from 100 to 63,800 ng g(-1). Most of the 32 samples contained the highly toxic L. lunaris. Based on the results, we suggest that the monitoring of roasted fish fillet should be strengthened and the processing procedures should be standardised to minimise TTX poisoning caused by pufferfish.

  13. DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences.

    Science.gov (United States)

    Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh

    2017-04-01

    The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.

  14. International Barcode of Life: Focus on big biodiversity in South Africa.

    Science.gov (United States)

    Adamowicz, Sarah J; Hollingsworth, Peter M; Ratnasingham, Sujeevan; van der Bank, Michelle

    2017-11-01

    Participants in the 7th International Barcode of Life Conference (Kruger National Park, South Africa, 20-24 November 2017) share the latest findings in DNA barcoding research and its increasingly diversified applications. Here, we review prevailing trends synthesized from among 429 invited and contributed abstracts, which are collated in this open-access special issue of Genome. Hosted for the first time on the African continent, the 7th Conference places special emphasis on the evolutionary origins, biogeography, and conservation of African flora and fauna. Within Africa and elsewhere, DNA barcoding and related techniques are being increasingly used for wildlife forensics and for the validation of commercial products, such as medicinal plants and seafood species. A striking trend of the conference is the dramatic rise of studies on environmental DNA (eDNA) and on diverse uses of high-throughput sequencing techniques. Emerging techniques in these areas are opening new avenues for environmental biomonitoring, managing species-at-risk and invasive species, and revealing species interaction networks in unprecedented detail. Contributors call for the development of validated community standards for high-throughput sequence data generation and analysis, to enable the full potential of these methods to be realized for understanding and managing biodiversity on a global scale.

  15. Using DNA-barcoding to make the necrobiont beetle family Cholevidae accessible for forensic entomology.

    Science.gov (United States)

    Schilthuizen, Menno; Scholte, Cindy; van Wijk, Renske E J; Dommershuijzen, Jessy; van der Horst, Devi; Zu Schlochtern, Melanie Meijer; Lievers, Rik; Groenenberg, Dick S J

    2011-07-15

    The beetle family Cholevidae (Coleoptera: Staphylinoidea), sometimes viewed as the subfamily Cholevinae of the Leiodidae, consists of some 1700 species worldwide. With the exception of specialized cave-dwelling species and species living in bird and mammal nests and burrows, the species are generalized soil-dwellers that, at least in temperate regions, are mostly found on vertebrate cadavers. Although they have been regularly reported from human corpses, and offer potential because of many species' peak activity in the cold season, they have not been a focus of forensic entomologists so far. This is probably due to their small size and the difficulty in identifying the adults and their larvae. In this paper, we show that DNA-barcoding can help make this group of necrobiont beetles available as a tool for forensic research. We collected 86 specimens of 20 species of the genera Catops, Fissocatops, Apocatops, Choleva, Nargus, Ptomaphagus, and Sciodrepoides from the Netherlands and France and show that a broad "barcoding gap" allows almost all species to be easily and unambiguously identified by the sequence of the "barcoding gene" cytochrome c oxidase I (COI). This opens up the possibility of adding Cholevidae to the set of insect taxa routinely used in forensic entomology. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  16. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  17. Qualitative assessment of the diet of European eel larvae in the Sargasso Sea resolved by DNA barcoding

    DEFF Research Database (Denmark)

    Riemann, L.; Alfredsson, H.; Hansen, Michael Møller

    2010-01-01

    , the Sargasso Sea is oligotrophic, with generally low plankton biomass, and the feeding biology of eel larvae has so far remained a mystery, hampering understanding of this peculiar life history. DNA barcoding of gut contents of 61 genetically identified A. anguilla larvae caught in the Sargasso Sea showed...

  18. DNA barcoding of gypsy moths from China (Lepidoptera: Erebidae) reveals new haplotypes and divergence patterns within gypsy moth subspecies

    Science.gov (United States)

    Fang Chen; Youqing Luo; Melody A. Keena; Ying Wu; Peng Wu; Juan Shi

    2015-01-01

    The gypsy moth from Asia (two subspecies) is considered a greater threat to North America than European gypsy moth, because of a broader host range and females being capable of flight. Variation within and among gypsy moths from China (nine locations), one of the native countries of Asian gypsy moth, were compared using DNA barcode sequences (658 bp of mtDNA cytochrome...

  19. ITS and trnH-psbA as Efficient DNA Barcodes to Identify Threatened Commercial Woody Angiosperms from Southern Brazilian Atlantic Rainforests.

    Science.gov (United States)

    Bolson, Mônica; Smidt, Eric de Camargo; Brotto, Marcelo Leandro; Silva-Pereira, Viviane

    2015-01-01

    The Araucaria Forests in southern Brazil are part of the Atlantic Rainforest, a key hotspot for global biodiversity. This habitat has experienced extensive losses of vegetation cover due to commercial logging and the intense use of wood resources for construction and furniture manufacturing. The absence of precise taxonomic tools for identifying Araucaria Forest tree species motivated us to test the ability of DNA barcoding to distinguish species exploited for wood resources and its suitability for use as an alternative testing technique for the inspection of illegal timber shipments. We tested three cpDNA regions (matK, trnH-psbA, and rbcL) and nrITS according to criteria determined by The Consortium for the Barcode of Life (CBOL). The efficiency of each marker and selected marker combinations were evaluated for 30 commercially valuable woody species in multiple populations, with a special focus on Lauraceae species. Inter- and intraspecific distances, species discrimination rates, and ability to recover species-specific clusters were evaluated. Among the regions and different combinations, ITS was the most efficient for identifying species based on the 'best close match' test; similarly, the trnH-psbA + ITS combination also demonstrated satisfactory results. When combining trnH-psbA + ITS, Maximum Likelihood analysis demonstrated a more resolved topology for internal branches, with 91% of species-specific clusters. DNA barcoding was found to be a practical and rapid method for identifying major threatened woody angiosperms from Araucaria Forests such as Lauraceae species, presenting a high confidence for recognizing members of Ocotea. These molecular tools can assist in screening those botanical families that are most targeted by the timber industry in southern Brazil and detecting certain species protected by Brazilian legislation and could be a useful tool for monitoring wood exploitation.

  20. Monitoring an alien invasion: DNA barcoding and the identification of lionfish and their prey on coral reefs of the Mexican Caribbean.

    Science.gov (United States)

    Valdez-Moreno, Martha; Quintal-Lizama, Carolina; Gómez-Lozano, Ricardo; García-Rivas, María Del Carmen

    2012-01-01

    In the Mexican Caribbean, the exotic lionfish Pterois volitans has become a species of great concern because of their predatory habits and rapid expansion onto the Mesoamerican coral reef, the second largest continuous reef system in the world. This is the first report of DNA identification of stomach contents of lionfish using the barcode of life reference database (BOLD). We confirm with barcoding that only Pterois volitans is apparently present in the Mexican Caribbean. We analyzed the stomach contents of 157 specimens of P. volitans from various locations in the region. Based on DNA matches in the Barcode of Life Database (BOLD) and GenBank, we identified fishes from five orders, 14 families, 22 genera and 34 species in the stomach contents. The families with the most species represented were Gobiidae and Apogonidae. Some prey taxa are commercially important species. Seven species were new records for the Mexican Caribbean: Apogon mosavi, Coryphopterus venezuelae, C. thrix, C. tortugae, Lythrypnus minimus, Starksia langi and S. ocellata. DNA matches, as well as the presence of intact lionfish in the stomach contents, indicate some degree of cannibalism, a behavior confirmed in this species by the first time. We obtained 45 distinct crustacean prey sequences, from which only 20 taxa could be identified from the BOLD and GenBank databases. The matches were primarily to Decapoda but only a single taxon could be identified to the species level, Euphausia americana. This technique proved to be an efficient and useful method, especially since prey species could be identified from partially-digested remains. The primary limitation is the lack of comprehensive coverage of potential prey species in the region in the BOLD and GenBank databases, especially among invertebrates.

  1. Monitoring an alien invasion: DNA barcoding and the identification of lionfish and their prey on coral reefs of the Mexican Caribbean.

    Directory of Open Access Journals (Sweden)

    Martha Valdez-Moreno

    Full Text Available BACKGROUND: In the Mexican Caribbean, the exotic lionfish Pterois volitans has become a species of great concern because of their predatory habits and rapid expansion onto the Mesoamerican coral reef, the second largest continuous reef system in the world. This is the first report of DNA identification of stomach contents of lionfish using the barcode of life reference database (BOLD. METHODOLOGY/PRINCIPAL FINDINGS: We confirm with barcoding that only Pterois volitans is apparently present in the Mexican Caribbean. We analyzed the stomach contents of 157 specimens of P. volitans from various locations in the region. Based on DNA matches in the Barcode of Life Database (BOLD and GenBank, we identified fishes from five orders, 14 families, 22 genera and 34 species in the stomach contents. The families with the most species represented were Gobiidae and Apogonidae. Some prey taxa are commercially important species. Seven species were new records for the Mexican Caribbean: Apogon mosavi, Coryphopterus venezuelae, C. thrix, C. tortugae, Lythrypnus minimus, Starksia langi and S. ocellata. DNA matches, as well as the presence of intact lionfish in the stomach contents, indicate some degree of cannibalism, a behavior confirmed in this species by the first time. We obtained 45 distinct crustacean prey sequences, from which only 20 taxa could be identified from the BOLD and GenBank databases. The matches were primarily to Decapoda but only a single taxon could be identified to the species level, Euphausia americana. CONCLUSIONS/SIGNIFICANCE: This technique proved to be an efficient and useful method, especially since prey species could be identified from partially-digested remains. The primary limitation is the lack of comprehensive coverage of potential prey species in the region in the BOLD and GenBank databases, especially among invertebrates.

  2. Monitoring an Alien Invasion: DNA Barcoding and the Identification of Lionfish and Their Prey on Coral Reefs of the Mexican Caribbean

    Science.gov (United States)

    Valdez-Moreno, Martha; Quintal-Lizama, Carolina; Gómez-Lozano, Ricardo; García-Rivas, María del Carmen

    2012-01-01

    Background In the Mexican Caribbean, the exotic lionfish Pterois volitans has become a species of great concern because of their predatory habits and rapid expansion onto the Mesoamerican coral reef, the second largest continuous reef system in the world. This is the first report of DNA identification of stomach contents of lionfish using the barcode of life reference database (BOLD). Methodology/Principal Findings We confirm with barcoding that only Pterois volitans is apparently present in the Mexican Caribbean. We analyzed the stomach contents of 157 specimens of P. volitans from various locations in the region. Based on DNA matches in the Barcode of Life Database (BOLD) and GenBank, we identified fishes from five orders, 14 families, 22 genera and 34 species in the stomach contents. The families with the most species represented were Gobiidae and Apogonidae. Some prey taxa are commercially important species. Seven species were new records for the Mexican Caribbean: Apogon mosavi, Coryphopterus venezuelae, C. thrix, C. tortugae, Lythrypnus minimus, Starksia langi and S. ocellata. DNA matches, as well as the presence of intact lionfish in the stomach contents, indicate some degree of cannibalism, a behavior confirmed in this species by the first time. We obtained 45 distinct crustacean prey sequences, from which only 20 taxa could be identified from the BOLD and GenBank databases. The matches were primarily to Decapoda but only a single taxon could be identified to the species level, Euphausia americana. Conclusions/Significance This technique proved to be an efficient and useful method, especially since prey species could be identified from partially-digested remains. The primary limitation is the lack of comprehensive coverage of potential prey species in the region in the BOLD and GenBank databases, especially among invertebrates. PMID:22675470

  3. ITS and trnH-psbA as Efficient DNA Barcodes to Identify Threatened Commercial Woody Angiosperms from Southern Brazilian Atlantic Rainforests.

    Directory of Open Access Journals (Sweden)

    Mônica Bolson

    Full Text Available The Araucaria Forests in southern Brazil are part of the Atlantic Rainforest, a key hotspot for global biodiversity. This habitat has experienced extensive losses of vegetation cover due to commercial logging and the intense use of wood resources for construction and furniture manufacturing. The absence of precise taxonomic tools for identifying Araucaria Forest tree species motivated us to test the ability of DNA barcoding to distinguish species exploited for wood resources and its suitability for use as an alternative testing technique for the inspection of illegal timber shipments. We tested three cpDNA regions (matK, trnH-psbA, and rbcL and nrITS according to criteria determined by The Consortium for the Barcode of Life (CBOL. The efficiency of each marker and selected marker combinations were evaluated for 30 commercially valuable woody species in multiple populations, with a special focus on Lauraceae species. Inter- and intraspecific distances, species discrimination rates, and ability to recover species-specific clusters were evaluated. Among the regions and different combinations, ITS was the most efficient for identifying species based on the 'best close match' test; similarly, the trnH-psbA + ITS combination also demonstrated satisfactory results. When combining trnH-psbA + ITS, Maximum Likelihood analysis demonstrated a more resolved topology for internal branches, with 91% of species-specific clusters. DNA barcoding was found to be a practical and rapid method for identifying major threatened woody angiosperms from Araucaria Forests such as Lauraceae species, presenting a high confidence for recognizing members of Ocotea. These molecular tools can assist in screening those botanical families that are most targeted by the timber industry in southern Brazil and detecting certain species protected by Brazilian legislation and could be a useful tool for monitoring wood exploitation.

  4. A test of the utility of DNA barcoding in the radiation of the freshwater stingray genus Potamotrygon (Potamotrygonidae, Myliobatiformes

    Directory of Open Access Journals (Sweden)

    Daniel Toffoli

    2008-01-01

    Full Text Available DNA barcoding is a recently proposed global standard in taxonomy based on DNA sequences. The two main goals of DNA barcoding methodology are assignment of specimens to a species and discovery of new species. There are two main underlying assumptions: i reciprocal monophyly of species, and ii intraspecific divergence is always less than interspecific divergence. Here we present a phylogenetic analysis of the family Potamotrygonidae based on mitochondrial cytochrome c oxidase I gene, sampling 10 out of the 18 to 20 valid species including two non-described species. Potamotrygonidae systematics is still not fully resolved with several still-to-be-described species while some other species are difficult to delimit due to overlap in morphological characters and because of sharing a complex color patterns. Our results suggest that the family passed through a process of rapid speciation and that the species Potamotrygon motoro, P. scobina, and P. orbignyi share haplotypes extensively. Our results suggest that systems of identification of specimens based on DNA sequences, together with morphological and/or ecological characters, can aid taxonomic studies, but delimitation of new species based on threshold values of genetic distances are overly simplistic and misleading.

  5. The loci recommended as universal barcodes for plants on the basis of floristic studies may not work with congeneric species as exemplified by DNA barcoding of Dendrobium species

    Directory of Open Access Journals (Sweden)

    Singh Hemant

    2012-01-01

    Full Text Available Abstract Background Based on the testing of several loci, predominantly against floristic backgrounds, individual or different combinations of loci have been suggested as possible universal DNA barcodes for plants. The present investigation was undertaken to check the applicability of the recommended locus/loci for congeneric species with Dendrobium species as an illustrative example. Results Six loci, matK, rbcL, rpoB, rpoC1, trnH-psbA spacer from the chloroplast genome and ITS, from the nuclear genome, were compared for their amplification, sequencing and species discrimination success rates among multiple accessions of 36 Dendrobium species. The trnH-psbA spacer could not be considered for analysis as good quality sequences were not obtained with its forward primer. Among the tested loci, ITS, recommended by some as a possible barcode for plants, provided 100% species identification. Another locus, matK, also recommended as a universal barcode for plants, resolved 80.56% species. ITS remained the best even when sequences of investigated loci of additional Dendrobium species available on the NCBI GenBank (93, 33, 20, 18 and 17 of ITS, matK, rbcL, rpoB and rpoC1, respectively were also considered for calculating the percent species resolution capabilities. The species discrimination of various combinations of the loci was also compared based on the 36 investigated species and additional 16 for which sequences of all the five loci were available on GenBank. Two-locus combination of matK+rbcL recommended by the Plant Working Group of Consortium for Barcoding of Life (CBOL could discriminate 86.11% of 36 species. The species discriminating ability of this barcode was reduced to 80.77% when additional sequences available on NCBI were included in the analysis. Among the recommended combinations, the barcode based on three loci - matK, rpoB and rpoC1- resolved maximum number of species. Conclusions Any recommended barcode based on the loci tested so

  6. The loci recommended as universal barcodes for plants on the basis of floristic studies may not work with congeneric species as exemplified by DNA barcoding of Dendrobium species.

    Science.gov (United States)

    Singh, Hemant Kumar; Parveen, Iffat; Raghuvanshi, Saurabh; Babbar, Shashi B

    2012-01-19

    Based on the testing of several loci, predominantly against floristic backgrounds, individual or different combinations of loci have been suggested as possible universal DNA barcodes for plants. The present investigation was undertaken to check the applicability of the recommended locus/loci for congeneric species with Dendrobium species as an illustrative example. Six loci, matK, rbcL, rpoB, rpoC1, trnH-psbA spacer from the chloroplast genome and ITS, from the nuclear genome, were compared for their amplification, sequencing and species discrimination success rates among multiple accessions of 36 Dendrobium species. The trnH-psbA spacer could not be considered for analysis as good quality sequences were not obtained with its forward primer. Among the tested loci, ITS, recommended by some as a possible barcode for plants, provided 100% species identification. Another locus, matK, also recommended as a universal barcode for plants, resolved 80.56% species. ITS remained the best even when sequences of investigated loci of additional Dendrobium species available on the NCBI GenBank (93, 33, 20, 18 and 17 of ITS, matK, rbcL, rpoB and rpoC1, respectively) were also considered for calculating the percent species resolution capabilities. The species discrimination of various combinations of the loci was also compared based on the 36 investigated species and additional 16 for which sequences of all the five loci were available on GenBank. Two-locus combination of matK+rbcL recommended by the Plant Working Group of Consortium for Barcoding of Life (CBOL) could discriminate 86.11% of 36 species. The species discriminating ability of this barcode was reduced to 80.77% when additional sequences available on NCBI were included in the analysis. Among the recommended combinations, the barcode based on three loci - matK, rpoB and rpoC1- resolved maximum number of species. Any recommended barcode based on the loci tested so far, is not likely to provide 100% species identification

  7. DNA barcode for the identification of the sand fly Lutzomyia longipalpis plant feeding preferences in a tropical urban environment.

    Science.gov (United States)

    Lima, Leonardo H G de M; Mesquita, Marcelo R; Skrip, Laura; de Souza Freitas, Moisés T; Silva, Vladimir C; Kirstein, Oscar D; Abassi, Ibrahim; Warburg, Alon; Balbino, Valdir de Q; Costa, Carlos H N

    2016-07-20

    Little is known about the feeding behavior of hematophagous insects that require plant sugar to complete their life cycles. We studied plant feeding of Lutzomyia longipalpis sand flies, known vectors of Leishmania infantum/chagasi parasites, in a Brazilian city endemic with visceral leishmaniasis. The DNA barcode technique was applied to identify plant food source of wild-caught L. longipalpis using specific primers for a locus from the chloroplast genome, ribulose diphosphate carboxylase. DNA from all trees or shrubs within a 100-meter radius from the trap were collected to build a barcode reference library. While plants from the Anacardiaceae and Meliaceae families were the most abundant at the sampling site (25.4% and 12.7% of the local plant population, respectively), DNA from these plant families was found in few flies; in contrast, despite its low abundance (2.9%), DNA from the Fabaceae family was detected in 94.7% of the sand flies. The proportion of sand flies testing positive for DNA from a given plant family was not significantly associated with abundance, distance from the trap, or average crown expansion of plants from that family. The data suggest that there may indeed be a feeding preference of L. longipalpis for plants in the Fabaceae family.

  8. Using high-throughput barcode sequencing to efficiently map connectomes.

    Science.gov (United States)

    Peikon, Ian D; Kebschull, Justus M; Vagin, Vasily V; Ravens, Diana I; Sun, Yu-Chi; Brouzes, Eric; Corrêa, Ivan R; Bressan, Dario; Zador, Anthony M

    2017-07-07

    The function of a neural circuit is determined by the details of its synaptic connections. At present, the only available method for determining a neural wiring diagram with single synapse precision-a 'connectome'-is based on imaging methods that are slow, labor-intensive and expensive. Here, we present SYNseq, a method for converting the connectome into a form that can exploit the speed and low cost of modern high-throughput DNA sequencing. In SYNseq, each neuron is labeled with a unique random nucleotide sequence-an RNA 'barcode'-which is targeted to the synapse using engineered proteins. Barcodes in pre- and postsynaptic neurons are then associated through protein-protein crosslinking across the synapse, extracted from the tissue, and joined into a form suitable for sequencing. Although our failure to develop an efficient barcode joining scheme precludes the widespread application of this approach, we expect that with further development SYNseq will enable tracing of complex circuits at high speed and low cost. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Discovering hidden biodiversity: The use of complementary monitoring of fish diet based on DNA barcoding in freshwater ecosystems

    DEFF Research Database (Denmark)

    Jo, Hyunbin; Ventura, Marc; Vidal, Nicolas

    2015-01-01

    analysis showed greater accuracy, yielding a 1.4-fold higher number of OTUs. Rarefaction curve analysis showed saturation of visually inspected taxa, while the curves from the DNA barcode did not saturate. The OTUs with the highest proportions of haplotypes were the families of terrestrial insects...

  10. Searching for evidence of selection in avian DNA barcodes.

    Science.gov (United States)

    Kerr, Kevin C R

    2011-11-01

    The barcode of life project has assembled a tremendous number of mitochondrial cytochrome c oxidase I (COI) sequences. Although these sequences were gathered to develop a DNA-based system for species identification, it has been suggested that further biological inferences may also be derived from this wealth of data. Recurrent selective sweeps have been invoked as an evolutionary mechanism to explain limited intraspecific COI diversity, particularly in birds, but this hypothesis has not been formally tested. In this study, I collated COI sequences from previous barcoding studies on birds and tested them for evidence of selection. Using this expanded data set, I re-examined the relationships between intraspecific diversity and interspecific divergence and sampling effort, respectively. I employed the McDonald-Kreitman test to test for neutrality in sequence evolution between closely related pairs of species. Because amino acid sequences were generally constrained between closely related pairs, I also included broader intra-order comparisons to quantify patterns of protein variation in avian COI sequences. Lastly, using 22 published whole mitochondrial genomes, I compared the evolutionary rate of COI against the other 12 protein-coding mitochondrial genes to assess intragenomic variability. I found no conclusive evidence of selective sweeps. Most evidence pointed to an overall trend of strong purifying selection and functional constraint. The COI protein did vary across the class Aves, but to a very limited extent. COI was the least variable gene in the mitochondrial genome, suggesting that other genes might be more informative for probing factors constraining mitochondrial variation within species. © 2011 Blackwell Publishing Ltd.

  11. Contrasting morphological and DNA barcode-suggested species boundaries among shallow-water amphipod fauna from the southern European Atlantic coast.

    Science.gov (United States)

    Lobo, Jorge; Ferreira, Maria S; Antunes, Ilisa C; Teixeira, Marcos A L; Borges, Luisa M S; Sousa, Ronaldo; Gomes, Pedro A; Costa, Maria Helena; Cunha, Marina R; Costa, Filipe O

    2017-02-01

    In this study we compared DNA barcode-suggested species boundaries with morphology-based species identifications in the amphipod fauna of the southern European Atlantic coast. DNA sequences of the cytochrome c oxidase subunit I barcode region (COI-5P) were generated for 43 morphospecies (178 specimens) collected along the Portuguese coast which, together with publicly available COI-5P sequences, produced a final dataset comprising 68 morphospecies and 295 sequences. Seventy-five BINs (Barcode Index Numbers) were assigned to these morphospecies, of which 48 were concordant (i.e., 1 BIN = 1 species), 8 were taxonomically discordant, and 19 were singletons. Twelve species had matching sequences (<2% distance) with conspecifics from distant locations (e.g., North Sea). Seven morphospecies were assigned to multiple, and highly divergent, BINs, including specimens of Corophium multisetosum (18% divergence) and Dexamine spiniventris (16% divergence), which originated from sampling locations on the west coast of Portugal (only about 36 and 250 km apart, respectively). We also found deep divergence (4%-22%) among specimens of seven species from Portugal compared to those from the North Sea and Italy. The detection of evolutionarily meaningful divergence among populations of several amphipod species from southern Europe reinforces the need for a comprehensive re-assessment of the diversity of this faunal group.

  12. Genetic patterns in European geometrid moths revealed by the Barcode Index Number (BIN system.

    Directory of Open Access Journals (Sweden)

    Axel Hausmann

    Full Text Available BACKGROUND: The geometrid moths of Europe are one of the best investigated insect groups in traditional taxonomy making them an ideal model group to test the accuracy of the Barcode Index Number (BIN system of BOLD (Barcode of Life Datasystems, a method that supports automated, rapid species delineation and identification. METHODOLOGY/PRINCIPAL FINDINGS: This study provides a DNA barcode library for 219 of the 249 European geometrid moth species (88% in five selected subfamilies. The data set includes COI sequences for 2130 specimens. Most species (93% were found to possess diagnostic barcode sequences at the European level while only three species pairs (3% were genetically indistinguishable in areas of sympatry. As a consequence, 97% of the European species we examined were unequivocally discriminated by barcodes within their natural areas of distribution. We found a 1:1 correspondence between BINs and traditionally recognized species for 67% of these species. Another 17% of the species (15 pairs, three triads shared BINs, while specimens from the remaining species (18% were divided among two or more BINs. Five of these species are mixtures, both sharing and splitting BINs. For 82% of the species with two or more BINs, the genetic splits involved allopatric populations, many of which have previously been hypothesized to represent distinct species or subspecies. CONCLUSIONS/SIGNIFICANCE: This study confirms the effectiveness of DNA barcoding as a tool for species identification and illustrates the potential of the BIN system to characterize formal genetic units independently of an existing classification. This suggests the system can be used to efficiently assess the biodiversity of large, poorly known assemblages of organisms. For the moths examined in this study, cases of discordance between traditionally recognized species and BINs arose from several causes including overlooked species, synonymy, and cases where DNA barcodes revealed

  13. Who’s there? – First morphological and DNA barcoding catalogue of the shallow Hawai’ian sponge fauna

    Science.gov (United States)

    Gates, Ruth D.

    2017-01-01

    The sponge fauna has been largely overlooked in the Archipelago of Hawai’i, notwithstanding the paramount role of this taxon in marine ecosystems. The lack of knowledge about Porifera populations inhabiting the Hawai’ian reefs limits the development of ecological studies aimed at understanding the functioning of these marine systems. Consequently, this project addresses this gap by describing the most representative sponge species in the shallow waters of the enigmatic bay of Kane’ohe Bay, in O’ahu Island. A total of 30 species (28 demosponges and two calcareous sponges) living associated to the reef structures are here reported. Six of these species are new records to the Hawai’ian Porifera catalogue and are suspected to be recent introductions to these islands. Morphological descriptions of the voucher specimens are provided, along with sequencing data of two partitions involving the mitochondrial cytochrome oxidase subunit 1 (COI) marker and a fragment covering partial (18S and 28S) and full (ITS-1, 5.8S and ITS-2) nuclear ribosomal genes. Species delimitations based on genetic distances were calculated to valitate how taxonomic assignments from DNA barcoding aligned with morphological identifications. Of the 60 sequences submitted to GenBank ~88% are the first sequencing records for the corresponding species and genetic marker. This work compiles the first catalogue combining morphological characters with DNA barcoding of Hawai’ian sponges, and contributes to the repository of public databases through the Sponge Barcoding Project initiative. PMID:29267311

  14. DNA barcodes and molecular diagnostics to distinguish an introduced and native Laricobius (Coleoptera: Derodontidae) species in eastern North America

    Science.gov (United States)

    G.A. Davis; N.P. Havill; Z.N. Adelman; A. Caccone; L.T. Kok; S.M. Salom

    2011-01-01

    Molecular diagnostics based on DNA barcodes can be powerful identification tools in the absence of distinctive morphological characters for distinguishing between closely related species. A specific example is distinguishing the endemic species Laricobius rubidus from Laricobius nigrinus, a biological control agent of hemlock...

  15. DNA barcodes effectively identify the morphologically similar Common Opossum (Didelphis marsupialis) and Virginia Opossum (Didelphis virginiana) from areas of sympatry in Mexico.

    Science.gov (United States)

    Cervantes, Fernando A; Arcangeli, Jésica; Hortelano-Moncada, Yolanda; Borisenko, Alex V

    2010-12-01

    Two morphologically similar species of opossum from the genus Didelphis-Didelphis virginiana and Didelphis marsupialis-cooccur sympatrically in Mexico. High intraspecific variation complicates their morphological discrimination, under both field and museum conditions. This study aims to evaluate the utility and reliability of using DNA barcodes (short standardized genome fragments used for DNA-based identification) to distinguish these two species. Sequences of the cytochrome c oxidase subunit I (Cox1) mitochondrial gene were obtained from 12 D. marsupialis and 29 D. virginiana individuals and were compared using the neighbor-joining (NJ) algorithm with Kimura's two-parameter (K2P) model of nucleotide substitution. Average K2P distances were 1.56% within D. virginiana and 1.65% in D. marsupialis. Interspecific distances between D. virginiana and D. marsupialis varied from 7.8 to 9.3% and their barcode sequences formed distinct non-overlapping clusters on NJ trees. All sympatric specimens of both species were effectively discriminated, confirming the utility of Cox1 barcoding as a tool for taxonomic identification of these morphologically similar taxa.

  16. Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples.

    Science.gov (United States)

    Arulandhu, Alfred J; Staats, Martijn; Hagelaar, Rico; Voorhuijzen, Marleen M; Prins, Theo W; Scholtens, Ingrid; Costessi, Adalberto; Duijsings, Danny; Rechenmann, François; Gaspar, Frédéric B; Barreto Crespo, Maria Teresa; Holst-Jensen, Arne; Birck, Matthew; Burns, Malcolm; Haynes, Edward; Hochegger, Rupert; Klingl, Alexander; Lundberg, Lisa; Natale, Chiara; Niekamp, Hauke; Perri, Elena; Barbante, Alessandra; Rosec, Jean-Philippe; Seyfarth, Ralf; Sovová, Tereza; Van Moorleghem, Christoff; van Ruth, Saskia; Peelen, Tamara; Kok, Esther

    2017-10-01

    DNA metabarcoding provides great potential for species identification in complex samples such as food supplements and traditional medicines. Such a method would aid Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) enforcement officers to combat wildlife crime by preventing illegal trade of endangered plant and animal species. The objective of this research was to develop a multi-locus DNA metabarcoding method for forensic wildlife species identification and to evaluate the applicability and reproducibility of this approach across different laboratories. A DNA metabarcoding method was developed that makes use of 12 DNA barcode markers that have demonstrated universal applicability across a wide range of plant and animal taxa and that facilitate the identification of species in samples containing degraded DNA. The DNA metabarcoding method was developed based on Illumina MiSeq amplicon sequencing of well-defined experimental mixtures, for which a bioinformatics pipeline with user-friendly web-interface was developed. The performance of the DNA metabarcoding method was assessed in an international validation trial by 16 laboratories, in which the method was found to be highly reproducible and sensitive enough to identify species present in a mixture at 1% dry weight content. The advanced multi-locus DNA metabarcoding method assessed in this study provides reliable and detailed data on the composition of complex food products, including information on the presence of CITES-listed species. The method can provide improved resolution for species identification, while verifying species with multiple DNA barcodes contributes to an enhanced quality assurance. © The Authors 2017. Published by Oxford University Press.

  17. Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building.

    Science.gov (United States)

    Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

    2018-04-01

    Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.

  18. DNA barcoding and traditional taxonomy unified through Integrative Taxonomy: a view that challenges the debate questioning both methodologies

    OpenAIRE

    Pires, Amanda Ciprandi; Marinoni, Luciane

    2010-01-01

    The taxonomic crisis, emphasized in recent years, is marked by the lack of popularity (lack of interest in taxonomy) and financial incentives to study biodiversity. This situation, coupled with the issues involved with the necessity of knowing many yet undiscovered species, has meant that new technologies, including the use of DNA, have emerged to revitalize taxonomy. Part of the scientific community, however, has rejected the use of these innovative ideas. DNA barcoding has especially been t...

  19. Authenticity analyses of Phyllanthus amarus using barcoding coupled with HRM analysis to control its quality for medicinal plant product.

    Science.gov (United States)

    Buddhachat, Kittisak; Osathanunkul, Maslin; Madesis, Panagiotis; Chomdej, Siriwadee; Ongchai, Siriwan

    2015-11-15

    The Phyllanthus genus, a plant used in traditional Thai medicine, has according to several pharmacopeias hepatoprotective properties. Not only is the anatomical morphology of these species relatively similar but they also share the Thai common names Look-Tai-Bai (ลูกใต้ใบ) and Yah-Tai-Bai (หญ้าใต้ใบ), which might cause confusion for laypersons. This study attempted to develop a method for accurate identification of Phyllanthus species, especially Phyllanthus amarus, and to detect contaminants in P. amarus products by using DNA barcoding coupled with high resolution melting (HRM) analysis (bar-HRM). Two plastid loci (rbcL and trnL) were chosen for DNA barcoding to generate a suitable primer for distinguishing Phyllanthus species by HRM analysis. The five species of Phyllanthus were subjected to amplification for testing the specificity and discrimination power of the designed primers derived from rbcL and trnL regions. Sensitivity of the method (DNA barcoding conjugated with HRM) to detect adulterant in P. amarus samples was evaluated. The commercial P. amarus products obtained from a local market were authenticated. The primer pair derived from trnL DNA barcoding (PhylltrnL) had more specificity and power of discrimination for Phyllanthus species than that derived from rbcL DNA barcoding (PhyllrbcL). The result showed that Tm of P. amarus, Phyllanthus urinaria, Phyllanthus debilis, Phyllanthus airy-shawii, and Phyllanthus virgatus was 74.3±0.08, 73.04±0.07, 73.36±0.05, 72.21±0.06, 72.77±0.15°C, respectively. This method proved to be a very sensitive tool that can be used for rapid detection of contamination as low as 1% of other Phyllanthus species in P. amarus admixtures. All commercial products of P. amarus obtained from a local market in Thailand were found to contain pure raw materials of P. amarus without any substitution or contamination. Our results indicated that the use of DNA barcoding coupled with HRM was an

  20. Barcoding the food chain: from Sanger to high-throughput sequencing.

    Science.gov (United States)

    Littlefair, Joanne E; Clare, Elizabeth L

    2016-11-01

    Society faces the complex challenge of supporting biodiversity and ecosystem functioning, while ensuring food security by providing safe traceable food through an ever-more-complex global food chain. The increase in human mobility brings the added threat of pests, parasites, and invaders that further complicate our agro-industrial efforts. DNA barcoding technologies allow researchers to identify both individual species, and, when combined with universal primers and high-throughput sequencing techniques, the diversity within mixed samples (metabarcoding). These tools are already being employed to detect market substitutions, trace pests through the forensic evaluation of trace "environmental DNA", and to track parasitic infections in livestock. The potential of DNA barcoding to contribute to increased security of the food chain is clear, but challenges remain in regulation and the need for validation of experimental analysis. Here, we present an overview of the current uses and challenges of applied DNA barcoding in agriculture, from agro-ecosystems within farmland to the kitchen table.

  1. Prey identification in nests of the potter wasp Hypodynerus andeus (Packard (Hymenoptera, Vespidae, Eumeninae using DNA barcodes

    Directory of Open Access Journals (Sweden)

    Héctor A. Vargas

    2014-06-01

    Full Text Available Prey identification in nests of the potter wasp Hypodynerus andeus (Packard (Hymenoptera, Vespidae, Eumeninae using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869 (Hymenoptera, Vespidae, Eumeninae in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

  2. Colour patterns do not diagnose species: quantitative evaluation of a DNA barcoded cryptic bumblebee complex.

    Directory of Open Access Journals (Sweden)

    James C Carolan

    Full Text Available Cryptic diversity within bumblebees (Bombus has the potential to undermine crucial conservation efforts designed to reverse the observed decline in many bumblebee species worldwide. Central to such efforts is the ability to correctly recognise and diagnose species. The B. lucorum complex (Bombus lucorum, B. cryptarum and B. magnus comprises one of the most abundant and important group of wild plant and crop pollinators in northern Europe. Although the workers of these species are notoriously difficult to diagnose morphologically, it has been claimed that queens are readily diagnosable from morphological characters. Here we assess the value of colour-pattern characters in species identification of DNA-barcoded queens from the B. lucorum complex. Three distinct molecular operational taxonomic units were identified each representing one species. However, no uniquely diagnostic colour-pattern character state was found for any of these three molecular units and most colour-pattern characters showed continuous variation among the units. All characters previously deemed to be unique and diagnostic for one species were displayed by specimens molecularly identified as a different species. These results presented here raise questions on the reliability of species determinations in previous studies and highlights the benefits of implementing DNA barcoding prior to ecological, taxonomic and conservation studies of these important key pollinators.

  3. Googling DNA sequences on the World Wide Web.

    Science.gov (United States)

    Hajibabaei, Mehrdad; Singer, Gregory A C

    2009-11-10

    New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.

  4. Limitations of mitochondrial gene barcoding in Octocorallia.

    Science.gov (United States)

    McFadden, Catherine S; Benayahu, Yehuda; Pante, Eric; Thoma, Jana N; Nevarez, P Andrew; France, Scott C

    2011-01-01

    The widespread assumption that COI and other mitochondrial genes will be ineffective DNA barcodes for anthozoan cnidarians has not been well tested for most anthozoans other than scleractinian corals. Here we examine the limitations of mitochondrial gene barcoding in the sub-class Octocorallia, a large, diverse, and ecologically important group of anthozoans. Pairwise genetic distance values (uncorrected p) were compared for three candidate barcoding regions: the Folmer region of COI; a fragment of the octocoral-specific mitochondrial protein-coding gene, msh1; and an extended barcode of msh1 plus COI with a short, adjacent intergenic region (igr1). Intraspecific variation was barcodes, and there was no discernible barcoding gap between intra- and interspecific p values. In a case study to assess regional octocoral biodiversity, COI and msh1 barcodes each identified 70% of morphospecies. In a second case study, a nucleotide character-based analysis correctly identified 70% of species in the temperate genus Alcyonium. Although interspecific genetic distances were 2× greater for msh1 than COI, each marker identified similar numbers of species in the two case studies, and the extended COI + igr1 + msh1 barcode more effectively discriminated sister taxa in Alcyonium. Although far from perfect for species identification, a COI + igr1 + msh1 barcode nonetheless represents a valuable addition to the depauperate set of characters available for octocoral taxonomy. © 2010 Blackwell Publishing Ltd.

  5. DNA Barcoding Meets Nanotechnology: Development of a Universal Colorimetric Test for Food Authentication.

    Science.gov (United States)

    Valentini, Paola; Galimberti, Andrea; Mezzasalma, Valerio; De Mattia, Fabrizio; Casiraghi, Maurizio; Labra, Massimo; Pompa, Pier Paolo

    2017-07-03

    Food trade globalization and the growing demand for selected food varieties have led to the intensification of adulteration cases, especially in the form of species substitution and mixing with cheaper taxa. This phenomenon has huge economic impact and sometimes even public health implications. DNA barcoding represents a well-proven molecular approach to assess the authenticity of food items, although its use is hampered by analytical constraints and timeframes that are often prohibitive for the food market. To address such issues, we have introduced a new technology, named NanoTracer, that allows for rapid and naked-eye molecular traceability of any food and requires limited instrumentation and cost-effective reagents. Moreover, unlike sequencing, this method can be used to identify not only the substitution of a fine ingredient, but also its dilution with cheaper ones. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Mofolusho O. Falade

    2016-06-01

    Full Text Available DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S and cytochrome oxidase subunit I (COI for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ and maximum likelihood (ML methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average, which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria.

  7. Integrated Taxonomy and DNA Barcoding of Alpine Midges (Diptera: Chironomidae).

    Science.gov (United States)

    Montagna, Matteo; Mereghetti, Valeria; Lencioni, Valeria; Rossaro, Bruno

    2016-01-01

    Rapid and efficient DNA-based tools are recommended for the evaluation of the insect biodiversity of high-altitude streams. In the present study, focused principally on larvae of the genus Diamesa Meigen 1835 (Diptera: Chironomidae), the congruence between morphological/molecular delimitation of species as well as performances in taxonomic assignments were evaluated. A fragment of the mitochondrial cox1 gene was obtained from 112 larvae, pupae and adults (Diamesinae, Orthocladiinae and Tanypodinae) that were collected in different mountain regions of the Alps and Apennines. On the basis of morphological characters 102 specimens were attributed to 16 species, and the remaining ten specimens were identified to the genus level. Molecular species delimitation was performed using: i) distance-based Automatic Barcode Gap Discovery (ABGD), with no a priori assumptions on species identification; and ii) coalescent tree-based approaches as the Generalized Mixed Yule Coalescent model, its Bayesian implementation and Bayesian Poisson Tree Processes. The ABGD analysis, estimating an optimal intra/interspecific nucleotide distance threshold of 0.7%-1.4%, identified 23 putative species; the tree-based approaches, identified between 25-26 entities, provided nearly identical results. All species belonging to zernyi, steinboecki, latitarsis, bertrami, dampfi and incallida groups, as well as outgroup species, are recovered as separate entities, perfectly matching the identified morphospecies. In contrast, within the cinerella group, cases of discrepancy arose: i) the two morphologically separate species D. cinerella and D. tonsa are neither monophyletic nor diagnosable exhibiting low values of between-taxa nucleotide mean divergence (0.94%); ii) few cases of larvae morphological misidentification were observed. Head capsule color is confirmed to be a valid character able to discriminate larvae of D. zernyi, D. tonsa and D. cinerella, but it is here better defined as a color gradient

  8. Discriminating plants using the DNA barcode rbcLb: an appraisal based on a large data set.

    Science.gov (United States)

    Dong, Wenpan; Cheng, Tao; Li, Changhao; Xu, Chao; Long, Ping; Chen, Chumming; Zhou, Shiliang

    2014-03-01

    The ideal DNA barcode for plants remains to be discovered, and the candidate barcode rbcL has been met with considerable skepticism since its proposal. In fact, the variability within this gene has never been fully explored across all plant groups from algae to flowering plants, and its performance as a barcode has not been adequately tested. By analysing all of the rbcL sequences currently available in GenBank, we attempted to determine how well a region of rbcL performs as a barcode in species discrimination. We found that the rbcLb region was more variable than the frequently used rbcLa region. Both universal and plant group-specific primers were designed to amplify rbcLb, and the performance of rbcLa and rbcLb was tested in several ways. Using blast, both regions successfully identified all families and nearly all genera; however, the successful species identification rates varied significantly among plant groups, ranging from 24.58% to 85.50% for rbcLa and from 36.67% to 90.89% for rbcLb. Successful species discrimination ranged from 5.19% to 96.33% for rbcLa and from 22.09% to 98.43% for rbcLb in species-rich families, and from 0 to 88.73% for rbcLa and from 2.04% to 100% for rbcLb in species-rich genera. Both regions performed better for lower plants than for higher plants, although rbcLb performed significantly better than rbcLa overall, particularly for angiosperms. Considering the applicability across plants, easy and unambiguous alignment, high primer universality, high sequence quality and high species discrimination power for lower plants, we suggest rbcLb as a universal plant barcode. © 2013 John Wiley & Sons Ltd.

  9. DNA barcoding and phylogeny of Calidris and Tringa (Aves: Scolopacidae).

    Science.gov (United States)

    Huang, Zuhao; Tu, Feiyun

    2017-07-01

    The avian genera Calidris and Tringa are the largest of the widespread family of Scolopacidae. The phylogeny of members of the two genera is still a matter of controversial. Mitochondrial cytochrome c oxidase subunit I (COI) can serve as a fast and accurate marker for the identification and phylogeny of animal species. In this study, we analyzed the COI barcodes of thirty-one species of the two genera. All the species had distinct COI sequences. Two hundred and twenty-one variable sites were identified. Kimura two-parameter distances were calculated between barcodes. Neighbor-joining and maximum likelihood methods were used to construct phylogenetic trees. All the species could be discriminated by their distinct clades in the phylogenetic trees. The phylogenetic trees grouped all the species of Calidris and Tringa into different monophyletic clade, respectively. COI data showed a well-supported phylogeny for Calidris and Tringa species.

  10. Use of ITS2 region as the universal DNA barcode for plants and animals.

    Science.gov (United States)

    Yao, Hui; Song, Jingyuan; Liu, Chang; Luo, Kun; Han, Jianping; Li, Ying; Pang, Xiaohui; Xu, Hongxi; Zhu, Yingjie; Xiao, Peigen; Chen, Shilin

    2010-10-01

    The internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA is regarded as one of the candidate DNA barcodes because it possesses a number of valuable characteristics, such as the availability of conserved regions for designing universal primers, the ease of its amplification, and sufficient variability to distinguish even closely related species. However, a general analysis of its ability to discriminate species in a comprehensive sample set is lacking. In the current study, 50,790 plant and 12,221 animal ITS2 sequences downloaded from GenBank were evaluated according to sequence length, GC content, intra- and inter-specific divergence, and efficiency of identification. The results show that the inter-specific divergence of congeneric species in plants and animals was greater than its corresponding intra-specific variations. The success rates for using the ITS2 region to identify dicotyledons, monocotyledons, gymnosperms, ferns, mosses, and animals were 76.1%, 74.2%, 67.1%, 88.1%, 77.4%, and 91.7% at the species level, respectively. The ITS2 region unveiled a different ability to identify closely related species within different families and genera. The secondary structure of the ITS2 region could provide useful information for species identification and could be considered as a molecular morphological characteristic. As one of the most popular phylogenetic markers for eukaryota, we propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal species. We have also developed a web application to facilitate ITS2-based cross-kingdom species identification (http://its2-plantidit.dnsalias.org).

  11. DNA barcoding of invasive plants in China: A resource for identifying invasive plants.

    Science.gov (United States)

    Xu, Song-Zhi; Li, Zhen-Yu; Jin, Xiao-Hua

    2018-01-01

    Invasive plants have aroused attention globally for causing ecological damage and having a negative impact on the economy and human health. However, it can be extremely challenging to rapidly and accurately identify invasive plants based on morphology because they are an assemblage of many different families and many plant materials lack sufficient diagnostic characteristics during border inspections. It is therefore urgent to evaluate candidate loci and build a reliable genetic library to prevent invasive plants from entering China. In this study, five common single markers (ITS, ITS2, matK, rbcL and trnH-psbA) were evaluated using 634 species (including 469 invasive plant species in China, 10 new records to China, 16 potentially invasive plant species around the world but not introduced into China yet and 139 plant species native to China) based on three different methods. Our results indicated that ITS2 displayed largest intra- and interspecific divergence (1.72% and 91.46%). Based on NJ tree method, ITS2, ITS, matK, rbcL and trnH-psbA provided 76.84%, 76.5%, 63.21%, 52.86% and 50.68% discrimination rates, respectively. The combination of ITS + matK performed best and provided 91.03% discriminatory power, followed by ITS2 + matK (85.78%). For identifying unknown individuals, ITS + matK had 100% correct identification rate based on our database, followed by ITS/ITS2 (both 93.33%) and ITS2 + matK (91.67%). Thus, we propose ITS/ITS2 + matK as the most suitable barcode for invasive plants in China. This study also demonstrated that DNA barcoding is an efficient tool for identifying invasive species. © 2017 John Wiley & Sons Ltd.

  12. DNA barcoding of shark meats identify species composition and CITES-listed species from the markets in Taiwan.

    Directory of Open Access Journals (Sweden)

    Shang-Yin Vanson Liu

    Full Text Available BACKGROUND: An increasing awareness of the vulnerability of sharks to exploitation by shark finning has contributed to a growing concern about an unsustainable shark fishery. Taiwan's fleet has the 4th largest shark catch in the world, accounting for almost 6% of the global figures. Revealing the diversity of sharks consumed by Taiwanese is important in designing conservation plans. However, fins make up less than 5% of the total body weight of a shark, and their bodies are sold as filets in the market, making it difficult or impossible to identify species using morphological traits. METHODS: In the present study, we adopted a DNA barcoding technique using a 391-bp fragment of the mitochondrial cytochrome oxidase I (COI gene to examine the diversity of shark filets and fins collected from markets and restaurants island-wide in Taiwan. RESULTS: Amongst the 548 tissue samples collected and sequenced, 20 major clusters were apparent by phylogenetic analyses, each of them containing individuals belonging to the same species (most with more than 95% bootstrap values, corresponding to 20 species of sharks. Additionally, Alopias pelagicus, Carcharhinus falciformis, Isurus oxyrinchus, and Prionace glauca consisted of 80% of the samples we collected, indicating that these species might be heavily consumed in Taiwan. Approximately 5% of the tissue samples used in this study were identified as species listed in CITES Appendix II, including two species of Sphyrna, C. longimanus and Carcharodon carcharias. CONCLUSION: DNA barcoding provides an alternative method for understanding shark species composition when species-specific data is unavailable. Considering the global population decline, stock assessments of Appendix II species and highly consumed species are needed to accomplish the ultimate goal of shark conservation.

  13. The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

    Science.gov (United States)

    Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

    2012-01-01

    Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

  14. DNA barcoding of freshwater fishes and the development of a quantitative qPCR assay for the species-specific detection and quantification of fish larvae from plankton samples.

    Science.gov (United States)

    Loh, W K W; Bond, P; Ashton, K J; Roberts, D T; Tibbetts, I R

    2014-08-01

    The barcoding of mitochondrial cytochrome c oxidase subunit 1 (coI) gene was amplified and sequenced from 16 species of freshwater fishes found in Lake Wivenhoe (south-eastern Queensland, Australia) to support monitoring of reservoir fish populations, ecosystem function and water health. In this study, 630-650 bp sequences of the coI barcoding gene from 100 specimens representing 15 genera, 13 families and two subclasses of fishes allowed 14 of the 16 species to be identified and differentiated. The mean ± s.e. Kimura 2 parameter divergence within and between species was 0.52 ± 0.10 and 23.8 ± 2.20% respectively, indicating that barcodes can be used to discriminate most of the fish species accurately. The two terapontids, Amniataba percoides and Leiopotherapon unicolor, however, shared coI DNA sequences and could not be differentiated using this gene. A barcoding database was established and a qPCR assay was developed using coI sequences to identify and quantify proportional abundances of fish species in ichthyoplankton samples from Lake Wivenhoe. These methods provide a viable alternative to the time-consuming process of manually enumerating and identifying ichthyoplankton samples. © 2014 The Fisheries Society of the British Isles.

  15. Identification of marine traditional Chinese medicine dried seahorses in the traditional Chinese medicine market using DNA barcoding.

    Science.gov (United States)

    Hou, Feixia; Wen, Longlian; Peng, Cheng; Guo, Jinlin

    2018-01-01

    Seahorse documented in Chinese pharmacopeia possess important medicinal efficacy and are used as an ingredient in traditional Chinese medicines. The growing international trade threatens the species. DNA barcoding holds a great application potentiality in wildlife conservation and might prevent the illegal trade of threatened species. The COI gene was used to identify seahorse, and nine Hippocampus species were found in the three large traditional Chinese medicines markets of China. All inter-specific genetic variations were larger than 2%. Mean genetic distances between species were 17-fold larger than those within the species. Phylogenetic tree showed that each species clustered in the appropriate branch. All results demonstrated that COI-based barcoding technique could be used to identify seahorse species and played a major role in monitoring the seahorse trade.

  16. Barcoding poplars (Populus L. from western China.

    Directory of Open Access Journals (Sweden)

    Jianju Feng

    Full Text Available BACKGROUND: Populus is an ecologically and economically important genus of trees, but distinguishing between wild species is relatively difficult due to extensive interspecific hybridization and introgression, and the high level of intraspecific morphological variation. The DNA barcoding approach is a potential solution to this problem. METHODOLOGY/PRINCIPAL FINDINGS: Here, we tested the discrimination power of five chloroplast barcodes and one nuclear barcode (ITS among 95 trees that represent 21 Populus species from western China. Among all single barcode candidates, the discrimination power is highest for the nuclear ITS, progressively lower for chloroplast barcodes matK (M, trnG-psbK (G and psbK-psbI (P, and trnH-psbA (H and rbcL (R; the discrimination efficiency of the nuclear ITS (I is also higher than any two-, three-, or even the five-locus combination of chloroplast barcodes. Among the five combinations of a single chloroplast barcode plus the nuclear ITS, H+I and P+I differentiated the highest and lowest portion of species, respectively. The highest discrimination rate for the barcodes or barcode combinations examined here is 55.0% (H+I, and usually discrimination failures occurred among species from sympatric or parapatric areas. CONCLUSIONS/SIGNIFICANCE: In this case study, we showed that when discriminating Populus species from western China, the nuclear ITS region represents a more promising barcode than any maternally inherited chloroplast region or combination of chloroplast regions. Meanwhile, combining the ITS region with chloroplast regions may improve the barcoding success rate and assist in detecting recent interspecific hybridizations. Failure to discriminate among several groups of Populus species from sympatric or parapatric areas may have been the result of incomplete lineage sorting, frequent interspecific hybridizations and introgressions. We agree with a previous proposal for constructing a tiered barcoding system in

  17. What do they eat? Using DNA barcoding to assess diet preferences of deer

    DEFF Research Database (Denmark)

    Fløjgaard, Camilla; Ejrnæs, Rasmus

    Humans have modified most ecosystems on Earth to a degree where even the largest “wild” nature reserves need management to avoid the loss of biodiversity. Native large herbivore grazing has potential as an efficient and natural tool in this management because they create dynamics and keep...... landscapes open. However, in order to use this tool properly, we need to know more about what the animals eat compared to what is available in different habitats and how access to supplementary fodder influences the grazing effect on the vegetation. Using DNA barcoding of feces, we are investigating the diet...

  18. Towards a comprehensive barcode library for arctic life - Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Canada

    Science.gov (United States)

    2009-01-01

    Background This study reports progress in assembling a DNA barcode reference library for Ephemeroptera, Plecoptera, and Trichoptera ("EPTs") from a Canadian subarctic site, which is the focus of a comprehensive biodiversity inventory using DNA barcoding. These three groups of aquatic insects exhibit a moderate level of species diversity, making them ideal for testing the feasibility of DNA barcoding for routine biotic surveys. We explore the correlation between the morphological species delineations, DNA barcode-based haplotype clusters delimited by a sequence threshold (2%), and a threshold-free approach to biodiversity quantification--phylogenetic diversity. Results A DNA barcode reference library is built for 112 EPT species for the focal region, consisting of 2277 COI sequences. Close correspondence was found between EPT morphospecies and haplotype clusters as designated using a standard threshold value. Similarly, the shapes of taxon accumulation curves based upon haplotype clusters were very similar to those generated using phylogenetic diversity accumulation curves, but were much more computationally efficient. Conclusion The results of this study will facilitate other lines of research on northern EPTs and also bode well for rapidly conducting initial biodiversity assessments in unknown EPT faunas. PMID:20003245

  19. A novel mini-DNA barcoding assay to identify processed fins from internationally protected shark species.

    Science.gov (United States)

    Fields, Andrew T; Abercrombie, Debra L; Eng, Rowena; Feldheim, Kevin; Chapman, Demian D

    2015-01-01

    There is a growing need to identify shark products in trade, in part due to the recent listing of five commercially important species on the Appendices of the Convention on International Trade in Endangered Species (CITES; porbeagle, Lamna nasus, oceanic whitetip, Carcharhinus longimanus scalloped hammerhead, Sphyrna lewini, smooth hammerhead, S. zygaena and great hammerhead S. mokarran) in addition to three species listed in the early part of this century (whale, Rhincodon typus, basking, Cetorhinus maximus, and white, Carcharodon carcharias). Shark fins are traded internationally to supply the Asian dried seafood market, in which they are used to make the luxury dish shark fin soup. Shark fins usually enter international trade with their skin still intact and can be identified using morphological characters or standard DNA-barcoding approaches. Once they reach Asia and are traded in this region the skin is removed and they are treated with chemicals that eliminate many key diagnostic characters and degrade their DNA ("processed fins"). Here, we present a validated mini-barcode assay based on partial sequences of the cytochrome oxidase I gene that can reliably identify the processed fins of seven of the eight CITES listed shark species. We also demonstrate that the assay can even frequently identify the species or genus of origin of shark fin soup (31 out of 50 samples).

  20. A novel mini-DNA barcoding assay to identify processed fins from internationally protected shark species.

    Directory of Open Access Journals (Sweden)

    Andrew T Fields

    Full Text Available There is a growing need to identify shark products in trade, in part due to the recent listing of five commercially important species on the Appendices of the Convention on International Trade in Endangered Species (CITES; porbeagle, Lamna nasus, oceanic whitetip, Carcharhinus longimanus scalloped hammerhead, Sphyrna lewini, smooth hammerhead, S. zygaena and great hammerhead S. mokarran in addition to three species listed in the early part of this century (whale, Rhincodon typus, basking, Cetorhinus maximus, and white, Carcharodon carcharias. Shark fins are traded internationally to supply the Asian dried seafood market, in which they are used to make the luxury dish shark fin soup. Shark fins usually enter international trade with their skin still intact and can be identified using morphological characters or standard DNA-barcoding approaches. Once they reach Asia and are traded in this region the skin is removed and they are treated with chemicals that eliminate many key diagnostic characters and degrade their DNA ("processed fins". Here, we present a validated mini-barcode assay based on partial sequences of the cytochrome oxidase I gene that can reliably identify the processed fins of seven of the eight CITES listed shark species. We also demonstrate that the assay can even frequently identify the species or genus of origin of shark fin soup (31 out of 50 samples.