WorldWideScience

Sample records for dna amplification fingerprinting

  1. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  2. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  3. Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD

    Directory of Open Access Journals (Sweden)

    Silva L.M.

    2001-01-01

    Full Text Available The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA, developed by Heath et al. [Nucleic Acids Research (1993 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

  4. Diversity among Cynodon accessions and taxa based on DNA amplification fingerprinting.

    Science.gov (United States)

    Assefa, S; Taliaferro, C M; Anderson, M P; de los Reyes, B G; Edwards, R M

    1999-06-01

    The genus Cynodon (Gramineae), comprised of 9 species, is geographically widely distributed and genetically diverse. Information on the amounts of molecular genetic variation among and within Cynodon taxa is needed to enhance understanding of phylogenetic relations and facilitate germplasm management and breeding improvement efforts. Genetic relatedness among 62 Cynodon accessions, representing eight species, was assessed using DNA amplification fingerprinting (DAF). Ten 8-mer oligonucleotides were used to amplify specific Cynodon genomic sequences. The DNA amplification products of individual accessions were scored for presence (1) or absence (0) of bands. Similarity matrices were developed and the accessions were grouped by cluster (UPGMA) and principal coordinate analysis. Analyses were conducted within ploidy level (2x = 18 and 4x = 36) and over ploidy levels. Each primer revealed polymorphic loci among accessions within species. Of 539 loci (bands) scored, 496 (92%) were polymorphic. Cynodon arcuatus was clearly separated from other species by numerous monomorphic bands. The strongest species similarities were between C. aethiopicus and C. arcuatus, C. transvaalensis and C. plectostachyus, and C. incompletus and C. nlemfuensis. Intraspecific variation was least for C. aethiopicus, C. arcuatus, and C. transvaalensis, and greatest for C. dactylon. Accessions of like taxonomic classification were generally clustered, except the cosmopolitan C. dactylon var. dactylon and C. dactylon var. afganicus. Within taxa, accessions differing in chromosome number clustered in all instances indicating the 2x and 4x forms to be closely related. Little, if any, relationship was found between relatedness as indicated by the DAF profiles and previous estimates of hybridization potential between the different taxa.

  5. Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions

    Directory of Open Access Journals (Sweden)

    Silvia L. Bustamante

    2003-07-01

    Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

  6. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  7. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  8. Making DNA Fingerprints.

    Science.gov (United States)

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  9. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  10. An Introduction to DNA Fingerprinting.

    Science.gov (United States)

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  11. Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions Caracterización molecular del germoplasma de ñame colombiano utilizando "DNA Amplificaron Fingerprinting (DAF" en condiciones radiactivas

    Directory of Open Access Journals (Sweden)

    Bustamante Silvia L.

    2003-12-01

    Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

  12. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  13. Beware of the possibility of fingerprinting techniques transferring DNA.

    Science.gov (United States)

    van Oorschot, Roland A H; Treadwell, Sally; Beaurepaire, James; Holding, Nicole L; Mitchell, Robert J

    2005-11-01

    Fingerprinting brushes have the potential to collect and transfer DNA during powdering. Squirrel-hair fingerprint brushes exposed to specific sets of saliva stains and brushes used in routine casework were tested for their ability to collect and transfer DNA containing material using standard DNA extraction procedures and AmpFlSTR Profiler Plus amplification and typing procedures. The tests found that the risk of transferring DNA during powdering and having a detrimental impact on the analysis increases if the examiner powders over either biological stains (such as blood or saliva) or very fresh prints and uses more sensitive PCR amplification and typing procedures. We advocate caution when powdering prints from which DNA may also be collected and provide options for consideration to limit the risk of transferred DNA contamination while fingerprinting.

  14. Laser mass spectrometry for DNA fingerprinting for forensic applications

    Energy Technology Data Exchange (ETDEWEB)

    Chen, C.H.; Tang, K.; Taranenko, N.I.; Allman, S.L.; Chang, L.Y.

    1994-12-31

    The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual`s DNA structure is identical within all tissues of their body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et al. found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endonuclease sites can provide the basis for identification. The major steps for conventional DNA fingerprinting include (1) specimen processing (2) amplification of selected DNA segments by PCR, and (3) gel electrophoresis to do the final DNA analysis. In this work we propose to use laser desorption mass spectrometry for fast DNA fingerprinting. The process and advantages are discussed.

  15. Graphene Nanopres for DNA Fingerprinting

    Science.gov (United States)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  16. DNA Fingerprinting in a Forensic Teaching Experiment

    Science.gov (United States)

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  17. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

    Science.gov (United States)

    Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

    2009-05-01

    Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

  18. DNA fingerprints come to court

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person

  19. Generation of DNA profiles from fingerprints developed with columnar thin film technique.

    Science.gov (United States)

    Plazibat, Stephanie L; Roy, Reena; Swiontek, Stephen E; Lakhtakia, Akhlesh

    2015-12-01

    Partial-bloody fingerprints and partial fingerprints with saliva are often encountered at crime scenes, potentially enabling the combination of fingerprint and DNA analyses for absolute identification, provided that the development technique for fingerprint analysis does not inhibit DNA analysis. 36 partial-bloody fingerprints and 30 fingerprints wetted with saliva, all deposited on brass, were first developed using the columnar-thin-film (CTF) technique and then subjected to short tandem repeat (STR) DNA analysis. Equal numbers of samples were subjected to the same DNA analysis without development. Tris (8-hydroxyquinolinato) aluminum, or Alq3, was evaporated to deposit CTFs for development of the prints. DNA was extracted from all 132 samples, quantified, and amplified with AmpFlSTR(®) Identifiler Plus Amplification Kit. Additionally, DNA analyses were conducted on four blood smears on un-fingerprinted brass that had been subjected to CTF deposition and four blood smears on un-fingerprinted brass that had not been subjected to CTF deposition. Complete and concordant autosomal STR profiles of the same quality were obtained from both undeveloped and CTF-developed fingerprints, indicating that CTF development of fingerprints preserves DNA and does not inhibit subsequent DNA analysis. Even when there were no fingerprints, CTF deposition did not lead to inhibition of DNA analysis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Acetone facilitated DNA sampling from electrical tapes improves DNA recovery and enables latent fingerprints development.

    Science.gov (United States)

    Feine, Ilan; Shpitzen, Moshe; Geller, Boris; Salmon, Eran; Peleg, Tsach; Roth, Jonathan; Gafny, Ron

    2017-07-01

    Electrical tapes (ETs) are a common component of improvised explosive devices (IEDs) used by terrorists or criminal organizations and represent a valuable forensic resource for DNA and latent fingerprints recovery. However, DNA recovery rates are typically low and usually below the minimal amount required for amplification. In addition, most DNA extraction methods are destructive and do not allow further latent fingerprints development. In the present study a cell culture based touch DNA model was used to demonstrate a two-step acetone-water DNA recovery protocol from ETs. This protocol involves only the adhesive side of the ET and increases DNA recovery rates by up to 70%. In addition, we demonstrated partially successful latent fingerprints development from the non-sticky side of the ETs. Taken together, this protocol maximizes the forensic examination of ETs and is recommended for routine casework processing. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. DNA fingerprinting in forensics: past, present, future.

    Science.gov (United States)

    Roewer, Lutz

    2013-11-18

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

  2. DNA fingerprinting in botany: past, present, future

    OpenAIRE

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the n...

  3. DNAzyme Feedback Amplification: Relaying Molecular Recognition to Exponential DNA Amplification.

    Science.gov (United States)

    Liu, Meng; Yin, Qingxin; McConnell, Erin M; Chang, Yangyang; Brennan, John D; Li, Yingfu

    2018-03-26

    Technologies capable of linking DNA amplification to molecular recognition are very desirable for ultrasensitive biosensing applications. We have developed a simple but powerful isothermal DNA amplification method, termed DNAzyme feedback amplification (DFA), that is capable of relaying molecular recognition to exponential DNA amplification. The method incorporates both an RNA-cleaving DNAzyme (RCD) and rolling circle amplification (RCA) carried out by a special DNA polymerase using a circular DNA template. DFA begins with a stimulus-dependent RCA reaction, producing tandemly linked RCDs in long-chain DNA products. These RCDs cleave an RNA-containing DNA sequence to form additional primers that hybridize to the circular DNA molecule, giving rise to DNA assemblies that act as the new inputs for RCA. The RCA reaction and the cleavage event keep on feeding each other autonomously, resulting in exponential growth of repetitive DNA sequences that can be easily detected. This method can be used for the detection of both nucleic acid based targets and non-nucleic acid analytes. In this article, we discuss the conceptual framework of the feedback amplification approach, the essential features of this method as well as remaining challenges and possible solutions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. DNA fingerprinting in botany: past, present, future.

    Science.gov (United States)

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-03

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  5. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  6. Diversity of DNA fingerprints in Cryptococcus neoformans.

    Science.gov (United States)

    Varma, A; Swinne, D; Staib, F; Bennett, J E; Kwon-Chung, K J

    1995-07-01

    DNA fingerprint patterns of 156 Cryptococcus neoformans isolates (26 AIDS patients, 46 non-AIDS patients, and 40 environmental sources) from both varieties (126 C. neoformans var. neoformans and 30 C. neoformans var. gattii isolates) and from seven countries were analyzed by using the DNA probe UT-4p. Nine and twelve distinct DNA fingerprint patterns were observed for isolates of the C. neoformans var. neoformans and var. gattii, respectively. No pattern was unique to AIDS patients, non-AIDS patients, or the environment. Pattern II was observed more often in non-AIDS patients (8 of 23) than in AIDS patients (0 of 25). Pattern V was the most prevalent pattern (42 of 82) in clinical and environmental isolates. Isolates from three AIDS patients in Burundi and Zaire exhibited patterns identical to each other but different from those of isolates collected from their houses (i.e., dust of floors, walls, etc.) or a nearby pigeon coop. DNA fingerprint stability was determined for 53 isolates from nine non-AIDS patients at different time intervals during 5 to 128 weeks of antifungal therapy. For eight patients, the fingerprint pattern was stable while the ninth may have had a mixed infection. Pattern II was observed in 4 of 9 patients, which is similar to 4 of 14 in other non-AIDS patients as reported here. In spite of the extensive pattern heterogeneity among 15 C. neoformans var. gattii isolates in Australia, the patterns observed in seven California isolates were quite different from those in Australia. Among isolates of C. neoformans var. gattii, one fingerprint pattern (designated b) was observed in several countries of the Far East. The fingerprint patterns of two of three environmental isolates from Eucalyptus camaldulensis trees in Australia were identical to those of 2 of the 12 clinical isolates from the country.

  7. Cluster analysis of Helicobacter pylori genomic DNA fingerprints suggests gastroduodenal disease-specific associations.

    Science.gov (United States)

    Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R

    1995-07-01

    Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.

  8. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  9. Caracterización molecular de Colletotrichum gloeosporioides aislado de plantas de ñame de la Costa Atlántica Colombiana utilizando la técnica “DNA Amplification Fingerprinting (DAF”

    Directory of Open Access Journals (Sweden)

    Natalia Giraldo Marroquín

    2016-01-01

    Full Text Available La antracnosis en ñame, causada por el hongo Colletotrichum gloeosporioides, es una enfermedad relevante que posee el potencial de destruir el 100% de la cosecha, convirtiéndose en la principal limitante fitosanitaria para el rendimiento del cultivo en el país. Esta es una situación preocupante considerando que aproximadamente 35.000 familias de pequeños y medianos agricultores de la Costa Atlántica Colombiana subsisten de este cultivo; es por esto que el objetivo de este trabajo fue caracterizar molecularmente 42 aislamientos del hongo procedentes de plantas de ñame con síntomas de la enfermedad, utilizando la técnica molecular “DNA Amplification Fingerprinting (DAF”, caracterizada por su resolución en la determinación de la variabilidad genética de diferentes organismos. Para la determinación de polimorfismos, se amplificaron 16 marcadores DAF implementando iniciadores tipo decámero, los cuales fueron visualizados por electroforesis en microchip con el equipo MCE-202 MultiNA. Se evaluó la reproducibilidad de la técnica DAF. La amplificación arrojó 391 bandas inequívocamente polimórficas en todas las muestras, el coeficiente de Dice identificó cinco grupos con 0.30% de similaridad y el índice de diversidad genética fue de 0.28; datos que reflejan un alto grado de variabilidad en la colección estudiada de C. gloeosporioides. Ésta puede deberse, al intercambio de germoplasma, a su condición heterotálica, a las mutaciones y al alto potencial de dispersión de las conidias que le permiten mantener la viabilidad bajo condiciones adversas. Por último, se encontró que DAF es una técnica reproducible, confirmando que es una metodología fiable para la caracterización molecular de hongos.

  10. DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

    Science.gov (United States)

    Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

    2008-01-01

    This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

  11. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  12. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  13. Effect of dactyloscopic powders on DNA profiling from enhanced fingerprints: results from an experimental study.

    Science.gov (United States)

    Tozzo, Pamela; Giuliodori, Alice; Rodriguez, Daniele; Caenazzo, Luciana

    2014-03-01

    We conducted a study on the effect of fingerprint enhancement methods on subsequent short tandem repeat profiling. First, we performed a study typing blood traces deposited on 5 different surfaces, treated with 8 types of dactyloscopic powders. Three different DNA extraction methods were used. Subsequently, we analyzed latent fingerprints on the same 5 surfaces enhanced with the 8 different powders used in the first part of the study. This study has demonstrated that DNA profiling can be performed on fingerprints left on different substrates, and the substrate will affect the amount of DNA that can be recovered for DNA typing. In the first phase of the study, a profile was obtained in 92% of the 120 samples analyzed; in the second part, in 55% of the 80 samples analyzed, we obtained a profile complete in 32.5% of the cases. From the results obtained, it seems that the powders used in latent fingerprints enhancement, rather than having a direct inhibitory effect on extraction and amplification of DNA, may cause partial degradation of DNA, reducing the efficiency of amplification reaction. It should not be forgotten that these results were obtained under laboratory conditions, and in real caseworks, there may still be different problems involved.

  14. DNA Fingerprint Analysis of Three Short Tandem Repeat (STR) Loci for Biochemistry and Forensic Science Laboratory Courses

    Science.gov (United States)

    McNamara-Schroeder, Kathleen; Olonan, Cheryl; Chu, Simon; Montoya, Maria C.; Alviri, Mahta; Ginty, Shannon; Love, John J.

    2006-01-01

    We have devised and implemented a DNA fingerprinting module for an upper division undergraduate laboratory based on the amplification and analysis of three of the 13 short tandem repeat loci that are required by the Federal Bureau of Investigation Combined DNA Index System (FBI CODIS) data base. Students first collect human epithelial (cheek)…

  15. Recovery of latent fingerprints and DNA on human skin.

    Science.gov (United States)

    Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

    2010-11-01

    The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%). © 2010 American Academy of Forensic Sciences.

  16. Qualitative and quantitative assessment of single fingerprints in forensic DNA analysis.

    Science.gov (United States)

    Ostojic, Lana; Klempner, Stacey A; Patel, Rosni A; Mitchell, Adele A; Axler-DiPerte, Grace L; Wurmbach, Elisa

    2014-11-01

    Fingerprints and touched items are important sources of DNA for STR profiling, since this evidence can be recovered in a wide variety of criminal offenses. However, there are some fundamental difficulties in working with these samples, including variability in quantity and quality of extracted DNA. In this study, we collected and analyzed over 700 fingerprints. We compared a commercially available extraction protocol (Zygem) to two methods developed in our laboratory, a simple one-tube protocol and a high sensitivity protocol (HighSens) that includes additional steps to concentrate and purify the DNA. The amplification protocols tested were AmpFLSTR® Identifiler® using either 28 or 31 amplification cycles, and Identifiler® Plus using 32 amplification cycles. We found that the HighSens and Zygem extraction methods were significantly better in their DNA yields than the one-tube method. Identifiler® Plus increased the quality of the STR profiles for the one-tube extraction significantly. However, this effect could not be verified for the other extraction methods. Furthermore, microscopic analysis of single fingerprints revealed that some individuals tended to shed more material than others onto glass slides. However, a dense deposition of skin flakes did not strongly correlate with a high quality STR profile. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

    Science.gov (United States)

    Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

    2008-01-01

    Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

  18. The Ins and Outs of DNA Fingerprinting the Infectious Fungi

    Science.gov (United States)

    Soll, David R.

    2000-01-01

    DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003

  19. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  20. Teaching DNA Fingerprinting using a Hands-on Simulation.

    Science.gov (United States)

    Schug, Thatcher

    1998-01-01

    Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

  1. Multifragment alleles in DNA fingerprints of the parrot, Amazona ventralis

    Science.gov (United States)

    Brock, M.K.; White, B.N.

    1991-01-01

    Human DNA probes that identify variable numbers of tandem repeat loci are being used to generate DNA fingerprints in many animal and plant species. In most species the majority of the sc rable autoradiographic bands of the DNA fingerprint represent alleles from numerous unlinked loci. This study was initiated to use DNA fingerprints to determine the amount of band-sharing among captive Hispaniolan parrots (Amazona ventralis) with known genetic relationships. This would form the data base to examine DNA fingerprints of the closely related and endangered Puerto Rican parrot (A. vittata) and to estimate the degree of inbreeding in the relic population. We found by segregation analysis of the bands scored in the DNA fingerprints of the Hispaniolan parrots that there may be as few as two to five loci identified by the human 33.15 probe. Furthermore, at one locus we identified seven alleles, one of which is represented by as many as 19 cosegregating bands. It is unknown how common multiband alleles might be in natural populations, and their existence will cause problems in the assessment of relatedness by band-sharing analysis. We believe, therefore, that a pedigree analysis should be included in all DNA fingerprinting studies, where possible, in order to estimate the number of loci identified by a minisatellite DNA probe and to examine the nature of their alleles.

  2. Cascade DNA nanomachine and exponential amplification biosensing.

    Science.gov (United States)

    Xu, Jianguo; Wu, Zai-Sheng; Shen, Weiyu; Xu, Huo; Li, Hongling; Jia, Lee

    2015-11-15

    DNA is a versatile scaffold for the assembly of multifunctional nanostructures, and potential applications of various DNA nanodevices have been recently demonstrated for disease diagnosis and treatment. In the current study, a powerful cascade DNA nanomachine was developed that can execute the exponential amplification of p53 tumor suppressor gene. During the operation of the newly-proposed DNA nanomachine, dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) was ingeniously introduced, where the target trigger is repeatedly used as the fuel molecule and the nicked fragments are dramatically accumulated. Moreover, each displaced nicked fragment is able to activate the another type of cyclical strand-displacement amplification, increasing exponentially the value of fluorescence intensity. Essentially, one target binding event can induce considerable number of subsequent reactions, and the nanodevice was called cascade DNA nanomachine. It can implement several functions, including recognition element, signaling probe, polymerization primer and template. Using the developed autonomous operation of DNA nanomachine, the p53 gene can be quantified in the wide concentration range from 0.05 to 150 nM with the detection limit of 50 pM. If taking into account the final volume of mixture, the detection limit is calculated as lower as 6.2 pM, achieving an desirable assay ability. More strikingly, the mutant gene can be easily distinguished from the wild-type one. The proof-of-concept demonstrations reported herein is expected to promote the development and application of DNA nanomachine, showing great potential value in basic biology and medical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

    1997-03-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  4. Assessing the Risk of Secondary Transfer Via Fingerprint Brush Contamination Using Enhanced Sensitivity DNA Analysis Methods.

    Science.gov (United States)

    Bolivar, Paula-Andrea; Tracey, Martin; McCord, Bruce

    2016-01-01

    Experiments were performed to determine the extent of cross-contamination of DNA resulting from secondary transfer due to fingerprint brushes used on multiple items of evidence. Analysis of both standard and low copy number (LCN) STR was performed. Two different procedures were used to enhance sensitivity, post-PCR cleanup and increased cycle number. Under standard STR typing procedures, some additional alleles were produced that were not present in the controls or blanks; however, there was insufficient data to include the contaminant donor as a contributor. Inclusion of the contaminant donor did occur for one sample using post-PCR cleanup. Detection of the contaminant donor occurred for every replicate of the 31 cycle amplifications; however, using LCN interpretation recommendations for consensus profiles, only one sample would include the contaminant donor. Our results indicate that detection of secondary transfer of DNA can occur through fingerprint brush contamination and is enhanced using LCN-DNA methods. © 2015 American Academy of Forensic Sciences.

  5. DNA fingerprinting in zoology: past, present, future.

    Science.gov (United States)

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-02-03

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

  6. Application of DNA fingerprints for cell-line individualization.

    Science.gov (United States)

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-09-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.

  7. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  8. Analysis of cellular and extracellular DNA in fingerprints

    Energy Technology Data Exchange (ETDEWEB)

    Button, Julie M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-09-09

    It has been previously shown that DNA can be recovered from latent fingerprints left on various surfaces [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. However, the source of the DNA, extracellular versus cellular origin, is difficult to determine. If the DNA is cellular, it is believed to belong to skin cells while extracellular DNA is believed to originate from body fluids such as sweat [D. J. Daly et. al, Forensic Sci. Int. Genet. 6, 41-46 (2012); V. V. Vlassov et. al, BioEssays 29, 654-667 (2007)]. The origin of the DNA in fingerprints has implications for processing and interpretation of forensic evidence. The determination of the origin of DNA in fingerprints is further complicated by the fact that the DNA in fingerprints tends to be at a very low quantity [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. This study examined fingerprints from five volunteers left on sterilized glass slides and plastic pens. Three fingerprints were left on each glass slide (thumb, index, and middle fingers) while the pens were held as if one was writing with them. The DNA was collected from the objects using the wet swabbing technique (TE buffer). Following collection, the cellular and extracellular components of each sample were separated using centrifugation and an acoustofluidics system. Centrifugation is still the primary separation technique utilized in forensics laboratories, while acoustic focusing uses sound waves to focus large particles (cells) into low pressure nodes, separating them from the rest of the sample matrix. After separation, all samples were quantified using real-time quantitative PCR (qPCR). The overall trend is that there is more DNA in the extracellular fractions than cellular fractions for both centrifugation and acoustofluidic processing. Additionally, more DNA was generally collected from the pen samples than the samples left on glass slides.

  9. Typing DNA profiles from previously enhanced fingerprints using direct PCR.

    Science.gov (United States)

    Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian

    2017-07-01

    Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold ® DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017

  10. DNA fingerprinting of the NCI-60 cell line panel.

    Science.gov (United States)

    Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

    2009-04-01

    The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

  11. Analysis of fingerprint samples, testing various conditions, for forensic DNA identification.

    Science.gov (United States)

    Ostojic, Lana; Wurmbach, Elisa

    2017-01-01

    Fingerprints can be of tremendous value for forensic biology, since they can be collected from a wide variety of evident types, such as handles of weapons, tools collected in criminal cases, and objects with no apparent staining. DNA obtained from fingerprints varies greatly in quality and quantity, which ultimately affects the quality of the resulting STR profiles. Additional difficulties can arise when fingerprint samples show mixed STR profiles due to the handling of multiple persons. After applying a tested protocol for sample collection (swabbing with 5% Triton X-100), DNA extraction (using an enzyme that works at elevated temperatures), and PCR amplification (AmpFlSTR® Identifiler® using 31cycles) extensive analysis was performed to better understand the challenges inherent to fingerprint samples, with the ultimate goal of developing valuable profiles (≥50% complete). The impact of time on deposited fingerprints was investigated, revealing that while the quality of profiles deteriorated, full STR profiles could still be obtained from samples after 40days of storage at room temperature. By comparing the STR profiles from fingerprints of the dominant versus the non-dominant hand, we found a slightly better quality from the non-dominant hand, which was not always significant. Substrates seem to have greater effects on fingerprints. Tests on glass, plastic, paper and metal (US Quarter dollar, made of Cu and Ni), common substrates in offices and homes, showed best results for glass, followed by plastic and paper, while almost no profiles were obtained from a Quarter dollar. Important for forensic casework, we also assessed three-person mixtures of touched fingerprint samples. Unlike routinely used approaches for sampling evidence, the surface of an object (bottle) was sectioned into six equal parts and separate samples were taken from each section. The samples were processed separately for DNA extraction and STR amplification. The results included a few single

  12. Comparison of Quantifiler(®) Trio and InnoQuant™ human DNA quantification kits for detection of DNA degradation in developed and aged fingerprints.

    Science.gov (United States)

    Goecker, Zachary C; Swiontek, Stephen E; Lakhtakia, Akhlesh; Roy, Reena

    2016-06-01

    The development techniques employed to visualize fingerprints collected from crime scenes as well as post-development ageing may result in the degradation of the DNA present in low quantities in such evidence samples. Amplification of the DNA samples with short tandem repeat (STR) amplification kits may result in partial DNA profiles. A comparative study of two commercially available quantification kits, Quantifiler(®) Trio and InnoQuant™, was performed on latent fingerprint samples that were either (i) developed using one of three different techniques and then aged in ambient conditions or (ii) undeveloped and then aged in ambient conditions. The three fingerprint development techniques used were: cyanoacrylate fuming, dusting with black powder, and the columnar-thin-film (CTF) technique. In order to determine the differences between the expected quantities and actual quantities of DNA, manually degraded samples generated by controlled exposure of DNA standards to ultraviolet radiation were also analyzed. A total of 144 fingerprint and 42 manually degraded DNA samples were processed in this study. The results indicate that the InnoQuant™ kit is capable of producing higher degradation ratios compared to the Quantifiler(®) Trio kit. This was an expected result since the degradation ratio is a relative value specific for a kit based on the length and extent of amplification of the two amplicons that vary from one kit to the other. Additionally, samples with lower concentrations of DNA yielded non-linear relationships of degradation ratio with the duration of aging, whereas samples with higher concentrations of DNA yielded quasi-linear relationships. None of the three development techniques produced a noticeably different degradation pattern when compared to undeveloped fingerprints, and therefore do not impede downstream DNA analysis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  14. DNA Profiles from Fingerprint Lifts-Enhancing the Evidential Value of Fingermarks Through Successful DNA Typing.

    Science.gov (United States)

    Subhani, Zuhaib; Daniel, Barbara; Frascione, Nunzianda

    2018-05-25

    This study evaluated the compatibility of the most common enhancement methods and lifting techniques with DNA profiling. Emphasis is placed on modern lifting techniques (i.e., gelatin lifters and Isomark™) and historical fingerprint lifts for which limited research has been previously conducted. A total of 180 fingerprints were deposited on a glass surface, enhanced, lifted, and processed for DNA typing. DNA could be extracted and profiled for all the powders and lifts tested and from both groomed fingerprints and natural prints with no significant difference in the percentage of profile recovered. DNA profiles could also be obtained from historical fingerprint lifts (79.2% of 72 lifts) with one or more alleles detected. These results demonstrate the compatibility between different powder/lift combinations and DNA profiling therefore augmenting the evidential value of fingerprints in forensic casework. © 2018 American Academy of Forensic Sciences.

  15. Recovery of DNA and fingerprints from touched documents.

    Science.gov (United States)

    Sewell, Jonathan; Quinones, Ignacio; Ames, Carole; Multaney, Bryan; Curtis, Stuart; Seeboruth, Haj; Moore, Stephen; Daniel, Barbara

    2008-09-01

    This study investigated the various factors affecting DNA profiling from DNA recovered from fingerprints deposited on paper before and after fingerprint enhancement treatments. The DNeasy plant mini kit (QIAGEN) was found to improve DNA recovery from paper by over 150% compared with the QIAamp mini kit. A significant decrease in the amount of DNA recovered was observed following treatment with DFO and/or Ninhydrin. This decrease in yield did not have a comparably significant effect on the quality of the SGM Plus profiles. Furthermore, this study found that whilst certain paper types, such as newspaper, magazine and filter paper allowed for the good recovery of DNA, common office paper and white card, strongly interfered with the recovery of DNA resulting in poor quality profiles.

  16. Laser mass spectrometry for DNA fingerprinting for forensic applications

    Science.gov (United States)

    Chen, C. H. Winston; Tang, Kai; Taranenko, N. I.; Allman, S. L.; Ch'ang, L. Y.

    1994-10-01

    The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual's DNA structure is identical within all tissues oftheir body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et aL2 found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. Take the Huntington gene as an example, there are CAG trinucleotide repeats. For normal people, the number of CAG repeats is usually between 10 and 40. Since people have chromosomes in pairs, the possibility oftwo individuals having the same VNTR in the Huntington gene is less than one percent, ifwe assume equal distribution for various repeats. When several allels containing VNTR are analyzed for the number of repeats, the possibility of two individuals being exactly identical becomes very unlikely. Thus, DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endornuclease sites can provide the basis for identification.

  17. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  18. Recovery of DNA from latent fingerprint tape lifts archived against matte acetate.

    Science.gov (United States)

    Steadman, Shelly A; Hoofer, Steven R; Geering, Sarah C; King, Stephanie; Bennett, Marc A

    2015-05-01

    This study was driven by court order to examine methods to remove, extract, and STR-type potential DNA entrapped between latent fingerprint lifting tape and matte acetate that was collected from a 1977 crime scene. Results indicate that recovery of appreciable quantities of DNA is more challenging once adhesive is attached to matte acetate cards and even more difficult when fixed following black powder enhancement. STR amplification of extracts from entrapped fingermarks collected following the dusting/lifting procedure did not produce robust profiles, and extraneous peaks not expressed by print donors were detected for some samples. A hearing was set to argue whether there was DNA remaining to be tested, and if so, whether that DNA could be exculpatory in this postconviction matter. The studies herein provided the basis for the court's decision to not require the testing. © 2015 American Academy of Forensic Sciences.

  19. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    Science.gov (United States)

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  20. DNA fingerprinting based on simple sequence repeat (SSR ...

    African Journals Online (AJOL)

    New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

  1. SSR marker based DNA fingerprinting and diversity study in rice ...

    African Journals Online (AJOL)

    The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

  2. Multiple displacement amplification of whole genomic DNA from urediospores of Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Zhang, R; Ma, Z H; Wu, B M

    2015-05-01

    Biotrophic fungi, such as Puccinia striiformis f. sp. tritici, because they cannot be cultured on nutrient media, to obtain adequate quantity of DNA for molecular genetic analysis, are usually propagated on living hosts, wheat plants in case of P. striiformis f. sp. tritici. The propagation process is time-, space- and labor-consuming and has been a bottleneck to molecular genetic analysis of this pathogen. In this study we evaluated multiple displacement amplification (MDA) of pathogen genomic DNA from urediospores as an alternative approach to traditional propagation of urediospores followed by DNA extraction. The quantities of pathogen genomic DNA in the products were further determined via real-time PCR with a pair of primers specific for the β-tubulin gene of P. striiformis f. sp. tritici. The amplified fragment length polymorphism (AFLP) fingerprints were also compared between the DNA products. The results demonstrated that adequate genomic DNA at fragment size larger than 23 Kb could be amplified from 20 to 30 urediospores via MDA method. The real-time PCR results suggested that although fresh urediospores collected from diseased leaves were the best, spores picked from diseased leaves stored for a prolonged period could also be used for amplification. AFLP fingerprints exhibited no significant differences between amplified DNA and DNA extracted with CTAB method, suggesting amplified DNA can represent the pathogen's genomic DNA very well. Therefore, MDA could be used to obtain genomic DNA from small precious samples (dozens of spores) for molecular genetic analysis of wheat stripe rust pathogen, and other fungi that are difficult to propagate.

  3. Integrated DNA and fingerprint analyses in the identification of 60-year-old mummified human remains discovered in an Alaskan glacier.

    Science.gov (United States)

    Loreille, Odile M; Parr, Ryan L; McGregor, Kevin A; Fitzpatrick, Colleen M; Lyon, Chriss; Yang, Dongya Y; Speller, Camilla F; Grimm, Michael R; Grimm, Michael J; Irwin, Jodi A; Robinson, Edward M

    2010-05-01

    This report describes the identification of a merchant mariner who perished in 1948 when Northwest Airlines Flight 4422, a DC-4 carrying 24 seamen and six crew members crashed into Mount Sanford, Alaska. Fifty-one years later, a human forearm and hand were found close by the wreckage of the plane, prompting identification efforts using DNA and fingerprints. There were significant challenges to both the fingerprint and DNA analyses. The hand was badly desiccated, making fingerprint friction-ridge detail almost invisible and the remains had been embalmed upon discovery, making DNA amplification difficult. We present the results of an interdisciplinary approach that successfully addressed these challenges and ultimately led to the identification of the remains. These efforts relied on efficient fingerprint rejuvenation and imaging techniques that improved print resolution, as well as new DNA extraction techniques optimized for aggressively embalmed remains.

  4. DNA Electronic Fingerprints by Local Spectroscopy on Graphene

    Science.gov (United States)

    Balatsky, Alexander

    2013-03-01

    Working and scalable alternatives to the conventional chemical methods of DNA sequencing that are based on electronic/ionic signatures would revolutionize the field of sequencing. The approach of a single molecule imaging and spectroscopy with unprecedented resolution, achieved by Scanning Tunneling Spectroscopy (STS) and nanopore electronics could enable this revolution. We use the data from our group and others in applying this local scanning tunneling microscopy and illustrate possibilities of electronic sequencing of freeze dried deposits on graphene. We will present two types of calculated fingerprints: first in Local Density of States (LDOS) of DNA nucleotide bases (A,C,G,T) deposited on graphene. Significant base-dependent features in the LDOS in an energy range within few eV of the Fermi level were found in our calculations. These features can serve as electronic fingerprints for the identification of individual bases in STS. In the second approach we present calculated base dependent electronic transverse conductance as DNA translocates through the graphene nanopore. Thus we argue that the fingerprints of DNA-graphene hybrid structures may provide an alternative route to DNA sequencing using STS. Work supported by US DOE, NORDITA.

  5. DNA fingerprinting sets for four southern pines

    Science.gov (United States)

    Craig Echt; Sedley Josserand

    2018-01-01

    DNA markers can provide valuable genetic information for forest tree research, breeding, conservation, and restoration programs. When properly evaluated, selected sets of DNA markers can be used to efficiently get information about genetic diversity in regions, forests, or stands, or in seed lots and orchards. Selected markers also can be used to determine parentage or...

  6. Drama Drives a DNA Fingerprinting Lab Exercise.

    Science.gov (United States)

    Rubenstein, Elaine C.; And Others

    1996-01-01

    Presents a laboratory exercise for an intermediate cell and molecular biology course that uses a murder-mystery play. Provokes students to think critically about important issues in scientific methodology in general and DNA analysis in particular. (JRH)

  7. An overview of DNA fingerprinting with 32P nucleotides

    International Nuclear Information System (INIS)

    Pappas, G.G.

    1992-01-01

    The DNA probes radiolabeled with 32 P, a primary tool employed by researchers in the life sciences for > 20 yr, are used by private companies, state-run laboratories, and the FBI to generate autoradiographs displaying the unique banding patterns that constitute the DNA fingerprint. The ability to identify an individual or animal from a biological sample has profound implications. Unidentified bodies, unrecognizable remains, and missing children can be tested and the DNA fingerprint compared to those of family members for positive identification. Paternity can be established before a child's birth. Immigration disputes can easily be resolved. Other uses include pedigree determination and testing for cell-line cross-contamination. Using a DNA fingerprint to determine the guilt or innocence of an individual allegedly involved in a violent crime is very controversial and has great legal and moral implications for society. Forensic laboratories have been challenged to ensure a level of quality control and quality assurance consistent with the weight given to these tests when used as evidence in a court of law

  8. Development of an optimized random amplified polymorphic DNA protocol for fingerprinting of Klebsiella pneumoniae.

    Science.gov (United States)

    Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M

    2012-04-01

    To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  9. Multilocus DNA fingerprints in gallinaceous birds: general approach and problems.

    Science.gov (United States)

    Hanotte, O; Bruford, M W; Burke, T

    1992-06-01

    Multilocus profiles were investigated in five different species of Galliformes (ring-necked pheasant Phasianus colchicus, Indian peafowl Pavo cristatus, Japanese quail Coturnix coturnix japonica, domestic chicken Gallus gallus, and red grouse Lagopus lagopus scoticus) using two human multilocus probes (33.6 and 33.15) in combination with each of four restriction enzymes (AluI, DdeI, HaeIII or HinfI). All the species show a DNA fingerprint-like pattern using at least one restriction enzyme in combination with each multilocus probe. The number of bands detected and the value of the index of similarity for each species differ significantly between the profiles obtained with each multilocus probe. Some enzyme/probe combinations reveal strong cross-hybridization of the multilocus probes with satellite or satellite-like DNA sequences in pheasant, peacock, quail and chicken, which partially or completely prevented scoring of the profile. The choice of restriction enzyme was found to influence the number of bands, the value of the index of similarity and the probability of obtaining an identical fingerprint between unrelated individuals. The Mendelian inheritance and independent segregation of the fragments detected using AluI was investigated in three species (ring-necked pheasant, Indian peafowl and red grouse). Some bands were shown to be tightly linked. An extreme case was encountered in the red grouse, where 12 of the 15 bands scored in one parent represented only two, apparently allelic, haplotypes and so derived from a single locus. However, fingerprint patterns will often be adequate for use in paternity analyses, such as in behavioural studies, despite the occurrence of haplotypic sets of bands. Identical DNA multilocus profiles were sometimes observed between captive-bred siblings in one species. These results emphasize the desirability of determining, in each new species, the optimal experimental conditions as a preliminary to any behavioural or population

  10. Virulence properties and random amplification of polymorphic DNA ...

    African Journals Online (AJOL)

    Genotypic and phenotypic characterization as well as studies on the virulence factors of Candida albicans isolates obtained from oral cavity of patients was carried out using random amplified polymorphic DNA (RAPD) fingerprinting and epithelial cells adherence assay, respectively. RAPD patterns revealed the presence of ...

  11. Chemically induced DNA hypomethylation in breast carcinoma cells detected by the amplification of intermethylated sites

    International Nuclear Information System (INIS)

    Sadikovic, Bekim; Haines, Thomas R; Butcher, Darci T; Rodenhiser, David I

    2004-01-01

    Compromised patterns of gene expression result in genomic instability, altered patterns of gene expression and tumour formation. Specifically, aberrant DNA hypermethylation in gene promoter regions leads to gene silencing, whereas global hypomethylation events can result in chromosomal instability and oncogene activation. Potential links exist between environmental agents and DNA methylation, but the destabilizing effects of environmental exposures on the DNA methylation machinery are not understood within the context of breast cancer aetiology. We assessed genome-wide changes in methylation patterns using a unique methylation profiling technique called amplification of intermethylated sites (AIMS). This method generates easily readable fingerprints that represent the investigated cell line's methylation profile, based on the differential cleavage of DNA with methylation-specific isoschisomeric restriction endonucleases. We validated this approach by demonstrating both unique and reoccurring sites of genomic hypomethylation in four breast carcinoma cell lines treated with the cytosine analogue 5-azacytidine. Comparison of treated with control samples revealed individual bands that exhibited methylation changes, and these bands were excized and cloned, and the precise genomic location individually identified. In most cases, these regions of hypomethylation coincided with susceptible target regions previously associated with chromosome breakage, rearrangement and gene amplification. Similarly, we observed that acute benzopyrene exposure is associated with altered methylation patterns in these cell lines. These results reinforce the link between environmental exposures, DNA methylation and breast cancer, and support a role for AIMS as a rapid, affordable screening method to identify environmentally induced DNA methylation changes that occur in tumourigenesis

  12. DNA amplification is rare in normal human cells

    International Nuclear Information System (INIS)

    Wright, J.A.; Watt, F.M.; Hudson, D.L.; Stark, G.R.; Smith, H.S.; Hancock, M.C.

    1990-01-01

    Three types of normal human cells were selected in tissue culture with three drugs without observing a single amplification event from a total of 5 x 10 8 cells. No drug-resistant colonies were observed when normal foreskin keratinocytes were selected with N-(phosphonacetyl)-L-aspartate or with hydroxyurea or when normal mammary epithelial cells were selected with methotrexate. Some slightly resistant colonies with limited potential for growth were obtained when normal diploid fibroblast cells derived from fetal lung were selected with methotrexate or hydroxyurea but careful copy-number analysis of the dihydrofolate reductase and ribonucleotide reductase genes revealed no evidence of amplification. The rarity of DNA amplification in normal human cells contrasts strongly with the situation in tumors and in established cell lines, where amplification of onogenes and of genes mediating drug resistance is frequent. The results suggest that tumors and cell lines have acquired the abnormal ability to amplify DNA with high frequency

  13. DNA sequence responsible for the amplification of adjacent genes.

    Science.gov (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  14. Fingerprint enhancement revisited and the effects of blood enhancement chemicals on subsequent profiler Plus fluorescent short tandem repeat DNA analysis of fresh and aged bloody fingerprints.

    Science.gov (United States)

    Frégeau, C J; Germain, O; Fourney, R M

    2000-03-01

    This study was aimed at determining the effect of seven blood enhancement reagents on the subsequent Profiler Plus fluorescent STR DNA analysis of fresh or aged bloody fingerprints deposited on various porous and nonporous surfaces. Amido Black, Crowle's Double Stain. 1,8-diazafluoren-9-one (DFO), Hungarian Red, leucomalachite green, luminol and ninhydrin were tested on linoleum, glass, metal, wood (pine, painted white), clothing (85% polyester/15% cotton, 65% polyester/35% cotton, and blue denim) and paper (Scott 2-ply and Xerox-grade). Preliminary experiments were designed to determine the optimal blood dilutions to use to ensure a DNA typing result following chemical enhancement. A 1:200 blood dilution deposited on linoleum and enhanced with Crowle's Double Stain generated enough DNA for one to two rounds of Profiler Plus PCR amplification. A comparative study of the DNA yields before and after treatment indicated that the quantity of DNA recovered from bloody fingerprints following enhancement was reduced by a factor of 2 to 12. Such a reduction in the DNA yields could potentially compromise DNA typing analysis in the case of small stains. The blood enhancement chemicals selected were also evaluated for their capability to reveal bloodmarks on the various porous and nonporous surfaces chosen in this study. Luminol. Amido Black and Crowle's Double Stain showed the highest sensitivity of all seven chemicals tested and revealed highly diluted (1:200) bloody fingerprints. Both luminol and Amido Black produced excellent results on both porous and nonporous surfaces, but Crowle's Double Stain failed to produce any results on porous substrates. Hungarian Red, DFO, leucomalachite green and ninhydrin showed lower sensitivities. Enhancement of bloodmarks using any of the chemicals selected, and short-term exposure to these same chemicals (i.e., less than 54 days), had no adverse effects on the PCR amplification of the nine STR systems surveyed (D3S 1358, HumvWA, Hum

  15. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  16. DNA fingerprinting in zoology: past, present, future

    Science.gov (United States)

    2014-01-01

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic ‘paradigm shifts’ during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys’ identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as ‘DNA fingerprinting’, also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys’ invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys’ pioneering work. PMID:24490906

  17. Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes.

    Science.gov (United States)

    Tims, Sebastian; van Wamel, Willem; Endtz, Hubert P; van Belkum, Alex; Kayser, Manfred

    2010-09-01

    Human fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically restricted DNA diversity. We tested the suitability of physical fingerprints for revealing human host information, with geographic inference as example, via microbial DNA fingerprinting. We showed that the transient exogenous fingertip microflora is frequently different from the resident endogenous bacteria of the same individuals. In only 54% of the experiments, the DNA analysis of the transient fingertip microflora allowed the detection of defined, but often not the major, elements of the resident microflora. Although we found microbial persistency in certain individuals, time-wise variation of transient and resident microflora within individuals was also observed when resampling fingerprints after 3 weeks. While microbial species differed considerably in their frequency spectrum between fingerprint samples from volunteers in Europe and southern Asia, there was no clear geographic distinction between Staphylococcus strains in a cluster analysis, although bacterial genotypes did not overlap between both continental regions. Our results, though limited in quantity, clearly demonstrate that the dynamic fingerprint microflora challenges human host inferences for forensic purposes including geographic ones. Overall, our results suggest that human fingerprint microflora is too dynamic to allow for forensic marker developments for retrieving human information.

  18. DNA fingerprinting of pearls to determine their origins.

    Directory of Open Access Journals (Sweden)

    Joana B Meyer

    Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

  19. IDENTIFICATION OF ANIMAL ADHESIVES USING DNA AMPLIFICATION

    DEFF Research Database (Denmark)

    Eriksen, Anne Marie; Kristensen, Hans Viborg; Bøllingtoft, Peder

    2014-01-01

    The aim of this study was to examine whether DNA was degraded in the manufacturing of animal glue. To test this, two different types of sturgeon glue (Acipenser sp.) were manufactured using historic recipes. One glue was boiled for a substantial amount of time and the other was kept under 75°C. DNA...... of the glue and in 18 out of 24 samples collected of the canvas. In four out of the five cases where it was not possible amplify DNA, the sample belongs to the smallest size of the canvas investigated. As shown in this study it is possible to get DNA out of boiled animal glue and glue applied onto canvas...

  20. DNA fingerprinting, biological and chemical investigation of certain Yucca species.

    Science.gov (United States)

    El Hawary, Seham; El Sayed, Abeer; Helmy, Maged W; El Naggar, El Moataz Bellah; Marzouk, Hanan S; Bassam, Samar M

    2018-01-05

    Yucca aloifolia, Y. aloifolia variegata, Y. elephantipes and Y. filamentosa were investigated. DNA sequencing was performed for the four plants and a genomic DNA fingerprint was obtained and provided. The cytotoxic activities against four human cancer cell lines were investigated. The ethanolic extracts of leaves of Y. aloifolia variegata prevailed, especially against liver cancer HepG-2 and breast cancer MCF-7. In vivo assessment of hepatoprotective activity in rats also revealed the hepatoprotective potential of the ethanolic extracts of the four plants against CCl 4 - induced rats' liver damage. Qualitative and quantitative analysis of the flavonoid and phenolic content of the promising species was performed using HPLC. The analysis identified and quantified 18 flavonoids and 19 phenolic acids in the different fractions of Y. aloifolia variegata, among which the major flavonoids were hesperidin and kaemp-3-(2-p-coumaroyl) glucose and the major phenolic acids were gallic acid and protocatechuic acid.

  1. Genetic signatures from amplification profiles characterize DNA mutation in somatic and radiation-induced sports of chrysanthemum

    International Nuclear Information System (INIS)

    Trigiano, R.N.; Scott, M.C.; Caetano-Anolles, G.

    1998-01-01

    The chrysanthemum (Dendranthema grandiflora Tzvelev.) cultivars 'Dark Charm', 'Salmon Charm', 'Coral Charm' and 'Dark Bronze Charm' are either radiation-induced mutants or spontaneous sports of 'Charm' and constitute a family or series of plants that primarily differ in flower color. These cultivars, which were difficult to differentiate genetically by DNA amplification fingerprinting (DAF), were easily identified by using arbitrary signatures from amplification profiles (ASAP). Genomic DNA was first amplified with three standard octamer arbitrary primers, all of which produced monomorphic profiles. Products from each of these DNA fingerprints were subsequently reamplified using four minihairpin decamer primers. The 12 primer combinations produced signatures containing approximately 37% polymorphic character loci, which were used to estimate genetic relationships between cultivars. Forty-six (32%) unique amplification products were associated with individual cultivars. The number of ASAP polymorphisms detected provided an estimate of the mutation rate in the mutant cultivars, ranging from 0.03% to 1.6% of nucleotide changes within an average of 18 kb of arbitrary amplified DAF sequence. The ASAP technique permits the clear genetic identification of somatic mutants and radiation-induced sports that are genetically highly homogeneous and should facilitate marker assisted breeding and protection of plant breeders rights of varieties or cultivars

  2. [An analysis of the DNA fingerprinting of intestinal flora in inflammatory bowel disease].

    Science.gov (United States)

    Li, Run-mei; Han, Ying; Wang, Ji-heng; Wang, Zhi-hong

    2007-02-01

    DNA fingerprinting for inflammatory bowel disease (IBD) patients and healthy subjects was carried out to compare the difference of intestinal flora between the two groups. DNA fingerprinting for IBD patients and healthy persons was set up with enterobacterial repetitive intergenic consensus (ERIC-PCR) technology and the difference of intestinal flora between the two groups compared. DNA fingerprinting of the IBD patients and healthy subjects was identified and a significant difference was noticed between them. There were lots of bands in the DNA fingerprinting of the healthy subjects but few in that of the IBD patients. Strikingly, same distribution of the principal band of DNA fingerprinting was noticed in IBD patients. The variety of intestinal flora in healthy subjects is more apparent than that in IBD patients. An unique principal band might be the sequence of the presence of specific etiopathogenetic bacterium, or it might be the combined sequence of mixed bacterial flora.

  3. DNA fingerprinting of lactic acid bacteria in sauerkraut fermentations.

    Science.gov (United States)

    Plengvidhya, Vethachai; Breidt, Fredrick; Lu, Zhongjing; Fleming, Henry P

    2007-12-01

    Previous studies using traditional biochemical identification methods to study the ecology of commercial sauerkraut fermentations revealed that four species of lactic acid bacteria, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis, were the primary microorganisms in these fermentations. In this study, 686 isolates were collected from four commercial fermentations and analyzed by DNA fingerprinting. The results indicate that the species of lactic acid bacteria present in sauerkraut fermentations are more diverse than previously reported and include Leuconostoc citreum, Leuconostoc argentinum, Lactobacillus paraplantarum, Lactobacillus coryniformis, and Weissella sp. The newly identified species Leuconostoc fallax was also found. Unexpectedly, only two isolates of P. pentosaceus and 15 isolates of L. brevis were recovered during this study. A better understanding of the microbiota may aid in the development of low-salt fermentations, which may have altered microflora and altered sensory characteristics.

  4. Touch DNA collection versus firearm fingerprinting: comparing evidence production and identification outcomes.

    Science.gov (United States)

    Nunn, Samuel

    2013-05-01

    A project by a metropolitan police agency in 2008-2009 had police use touch DNA kits to collect cell samples from seized firearms. To assess outcomes, results of touch DNA swabbing of firearms were compared to fingerprinting firearm evidence. The rationale was that fingerprinting, as the older technology, was the baseline against which to compare touch DNA. But little is known about ways to measure touch DNA productivity compared to fingerprinting. To examine differences between the two requires comparable measurements. Two measures were used: quantity of probative or investigative evidence produced and identification outcomes. When applied to firearms seized within an Indianapolis, IN police district, touch DNA produced a larger volume of evidence than fingerprinting, but identification outcomes for the two methods were equal. Because touch DNA was deployed by police patrol officers, there are implications for firearm forensics and the choice of forensic approaches used by police. © 2013 American Academy of Forensic Sciences.

  5. Characterization of selection effects on broiler lines using DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    GS Schmidt

    2003-05-01

    Full Text Available The objective of this study was to evaluate the effect of selection for body weight on the genetic variability and diversity in broiler lines. Two paternal broiler lines (LL and LLc were used. LL line was selected for 12 generations for growth and carcass and reproduction characteristics. The LLc line was established from LL line in 1985 and mated at random. Blood samples from six chickens per line were collected and used for molecular analysis. Also, a DNA pool was made for each line to compare effects between lines. Data were analyzed considering the collected information on the presence or absence of DNA bands. Band sharing scores were calculated using the DICE coefficient. The pattern of the 21 most representative bands was used. DNA fingerprinting (DFP showed 90.48 % of polymorphism bands for both lines. Difference between lines was not due to the presence or absence of bands, but to the frequency of such bands in each genotype. Considering that both lines had the same genetic background, changes on band frequency were probably due to selection. Selection for body weight had an effect on the band frequency as evaluated by DFP, and for this reason this technique could be used as a tool in the selection process. Results also suggest that bands 4, 5 and 19 were linked to body weight traits, and bands 9, 10, 12, 13 and 21 were linked to reproductive traits such as egg production.

  6. Combined histochemical staining, RNA amplification, regional, and single cell cDNA analysis within the hippocampus.

    Science.gov (United States)

    Ginsberg, Stephen D; Che, Shaoli

    2004-08-01

    The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.

  7. Age Estimation with DNA: From Forensic DNA Fingerprinting to Forensic (Epi)Genomics: A Mini-Review.

    Science.gov (United States)

    Parson, Walther

    2018-01-23

    Forensic genetics developed from protein-based techniques a quarter of a century ago and became famous as "DNA fingerprinting," this being based on restriction fragment length polymorphisms (RFLPs) of high-molecular-weight DNA. The amplification of much smaller short tandem repeat (STR) sequences using the polymerase chain reaction soon replaced RFLP analysis and advanced to become the gold standard in genetic identification. Meanwhile, STR multiplexes have been developed and made commercially available which simultaneously amplify up to 30 STR loci from as little as 15 cells or fewer. The enormous information content that comes with the large variety of observed STR genotypes allows for genetic individualisation (with the exception of identical twins). Carefully selected core STR loci form the basis of intelligence-led DNA databases that provide investigative leads by linking unsolved crime scenes and criminals through their matched STR profiles. Nevertheless, the success of modern DNA fingerprinting depends on the availability of reference material from suspects. In order to provide new investigative leads in cases where such reference samples are absent, forensic scientists started to explore the prediction of phenotypic traits from the DNA of the evidentiary sample. This paradigm change now uses DNA and epigenetic markers to forecast characteristics that are useful to triage further investigative work. So far, the best investigated externally visible characteristics are eye, hair and skin colour, as well as geographic ancestry and age. Information on the chronological age of a stain donor (or any sample donor) is elemental for forensic investigations in a number of aspects and has, therefore, been explored by researchers in some detail. Among different methodological approaches tested to date, the methylation-sensitive analysis of carefully selected DNA markers (CpG sites) has brought the most promising results by providing prediction accuracies of ±3-4 years

  8. Compatibility of DNA IQ™, QIAamp® DNA Investigator, and QIAsymphony® DNA Investigator® with various fingerprint treatments.

    Science.gov (United States)

    Lin, Sze-Wah; Ip, Stephen C Y; Lam, Tze-Tsun; Tan, Tung-Fai; Yeung, Wai-Lung; Tam, Wai-Ming

    2017-03-01

    Latent fingerprint and touch DNA are the two most important contact evidence for individualization in forensic science which provide complementary information that can lead to direct and unequivocal identification of the culprit. In order to retrieve useful information from both fingerprints and DNA, which are usually mingled together, one strategy is to perform fingerprint examination prior to DNA analysis since common DNA sampling technique such as swabbing could disturb or even destroy fingerprint details. Here, we describe the compatibility of three automatic DNA extraction systems, namely, DNA IQ™, QIAamp ® DNA Investigator, and QIAsymphony ® DNA Investigator ® , with respective to the effects of various fingerprint detection techniques. Our results demonstrate that Super Glue fingerprint treatment followed by DNA IQ™ extraction shows better effectiveness in DNA profiling. Aluminum powder dusting offers the least interference to the three DNA extraction systems above. Magnetic powder dusting, on the other hand, strongly impedes DNA recovery. Physical Developer is the most intrusive, which yields profiles with poor quality, including lower peak heights, poor peak height ratios, and poor intra-color balance. In terms of the choice of extraction method, DNA IQ™ system is recommended for sampling after fingerprint treatments, but not the two DNA Investigator systems.

  9. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    Science.gov (United States)

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  10. Blocking human contaminant DNA during PCR allows amplification of rare mammal species from sedimentary ancient DNA

    DEFF Research Database (Denmark)

    Boessenkool, Sanne; Epp, Laura S.; Haile, James Seymour

    2012-01-01

    the amplification of contaminant sequences to such an extent that retrieval of the endogenous DNA is severely restricted. The application of blocking primers is a promising tool to avoid this bias and can greatly enhance the quantity and the diversity of the endogenous DNA sequences that are amplified....

  11. Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

    1995-01-01

    textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

  12. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  13. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  14. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    International Nuclear Information System (INIS)

    Dallas, J.F.

    1988-01-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  15. Interstrain polymorphisms of isoenzyme profiles and mitochondrial DNA fingerprints among seven strains assigned to Acanthamoeba polyphaga.

    Science.gov (United States)

    Kong, H H; Park, J H; Chung, D I

    1995-12-01

    Interstrain polymorphisms of isoenzyme profiles and mitochondrial (Mt) DNA fingerprints were observed among seven strains of Acanthamoeba isolated from different sources and morphologically assigned to A. polyphaga. Mt DNA fingerprints by eight restriction endonucleases (Bgl II, Sca I, Cla I, EcoR I, Xba I, Kpn I, Sal I, and Sst I) revealed considerable interstrain polymorphisms. Isoenzyme profiles revealed considerable interstrain polymorphisms for acid phosphatase, lactate dehydrogenase, and glucose-6-phosphate dehydrogenase while those for glucose phosphate isomerase, leucine aminopeptidase, and malate dehydrogenase showed similarity. Despite of the interstrain polymorphisms, the isoenzyme profiles and Mt DNA fingerprints of the strain Ap were found to be identical with those of the strain Jones. Mt DNA fingerprinting was found to be highly applicable for the strain identification, characterization, and differentiation.

  16. Cranberry SSR multiplexing panels for DNA horticultural fingerprinting and genetic studies

    Science.gov (United States)

    Cranberry (Vaccinium macrocarpon) is in need of inexpensive high-throughput DNA fingerprinting methods for genetic research and germplasm purity testing for agricultural purposes. Therefore, we designed and validated 16-multiplexing panels containing 61 evenly distributed simple sequence (SSR) marke...

  17. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  18. On some surprising statistical properties of a DNA fingerprinting technique called AFLP

    NARCIS (Netherlands)

    Gort, G.

    2010-01-01

    AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

  19. DNA Fingerprinting of Olive Varieties by Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Dunja Bandelj

    2002-01-01

    Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.

  20. dna and seed proteins fingerprinting of egyptian crop plants

    African Journals Online (AJOL)

    Dr. Haddad

    2012-11-01

    Nov 1, 2012 ... combinations were used for fingerprinting six cultivars which belongs to barley, rice and wheat cultivars leading to the production of numerous AFLP bands, 300 of them were polymorphic. Thirty SSR markers were obtained from fingerprinting eight cultivars belonging to the five studied species using 11.

  1. Electrochemical DNA biosensor based on MNAzyme-mediated signal amplification

    International Nuclear Information System (INIS)

    Diao, Wei; Tang, Min; Ding, Xiaojuan; Zhang, Ye; Yang, Jianru; Cheng, Wenbin; Mo, Fei; Wen, Bo; Xu, Lulu; Yan, Yurong

    2016-01-01

    The authors describe an electrochemical sensing strategy for highly sensitive and specific detection of target (analyte) DNA based on an amplification scheme mediated by a multicomponent nucleic acid enzyme (MNAzyme). MNAzymes were formed by multicomponent complexes which produce amplified “output” signals in response to specific “input” signal. In the presence of target nucleic acid, multiple partial enzymes (partzymes) oligonucleotides are assembled to form active MNAzymes. These can cleave H0 substrate into two pieces, thereby releasing the activated MNAzyme to undergo an additional cycle of amplification. Here, the two pieces contain a biotin-tagged sequence and a byproduct. The biotin-tagged sequences are specifically captured by the detection probes immobilized on the gold electrode. By employing streptavidinylated alkaline phosphatase as an enzyme label, an electrochemical signal is obtained. The electrode, if operated at a working potential of 0.25 V (vs. Ag/AgCl) in solution of pH 7.5, covers the 100 pM to 0.25 μM DNA concentration range, with a 79 pM detection limit. In our perception, the strategy introduced here has a wider potential in that it may be applied to molecular diagnostics and pathogen detection. (author)

  2. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

    Science.gov (United States)

    Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

    2010-11-01

    Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

  3. DNA fingerprinting on trial: the dramatic early history of a new forensic technique.

    Science.gov (United States)

    Aronson, Jay D

    2005-09-01

    The early history of "DNA fingerprinting" in the UK might have been different were it not for the accounts of two dramatic courtroom trials, made by the participants and the media, in the mid-1980s. But these reports, which misrepresented the importance DNA evidence had in the trials, left a strong impression on the British public and on judges on both sides of the Atlantic. These trials, widely considered to be the first "victories" for DNA fingerprinting, have been frequently cited as proof of the utility and reliability of the technique, in both the UK and beyond. But in reality, it was the threat of DNA evidence being used rather than the integrity or validity of it that resolved these cases. At that time, DNA fingerprinting was still in its infancy, an untried and untested technology.

  4. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    Science.gov (United States)

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  5. DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

    Science.gov (United States)

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  6. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    Directory of Open Access Journals (Sweden)

    Peng Gao

    Full Text Available Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines. Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR codes of 471 melon varieties (lines were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  7. DNA Fingerprinting of Single Colonies of Helicobacter pylori from Gastric Cancer Patients Suggests Infection with a Single Predominant Strain

    OpenAIRE

    Miehlke, Stephan; Thomas, Rachel; Guiterrez, Oscar; Graham, David Y.; Go, Mae F.

    1999-01-01

    In each of six gastric cancer patients, repetitive extragenic palindromic PCR DNA fingerprints of 18 single colonies of Helicobacter pylori from the gastric antrum, corpus, and cardia were identical and matched that of the parental isolate. In three additional gastric cancer patients, 17 of 18 single-colony DNA fingerprints were identical to each other and to the DNA fingerprint of the corresponding parental isolate.

  8. Characterization of human glioblastoma cell lines in vitro and their xenografts in nude mice by DNA fingerprinting

    DEFF Research Database (Denmark)

    Türeci, O; Fischer, H; Lagoda, P

    1990-01-01

    Human gliomas were grown as permanent tissue cultures and xenografts in nude mice. DNA fingerprint patterns from two human gliomas were established using two different hypervariable multilocus probes [( GTG]5 and 33.15). In general the cell lines investigated showed an overall stability in the DNA...... fingerprint pattern. However, differences in the DNA fingerprint patterns were shown to occur depending upon the above mentioned parameters....

  9. Cloning and Characterization of a Complex DNA Fingerprinting Probe for Candida parapsilosis

    Science.gov (United States)

    Enger, Lee; Joly, Sophie; Pujol, Claude; Simonson, Patricia; Pfaller, Michael; Soll, David R.

    2001-01-01

    Candida parapsilosis accounts for a significant number of nosocomial fungemias, but in fact, no effective and verified genetic fingerprinting method has emerged for assessing the relatedness of independent isolates for epidemiological studies. A complex 15-kb DNA fingerprinting probe, Cp3-13, was therefore isolated from a library of C. parapsilosis genomic DNA fragments. The efficacy of Cp3-13 for DNA fingerprinting was verified by a comparison of its clustering capacity with those of randomly amplified polymorphic DNA analysis and internally transcribed spacer region sequencing, by testing species specificity, and by assessing its capacity to identify microevolutionary changes both in vitro and in vivo. Southern blot hybridization of EcoRI/SalI-digested DNA with Cp3-13 provides a fingerprinting system that (i) identifies the same strain in independent isolates, (ii) discriminates between unrelated isolates, (iii) separates independent isolates into valid groups in a dendrogram, (iv) identifies microevolution in infecting populations, and (v) is amenable to automatic computer-assisted DNA fingerprint analysis. This probe is now available for epidemiological studies. PMID:11158125

  10. The examination of Hevea brasiliensis plants produced by in vitro culture and mutagenesis by DNA fingerprinting techniques

    International Nuclear Information System (INIS)

    Low, F.C.; Atan, S.; Jaafar, H.

    1998-01-01

    Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of

  11. Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

    Science.gov (United States)

    Bowden, G; Johnson, J; Schachtele, C

    1993-08-01

    Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

  12. Classification of human cancers based on DNA copy number amplification modeling

    Directory of Open Access Journals (Sweden)

    Knuutila Sakari

    2008-05-01

    Full Text Available Abstract Background DNA amplifications alter gene dosage in cancer genomes by multiplying the gene copy number. Amplifications are quintessential in a considerable number of advanced cancers of various anatomical locations. The aims of this study were to classify human cancers based on their amplification patterns, explore the biological and clinical fundamentals behind their amplification-pattern based classification, and understand the characteristics in human genomic architecture that associate with amplification mechanisms. Methods We applied a machine learning approach to model DNA copy number amplifications using a data set of binary amplification records at chromosome sub-band resolution from 4400 cases that represent 82 cancer types. Amplification data was fused with background data: clinical, histological and biological classifications, and cytogenetic annotations. Statistical hypothesis testing was used to mine associations between the data sets. Results Probabilistic clustering of each chromosome identified 111 amplification models and divided the cancer cases into clusters. The distribution of classification terms in the amplification-model based clustering of cancer cases revealed cancer classes that were associated with specific DNA copy number amplification models. Amplification patterns – finite or bounded descriptions of the ranges of the amplifications in the chromosome – were extracted from the clustered data and expressed according to the original cytogenetic nomenclature. This was achieved by maximal frequent itemset mining using the cluster-specific data sets. The boundaries of amplification patterns were shown to be enriched with fragile sites, telomeres, centromeres, and light chromosome bands. Conclusions Our results demonstrate that amplifications are non-random chromosomal changes and specifically selected in tumor tissue microenvironment. Furthermore, statistical evidence showed that specific chromosomal features

  13. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  14. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  15. Usefulness of the secondary probe pTBN12 in DNA fingerprinting of Mycobacterium tuberculosis.

    OpenAIRE

    Chaves, F; Yang, Z; el Hajj, H; Alonso, M; Burman, W J; Eisenach, K D; Dronda, F; Bates, J H; Cave, M D

    1996-01-01

    A comparison was made between DNA fingerprints of Mycobacterium tuberculosis produced with the insertion sequence IS6110 and those produced with the polymorphic GC-rich repetitive sequence contained in the plasmid pTBN12. A total of 302 M. tuberculosis isolates from the prison system in Madrid, Spain, and the Denver Public Health Department (Denver, Colo.) were analyzed with the two probes. Both probes identified the same isolates in the same clusters when the fingerprints had six or more cop...

  16. The use of DNA fingerprinting to resolve conflicting results in patients with suspected gastrointestinal malignancy.

    Science.gov (United States)

    Islam, Sameer; Miller, Ethan D; Patel, Neal; De Petris, Giovanni; Highsmith, Edward W; Fleischer, David E

    2013-03-01

    To underscore the utility of DNA fingerprinting for clarifying disparate results from endoscopic pathologic specimens. Occasionally, serially obtained gastrointestinal biopsies may yield inconsistent results. These discrepancies pose a dilemma for gastroenterologists and their patients, especially when malignancy is a consideration. Patients referred to our tertiary care center from outside institutions had undergone endoscopically obtained esophageal biopsies showing malignancy, verified by pathologists at both our site and from the referring center. Repeat endoscopic biopsies at our center did not show malignancy. To verify that different sets of biopsies came from the same patient, we performed a polymerase chain reaction-based analysis comparing the 2 specimens. This analysis, called DNA fingerprinting, can show a high degree of certainty whether 2 specimens came from the same patient. In each case, DNA fingerprinting verified a match, laying the groundwork for intervention. One patient underwent endoscopic radiofrequency ablation to the esophageal mucosa involved. Another underwent esophagectomy with partial gastrectomy. Both are doing well clinically and remain cancer-free on follow-up. DNA fingerprinting is a powerful and a relatively inexpensive tool. Usually, only small amounts of tissue are required, and even degraded or archival tissue is adequate. DNA fingerprinting can be an important tool in the gastroenterologist's arsenal to help clarify conflicting results, allowing the patient and physician to move forward with the management.

  17. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

    Science.gov (United States)

    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

    2010-04-01

    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  18. Examining DNA fingerprinting as an epidemiology tool in the tuberculosis program in the Northwest Territories, Canada.

    Science.gov (United States)

    Case, Cheryl; Kandola, Kami; Chui, Linda; Li, Vincent; Nix, Nancy; Johnson, Rhonda

    2013-01-01

    Tuberculosis (TB) is an important public health problem in the Northwest Territories (NWT), particularly among Canadian Aboriginal people. To analyse the transmission patterns of tuberculosis among the population living in the NWT, a territorial jurisdiction located within Northern Canada. This population-based retrospective study examined the DNA fingerprints of all laboratory confirmed cases of TB in the NWT, Canada, between 1990 and 2009. An isolate of each lab-confirmed case had genotyping done using IS6110 Restriction Fragment Length Polymorphism. DNA patterns were assigned to each DNA fingerprint, and indistinguishable fingerprints patterns were assigned a cluster. Social network analysis (SNA) was used to examine direct linkages among cases determined through conventional contact tracing (CCT), their DNA fingerprint and home community. Of the 225 lab-confirmed cases identified, the study was limited to 195 subjects due to DNA fingerprinting data availability. The mean age of the cases was 43.8 years (±22.6) and 120 (61.5%) males. The Dene (First Nations) encompassed 120 of the cases (87.7%), 8 cases (4.1%) were Inuit, 2 cases (1.0%) were Metis, 7 cases (3.6%) were Immigrants and 1 case had unknown ethnicity. One hundred and eighty six (95.4%) subjects were clustered, resulting in 8 clusters. Trend analysis showed significant relationships between with risk factors for unemployment (p=0.020), geographic location (p≤0.001) and homelessness (p≤0.001). Other significant risk factors included excessive alcohol consumption, prior infection with Mycobacterium tuberculosis and prior contact with a case of TB. This study demonstrates how DNA fingerprinting and SNA can be additional epidemiological tools, along with CCT method, to determine transmission patterns of TB.

  19. Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

    NARCIS (Netherlands)

    Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

    PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

  20. Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

    NARCIS (Netherlands)

    Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

    1994-01-01

    PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

  1. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    Energy Technology Data Exchange (ETDEWEB)

    Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  2. [Genomic DNA fingerprints of Legionella pneumophila serogroup 2 strains as an epidemiologic marker].

    Science.gov (United States)

    Bender-Beck, L; Mühlenberg, W; Lück, P C; Ott, M; Horbach, I; Fehrenbach, F J; Wewalka, G; Hacker, J

    1995-08-01

    Using pulsed-field gel electrophoresis, DNA fingerprints of eleven Legionella pneumophila isolates of serogroup 2 were generated. It was shown that two strains from a patient suffering from pneumonia as well as three environmental strains isolated from the shower in the hotel where the patient stayed 5 days before his illness were identical. Six strains of the same serogroup isolated from other sources were clearly separated. Thus, DNA fingerprints by pulsed-field gel electrophoresis are excellent epidemiological markers for the rarely occurring serogroup 2 of Legionella pneumophila.

  3. Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y

    2017-12-08

    No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. A DNA Fingerprinting Simulation Laboratory for Biology Students: Hands-on Experimentation To Solve a Mock Forensic Problem.

    Science.gov (United States)

    Palladino, Michael A.; Cosentino, Emily

    2001-01-01

    Presents an alternative approach to DNA fingerprinting. Demonstrates how undergraduate students can be involved in many aspects of this type of experiment and how DNA fingerprinting experiments can be incorporated into the laboratory curriculum of courses for majors and nonmajors. (NB)

  5. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    Science.gov (United States)

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  6. Digital Droplet Multiple Displacement Amplification (ddMDA for Whole Genome Sequencing of Limited DNA Samples.

    Directory of Open Access Journals (Sweden)

    Minsoung Rhee

    Full Text Available Multiple displacement amplification (MDA is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet, ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.

  7. Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

    Science.gov (United States)

    Ishii, Satoshi; Sadowsky, Michael J

    2009-04-01

    A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

  8. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    Science.gov (United States)

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  9. Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

    Directory of Open Access Journals (Sweden)

    Bonita J Brewer

    2015-12-01

    Full Text Available DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs. Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins

  10. Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

    Science.gov (United States)

    Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K

    2015-12-01

    DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial

  11. DNA fingerprinting: a quality control case study for human biospecimen authentication.

    Science.gov (United States)

    Kofanova, Olga A; Mathieson, William; Thomas, Gerry A; Betsou, Fotini

    2014-04-01

    This case study illustrates the usefulness of the DNA fingerprinting method in biobank quality control (QC) procedures and emphasizes the need for detailed and accurate record keeping during processing of biological samples. It also underlines the value of independent third-party assessment to identify points at which errors are most likely to have occurred when unexpected results are obtained from biospecimens.

  12. Genetic diversity analysis of nine chewing cane varieties (lines) and construction of their DNA fingerprints

    Science.gov (United States)

    In order to provide theoretical basis for variety identification and parental selection during sugarcane breeding process, the present study was conducted to analyze genetic diversity of nine chewing cane varieties (lines) and construct their DNA fingerprints. Combining twenty-one SSR molecular mark...

  13. Genetic variation in Phoca vitulina (the harbour seal) revealed by DNA fingerprinting and RAPDs

    NARCIS (Netherlands)

    Kappe, A.L.; van de Zande, L.; Vedder, E.J.; Bijlsma, R.; van Delden, Wilke

    Genetic variation in two harbour seal (Phoca vitulina) populations from the Dutch Wadden Sea and Scotland was examined by RAPD analysis and DNA fingerprinting. For comparison a population of grey seals (Halichoerus grypus) was studied. The RAPD method revealed a very low number of polymorphic bands.

  14. DNA fingerprinting for the authentication of Ruta graveolens

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... In this study, random amplified polymorphic DNA (RAPD) was employed to ... samples using the DNA isolated from the dried leaf, seed and stem of both samples. ..... opposite strands and is complementary to the primer for.

  15. The Influence of Selected Fingerprint Enhancement Techniques on Forensic DNA Typing of Epithelial Cells Deposited on Porous Surfaces.

    Science.gov (United States)

    Tsai, Li-Chin; Lee, Cheng-Chang; Chen, Chun-Chieh; Lee, James Chun-I; Wang, Sheng-Meng; Huang, Nu-En; Linacre, Adrian; Hsieh, Hsing-Mei

    2016-01-01

    Fingerprints deposited at crime scene can be a source of DNA. Previous reports on the effects of fingerprint enhancement methods have focused mainly on fingermarks deposited in blood or saliva. Here, we evaluate the effects of fingerprint enhancement methods on fingerprints deposited on porous surfaces. We performed real-time quantification and STR typing, the results of which indicated that two methods (iodine fuming and 1,2-indanedione in ethyl acetate enhancement) had no effect on the quantity of DNA isolated and resultant STR alleles when compared to control samples. DNA quantities and allele numbers were lower for samples enhanced with silver nitrate and 1,2-indanedione in acetic acid when compared to control samples. Based on DNA quantity, quality, and observable stochastic effects, our data indicated that iodine fuming and 1,2-indanedione in ethyl acetate were the preferred options for the enhancement of fingerprints on porous surfaces. © 2015 American Academy of Forensic Sciences.

  16. Single-tube linear DNA amplification (LinDA) for robust ChIP-seq

    NARCIS (Netherlands)

    Shankaranarayanan, P.; Mendoza-Parra, M.A.; Walia, M.; Wang, L.; Li, N.; Trindade, L.M.; Gronemeyer, H.

    2011-01-01

    Genome-wide profiling of transcription factors based on massive parallel sequencing of immunoprecipitated chromatin (ChIP-seq) requires nanogram amounts of DNA. Here we describe a high-fidelity, single-tube linear DNA amplification method (LinDA) for ChIP-seq and reChIP-seq with picogram DNA amounts

  17. Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

    Science.gov (United States)

    Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

    2017-07-01

    In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical

  18. Lanthanide mixed ligand chelates for DNA profiling and latent fingerprint detection

    Science.gov (United States)

    Menzel, E. R.; Allred, Clay

    1997-02-01

    It is our aim to develop a universally applicable latent fingerprint detection method using lanthanide (rare-earth) complexes as a source of luminescence. Use of these lanthanide complexes offers advantages on several fronts, including benefits from large Stokes shifts, long luminescence lifetimes, narrow emissions, ability of sequential assembly of complexes, and chemical variability of the ligands. Proper exploitation of these advantages would lead to a latent fingerprint detection method superior to any currently available. These same characteristics also lend themselves to many of the problems associated with DNA processing in the forensic science context.

  19. DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

    Science.gov (United States)

    Bady, Pierre; Diserens, Annie-Claire; Castella, Vincent; Kalt, Stefanie; Heinimann, Karl; Hamou, Marie-France; Delorenzi, Mauro; Hegi, Monika E

    2012-06-01

    Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

  20. Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

    Science.gov (United States)

    McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

    2018-01-01

    One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

  1. Isothermal amplification of environmental DNA (eDNA for direct field-based monitoring and laboratory confirmation of Dreissena sp.

    Directory of Open Access Journals (Sweden)

    Maggie R Williams

    Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a

  2. Agro-ecological variations of sheath rot disease of rice caused by Sarocladium oryzae and DNA fingerprinting of the pathogen's population structure.

    Science.gov (United States)

    Tajul Islam Chowdhury, M; Salim Mian, M; Taher Mia, M A; Rafii, M Y; Latif, M A

    2015-12-28

    To examine the impact of regional and seasonal variations on the incidence and severity of sheath rot, a major seed-borne disease of rice caused by Sarocladium oryzae, data on incidence and severity were collected from 27 selected fields in the Gazipur, Rangpur, Bogra, Chittagong, Comilla, Gopalgonj, Jessore, Manikgonj, and Bhola districts of Bangladesh in rain-fed and irrigated conditions. Cultural variability of 29 pathogen isolates obtained from 8 different locations was studied on potato dextrose agar (PDA) and genetic variability was determined by DNA fingerprinting using variable number tandem repeat-polymerase chain reaction markers. Overall, disease incidence and severity were higher in irrigated rice. Disease incidence and severity were highest in the Bhola district in rain-fed rice and lowest in irrigated rice. Mycelial growth of 29 representative isolates was found to vary on PDA and the isolates were divided into 6 groups. The range of the overall size of conidia of the selected isolates was 2.40-7.20 x 1.20-2.40 μm. Analysis of the DNA fingerprint types of the 29 isolates of S. oryzae, obtained from the amplification reactions, revealed 10 fingerprinting types (FPTs) that were 80% similar. FPT-1 was the largest group and included 13 isolates (44.8%), while FPT-2 was the third largest group and included 3 isolates. Each of FPT-3, 4, 5, and 6 included only 1 isolate. We observed no relationship between cultural and genetic groupings.

  3. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Science.gov (United States)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  4. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  5. The Evidentiary Value of DNA Fingerprint as Criminal Evidence

    Directory of Open Access Journals (Sweden)

    Mussa Masoud Irhouma

    2016-12-01

    Full Text Available The subject of criminal evidence is considered to be one of the greatest challenges that face authorities concerned with fighting crime at all levels. Due to this, authorities try to benefit as much as possible from scientific evidence due to the important role it plays in revealing the identity of criminals or victims in present or past criminal cases against unknown people through the physical traces that are found at the scene of an event, which include biological traces. DNA is one of these scientific evidences which can be benefited from in the field of crime investigation. Despite the importance of DNA technology in this area of work, there is still some debate surrounding its acceptance as criminal evidence. Some experts believe it to be of great importance whereas others cast doubt on its evidentiary value. They attribute this to a number of factors including the experts who are entrusted to examine DNA samples, the laboratories in which DNA analysis takes place, as well as the fact that resorting to DNA as a criminal evidence raises some legal complexities related to the permissibility of using it and the conditions and scope of its use. This paper sheds light on DNA and its evidentiary value among the judiciary in criminal cases by answering a number of questions such as the possibility of forcing a person to undergo DNA analysis or not to do so and to what extent it is to be relied upon as criminal evidence. This paper concluded the importance of DNA and its role in the field of criminal evidence. Despite this, even if the DNA evidence is sufficient in proving the innocence of the accused, it is only an indication that must not be solely relied upon and treated as a single conclusive evidence, particularly in cases that involve prescribed Islamic or retributive punishments.

  6. Effects of DNA mass on multiple displacement whole genome amplification and genotyping performance

    Directory of Open Access Journals (Sweden)

    Haque Kashif A

    2005-09-01

    Full Text Available Abstract Background Whole genome amplification (WGA promises to eliminate practical molecular genetic analysis limitations associated with genomic DNA (gDNA quantity. We evaluated the performance of multiple displacement amplification (MDA WGA using gDNA extracted from lymphoblastoid cell lines (N = 27 with a range of starting gDNA input of 1–200 ng into the WGA reaction. Yield and composition analysis of whole genome amplified DNA (wgaDNA was performed using three DNA quantification methods (OD, PicoGreen® and RT-PCR. Two panels of N = 15 STR (using the AmpFlSTR® Identifiler® panel and N = 49 SNP (TaqMan® genotyping assays were performed on each gDNA and wgaDNA sample in duplicate. gDNA and wgaDNA masses of 1, 4 and 20 ng were used in the SNP assays to evaluate the effects of DNA mass on SNP genotyping assay performance. A total of N = 6,880 STR and N = 56,448 SNP genotype attempts provided adequate power to detect differences in STR and SNP genotyping performance between gDNA and wgaDNA, and among wgaDNA produced from a range of gDNA templates inputs. Results The proportion of double-stranded wgaDNA and human-specific PCR amplifiable wgaDNA increased with increased gDNA input into the WGA reaction. Increased amounts of gDNA input into the WGA reaction improved wgaDNA genotyping performance. Genotype completion or genotype concordance rates of wgaDNA produced from all gDNA input levels were observed to be reduced compared to gDNA, although the reduction was not always statistically significant. Reduced wgaDNA genotyping performance was primarily due to the increased variance of allelic amplification, resulting in loss of heterozygosity or increased undetermined genotypes. MDA WGA produces wgaDNA from no template control samples; such samples exhibited substantial false-positive genotyping rates. Conclusion The amount of gDNA input into the MDA WGA reaction is a critical determinant of genotyping performance of wgaDNA. At least 10 ng of

  7. Genetic diversity and DNA fingerprint study in tomato (Solanum ...

    African Journals Online (AJOL)

    User_Name

    tomato (S. lycopersicon) that have different origin and grown under. Egyptian environment ..... Saccharomyces cerevisiae (Sia et al., 2000) up to 10-3 in the pipefish .... (2000). Analysis of microsatellite mutations in the mitochondrial DNA.

  8. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  9. A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

    Science.gov (United States)

    Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

    2001-12-01

    Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

  10. Locked nucleic acid inhibits amplification of contaminating DNA in real-time PCR

    DEFF Research Database (Denmark)

    Hummelshoj, Lone; Ryder, Lars P; Madsen, Hans O

    2005-01-01

    and real-time PCR, the addition of LNA showed blocking of the amplification of genomic XBP1 but not cDNA XBP1. To test the effect of melting temperature (Tm) on the LNA, we investigated the number of LNA nucleotides that could be replaced with DNA nucleotides and still retain the blocking activity. More...

  11. Single-tube linear DNA amplification for genome-wide studies using a few thousand cells

    NARCIS (Netherlands)

    Shankaranarayanan, P.; Mendoza-Parra, M.A.; Gool, van W.; Trindade, L.M.; Gronemeyer, H.

    2012-01-01

    Linear amplification of DNA (LinDA) by T7 polymerase is a versatile and robust method for generating sufficient amounts of DNA for genome-wide studies with minute amounts of cells. LinDA can be coupled to a great number of global profiling technologies. Indeed, chromatin immunoprecipitation coupled

  12. DNA fingerprinting demonstrates extremely low levels of genetic variation among blackberry cultivars grown in Finland

    Directory of Open Access Journals (Sweden)

    K. ANTONIUS

    2008-12-01

    Full Text Available Most blackberry plants cultivated in Finland closely resemble the American species Rubus allegheniensis. Thirty nine such blackberry accessions in the University of Helsinki clone collection were studied by hybridization-based DNA fingerprinting and compared with some known cultivars of R. allegheniensis derivation. 'Imperial' appears to be identical to the old cultivar 'Majestät', but 'Earliest of All' differs considerably. In addition, 37 of the accessions analysed also have DNA fingerprints that appear to be completely identical to that of 'Majestät'! The remaining two accessions, although identical to each other, exhibit one band not found in 'Majestät' that is probably caused by a somatic mutation.

  13. Acute and chronic gregarisation are associated with distinct DNA methylation fingerprints in desert locusts.

    Science.gov (United States)

    Mallon, Eamonn B; Amarasinghe, Harindra E; Ott, Swidbert R

    2016-10-18

    Desert locusts (Schistocerca gregaria) show a dramatic form of socially induced phenotypic plasticity known as phase polyphenism. In the absence of conspecifics, locusts occur in a shy and cryptic solitarious phase. Crowding with conspecifics drives a behavioural transformation towards gregariousness that occurs within hours and is followed by changes in physiology, colouration and morphology, resulting in the full gregarious phase syndrome. We analysed methylation-sensitive amplified fragment length polymorphisms (MS-AFLP) to compare the effect of acute and chronic crowding on DNA methylation in the central nervous system. We find that crowd-reared and solitary-reared locusts show markedly different neural MS-AFLP fingerprints. However, crowding for a day resulted in neural MS-AFLP fingerprints that were clearly distinct from both crowd-reared and uncrowded solitary-reared locusts. Our results indicate that changes in DNA methylation associated with behavioural gregarisation proceed through intermediate states that are not simply partial realisations of the endpoint states.

  14. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

    Science.gov (United States)

    Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne

    2009-02-02

    The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  15. DNA fingerprinting tags novel altered chromosomal regions and identifies the involvement of SOX5 in the progression of prostate cancer.

    Science.gov (United States)

    Ma, Stephanie; Chan, Yuen Piu; Woolcock, Bruce; Hu, Liang; Wong, Kai Yau; Ling, Ming Tat; Bainbridge, Terry; Webber, Douglas; Chan, Tim Hon Man; Guan, Xin-Yuan; Lam, Wan; Vielkind, Juergen; Chan, Kwok Wah

    2009-05-15

    Identification of genomic alterations associated with the progression of prostate cancer may facilitate the better understanding of the development of this highly variable disease. Matched normal, premalignant high-grade prostatic intraepithelial neoplasia and invasive prostate carcinoma cells were procured by laser capture microdissection (LCM) from human radical prostatectomy specimens. From these cells, comparative DNA fingerprints were generated by a modified PCR-based technique called scanning of microdissected archival lesion (SMAL)-PCR. Recurrent polymorphic fingerprint fragments were used in tagging altered chromosomal regions. Altered regions were found at cytobands 1p31.3, 1q44, 2p23.1, 3p26.3, 3q22.3, 4q22.3, 4q35.2, 5q23.2, 8q22.3, 8q24.13, 9q21.3, 9q22.32, 10q11.21, 11p13, 12p12.1, 13q12.1, 16q12.2 and 18q21.31. Candidate genes in the surrounding area that may possibly harbor mutations that change normal prostatic cells to progress into their tumor stages were proposed. Of these fragments, a 420 bp alteration, absent in all 26 normal samples screened, was observed in 2 tumors. This fragment was cloned, sequenced and localized to chromosome 12p12.1. Within this region, candidate gene sex determining region Y-box 5 (SOX5) was proposed. Further studies of SOX5 in cell lines, xenografts and human prostate specimens, at both the RNA and protein levels, found overexpression of the gene in tumors. This overexpression was then subsequently found by fluorescent in situ hybridization to be caused by amplification of the region. In conclusion, our results suggest LCM coupled with SMAL-PCR DNA fingerprinting is a useful method for the screening and identification of chromosomal regions and genes associated with cancer development. Further, overexpression of SOX5 is associated with prostate tumor progression and early development of distant metastasis. (c) 2008 Wiley-Liss, Inc.

  16. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    User

    Full Length Research Paper ... resulted in a search for better techniques for classifying ... only a few laboratories worldwide are able to perform a ... MATERIALS AND METHODS. Bacterial ... s with distilled water and blotted dry with tissue paper (Kimberly- ... A test on the quality and quantity of DNA extracted was conducted.

  17. Serotypes and DNA fingerprint profiles of Pasteurella multocida isolated from raptors

    Science.gov (United States)

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Pasteurella multocida isolates from 21 raptors were examined by DNA fingerprint profile and serotyping methods. Isolates were obtained from noncaptive birds of prey found in 11 states from November 28, 1979, through February 10, 1993. Nine isolates were from bald eagles, and the remaining isolates were from hawks, falcons, and owls. Seven isolates were members of capsule group A, and 14 were nonencapsulated. One isolate was identified as somatic type 3, and another was type 3,4,7; both had unique HhaI DNA fingerprint profiles. Nineteen isolates expressed somatic type 1 antigen; HhaI profiles of all type 1 isolates were identical to each other and to the HhaI profile of the reference somatic type 1, strain X-73. The 19 type 1 isolates were differentiated by sequential digestion of DNA with HpaII; four HpaII fingerprint profiles were obtained. The HpaII profile of one isolate was identical to the HpaII profile of strain X-73. Incidence of P. multocida somatic type 1 in raptors suggests that this type may be prevalent in other wildlife or wildlife environments.

  18. DNA fingerprinting techniques for the analysis of genetic and epigenetic alterations in colorectal cancer.

    Science.gov (United States)

    Samuelsson, Johanna K; Alonso, Sergio; Yamamoto, Fumiichiro; Perucho, Manuel

    2010-11-10

    Genetic somatic alterations are fundamental hallmarks of cancer. In addition to point and other small mutations targeting cancer genes, solid tumors often exhibit aneuploidy as well as multiple chromosomal rearrangements of large fragments of the genome. Whether somatic chromosomal alterations and aneuploidy are a driving force or a mere consequence of tumorigenesis remains controversial. Recently it became apparent that not only genetic but also epigenetic alterations play a major role in carcinogenesis. Epigenetic regulation mechanisms underlie the maintenance of cell identity crucial for development and differentiation. These epigenetic regulatory mechanisms have been found substantially altered during cancer development and progression. In this review, we discuss approaches designed to analyze genetic and epigenetic alterations in colorectal cancer, especially DNA fingerprinting approaches to detect changes in DNA copy number and methylation. DNA fingerprinting techniques, despite their modest throughput, played a pivotal role in significant discoveries in the molecular basis of colorectal cancer. The aim of this review is to revisit the fingerprinting technologies employed and the oncogenic processes that they unveiled. 2010 Elsevier B.V. All rights reserved.

  19. A study of the genetic relationships within and among wolf packs using DNA fingerprinting and mitochondrial DNA

    Science.gov (United States)

    Lehman, Niles; Clarkson, Peter; Mech, L. David; Meier, Thomas J.; Wayne, Robert K.

    1992-01-01

    DNA fingerprinting and mitochondrial DNA analyses have not been used in combination to study relatedness in natural populations. We present an approach that involves defining the mean fingerprint similarities among individuals thought to be unrelated because they have different mtDNA genotypes. Two classes of related individuals are identified by their distance in standard errors above this mean value. The number of standard errors is determined by analysis of the association between fingerprint similarity and relatedness in a population with a known genealogy. We apply this approach to gray wolf packs from Minnesota, Alaska, and the Northwest Territories. Our results show that: (1) wolf packs consist primarily of individuals that are closely related genetically, but some packs contain unrelated, non-reproducing individuals; (2) dispersal among packs within the same area is common; and (3) short-range dispersal appears more common for female than male wolves. The first two of these genetically-based observations are consistent with behavioral data on pack structure and dispersal in wolves, while the apparent sex bias in dispersal was not expected.

  20. Genetic relationships among wild and cultivated accessions of curry leaf plant (Murraya koenigii (L.) Spreng.), as revealed by DNA fingerprinting methods.

    Science.gov (United States)

    Verma, Sushma; Rana, T S

    2013-02-01

    Murraya koenigii (L.) Spreng. (Rutaceae), is an aromatic plant and much valued for its flavor, nutritive and medicinal properties. In this study, three DNA fingerprinting methods viz., random amplification of polymorphic DNA (RAPD), directed amplification of minisatellite DNA (DAMD), and inter-simple sequence repeat (ISSR), were used to unravel the genetic variability and relationships across 92 wild and cultivated M. koenigii accessions. A total of 310, 102, and 184, DNA fragments were amplified using 20 RAPD, 5 DAMD, and 13 ISSR primers, revealing 95.80, 96.07, and 96.73% polymorphism, respectively, across all accessions. The average polymorphic information content value obtained with RAPD, DAMD, and ISSR markers was 0.244, 0.250, and 0.281, respectively. The UPGMA tree, based on Jaccard's similarity coefficient generated from the cumulative (RAPD, DAMD, and ISSR) band data showed two distinct clusters, clearly separating wild and cultivated accessions in the dendrogram. Percentage polymorphism, gene diversity (H), and Shannon information index (I) estimates were higher in cultivated accessions compared to wild accessions. The overall high level of polymorphism and varied range of genetic distances revealed a wide genetic base in M. koenigii accessions. The study suggests that RAPD, DAMD, and ISSR markers are highly useful to unravel the genetic variability in wild and cultivated accessions of M. koenigii.

  1. Multilocus DNA fingerprinting in paternity analysis: a Chilean experience

    Directory of Open Access Journals (Sweden)

    Cifuentes O. Lucía

    2000-01-01

    Full Text Available DNA polymorphism is very useful in paternity analysis. The present paper describes paternity studies done using DNA profiles obtained with the (CAC5 probe. All of the subjects studied were involved in nonjudicial cases of paternity. Genomic DNA digested with HaeIII was run on agarose gels and hybridized in the gel with the (CAC5 probe labeled with 32P. The mean number of bands larger than the 4.3 kb per individual was 16.1. The mean proportion of bands shared among unrelated individuals was 0.08 and the mean number of test bands was 7.1. This corresponded to an exclusion probability greater than 0.999999. Paternity was excluded in 34.5% of the cases. The mutation frequency estimated from non-excluded cases was 0.01143 bands per child. In these cases, the paternity was confirmed by a locus-specific analysis of eight independent PCR-based loci. The paternity index was computed in all non-excluded cases. It can be concluded that this method is a powerful and inexpensive alternative to solve paternity doubts.

  2. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  3. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  4. Genetic diversity in different populations of sloths assessed by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    MORAES N.

    2002-01-01

    Full Text Available In this study we analyzed a population of Bradypus torquatus with individuals originally distributed in different localities of Bahia, and two populations of B. variegatus with individuals from Bahia and São Paulo States. Using the DNA fingerprinting method, we assessed the genetic variability within and between populations. Analysis of the DNA profiles revealed genetic similarity indices ranging from 0.34 ± 0.07 to 0.87 ± 0.04. Similar low levels of genetic variability were found only in isolated mammalian populations or among related individuals. This study presents the first analyses of genetic diversity in sloth populations.

  5. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  6. ESDA®-Lite collection of DNA from latent fingerprints on documents.

    Science.gov (United States)

    Plaza, Dane T; Mealy, Jamia L; Lane, J Nicholas; Parsons, M Neal; Bathrick, Abigail S; Slack, Donia P

    2015-05-01

    The ability to detect and non-destructively collect biological samples for DNA processing would benefit the forensic community by preserving the physical integrity of evidentiary items for more thorough evaluations by other forensic disciplines. The Electrostatic Detection Apparatus (ESDA®) was systemically evaluated for its ability to non-destructively collect DNA from latent fingerprints deposited on various paper substrates for short tandem repeat (STR) DNA profiling. Fingerprints were deposited on a variety of paper substrates that included resume paper, cotton paper, magazine paper, currency, copy paper, and newspaper. Three DNA collection techniques were performed: ESDA collection, dry swabbing, and substrate cutting. Efficacy of each collection technique was evaluated by the quantity of DNA present in each sample and the percent profile generated by each sample. Both the ESDA and dry swabbing non-destructive sampling techniques outperformed the destructive methodology of substrate cutting. A greater number of full profiles were generated from samples collected with the non-destructive dry swabbing collection technique than were generated from samples collected with the ESDA; however, the ESDA also allowed the user to visualize the area of interest while non-destructively collecting the biological material. The ability to visualize the biological material made sampling straightforward and eliminated the need for numerous, random swabbings/cuttings. Based on these results, the evaluated non-destructive ESDA collection technique has great potential for real-world forensic implementation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection.

    Science.gov (United States)

    Rosser, A; Rollinson, D; Forrest, M; Webster, B L

    2015-09-04

    Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.

  8. Detection of Colorectal Cancer by a Quantitative Fluorescence Determination of DNA Amplification in Stool

    Directory of Open Access Journals (Sweden)

    Daniele Calistri

    2004-09-01

    Full Text Available DNA amplification of exfoliated cells in stool repre sents an inexpensive and rapid test, but has only 50% to 60% sensitivity. A new quantitative method, calle( fluorescence long DNA, was developed and validate( in our laboratory on stool obtained from 86 patient., with primary colorectal cancer and from 62 health individuals. It consists of the amplification of stoo DNA with fluorescence primers and the quantification of the amplification using a standard curve. Results are arbitrarily expressed in nanograms. The potential of thi new method compared to the conventional approact was analyzed in a subgroup of 94 individuals (51 patients and 38 healthy volunteers. In the presen series, DNA amplification analysis showed a specific ity of 97% and a sensitivity of only 50%. Conversely fluorescence DNA evaluation, using the best cutoff o 25 ng, showed a sensitivity of about 76% and a spec ificity of 93%. Similar sensitivity was observed regard less of Dukes stage, tumor location, and size, thu., also permitting the detection of early-stage tumors The present study seems to indicate that quantitative fluorescence DNA determination in stool successfully identifies colorectal cancer patients with a sensitivity comparable, if not superior, to that of multiple gene analysis but at a lower cost and in a shorter time.

  9. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  10. Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

    Science.gov (United States)

    Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

    2018-01-01

    Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

  11. Genetic effect of A-bomb radiation- Analysis of minisatellite regions detected by DNA fingerprint probe

    International Nuclear Information System (INIS)

    Kodaira, Mieko

    1999-01-01

    In author's laboratory, screening of mutation in germ cells of A-bomb survivors is under investigation with use of 8 single-locus minisatellite probes and no increase in mutation rate has been detected hitherto. This paper reported results of screening on the minisatellite region, which consisting of short repeated base sequence, using a DNA fingerprint probe for 33.15 core sequence. Subjects were 50 A-bomb survivor families exposed to mean dose of 1.9 Sv (exposed group) or 0 Gy (control), having 64 or 60 children, respectively. DNA was extracted from their B cells established by EB virus and subjected to agarose-gel electrophoresis followed by southern blotting with some improvements for fingerprinting. On the fingerprints, numbers of the band detected in regions of >3.5 kb were 1080 in children of the exposed group (16.9/child) and 1024 (17.1) in the control group, indicating no detectable effect of exposure on the germ cell mutation rate in the region.(K.H.)

  12. Effects of latent fingerprint development reagents on subsequent forensic DNA typing: a review.

    Science.gov (United States)

    Kumar, Parveen; Gupta, Ritika; Singh, Rajinder; Jasuja, Om Prakash

    2015-05-01

    Successful development of latent fingerprints can be helpful in solving the case but in case where fingerprints are smudged, distorted or overlapped, the question arises whether it is still possible to identify the person apart from dermatoglyphic features. Sweat residue present in the latent prints is supposed to have quite good quantity of cellular material which if analyzed properly can be used to generate forensic DNA profile of the individual and may answer the queries related to the effect of reagents used to develop the prints, as they may have a significant effect on the process of examination of this evidentiary material. In the present work an effort has been made to summarize the published review of literature on this aspect of personal identification. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  13. DNA fingerprinting approaches to trace Escherichia coli sharing between dogs and owners.

    Science.gov (United States)

    Naziri, Z; Derakhshandeh, A; Firouzi, R; Motamedifar, M; Shojaee Tabrizi, A

    2016-02-01

    To determine the prevalence of cross-species sharing of Escherichia coli between healthy dogs and humans living in the same household. Two faecal E. coli isolates from 25 healthy dog-owner pairs and 16 healthy control humans were tested using three fingerprinting methods. The prevalence of within-household sharing of E. coli was 4, 8 and 8% using pulsed-field gel electrophoresis, randomly amplified polymorphic DNA and enterobacterial repetitive intergenic consensus-PCR analyses respectively. Within-household bacterial sharing was more prevalent than across-household sharing (P fingerprinting techniques will help to find ways for reducing the economic impact of E. coli infections. This study support claims that public health concerns regarding the cross-species sharing of E. coli are warranted but this risk is minimal. © 2015 The Society for Applied Microbiology.

  14. Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

    International Nuclear Information System (INIS)

    Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

    2015-01-01

    In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

  15. Simple system for isothermal DNA amplification coupled to lateral flow detection.

    Directory of Open Access Journals (Sweden)

    Kristina Roskos

    Full Text Available Infectious disease diagnosis in point-of-care settings can be greatly improved through integrated, automated nucleic acid testing devices. We have developed an early prototype for a low-cost system which executes isothermal DNA amplification coupled to nucleic acid lateral flow (NALF detection in a mesofluidic cartridge attached to a portable instrument. Fluid handling inside the cartridge is facilitated through one-way passive valves, flexible pouches, and electrolysis-driven pumps, which promotes a compact and inexpensive instrument design. The closed-system disposable prevents workspace amplicon contamination. The cartridge design is based on standard scalable manufacturing techniques such as injection molding. Nucleic acid amplification occurs in a two-layer pouch that enables efficient heat transfer. We have demonstrated as proof of principle the amplification and detection of Mycobacterium tuberculosis (M.tb genomic DNA in the cartridge, using either Loop Mediated Amplification (LAMP or the Exponential Amplification Reaction (EXPAR, both coupled to NALF detection. We envision that a refined version of this cartridge, including upstream sample preparation coupled to amplification and detection, will enable fully-automated sample-in to answer-out infectious disease diagnosis in primary care settings of low-resource countries with high disease burden.

  16. Efficient DNA Fingerprinting Based on the Targeted Sequencing of Active Retrotransposon Insertion Sites Using a Bench-Top High-Throughput Sequencing Platform

    OpenAIRE

    Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

    2014-01-01

    In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LI...

  17. A Novel Low Temperature PCR Assured High-Fidelity DNA Amplification

    Directory of Open Access Journals (Sweden)

    Shaoxia Zhou

    2013-06-01

    Full Text Available As previously reported, a novel low temperature (LoTemp polymerase chain reaction (PCR catalyzed by a moderately heat-resistant (MHR DNA polymerase with a chemical-assisted denaturation temperature set at 85 °C instead of the conventional 94–96 °C can achieve high-fidelity DNA amplification of a target DNA, even after up to 120 PCR thermal cycles. Furthermore, such accurate amplification is not achievable with conventional PCR. Now, using a well-recognized L1 gene segment of the human papillomavirus (HPV type 52 (HPV-52 as the template for experiments, we demonstrate that the LoTemp high-fidelity DNA amplification is attributed to an unusually high processivity and stability of the MHR DNA polymerase whose high fidelity in template-directed DNA synthesis is independent of non-existent 3'–5' exonuclease activity. Further studies and understanding of the characteristics of the LoTemp PCR technology may facilitate implementation of DNA sequencing-based diagnostics at the point of care in community hospital laboratories.

  18. Revealing the uncultivated majority: combining DNA stable-isotope probing, multiple displacement amplification and metagenomic analyses of uncultivated Methylocystis in acidic peatlands.

    Science.gov (United States)

    Chen, Yin; Dumont, Marc G; Neufeld, Josh D; Bodrossy, Levente; Stralis-Pavese, Nancy; McNamara, Niall P; Ostle, Nick; Briones, Maria J I; Murrell, J Colin

    2008-10-01

    Peatlands represent an enormous carbon reservoir and have a potential impact on the global climate because of the active methanogenesis and methanotrophy in these soils. Uncultivated methanotrophs from seven European peatlands were studied using a combination of molecular methods. Screening for methanotroph diversity using a particulate methane monooxygenase-based diagnostic gene array revealed that Methylocystis-related species were dominant in six of the seven peatlands studied. The abundance and methane oxidation activity of Methylocystis spp. were further confirmed by DNA stable-isotope probing analysis of a sample taken from the Moor House peatland (England). After ultracentrifugation, (13)C-labelled DNA, containing genomic DNA of these Methylocystis spp., was separated from (12)C DNA and subjected to multiple displacement amplification (MDA) to generate sufficient DNA for the preparation of a fosmid metagenomic library. Potential bias of MDA was detected by fingerprint analysis of 16S rRNA using denaturing gradient gel electrophoresis for low-template amplification (0.01 ng template). Sufficient template (1-5 ng) was used in MDA to circumvent this bias and chimeric artefacts were minimized by using an enzymatic treatment of MDA-generated DNA with S1 nuclease and DNA polymerase I. Screening of the metagenomic library revealed one fosmid containing methanol dehydrogenase and two fosmids containing 16S rRNA genes from these Methylocystis-related species as well as one fosmid containing a 16S rRNA gene related to that of Methylocella/Methylocapsa. Sequencing of the 14 kb methanol dehydrogenase-containing fosmid allowed the assembly of a gene cluster encoding polypeptides involved in bacterial methanol utilization (mxaFJGIRSAC). This combination of DNA stable-isotope probing, MDA and metagenomics provided access to genomic information of a relatively large DNA fragment of these thus far uncultivated, predominant and active methanotrophs in peatland soil.

  19. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    NARCIS (Netherlands)

    Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

  20. Amplification of DNA mixtures--Missing data approach

    DEFF Research Database (Denmark)

    Tvedebrink, Torben; Eriksen, Poul Svante; Mogensen, Helle Smidt

    2008-01-01

    This paper presents a model for the interpretation of results of STR typing of DNA mixtures based on a multivariate normal distribution of peak areas. From previous analyses of controlled experiments with mixed DNA samples, we exploit the linear relationship between peak heights and peak areas...... DNA samples, it is only possible to observe the cumulative peak heights and areas. Complying with this latent structure, we use the EM-algorithm to impute the missing variables based on a compound symmetry model. That is the measurements are subject to intra- and inter-loci correlations not depending...... on the actual alleles of the DNA profiles. Due to factorization of the likelihood, properties of the normal distribution and use of auxiliary variables, an ordinary implementation of the EM-algorithm solves the missing data problem. We estimate the parameters in the model based on a training data set. In order...

  1. Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

    Science.gov (United States)

    Jorgez, Carolina J; Bischoff, Farideh Z

    2009-01-01

    Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

  2. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    Directory of Open Access Journals (Sweden)

    Emmanuelle eFiore

    2015-08-01

    Full Text Available Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  3. Enhancing PCR Amplification of DNA from Recalcitrant Plant Specimens Using a Trehalose-Based Additive

    Directory of Open Access Journals (Sweden)

    Tharangamala Samarakoon

    2013-01-01

    Full Text Available Premise of the study: PCR amplification of DNA extracted from plants is sometimes difficult due to the presence of inhibitory compounds. An effective method to overcome the inhibitory effect of compounds that contaminate DNA from difficult plant specimens is needed. Methods and Results: The effectiveness of a PCR additive reagent containing trehalose, bovine serum albumin (BSA, and polysorbate-20 (Tween-20 (TBT-PAR was tested. PCR of DNA extracted from fresh, silica-dried, and herbarium leaf material of species of Achariaceae, Asteraceae, Lacistemataceae, and Samydaceae that failed using standard techniques were successful with the addition of TBT-PAR. Conclusions: The addition of TBT-PAR during routine PCR is an effective method to improve amplification of DNA extracted from herbarium specimens or plants that are known to contain PCR inhibitors.

  4. Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

    Science.gov (United States)

    Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

    2012-02-01

    We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

  5. Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

    International Nuclear Information System (INIS)

    Wang Hua; Zhang Jian; Wang Kai; Liu Bing-Bing; Zou Bo; Zou Guang-Tian; Yang Fan; Shen Si-Le

    2011-01-01

    The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively. (general)

  6. Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

    Science.gov (United States)

    Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

    2011-01-01

    The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

  7. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection

    NARCIS (Netherlands)

    Velders, Aldrik H.; Schoen, Cor; Saggiomo, Vittorio

    2018-01-01

    Objective: Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap

  8. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Directory of Open Access Journals (Sweden)

    Stefan Niemann

    2009-10-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

  9. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Science.gov (United States)

    Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

    2009-10-12

    Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

  10. Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers

    Institute of Scientific and Technical Information of China (English)

    Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi

    2015-01-01

    Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  11. Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers

    Directory of Open Access Journals (Sweden)

    Liwu Zhang

    2015-10-01

    Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  12. Trophectoderm DNA fingerprinting by quantitative real-time PCR successfully distinguishes sibling human embryos.

    Science.gov (United States)

    Scott, Richard T; Su, Jing; Tao, Xin; Forman, Eric J; Hong, Kathleen H; Taylor, Deanne; Treff, Nathan R

    2014-11-01

    To validate a novel and more practical system for trophectoderm DNA fingerprinting which reliably distinguishes sibling embryos from each other. In this prospective and blinded study two-cell and 5-cell samples from commercially available sibling cell lines and excess DNA from trophectoderm biopsies of sibling human blastocysts were evaluated for accurate assignment of relationship using qPCR-based allelic discrimination from 40 single nucleotide polymorphisms (SNPs) with low allele frequency variation and high heterozygosity. Cell samples with self relationships averaged 95.1 ± 5.9 % similarity. Sibling relationships averaged 57.2 ± 5.9 % similarity for all 40 SNPs, and 40.8 ± 8.2 % similarity for the 25 informative SNPs. Assignment of relationships was accomplished with 100 % accuracy for cell lines and embryos. These data demonstrate the first trophectoderm qPCR-based DNA fingerprinting technology capable of unequivocal discrimination of sibling human embryos. This methodology will empower research and development of new markers of, and interventions that influence embryonic reproductive potential.

  13. Antimicrobial susceptibilities and random amplified polymorphic DNA-PCR fingerprint characterization of Lactococcus lactis ssp. lactis and Lactococcus garvieae isolated from bovine intramammary infections.

    Science.gov (United States)

    Plumed-Ferrer, C; Barberio, A; Franklin-Guild, R; Werner, B; McDonough, P; Bennett, J; Gioia, G; Rota, N; Welcome, F; Nydam, D V; Moroni, P

    2015-09-01

    In total, 181 streptococci-like bacteria isolated from intramammary infections (IMI) were submitted by a veterinary clinic to Quality Milk Production Services (QMPS, Cornell University, Ithaca, NY). The isolates were characterized by sequence analysis, and 46 Lactococcus lactis ssp. lactis and 47 Lactococcus garvieae were tested for susceptibility to 17 antibiotics. No resistant strains were found for β-lactam antibiotics widely used in clinical practice (penicillin, ampicillin, and amoxicillin), and all minimum inhibitory concentrations (MIC) were far from the resistance breakpoints. Eight strains had MIC intermediate to cefazolin. The random amplification of polymorphic DNA (RAPD)-PCR fingerprint patterns showed a slightly higher heterogeneity for Lc. lactis ssp. lactis isolates than for Lc. garvieae isolates. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Assessing the bias linked to DNA recovery from biofiltration woodchips for microbial community investigation by fingerprinting.

    Science.gov (United States)

    Cabrol, Léa; Malhautier, Luc; Poly, Franck; Lepeuple, Anne-Sophie; Fanlo, Jean-Louis

    2010-01-01

    In this study, we explored methodological aspects of nucleic acid recovery from microbial communities involved in a gas biofilter filled with pine bark woodchips. DNA was recovered indirectly in two steps, comparing different methods: cell dispersion (crushing, shaking, and sonication) and DNA extraction (three commercial kits and a laboratory protocol). The objectives were (a) to optimize cell desorption from the packing material and (b) to compare the 12 combinations of desorption and extraction methods, according to three relevant criteria: DNA yield, DNA purity, and community structure representation by denaturing gradient gel electrophoresis (DGGE). Cell dispersion was not influenced by the operational parameters tested for shaking and blending, while it increased with time for sonication. DNA extraction by the laboratory protocol provided the highest DNA yields, whereas the best DNA purity was obtained by a commercial kit designed for DNA extraction from soil. After successful PCR amplification, the 12 methods did not generate the same bias in microbial community representation. Eight combinations led to high diversity estimation, independently of the experimental procedure. Among them, six provided highly similar DGGE profiles. Two protocols generated a significantly dissimilar community profile, with less diversity. This study highlighted the crucial importance of DNA recovery bias evaluation.

  15. Direct PCR amplification of the HVSI region in mitochondrial DNA from buccal cell swabs

    Directory of Open Access Journals (Sweden)

    Kovačević-Grujičić Nataša

    2012-01-01

    Full Text Available Amplification of human mitochondrial DNA (mtDNA has been widely used in population genetics, human evolutionary and molecular anthropology studies. mtDNA hypervariable segments I and II (HVSI and HVSII were shown to be a suitable tool in genetic analyses due to the unique properties of mtDNA, such as the lack of recombination, maternal mode of inheritance, rapid evolutionary rate and high population-specific polymorphisms. Here we present a rapid and low-cost method for direct PCR amplification of a 330 bp fragment of HVSI from buccal cell samples. Avoiding the DNA isolation step makes this method appropriate for the analysis of a large number of samples in a short period of time. Since the transportation of samples and fieldwork conditions can affect the quality of samples and subsequent DNA analysis, we tested the effects of long-term storage of buccal cell swabs on the suitability of such samples for direct PCR amplification. We efficiently amplified a 330 bp fragment of HVSI even after the long-term storage of buccal cells at room temperature, +4°C or at -20°C, for up to eight months. All examined PCR products were successfully sequenced, regardless of sample storage time and conditions. Our results suggest that the direct PCR amplification of the HVSI region from buccal cells is a method well suited for large-scale mtDNA population studies.[Acknowledgments. This work was supported by the Ministry of Education and Science of the Republic of Serbia (Grant no. III 47025.

  16. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  17. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  18. Quantification of trace-level DNA by real-time whole genome amplification.

    Science.gov (United States)

    Kang, Min-Jung; Yu, Hannah; Kim, Sook-Kyung; Park, Sang-Ryoul; Yang, Inchul

    2011-01-01

    Quantification of trace amounts of DNA is a challenge in analytical applications where the concentration of a target DNA is very low or only limited amounts of samples are available for analysis. PCR-based methods including real-time PCR are highly sensitive and widely used for quantification of low-level DNA samples. However, ordinary PCR methods require at least one copy of a specific gene sequence for amplification and may not work for a sub-genomic amount of DNA. We suggest a real-time whole genome amplification method adopting the degenerate oligonucleotide primed PCR (DOP-PCR) for quantification of sub-genomic amounts of DNA. This approach enabled quantification of sub-picogram amounts of DNA independently of their sequences. When the method was applied to the human placental DNA of which amount was accurately determined by inductively coupled plasma-optical emission spectroscopy (ICP-OES), an accurate and stable quantification capability for DNA samples ranging from 80 fg to 8 ng was obtained. In blind tests of laboratory-prepared DNA samples, measurement accuracies of 7.4%, -2.1%, and -13.9% with analytical precisions around 15% were achieved for 400-pg, 4-pg, and 400-fg DNA samples, respectively. A similar quantification capability was also observed for other DNA species from calf, E. coli, and lambda phage. Therefore, when provided with an appropriate standard DNA, the suggested real-time DOP-PCR method can be used as a universal method for quantification of trace amounts of DNA.

  19. The role of DNA amplification and cultural growth in complicated acute appendicitis

    Directory of Open Access Journals (Sweden)

    Francesca Tocchioni

    2016-09-01

    Full Text Available Bacterial growth of peritoneal fluid specimens obtained during surgical procedures for acute appendicitis may be useful to optimize further antibiotic therapy in complicated cases. DNA amplification represents a fast technique to detect microbial sequences. We aimed to compare the potential of DNA amplification versus traditional bacterial growth culture highlighting advantages and drawbacks in a surgical setting. Peritoneal fluid specimens were collected during surgery from 36 children who underwent appendectomy between May and December 2012. Real-time polymerase chain reaction (RT-PCR and cultures were performed on each sample. RT-PCR showed an amplification of 16S in 18/36 samples, Escherichia coli (in 7 cases, Pseudomonas aeruginosa (3, Fusobacterium necrophorum (3, Adenovirus (2, E.coli (1, Klebsiella pneumoniae (1, Serratia marcescens/Enterobacter cloacae (1. Bacterial growth was instead observed only in four patients (3 E.coli and 1 P.aeruginosa and Bacteroides ovatus. Preoperative C-reactive protein and inflammation degree, the most reliable indicators of bacterial translocation, were elevated as expected. DNA amplification was a quick and useful method to detect pathogens and it was even more valuable in detecting aggressive pathogens such as anaerobes, difficult to preserve in biological cultures; its drawbacks were the lack of biological growths and of antibiograms. In our pilot study RT-PCR and cultures did not influence the way patients were treated.

  20. Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

    Directory of Open Access Journals (Sweden)

    Shichu Huang

    Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

  1. Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

    Science.gov (United States)

    Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

    2013-01-01

    In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

  2. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection.

    Science.gov (United States)

    Velders, Aldrik H; Schoen, Cor; Saggiomo, Vittorio

    2018-02-01

    Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap and easy, one-button device that can perform LAMP experiments. Here we show how to build and program an Arduino shield for a LAMP and detection of DNA. The here described Arduino Shield is cheap, easy to assemble, to program and use, it is battery operated and the detection of DNA is done by naked-eye so that it can be used in field.

  3. Diversities in virulence, antifungal activity, pigmentation and DNA fingerprint among strains of Burkholderia glumae.

    Science.gov (United States)

    Karki, Hari S; Shrestha, Bishnu K; Han, Jae Woo; Groth, Donald E; Barphagha, Inderjit K; Rush, Milton C; Melanson, Rebecca A; Kim, Beom Seok; Ham, Jong Hyun

    2012-01-01

    Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR.

  4. Estimates of population genetic diversity in brown bullhead catfish by DNA fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Roth, A.C.; Wessendarp, T.K.; Gordon, D.A.; Smith, M.K. [Environmental Protection Agency, Cincinnati, OH (United States); Lattier, D.L. [Oak Ridge Inst. for Science and Education, Cincinnati, OH (United States); Hertzberg, V.; Leonard, A. [Univ. of Cincinnati, OH (United States). Dept. of Environmental Health

    1994-12-31

    Estimates of population genetic diversity may be a sensitive indicator of environmental impact, since limiting the effective breeding population by any means will result in loss of some variant genotypes, as has been demonstrated by allozyme analysis. DNA fingerprinting techniques are also coming into use for population analyses, and the authors chose to apply fingerprinting analysis three populations of brown bullhead catfish collected in Northern Ohio. DNA was isolated from the red blood cells of individual fish. Purified DNAs were digested with EcoR1 restriction enzyme; the digests were then sized on a 1% agarose gel, transferred to nylon membranes and probed with a radiolabeled M13 probe using the Westneat hybridization protocol (Southern blotting). This method effects fragments containing VNTR (variable number of tandem repeat) sequences complementary to the M13, which are highly variable among individual catfish. Hybridized bands were visualized by a Molecular Dynamics phosphorimager and recorded and analyzed with its proprietary Imagequant image analysis program, Excel and SAS. A total of 10 variable bands were identified and their presence or absence scored in each individual. These data were analyzed to determine between and within-population similarity indices as well as population heterozygosity and genetic diversity measures.

  5. Tuberculosis outbreaks predicted by characteristics of first patients in a DNA fingerprint cluster.

    Science.gov (United States)

    Kik, Sandra V; Verver, Suzanne; van Soolingen, Dick; de Haas, Petra E W; Cobelens, Frank G; Kremer, Kristin; van Deutekom, Henk; Borgdorff, Martien W

    2008-07-01

    Some clusters of patients who have Mycobacterium tuberculosis isolates with identical DNA fingerprint patterns grow faster than others. It is unclear what predictors determine cluster growth. To assess whether the development of a tuberculosis (TB) outbreak can be predicted by the characteristics of its first two patients. Demographic and clinical data of all culture-confirmed patients with TB in the Netherlands from 1993 through 2004 were combined with DNA fingerprint data. Clusters were restricted to cluster episodes of 2 years to only detect newly arising clusters. Characteristics of the first two patients were compared between small (2-4 cases) and large (5 or more cases) cluster episodes. Of 5,454 clustered cases, 1,756 (32%) were part of a cluster episode of 2 years. Of 622 cluster episodes, 54 (9%) were large and 568 (91%) were small episodes. Independent predictors for large cluster episodes were as follows: less than 3 months' time between the diagnosis of the first two patients, one or both patients were young (<35 yr), both patients lived in an urban area, and both patients came from sub-Saharan Africa. In the Netherlands, patients in new cluster episodes should be screened for these risk factors. When the risk pattern applies, targeted interventions (e.g., intensified contact investigation) should be considered to prevent further cluster expansion.

  6. DNA fingerprint similarity between female and juvenile brown-headed cowbirds trapped together

    Science.gov (United States)

    Hahn, D.C.; Fleischer, R.C.

    1995-01-01

    This DNA fingerprinting study investigates whether females of the brood parasite brown-headed cowbird, Molothrus ater, associate with their own juvenile offspring at feeding sites more often than would be expected by chance. Cowbirds lay their eggs in the nests of a variety of host species and, as far as is known, leave them to the care of foster parents. Using baited walk-in funnel traps, 36 adult female-juvenile pairs (or trios) of cowbirds were trapped. Blood samples were collected from these individuals to conduct DNA fingerprinting analyses, calculate similarity indices, and to compare S-values for the 11 comparisons of juveniles and the females with which they were caught with S-values of random pairings of juveniles and the females in adjacent gel lanes with which they were not caught. Overall band-sharing was significantly higher for the individuals trapped together than for the random pairings. These associations between juvenile cowbirds and their mothers could occur as a result of female cowbirds monitoring the development of their young in the nests where they have laid. Alternatively, nestling cowbirds in the nest could become familiar visually and locally with a female parent that is frequently in their territory and could follow her when she departs for feeding grounds. In either case these data suggest that adult cowbirds associate with juveniles, in some cases their own offspring, and that offspring may learn to function as cowbirds in part from this association.

  7. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  8. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.

    2002-01-01

    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

  9. Examining the effects of a DNA fingerprinting workshop on science teachers' professional development and student learning

    Science.gov (United States)

    Sonmez, Duygu

    behavior. The goal is to understand what factors affect teachers' decision making to implement the new knowledge and skills in their classrooms. For this purpose, the study focuses on the effects of a DNA fingerprinting workshop, which has been developed and is regularly offered by a large Midwestern university in the United States for secondary science teachers and their students through cooperation between the university and a large Midwestern public school district. The workshop focuses on the biotechnology applications of genetics---specifically, use of DNA fingerprinting technology in different areas of social life---while forensic science is emphasized. Results indicate that the teachers' motivation to attend the DNA Fingerprinting professional development workshop was mainly influenced by two variables: (1) the need to improve content knowledge and skills, and (2) requirements associated with current educational policies. Level of content knowledge was also found to be a factor contributing to teachers' motivation to implement the workshop. Concerns related to student maturity and classroom management were also identified as factors influencing teachers' implementation behavior. Evidence that the DNA Fingerprinting workshop can be successfully implemented by classroom teachers was obtained. The DNA fingerprinting workshop was found to be a successful model for packaging professional development experiences for content intensive areas.

  10. Cell kinetics, DNA integrity, differentiation, and lipid fingerprinting analysis of rabbit adipose-derived stem cells.

    Science.gov (United States)

    Barretto, Letícia Siqueira de Sá; Lessio, Camila; Sawaki e Nakamura, Ahy Natally; Lo Turco, Edson Guimarães; da Silva, Camila Gonzaga; Zambon, João Paulo; Gozzo, Fábio César; Pilau, Eduardo Jorge; de Almeida, Fernando Gonçalves

    2014-10-01

    Human adipose tissue has been described as a potential alternative reservoir for stem cells. Although studies have been performed in rabbits using autologous adipose-derived stem cells (ADSC), these cells have not been well characterized. The primary objectives of this study were to demonstrate the presence of adipose-derived stem cells isolated from rabbit inguinal fat pads and to characterize them through osteogenic and adipogenic in vitro differentiation and lipid fingerprinting analysis. The secondary objective was to evaluate cell behavior through growth kinetics, cell viability, and DNA integrity. Rabbit ADSCs were isolated to determine the in vitro growth kinetics and cell viability. DNA integrity was assessed by an alkaline Comet assay in passages 0 and 5. The osteogenic differentiation was evaluated by Von Kossa, and Alizarin Red S staining and adipogenic differentiation were assessed by Oil Red O staining. Lipid fingerprinting analyses of control, adipogenic, and osteogenic differentiated cells were performed by MALDI-TOF/MS. We demonstrate that rabbit ADSC have a constant growth rate at the early passages, with increased DNA fragmentation at or after passage 5. Rabbit ADSC viability was similar in passages 2 and 5 (90.7% and 86.6%, respectively), but there was a tendency to decreased cellular growth rate after passage 3. The ADSC were characterized by the expression of surface markers such as CD29 (67.4%) and CD44 (89.4%), using CD 45 (0.77%) as a negative control. ADSC from rabbits were successfully isolated form the inguinal region. These cells were capable to differentiate into osteogenic and adipogenic tissue when they were placed in inductive media. After each passage, there was a trend towards decreased cell growth. On the other hand, DNA fragmentation increased at each passage. ADSC had a different lipid profile when placed in control, adipogenic, or osteogenic media.

  11. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  12. Direct PCR amplification of forensic touch and other challenging DNA samples: A review.

    Science.gov (United States)

    Cavanaugh, Sarah E; Bathrick, Abigail S

    2018-01-01

    DNA evidence sample processing typically involves DNA extraction, quantification, and STR amplification; however, DNA loss can occur at both the DNA extraction and quantification steps, which is not ideal for forensic evidence containing low levels of DNA. Direct PCR amplification of forensic unknown samples has been suggested as a means to circumvent extraction and quantification, thereby retaining the DNA typically lost during those procedures. Direct PCR amplification is a method in which a sample is added directly to an amplification reaction without being subjected to prior DNA extraction, purification, or quantification. It allows for maximum quantities of DNA to be targeted, minimizes opportunities for error and contamination, and reduces the time and monetary resources required to process samples, although data analysis may take longer as the increased DNA detection sensitivity of direct PCR may lead to more instances of complex mixtures. ISO 17025 accredited laboratories have successfully implemented direct PCR for limited purposes (e.g., high-throughput databanking analysis), and recent studies indicate that direct PCR can be an effective method for processing low-yield evidence samples. Despite its benefits, direct PCR has yet to be widely implemented across laboratories for the processing of evidentiary items. While forensic DNA laboratories are always interested in new methods that will maximize the quantity and quality of genetic information obtained from evidentiary items, there is often a lag between the advent of useful methodologies and their integration into laboratories. Delayed implementation of direct PCR of evidentiary items can be attributed to a variety of factors, including regulatory guidelines that prevent laboratories from omitting the quantification step when processing forensic unknown samples, as is the case in the United States, and, more broadly, a reluctance to validate a technique that is not widely used for evidence samples. The

  13. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Science.gov (United States)

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Detection of genetically modified organisms (GMOs using isothermal amplification of target DNA sequences

    Directory of Open Access Journals (Sweden)

    La Mura Maurizio

    2009-02-01

    Full Text Available Abstract Background The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR. Here we have applied the loop-mediated isothermal amplification (LAMP method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene junctions. Results We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. Conclusion This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  15. Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

    Science.gov (United States)

    Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

    2014-01-01

    DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic

  16. Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes

    NARCIS (Netherlands)

    S. Tims (Sebastian); W.J.B. van Wamel (Willem); H.P. Endtz (Hubert); A.F. van Belkum (Alex); M.H. Kayser (Manfred)

    2009-01-01

    textabstractHuman fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically

  17. Detection of DNA methylation changes in micropropagated banana plants using methylation-sensitive amplification polymorphism (MSAP).

    Science.gov (United States)

    Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.

    2001-07-01

    The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.

  18. Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

    Directory of Open Access Journals (Sweden)

    Åkerlund Monika

    2010-01-01

    Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

  19. DNA Hydrogel with Tunable pH-Responsive Properties Produced by Rolling Circle Amplification.

    Science.gov (United States)

    Xu, Wanlin; Huang, Yishun; Zhao, Haoran; Li, Pan; Liu, Guoyuan; Li, Jing; Zhu, Chengshen; Tian, Leilei

    2017-12-22

    Recently, smart DNA hydrogels, which are generally formed by the self-assembly of oligonucleotides or through the cross-linking of oligonucleotide-polymer hybrids, have attracted tremendous attention. However, the difficulties of fabricating DNA hydrogels limit their practical applications. We report herein a novel method for producing pH-responsive hydrogels by rolling circle amplification (RCA). In this method, pH-sensitive cross-linking sites were introduced into the polymeric DNA chains during DNA synthesis. As the DNA sequence can be precisely defined by its template, the properties of such hydrogels can be finely tuned in a very facile way through template design. We have investigated the process of hydrogel formation and pH-responsiveness to provide rationales for functional hydrogel design based on the RCA reaction. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DNA-fingerprinting di stipiti di Chryseobacterium spp isolati da pazienti con Fibrosi Cistica

    Directory of Open Access Journals (Sweden)

    Antonietta Lambiase

    2007-03-01

    Full Text Available Objectives: Pulmonary infections by Gram-negative bacteria, as Pseudomonas aeruginosa, Burkholderia cepacia, Stenotrophomonas maltophilia, are the major cause of morbidity in Cystic Fibrosis patients. In the past decade, several pathogens as Alcaligenes spp and no tuberculosis mycobacteria have been recovered in these patients. Bacteria of genus Chryseobacterium are widespread Gram-negative microrganisms and involved in human infections. Aims of this study were to value the isolation frequency of Chryseobacterium strains in a cohort of Cystic Fibrosis patients, to investigate their antimicrobial sensibility and to establish possible clonal likeness between strains. Methods:A retrospective study was undertaken between January 2003 and December 2005 on 300 patients receiving care at the Regional Cystic Fibrosis Centre of Naples University “Federico II”. Sputum samples were checked: for bacterial identification, selective media and commercial identification systems were used.The activity of antimicrobial agents was determined using diffusion and microdiluthion methods. For DNA-fingerprinting, a genomic DNA macrorestriction followed by pulsed-field electrophoresis was carried out. Results:A total of 26 strains from 17 patients were isolated (7 C. meningosepticum, 14 C. indologenes, 5 C. gleum. Strains were resistant to cephalosporins and carbapenems; some were sensitive to ciprofloxacin, levofloxacin and trimethoprim-sulphamethoxazole. Macrorestriction analysis showed substantial heterogeneity among strains. Conclusions: Actually, the prognostic role of Chryseobacterium in Cystic Fibrosis is unclear and although the small number of isolations, it is need to be on the look out regard such microorganisms. The considerable resistance implies difficulties on therapeutic approach. Results of DNA-fingerprinting indicate no evidence of clonal likeness and then of patient-to-patient spread.

  1. Donor-derived metastatic melanoma in a liver transplant recipient established by DNA fingerprinting.

    Science.gov (United States)

    Bilal, Muhammad; Eason, James D; Das, Kanak; Sylvestre, Pamela B; Dean, Amanda G; Vanatta, Jason M

    2013-10-01

    Metastatic melanoma is a donor-derived malignancy that has rarely been reported in liver allograft recipients. We present a case of a transmitted donor-derived melanoma to a liver allograft recipient in whom the diagnosis was established by polymerase chain reaction-based DNA fingerprinting. A 52-year-old African-American man underwent a successful orthotropic liver transplant for alcohol-induced cirrhosis. One year after the orthotropic liver transplant, he presented at our institution with diffuse abdominal pain, and a computed tomography scan of the abdomen and chest showed innumerable masses diffusely involving the liver and multiple subcutaneous nodules in the abdominal and chest wall. A liver biopsy confirmed the diagnosis of metastatic melanoma. The origin of melanoma was traced to the donor by DNA fingerprinting of the native liver, the donor liver, and the donor gallbladder. Chemotherapy was initiated with temozolomide (75 mg/m² daily) and thalidomide (50 mg daily), to which he responded within 8 weeks with radiologic improvement in metastatic lesions. Tacrolimus was switched to sirolimus because of renal insufficiency as well as reported effectiveness against melanoma. Our patient survived for 9 months after the diagnosis of metastatic melanoma. He ultimately died of brain metastases. Donor-derived metastatic melanoma is a rare cancer with the highest transmission and mortality rates, which requires better recognition. Prompt diagnosis of donor-derived melanoma is critical and can be achieved reliably with polymerase chain reaction-based DNA analysis. Management options after diagnosis include de-escalation of immunosuppression, with or without urgent organ removal or retransplant. The roles of chemotherapy, immunotherapy, and radiotherapy require further study.

  2. Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

    Science.gov (United States)

    Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

    2015-12-28

    The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.

  3. DNA fingerprinting validates seed dispersal curves from observational studies in the neotropical legume parkia.

    Science.gov (United States)

    Heymann, Eckhard W; Lüttmann, Kathrin; Michalczyk, Inga M; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

    2012-01-01

    Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants.

  4. DNA Fingerprinting Validates Seed Dispersal Curves from Observational Studies in the Neotropical Legume Parkia

    Science.gov (United States)

    Heymann, Eckhard W.; Lüttmann, Kathrin; Michalczyk, Inga M.; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

    2012-01-01

    Background Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. Methodology/Principal Findings In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Conclusions/Significance Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants. PMID:22514748

  5. New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

    Science.gov (United States)

    Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

    2011-09-01

    Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

  6. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  7. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  8. Fingerprinting of Peptides with a Large Channel of Bacteriophage Phi29 DNA Packaging Motor.

    Science.gov (United States)

    Ji, Zhouxiang; Wang, Shaoying; Zhao, Zhengyi; Zhou, Zhi; Haque, Farzin; Guo, Peixuan

    2016-09-01

    Nanopore technology has become a highly sensitive and powerful tool for single molecule sensing of chemicals and biopolymers. Protein pores have the advantages of size amenability, channel homogeneity, and fabrication reproducibility. But most well-studied protein pores for sensing are too small for passage of peptide analytes that are typically a few nanometers in dimension. The funnel-shaped channel of bacteriophage phi29 DNA packaging motor has previously been inserted into a lipid membrane to serve as a larger pore with a narrowest N-terminal constriction of 3.6 nm and a wider C-terminal end of 6 nm. Here, the utility of phi29 motor channel for fingerprinting of various peptides using single molecule electrophysiological assays is reported. The translocation of peptides is proved unequivocally by single molecule fluorescence imaging. Current blockage percentage and distinctive current signatures are used to distinguish peptides with high confidence. Each peptide generated one or two distinct current blockage peaks, serving as typical fingerprint for each peptide. The oligomeric states of peptides can also be studied in real time at single molecule level. The results demonstrate the potential for further development of phi29 motor channel for detection of disease-associated peptide biomarkers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  10. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  11. Low frequency of extra-pair fertilizations in the Great Tit Parus major revealed by DNA fingerprinting

    NARCIS (Netherlands)

    Verboven, N.; Mateman, A.C.

    1997-01-01

    Multilocus DNA fingerprinting was used to estimate the frequency of extra-pair fertilizations in a low density, island population of Great Tits Parus major. A total of 69 pairs and 516 offspring from 82 breeding attempts were examined. Only 18 offspring (3.5%) in seven different nests were not

  12. Investigating the Effects of a DNA Fingerprinting Workshop on 10th Grade Students' Self Efficacy and Attitudes toward Science.

    Science.gov (United States)

    Sonmez, Duygu; Simcox, Amanda

    The purpose of this study was investigate the effects of a DNA Fingerprinting Workshop on 10th grade students' self efficacy and attitudes toward science. The content of the workshop based on high school science curriculum and includes multimedia instruction, laboratory experiment and participation of undergraduate students as mentors. N=93…

  13. Amplification of a transcriptionally active DNA sequence in the human brain

    International Nuclear Information System (INIS)

    Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

    1986-01-01

    The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

  14. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

    Science.gov (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

    2016-07-15

    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Real-time DNA Amplification and Detection System Based on a CMOS Image Sensor.

    Science.gov (United States)

    Wang, Tiantian; Devadhasan, Jasmine Pramila; Lee, Do Young; Kim, Sanghyo

    2016-01-01

    In the present study, we developed a polypropylene well-integrated complementary metal oxide semiconductor (CMOS) platform to perform the loop mediated isothermal amplification (LAMP) technique for real-time DNA amplification and detection simultaneously. An amplification-coupled detection system directly measures the photon number changes based on the generation of magnesium pyrophosphate and color changes. The photon number decreases during the amplification process. The CMOS image sensor observes the photons and converts into digital units with the aid of an analog-to-digital converter (ADC). In addition, UV-spectral studies, optical color intensity detection, pH analysis, and electrophoresis detection were carried out to prove the efficiency of the CMOS sensor based the LAMP system. Moreover, Clostridium perfringens was utilized as proof-of-concept detection for the new system. We anticipate that this CMOS image sensor-based LAMP method will enable the creation of cost-effective, label-free, optical, real-time and portable molecular diagnostic devices.

  16. DNA fingerprinting of Mycobacterium tuberculosis: from phage typing to whole-genome sequencing.

    Science.gov (United States)

    Schürch, Anita C; van Soolingen, Dick

    2012-06-01

    Current typing methods for Mycobacterium tuberculosis complex evolved from simple phenotypic approaches like phage typing and drug susceptibility profiling to DNA-based strain typing methods, such as IS6110-restriction fragment length polymorphisms (RFLP) and variable number of tandem repeats (VNTR) typing. Examples of the usefulness of molecular typing are source case finding and epidemiological linkage of tuberculosis (TB) cases, international transmission of MDR/XDR-TB, the discrimination between endogenous reactivation and exogenous re-infection as a cause of relapses after curative treatment of tuberculosis, the evidence of multiple M. tuberculosis infections, and the disclosure of laboratory cross-contaminations. Simultaneously, phylogenetic analyses were developed based on single nucleotide polymorphisms (SNPs), genomic deletions usually referred to as regions of difference (RDs) and spoligotyping which served both strain typing and phylogenetic analysis. National and international initiatives that rely on the application of these typing methods have brought significant insight into the molecular epidemiology of tuberculosis. However, current DNA fingerprinting methods have important limitations. They can often not distinguish between genetically closely related strains and the turn-over of these markers is variable. Moreover, the suitability of most DNA typing methods for phylogenetic reconstruction is limited as they show a high propensity of convergent evolution or misinfer genetic distances. In order to fully explore the possibilities of genotyping in the molecular epidemiology of tuberculosis and to study the phylogeny of the causative bacteria reliably, the application of whole-genome sequencing (WGS) analysis for all M. tuberculosis isolates is the optimal, although currently still a costly solution. In the last years WGS for typing of pathogens has been explored and yielded important additional information on strain diversity in comparison to the

  17. Accurate quantification of mouse mitochondrial DNA without co-amplification of nuclear mitochondrial insertion sequences.

    Science.gov (United States)

    Malik, Afshan N; Czajka, Anna; Cunningham, Phil

    2016-07-01

    Mitochondria contain an extra-nuclear genome in the form of mitochondrial DNA (MtDNA), damage to which can lead to inflammation and bioenergetic deficit. Changes in MtDNA levels are increasingly used as a biomarker of mitochondrial dysfunction. We previously reported that in humans, fragments in the nuclear genome known as nuclear mitochondrial insertion sequences (NumtS) affect accurate quantification of MtDNA. In the current paper our aim was to determine whether mouse NumtS affect the quantification of MtDNA and to establish a method designed to avoid this. The existence of NumtS in the mouse genome was confirmed using blast N, unique MtDNA regions were identified using FASTA, and MtDNA primers which do not co-amplify NumtS were designed and tested. MtDNA copy numbers were determined in a range of mouse tissues as the ratio of the mitochondrial and nuclear genome using real time qPCR and absolute quantification. Approximately 95% of mouse MtDNA was duplicated in the nuclear genome as NumtS which were located in 15 out of 21 chromosomes. A unique region was identified and primers flanking this region were used. MtDNA levels differed significantly in mouse tissues being the highest in the heart, with levels in descending order (highest to lowest) in kidney, liver, blood, brain, islets and lung. The presence of NumtS in the nuclear genome of mouse could lead to erroneous data when studying MtDNA content or mutation. The unique primers described here will allow accurate quantification of MtDNA content in mouse models without co-amplification of NumtS. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  18. Amplification volume reduction on DNA database samples using FTA™ Classic Cards.

    Science.gov (United States)

    Wong, Hang Yee; Lim, Eng Seng Simon; Tan-Siew, Wai Fun

    2012-03-01

    The DNA forensic community always strives towards improvements in aspects such as sensitivity, robustness, and efficacy balanced with cost efficiency. Therefore our laboratory decided to study the feasibility of PCR amplification volume reduction using DNA entrapped in FTA™ Classic Card and to bring cost savings to the laboratory. There were a few concerns the laboratory needed to address. First, the kinetics of the amplification reaction could be significantly altered. Second, an increase in sensitivity might affect interpretation due to increased stochastic effects even though they were pristine samples. Third, statics might cause FTA punches to jump out of its allocated well into another thus causing sample-to-sample contamination. Fourth, the size of the punches might be too small for visual inspection. Last, there would be a limit to the extent of volume reduction due to evaporation and the possible need of re-injection of samples for capillary electrophoresis. The laboratory had successfully optimized a reduced amplification volume of 10 μL for FTA samples. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  19. Persistent Amplification of DNA Damage Signal Involved in Replicative Senescence of Normal Human Diploid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Masatoshi Suzuki

    2012-01-01

    Full Text Available Foci of phosphorylated histone H2AX and ATM are the surrogate markers of DNA double strand breaks. We previously reported that the residual foci increased their size after irradiation, which amplifies DNA damage signals. Here, we addressed whether amplification of DNA damage signal is involved in replicative senescence of normal human diploid fibroblasts. Large phosphorylated H2AX foci (>1.5 μm diameter were specifically detected in presenescent cells. The frequency of cells with large foci was well correlated with that of cells positive for senescence-associated β-galactosidase staining. Hypoxic cell culture condition extended replicative life span of normal human fibroblast, and we found that the formation of large foci delayed in those cells. Our immuno-FISH analysis revealed that large foci partially localized at telomeres in senescent cells. Importantly, large foci of phosphorylated H2AX were always colocalized with phosphorylated ATM foci. Furthermore, Ser15-phosphorylated p53 showed colocalization with the large foci. Since the treatment of senescent cells with phosphoinositide 3-kinase inhibitor, wortmannin, suppressed p53 phosphorylation, it is suggested that amplification of DNA damage signaling sustains persistent activation of ATM-p53 pathway, which is essential for replicative senescence.

  20. A reliable and reproducible technique for DNA fingerprinting in biorepositories: a pilot study from BioBIM.

    Science.gov (United States)

    Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Ialongo, Cristiano; Leone, Barbara; Lopez, Nadia; Valente, Maria Giovanna; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

    2013-12-17

    Standard operating procedures (SOPs) optimization for nucleic acid extraction from stored samples is of crucial importance in a biological repository, considering the large number of collected samples and their future downstream molecular and biological applications. However, the validity of molecular studies using stored specimens depends not only on the integrity of the biological samples, but also on the procedures that ensure the traceability of the same sample, certifying its uniqueness, and ensuring the identification of potential sample contaminations. With this aim, we have developed a rapid, reliable, low-cost, and simple DNA fingerprinting tool for a routine use in quality control of biorepositories samples. The method consists of a double ALU insertion/deletion genotyping panel suitable for uniqueness, identification of sample contaminations, and gender validation. Preliminary data suggest that this easy-to-use DNA fingerprinting protocol could routinely provide assurances of DNA identity and quality in a biorepository setting.

  1. Correlation of SHOX2 Gene Amplification and DNA Methylation in Lung Cancer Tumors

    International Nuclear Information System (INIS)

    Schneider, Katja U; Liebenberg, Volker; Kneip, Christoph; Seegebarth, Anke; Erdogan, Fikret; Rappold, Gudrun; Schmidt, Bernd; Dietrich, Dimo; Fleischhacker, Michael; Leschber, Gunda; Merk, Johannes; Schäper, Frank; Stapert, Henk R; Vossenaar, Erik R; Weickmann, Sabine

    2011-01-01

    DNA methylation in the SHOX2 locus was previously used to reliably detect lung cancer in a group of critical controls, including 'cytologically negative' samples with no visible tumor cell content, at a high specificity based on the analysis of bronchial lavage samples. This study aimed to investigate, if the methylation correlates with SHOX2 gene expression and/or copy number alterations. An amplification of the SHOX2 gene locus together with the observed tumor-specific hypermethylation might explain the good performance of this marker in bronchial lavage samples. SHOX2 expression, gene copy number and DNA methylation were determined in lung tumor tissues and matched morphologically normal adjacent tissues (NAT) from 55 lung cancer patients. Quantitative HeavyMethyl (HM) real-time PCR was used to detect SHOX2 DNA methylation levels. SHOX2 expression was assayed with quantitative real-time PCR, and copy numbers alterations were measured with conventional real-time PCR and array CGH. A hypermethylation of the SHOX2 locus in tumor tissue as compared to the matched NAT from the same patient was detected in 96% of tumors from a group of 55 lung cancer patients. This correlated highly significantly with the frequent occurrence of copy number amplification (p < 0.0001), while the expression of the SHOX2 gene showed no difference. Frequent gene amplification correlated with hypermethylation of the SHOX2 gene locus. This concerted effect qualifies SHOX2 DNA methylation as a biomarker for lung cancer diagnosis, especially when sensitive detection is needed, i.e. in bronchial lavage or blood samples

  2. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

    Science.gov (United States)

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

    2014-07-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Limited variation of DNA fingerprints (IS6110 and IS1081) in Korean strains of Mycobacterium tuberculosis.

    Science.gov (United States)

    Huh, Y J; Ahn, D I; Kim, S J

    1995-08-01

    To establish the usefulness of DNA fingerprinting for the epidemiology of Mycobacterium tuberculosis isolated from Korean tuberculosis patients. Comparison of restriction fragment length polymorphism (RFLP) patterns produced by southern hybridization of PvuII-digested chromosomal DNA. IS6110-associated banding patterns of 41 isolates varied considerably, containing 1-13 copies. The RFLP pattern of the epidemiologically related M. tuberculosis isolates was identical in 8 of 10 groups of close contact patients. No noticeable differences in RFLP were observed between drug-sensitive and drug-resistant isolates. IS1081-containing restriction fragment analysis of 52 isolates showed 6 different banding patterns, and the C type was found dominant in Korea. Identification of G type M. tuberculosis, which has a 8.0 kb IS1081-containing PvuII fragment, is unusual because it has been observed only in M. bovis BCG so far. IS6110 was a very useful tool for tracing the transmission route of tuberculosis; IS1081 was also useful for subdividing M. tuberculosis into several groups.

  4. Application of DNA fingerprinting to the recovery program of the endangered Puerto Rican parrot

    Science.gov (United States)

    Brock, M.K.; White, B.N.

    1992-01-01

    The Puerto Rican parrot was reduced to 13 animals in 1975 and as a conservation measure, a captive population was established from a few founders taken from the wild between 1973 and 1983. The number of successful breeding pairs in captivity has been !ow, and the captive breeding program has not been as productive as that of the closely related Hispaniolan parrot. Therefore, a genetic study was initiated to examine the relative levels of relatedness of the captive founders using levels of bandsharing in DNA fingerprints. Unrelated captive founder Puerto Rican parrots had the same average level of bandsharing (0.41) as second-degree relatives of the Hispaniolan parrot (0.38, P > 0,05), with an inbreeding coefficient of 0.04. High levels of bandsharing (>40%) between pairs of males and females correlated with reproductive failure, suggesting that inbreeding depression is partly responsible for the !ow number of' breeding pairs. Consequently, DNA profiling can be used to guide the captive breeding program for the Puerto Rican parrot, and other endangered species, by identifying pairs of males and females with low levels of bandsharing.

  5. Development and Characterization of Complex DNA Fingerprinting Probes for the Infectious Yeast Candida dubliniensis

    Science.gov (United States)

    Joly, Sophie; Pujol, Claude; Rysz, Michal; Vargas, Kaaren; Soll, David R.

    1999-01-01

    Using a strategy to clone large genomic sequences containing repetitive elements from the infectious yeast Candida dubliniensis, the three unrelated sequences Cd1, Cd24, and Cd25, with respective molecular sizes of 15,500, 10,000, and 16,000 bp, were cloned and analyzed for their efficacy as DNA fingerprinting probes. Each generated a complex Southern blot hybridization pattern with endonuclease-digested genomic DNA. Cd1 generated an extremely variable pattern that contained all of the bands of the pattern generated by the repeat element RPS of Candida albicans. We demonstrated that Cd1 does not contain RPS but does contain a repeat element associated with RPS throughout the C. dubliniensis genome. The Cd1 pattern was the least stable over time both in vitro and in vivo and for that reason proved most effective in assessing microevolution. Cd24, which did not exhibit microevolution in vitro, was highly variable in vivo, suggesting in vivo-dependent microevolution. Cd25 was deemed the best probe for broad epidemiological studies, since it was the most stable over time, was the only truly C. dubliniensis-specific probe of the three, generated the most complex pattern, was distributed throughout all C. dubliniensis chromosomes, and separated a worldwide collection of 57 C. dubliniensis isolates into two distinct groups. The presence of a species-specific repetitive element in Cd25 adds weight to the already substantial evidence that C. dubliniensis represents a bona fide species. PMID:10074523

  6. Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

    Directory of Open Access Journals (Sweden)

    Giuseppe Concheri

    Full Text Available BACKGROUND: The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. METHODOLOGY/PRINCIPAL FINDINGS: The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS and optical emission spectrometry (ICP-OES approaches, and b amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA. CONCLUSIONS: Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

  7. Forensic DNA Banding Patterns: How to Simulate & Explain DNA Fingerprinting in a Classroom with No Budget

    Science.gov (United States)

    Christensen, Doug

    2013-01-01

    Understanding how DNA banding patterns in a gel can aid in the conviction or exoneration of suspects and be utilized for positive identification of biological fathers in paternity cases can be intimidating. In reality, the logistics and technology used in such cases are rather straightforward. This exercise is designed for use in high school…

  8. PCR amplification and DNA sequencing of Demodex injai from otic secretions of a dog.

    Science.gov (United States)

    Milosevic, Milivoj A; Frank, Linda A; Brahmbhatt, Rupal A; Kania, Stephen A

    2013-04-01

    The identification of Demodex mites from dogs is usually based on morphology and location. Mites with uncharacteristic features or from unusual locations, hosts or disease manifestations could represent new species not previously described; however, this is difficult to determine based on morphology alone. The goal of this study was to identify and confirm Demodex injai in association with otitis externa in a dog using PCR amplification and DNA sequencing. Otic samples were obtained from a beagle in which a long-bodied Demodex mite was identified. For comparison, Demodex mite samples were collected from a swab and scraping of the dorsal skin of a wire-haired fox terrier and an otic sample from a dog with generalized and otic demodicosis. To identify the Demodex mite, DNA was extracted, and 16S rRNA was amplified by PCR, sequenced and compared with Demodex sequences available in public databases and from separate samples morphologically diagnosed as D. injai and Demodex canis. PCR amplification of the long-bodied mite rRNA DNA obtained from otic samples was approximately 330 bp and was identical to that from the mite morphologically identified as D. injai obtained from the dorsal skin of a dog. Furthermore, the examined mite did not have any significant homology to any of the reported genes from Demodex spp. These results confirmed that the demodex mites in this case were D. injai. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

  9. ENHANCING NETWORK SECURITY USING 'LEARNING-FROM-SIGNALS' AND FRACTIONAL FOURIER TRANSFORM BASED RF-DNA FINGERPRINTS

    Energy Technology Data Exchange (ETDEWEB)

    Buckner, Mark A [ORNL; Bobrek, Miljko [ORNL; Farquhar, Ethan [ORNL; Harmer, Paul K [Air Force Institute of Technology; Temple, Michael A [Air Force Institute of Technology

    2011-01-01

    Wireless Access Points (WAP) remain one of the top 10 network security threats. This research is part of an effort to develop a physical (PHY) layer aware Radio Frequency (RF) air monitoring system with multi-factor authentication to provide a first-line of defense for network security--stopping attackers before they can gain access to critical infrastructure networks through vulnerable WAPs. This paper presents early results on the identification of OFDM-based 802.11a WiFi devices using RF Distinct Native Attribute (RF-DNA) fingerprints produced by the Fractional Fourier Transform (FRFT). These fingerprints are input to a "Learning from Signals" (LFS) classifier which uses hybrid Differential Evolution/Conjugate Gradient (DECG) optimization to determine the optimal features for a low-rank model to be used for future predictions. Results are presented for devices under the most challenging conditions of intra-manufacturer classification, i.e., same-manufacturer, same-model, differing only in serial number. The results of Fractional Fourier Domain (FRFD) RF-DNA fingerprints demonstrate significant improvement over results based on Time Domain (TD), Spectral Domain (SD) and even Wavelet Domain (WD) fingerprints.

  10. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    Science.gov (United States)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection

  11. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  12. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari

    2014-01-01

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  13. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    Science.gov (United States)

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

    2017-12-22

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  14. Branched-DNA signal amplification combined with paper chromatography hybridization assay and used in hepatitis B virus DNA detection

    International Nuclear Information System (INIS)

    Fu, F.Z.; Liu, L.X.; Wang, W.Q.; Sun, S. H.; Liu, L.B.

    2002-01-01

    Nucleic acids detection method is vital to the clinical pathogen diagnosis. The established method can be classified into target direct amplification and signal amplification format according to the target DNA or RNA being directly amplified or not. Those methods have advantages and disadvantages respectively in the clinical application. In the United States of American, branched-DNA as a strong signal amplifier is broadly used in the quantification of the nucleic acids. To gain satisfied sensitivity, some expensive label molecular and instruments should be adopted. Personnel should be special trained to perform. Hence, those can't be widely carried out in the Third World. To avoid those disadvantages, we used the branched-DNA amplifier in the paper chromatography hybridization assay. Methods: Branched DNA signal amplifier and series of probes complementary to the nucleic acid sequence of hepatitis B virus (HBV) have been synthesized. HBV-DNA or it's capture probe were immobilized on the high flow nitrocellulose strip. Having loaded at one end of the strip in turn, probes or HBV-DNA in the hybridization solution migrate to the opposite end of the strip by capillary forces and hybridizes to the immobilized DNA. The branched-DNA signal amplifier and probe labeled with biotin or 32P were then loaded. Through streptavidin-alkaline phosphatase (SA-AP) conjugate and NBT/BCIP ( the specific chromogenic substrate of AP) or autoradiography, the result can be visualized by color reaction or image production on the X-ray film. Results: The sensitivity of this HBV-DNA detection method used probe labeled with biotin and 32P are 1ng and 10pg. The method using the probe labeled with biotin is simple and rapid (2h) without depending on special instruments, it also avoids the pollution of EtBr which can lead to tumor. And the method using the probe labeled with 32P is simple and sensitive, with the exception of long time autoradiography and the inconvenient isotopic disposal

  15. Identification of a new hominin bone from Denisova Cave, Siberia using collagen fingerprinting and mitochondrial DNA analysis

    Science.gov (United States)

    Brown, Samantha; Higham, Thomas; Slon, Viviane; Pääbo, Svante; Meyer, Matthias; Douka, Katerina; Brock, Fiona; Comeskey, Daniel; Procopio, Noemi; Shunkov, Michael; Derevianko, Anatoly; Buckley, Michael

    2016-03-01

    DNA sequencing has revolutionised our understanding of archaic humans during the Middle and Upper Palaeolithic. Unfortunately, while many Palaeolithic sites contain large numbers of bones, the majority of these lack the diagnostic features necessary for traditional morphological identification. As a result the recovery of Pleistocene-age human remains is extremely rare. To circumvent this problem we have applied a method of collagen fingerprinting to more than 2000 fragmented bones from the site of Denisova Cave, Russia, in order to facilitate the discovery of human remains. As a result of our analysis a single hominin bone (Denisova 11) was identified, supported through in-depth peptide sequencing analysis, and found to carry mitochondrial DNA of the Neandertal type. Subsequent radiocarbon dating revealed the bone to be >50,000 years old. Here we demonstrate the huge potential collagen fingerprinting has for identifying hominin remains in highly fragmentary archaeological assemblages, improving the resources available for wider studies into human evolution.

  16. Diversity of DNA fingerprints of Mycobacterium tuberculosis isolates in the United States.

    Science.gov (United States)

    Yang, Z; Barnes, P F; Chaves, F; Eisenach, K D; Weis, S E; Bates, J H; Cave, M D

    1998-04-01

    To investigate the diversity of IS6110 fingerprints of Mycobacterium tuberculosis isolates in the United States and to determine if matching IS6110 fingerprints represent recent interstate tuberculosis transmission, we performed restriction fragment length polymorphism analysis of M. tuberculosis isolates from 1,326 patients in three geographically separated states. Seven hundred ninety-five different IS6110 fingerprint patterns were generated, and pattern diversity was similar in each state. Ninety-six percent of the fingerprint patterns were observed in only one state, demonstrating that most IS6110 fingerprint patterns are confined to a single geographic location. Of the IS6110 fingerprint patterns that were shared by isolates from more than one state, most isolates with 1 to 5 IS6110 copies were separable by pTBN12 fingerprinting whereas those with > 15 copies were not. One high-copy-number M. tuberculosis strain had identical IS6110 and pTBN12 fingerprints and included 57 isolates from three states. Epidemiological data demonstrated significant recent transmission of tuberculosis within each city but not among the states. This suggests that identical fingerprints of isolates from geographically separate locations most likely reflect interstate tuberculosis transmission in the past, with subsequent intrastate spread of disease. Further evaluation of M. tuberculosis strains that cause outbreaks in different geographic locations will provide insight into the epidemiological and bacteriological factors that facilitate the spread of tuberculosis.

  17. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  18. Extraction, amplification and detection of DNA in microfluidic chip-based assays

    KAUST Repository

    Wu, Jinbo

    2013-12-20

    This review covers three aspects of PCR-based microfluidic chip assays: sample preparation, target amplification, and product detection. We also discuss the challenges related to the miniaturization and integration of each assay and make a comparison between conventional and microfluidic schemes. In order to accomplish these essential assays without human intervention between individual steps, the micro-components for fluid manipulation become critical. We therefore summarize and discuss components such as microvalves (for fluid regulation), pumps (for fluid driving) and mixers (for blending fluids). By combining the above assays and microcomponents, DNA testing of multi-step bio-reactions in microfluidic chips may be achieved with minimal external control. The combination of assay schemes with the use of micro-components also leads to rapid methods for DNA testing via multi-step bioreactions. Contains 259 references.

  19. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  20. Verifying the geographic origin of mahogany (Swietenia macrophylla King) with DNA-fingerprints.

    Science.gov (United States)

    Degen, B; Ward, S E; Lemes, M R; Navarro, C; Cavers, S; Sebbenn, A M

    2013-01-01

    Illegal logging is one of the main causes of ongoing worldwide deforestation and needs to be eradicated. The trade in illegal timber and wood products creates market disadvantages for products from sustainable forestry. Although various measures have been established to counter illegal logging and the subsequent trade, there is a lack of practical mechanisms for identifying the origin of timber and wood products. In this study, six nuclear microsatellites were used to generate DNA fingerprints for a genetic reference database characterising the populations of origin of a large set of mahogany (Swietenia macrophylla King, Meliaceae) samples. For the database, leaves and/or cambium from 1971 mahogany trees sampled in 31 stands from Mexico to Bolivia were genotyped. A total of 145 different alleles were found, showing strong genetic differentiation (δ(Gregorious)=0.52, F(ST)=0.18, G(ST(Hedrick))=0.65) and clear correlation between genetic and spatial distances among stands (r=0.82, P<0.05). We used the genetic reference database and Bayesian assignment testing to determine the geographic origins of two sets of mahogany wood samples, based on their multilocus genotypes. In both cases the wood samples were assigned to the correct country of origin. We discuss the overall applicability of this methodology to tropical timber trading. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  1. DNA fingerprinting and diversity analysis in Aus genotypes using microsatellite markers

    Directory of Open Access Journals (Sweden)

    MD. MONIRUL ISLAM

    2015-08-01

    Full Text Available DNA fingerprinting and genetic diversity of 94 Aus (6 BRRI released Aus variety and 88 local Aus landraces genotypes were carried out to protect the Aus landraces from biopiracy. A total of 91 microsatellite markers were tested for screening the genotypes. Among 91 amplified products, 56% have polymorphic bands giving 195 alleles. The number of alleles per locus ranged from four (RM25 and RM147 to twenty seven (RM519, where average allele number was 9.76. The Polymorphism Information Contents (PIC lied between 0.455 (RM5 to 0.934 (RM519. Most robust marker was found RM519 since it provided the highest PIC value (0.934. Pair-wise genetic dissimilarity co-efficient showed the lowest genetic dissimilarity was found BRRI dhan42 and BRRI dhan43 and the highest genetic dissimilarity was found local landraces each other. Here it is shown that most Aus landraces is recognized to have broad genetic base. Thus it is recommended to use these landraces for future breeding program or include new and untouched local landraces to incorporate new genes and broaden genetic base.

  2. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    Science.gov (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  3. Using DNA fingerprints to infer familial relationships within NHANES III households.

    Science.gov (United States)

    Katki, Hormuzd A; Sanders, Christopher L; Graubard, Barry I; Bergen, Andrew W

    2010-06-01

    Developing, targeting, and evaluating genomic strategies for population-based disease prevention require population-based data. In response to this urgent need, genotyping has been conducted within the Third National Health and Nutrition Examination (NHANES III), the nationally-representative household-interview health survey in the U.S. However, before these genetic analyses can occur, family relationships within households must be accurately ascertained. Unfortunately, reported family relationships within NHANES III households based on questionnaire data are incomplete and inconclusive with regards to actual biological relatedness of family members. We inferred family relationships within households using DNA fingerprints (Identifiler(R)) that contain the DNA loci used by law enforcement agencies for forensic identification of individuals. However, performance of these loci for relationship inference is not well understood. We evaluated two competing statistical methods for relationship inference on pairs of household members: an exact likelihood ratio relying on allele frequencies to an Identical By State (IBS) likelihood ratio that only requires matching alleles. We modified these methods to account for genotyping errors and population substructure. The two methods usually agree on the rankings of the most likely relationships. However, the IBS method underestimates the likelihood ratio by not accounting for the informativeness of matching rare alleles. The likelihood ratio is sensitive to estimates of population substructure, and parent-child relationships are sensitive to the specified genotyping error rate. These loci were unable to distinguish second-degree relationships and cousins from being unrelated. The genetic data is also useful for verifying reported relationships and identifying data quality issues. An important by-product is the first explicitly nationally-representative estimates of allele frequencies at these ubiquitous forensic loci.

  4. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  5. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  6. Evaluation on the effects of ageing factor, sampling and preservation methods on Asiatic black bear (Ursus thibetanus noninvasive DNA amplification

    Directory of Open Access Journals (Sweden)

    Chih-Chin SHIH

    2017-11-01

    Full Text Available Noninvasive genetic sampling allows studying wildlife without having to catch, handle or even observe individuals. In this study, factors which may affect the quality of noninvasive samples of Asiatic black bear (Ursus thibetanus in the subtropical areas were identified. We collected hair and faecal samples from captive Asiatic black bears and quantitatively evaluated the effects of hair age (from fresh to 60 days, faeces age (from fresh to 14 days, faeces sampling locations (i.e. sample collected from either the surface, inside or a mixture of both the surface and inside of faeces, and faeces preservation methods (frozen or kept at room temperature in 95% ethanol on amplification success rates of mitochondrial DNA fragments of different sizes (450bp, 900bp, and 1600bp. The results showed that the amplification success rates decreased with sample age and amplicon size in both hair and faecal DNA. In subtropical environment, there was no significant difference between amplification success of DNA extracted from fresh and 7-day-old samples of either the hair or faeces. The amplification success rates were not influenced by sampling location of faeces. For faeces preserved in 95% ethanol, the amplification success appeared unaffected by frozen at -20 °C or kept at room temperature in shorter mtDNA fragments, but was significantly influenced when amplicon size was 1600bp. The results of this study will reinforce the optimization of noninvasive sampling approaches in Asiatic black bear research, especially in the subtropics.

  7. Highly efficient PCR assay to discriminate allelic DNA methylation status using whole genome amplification

    Directory of Open Access Journals (Sweden)

    Ito Takashi

    2011-06-01

    Full Text Available Abstract Background We previously developed a simple method termed HpaII-McrBC PCR (HM-PCR to discriminate allelic methylation status of the genomic sites of interest, and successfully applied it to a comprehensive analysis of CpG islands (CGIs on human chromosome 21q. However, HM-PCR requires 200 ng of genomic DNA to examine one target site, thereby precluding its application to such samples that are limited in quantity. Findings We developed HpaII-McrBC whole-genome-amplification PCR (HM-WGA-PCR that uses whole-genome-amplified DNA as the template. HM-WGA-PCR uses only 1/100th the genomic template material required for HM-PCR. Indeed, we successfully analyzed 147 CGIs by HM-WGA-PCR using only ~300 ng of DNA, whereas previous HM-PCR study had required ~30 μg. Furthermore, we confirmed that allelic methylation status revealed by HM-WGA-PCR is identical to that by HM-PCR in every case of the 147 CGIs tested, proving high consistency between the two methods. Conclusions HM-WGA-PCR would serve as a reliable alternative to HM-PCR in the analysis of allelic methylation status when the quantity of DNA available is limited.

  8. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification.

    Science.gov (United States)

    Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng

    2014-06-15

    Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  10. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

    Science.gov (United States)

    Fahrimal, Y; Goff, W L; Jasmer, D P

    1992-01-01

    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  11. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Molecular Typing of Borrelia burgdorferi Sensu Lato by Randomly Amplified Polymorphic DNA Fingerprinting Analysis

    Science.gov (United States)

    Wang, Guiqing; van Dam, Alje P.; Spanjaard, Lodewijk; Dankert, Jacob

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA (RAPD) fingerprinting with four arbitrary primers. The RAPD patterns were reproducible up to the 95% similarity level as shown in duplicate experiments. In these experiments the purified DNAs prepared on different days, from different colonies, and after various passages were used as templates. With an intergroup difference of 55%, the 136 strains could be divided into seven genetic clusters. Six clusters comprised and corresponded to the established species B. burgdorferi sensu stricto (n = 23), Borrelia garinii (n = 39), Borrelia afzelii (n = 59), Borrelia japonica (n = 1), Borrelia valaisiana (n = 12), and genomic group DN127 (n = 1). One strain from a patient with erythema migrans (EM) did not belong to any of the species or genomic groups known up to now. The RAPD types of B. burgdorferi sensu stricto, B. garinii, and B. afzelii isolates, which may give rise to human Lyme borreliosis (LB), were associated with their geographic origins. A high degree of genetic diversity was observed among the 39 B. garinii strains, and six subgroups could be recognized. One of these comprised eight isolates from patients with disseminated LB only and no tick isolates. B. afzelii strains from patients with EM or acrodermatitis chronica atrophicans were not clustered in particular branches. Our study showed that RAPD analysis is a powerful tool for discriminating different Borrelia species as well as Borrelia isolates within species. PMID:9508310

  13. Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

    Science.gov (United States)

    Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

    2017-07-15

    This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.

    2013-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

  15. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  16. Detection of γ-ray-induced DNA damages in malformed dominant lethal embryos of the Japanese medaka (Oryzias latipes) using AP-PCR fingerprinting

    International Nuclear Information System (INIS)

    Kubota, Yoshiko; Shimada, Atsuko; Shima, Akihiro

    1992-01-01

    Adult male fish of the medaka HNI strain exposed to 9.5 Gy or 19 Gy (0.95 Gy/min) of γ-rays were mated with non-irradiated female fish of the Hd-rR strain. Genomic DNA was prepared from malformed individual embryos which were expected to be dominant lethal and used for AP-PCR fingerprinting. By the use of a part of the T3 promoter sequence (20 mer), which is not found in the medaka genome as an arbitrary primer, polymorphisms were found in genomic fingerprints which could distinguish the parental strains. On the other hand, fingerprints of F1 hybrids were found to be the sum of those of their parents. Based on these findings, the fingerprints of genomic DNA of each severely malformed embryo were analyzed, because it was expected that radiation-induced genomic damages resulting in severe malformation and eventually in dominant lethals should be detected as changes in paternal fingerprints of F1 hybrids. Indeed, changes were found in genomic DNA as loss of some paternal bands in fingerprints of malformed embryos. One of 10 malformed embryos obtained from 9.5 Gy γ-irradiated males had lost 5 bands. These results indicated a possibility that quantitative as well as qualitative estimation of γ-ray-induced DNA damages can be made by this method which does not require the functional selection based on a specific target gene. (author). 16 refs., 3 figs., 1 tab

  17. LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification DNA Signatures

    Directory of Open Access Journals (Sweden)

    Gardner Shea N

    2011-06-01

    Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.

  18. Amplification of bovine papillomavirus DNA by N-methyl-N'-nitro-N-nitrosoguanidine, ultraviolet irradiation, or infection with herpes simplex virus

    International Nuclear Information System (INIS)

    Schmitt, J.; Schlehofer, J.R.; Mergener, K.; Gissmann, L.; zur Hausen, H.

    1989-01-01

    Treatment with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) or irradiation with ultraviolet light (uv254 nm) induces amplification of integrated as well as episomal sequences of bovine papillomavirus (BPV) type 1 DNA in BPV-1-transformed mouse C127 cells (i.e., ID13 cells). This is shown by filter in situ hybridization and Southern blot analysis of cellular DNA. Similarly, infection of ID13 cells with herpes simplex virus (HSV) type 1 which has been shown to be mutagenic for host cell DNA leads to amplification of BPV DNA sequences. In contrast to this induction of DNA amplification by initiators, treatment of ID13 cells with the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) does not result in increased synthesis of BPV DNA nor does TPA treatment modulate the initiator-induced DNA amplification. Similar to other cell systems infection with adeno-associated virus (AAV) type 2 inhibits BPV-1 DNA amplification irrespective of the inducing agent. In contrast to initiator-induced DNA amplification, treatment with carcinogen (MNNG) or tumor promoters or combination of MNNG and promoter of C127 cells prior to transformation by BPV-1 does not lead to an increase in the number of transformed foci. The induction of amplification of papillomavirus DNA by initiating agents possibly represents one of the mechanisms by which the observed synergism between papillomavirus infection and initiators in tumorigenesis might occur

  19. Assessment of age and greenness of herbarium specimens as predictors for successful extraction and amplification of DNA

    NARCIS (Netherlands)

    Erkens, R.H.J.; Cross, H.; Maas, J.W.; Hoenselaar, K.; Chatrou, L.W.

    2008-01-01

    Age and the greenness of leaves have been frequently used as indicators for selecting herbarium specimens for molecular studies. Although plant DNA extraction and amplification have been common lab procedures for the past 20 years, no studies specifically investigated the success of these

  20. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  1. Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

    2011-02-07

    Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

  2. Amplification of DNA of Xanthomonas axonopodis pv. citri from historic citrus canker herbarium specimens.

    Science.gov (United States)

    Li, Wenbin; Brlansky, Ronald H; Hartung, John S

    2006-05-01

    Herbaria are important resources for the study of the origins and dispersal of plant pathogens, particularly bacterial plant pathogens that incite local lesions in which large numbers of pathogen genomes are concentrated. Xanthomonas axonopodis pv. citri (Xac), the causal agent of citrus bacterial canker disease, is a notable example of such a pathogen. The appearance of novel strains of the pathogen in Florida and elsewhere make it increasingly important to understand the relationships among strains of this pathogen. USDA-ARS at Beltsville, Maryland maintains approximately 700 herbarium specimens with citrus canker disease lesions up to 90 years old, originally collected from all over the world, and so is an important resource for phytogeographic studies of this bacterium. Unfortunately, DNA in herbarium specimens is degraded and may contain high levels of inhibitors of PCR. In this study, we compared a total of 23 DNA isolation techniques in combination with 31 novel primer pairs in order to develop an efficient protocol for the analysis of Xac DNA in herbarium specimens. We identified the most reliable extraction method, identified in terms of successful amplification by our panel of 31 primer pairs. We also identified the most robust primer pairs, identified as successful in the largest number of extracts prepared by different methods. We amplified Xac genomic sequences up to 542 bp long from herbarium samples up to 89 years old. Primers varied in effectiveness, with some primer pairs amplifying Xac DNA from a 1/10,000 dilution of extract from a single lesion from a citrus canker herbarium specimen. Our methodology will be useful to identify pathogens and perform molecular analyses of bacterial and possibly fungal genomes from herbarium specimens.

  3. PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

    Science.gov (United States)

    Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory

    1998-01-01

    We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434

  4. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  5. [Study of genome instability using DNA fingerprinting of the offspring of male mice subjected to chronic low dose gamma irradiation].

    Science.gov (United States)

    Bezlepkin, V G; Vasil'eva, G V; Lomaeva, M G; Sirota, N P; Gaziev, A I

    2000-01-01

    By a polymerase chain reaction with an arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F1 generation) from male parents of mice exposed to chronic low-level gamma-radiation was studied. Male BALB/c mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old offspring mice and DNA was isolated. The primer in the AP-PCR was a 20-mer oligonucleotide flanking the microsatellite locus Atp1b2 on chromosome 11 of the mouse. A comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of microsatellite-associated sequences in the genome of the offspring of the males exposed to 25 and 50 cGy. The DNA-fingerprints of the offspring of male mice exposed to chronic irradiation with the doses 10 and 25 cGy 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of "non-parent bands". The results of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-level radiation prior to fertilization.

  6. DNA Amplification by Breakage/Fusion/Bridge Cycles Initiated by Spontaneous Telomere Loss in a Human Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Anthony W.l. Lo

    2002-01-01

    Full Text Available The development of genomic instability is an important step in generatingthe multiple genetic changes required for cancer. One consequence of genomic instability is the overexpression of oncogenes due to gene amplification. One mechanism for gene amplification is the breakagelfusionlbridge (B/F/Bcyclethatinvolvesthe repeated fusion and breakage of chromosomes following the loss of a telomere. B/F/B cycles have been associated with low-copy gene amplification in human cancer cells, and have been proposed to be an initiating event in high-copy gene amplification. We have found that spontaneous telomere loss on a marker chromosome 16 in a human tumor cell line results in sister chromatid fusion and prolonged periods of chromosome instability. The high rate of anaphase bridges involving chromosome 16 demonstrates that this instability results from B/F/B cycles. The amplification of subtelomeric DNA on the marker chromosome provides conclusive evidence that B/F/B cycles initiated by spontaneous telomere loss are a mechanism for gene amplification in human cancer cells.

  7. Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

    Science.gov (United States)

    Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu

    2018-01-01

    Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844

  8. A novel electrochemical sensor for lead ion based on cascade DNA and quantum dots amplification

    International Nuclear Information System (INIS)

    Tang, Shurong; Lu, Wei; Gu, Fang; Tong, Ping; Yan, Zhiming; Zhang, Lan

    2014-01-01

    A new enzyme-free and ultrasensitive electrochemical Pb 2+ biosensor was developed. By coupling the DNA-assisted cascade of hybridization reaction with the quantum dots (QDs) for signal amplification, a detection limit as low as 6.1 pM can be obtained for Pb 2+ . In this study, the “8-17” DNAzyme was used for specific recognition of Pb 2+ . In the presence of Pb 2+ , the DNAzyme was activated and cleaved the substrate strand. And then, the hybridization between the linker probe and signal probe was initiated, which resulted in formation of a long cascade DNA structure as well as assemble of numerous QDs at last. By the use of magnetic beads, the free signal probe can be easily removed by external magnetic field. After acid lysis, a great amount of redox cations can be released from the QDs and eventually result in significantly amplified electrochemical signals. This method is highly sensitive, selective and simple without the participation of any protein based enzyme (nuclease), thereby holds great potential for real sample analysis

  9. Data on internal cDNA amplification and color changes of the proteins derived from Pacific white leg shrimp shell.

    Science.gov (United States)

    Chuang, Pan; Shoichiro, Ishizaki; Yuji, Nagashima; Jialong, Gao; Shugo, Watabe

    2018-02-01

    In this article, we report original data on the designation of the primers for full-length cDNA amplification and the internal cDNA amplification of red color-related pigment-binding protein derived from shrimp shell. Data on the color shifts of different soluble proteins under 100 °C 10 min heat treatment and the effects of heating temperatures (from 30 to 100 °C) on the color changes of crude water-soluble proteins are also included in this report. For further details and experimental findings please refer to the article "Isolation and cDNA cloning of a novel red color-related pigment-binding protein derived from the shell of shrimp, Litopenaeus vannamei " (Chuang et al., 2017) [1].

  10. Data on internal cDNA amplification and color changes of the proteins derived from Pacific white leg shrimp shell

    Directory of Open Access Journals (Sweden)

    Pan Chuang

    2018-02-01

    Full Text Available In this article, we report original data on the designation of the primers for full-length cDNA amplification and the internal cDNA amplification of red color-related pigment-binding protein derived from shrimp shell. Data on the color shifts of different soluble proteins under 100 °C 10 min heat treatment and the effects of heating temperatures (from 30 to 100 °C on the color changes of crude water-soluble proteins are also included in this report. For further details and experimental findings please refer to the article “Isolation and cDNA cloning of a novel red color-related pigment-binding protein derived from the shell of shrimp, Litopenaeus vannamei” (Chuang et al., 2017 [1].

  11. Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

    Science.gov (United States)

    Qian, Yong; Wang, Chunyan; Gao, Fenglei

    2015-01-15

    A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  13. Stability of Loop-Mediated Isothermal Amplification (LAMP) Reagents and its Amplification Efficiency on Crude Trypanosome DNA Templates

    OpenAIRE

    Thekisoe, Oriel M. M; Bazie, Raoul S. B; Coronel-Servian, Andrea M; Sugimoto, Chihiro; Kawazu, Shin-ichiro; Inoue, Noboru

    2009-01-01

    This study evaluated the stability of LAMP reagents when stored at 25C and 37C, and also assessed its detection efficiency on different DNA template preparations. Accordingly, LAMP using reagents stored at 25C and 37C amplified DNA of in vitro cultured T. b. brucei (GUTat 3.1) from day 1 to day 15 of reagent storage. There were no significant differences (P>0.05) in detection sensitivity of LAMP among the reagents stored at 25C, 37C and –20C (recommended storage temperature). LAMP usin...

  14. Stability of Loop-Mediated Isothermal Amplification (LAMP) reagents and its amplification efficiency on crude trypanosome DNA templates.

    Science.gov (United States)

    Thekisoe, Oriel M M; Bazie, Raoul S B; Coronel-Servian, Andrea M; Sugimoto, Chihiro; Kawazu, Shin-Ichiro; Inoue, Noboru

    2009-04-01

    This study evaluated the stability of LAMP reagents when stored at 25 degrees C and 37 degrees C, and also assessed its detection efficiency on different DNA template preparations. Accordingly, LAMP using reagents stored at 25 degrees C and 37 degrees C amplified DNA of in vitro cultured T. b. brucei (GUTat 3.1) from day 1 to day 15 of reagent storage. There were no significant differences (P>0.05) in detection sensitivity of LAMP among the reagents stored at 25 degrees C, 37 degrees C and -20 degrees C (recommended storage temperature). LAMP using the reagents stored at above-mentioned temperatures amplified serially diluted DNAs (genomic DNA extracted by phenol-chloroform method, FTA card and hemolysed blood) of T. b. gambiense (IL2343) with high sensitivity. Reactions were conducted on the reagents stored from 1 day to 30 days. LAMP detection sensitivity was poor when fresh blood as DNA template was added directly into reactive solution. Results of this study demonstrated that LAMP has the potential to be used in field conditions for diagnosis of trypanosome infections without being affected by ambient temperatures of tropical and sub-tropical countries where trypanosomosis is endemic.

  15. Amplification of an ancestral mammalian L1 family of long interspersed repeated DNA occurred just before the murine radiation

    International Nuclear Information System (INIS)

    Pascale, E.; Valle, E.; Furano, A.V.

    1990-01-01

    Each mammalian genus examined so far contains 50,000-100,000 members of an L1 (LINE 1) family of long interspersed repeated DNA elements. Current knowledge on the evolution of L1 families presents a paradox because, although L1 families have been in mammalian genomes since before the mammalian radiation ∼80 million years ago, most members of the L1 families are only a few million years old. Accordingly it has been suggested either that the extensive amplification that characterizes present-day L1 families did not occur in the past or that old members were removed as new one were generated. However, the authors show here that an ancestral rodent L1 family was extensively amplified ∼10 million years ago and that the relics of this amplification have persisted in modern murine genomes. This amplification occurred just before the divergence of modern murine genera from their common ancestor and identifies the murine node in the lineage of modern muroid rodents The results suggest that repeated amplification of L1 elements is a feature of the evaluation of mammalian genomes and that ancestral amplification events could provide a useful tool for determining mammalian lineages

  16. Detection of phytoplasma by loop-mediated isothermal amplification of DNA (LAMP).

    Science.gov (United States)

    Obura, E; Masiga, D; Wachira, F; Gurja, B; Khan, Z R

    2011-02-01

    Napier stunt phytoplasma (16SrXI and 16SrIII) in eastern Africa is a serious threat to the expansion of Napier grass (Pennisetum purpureum) farming in the region, where it is widely cultivated as fodder in zero grazing livestock systems. The grass has high potential for bio-fuel production, and has been adopted by farmers as a countermeasure to cereal stem borer Lepidoptera, since it attracts and traps the insect. Diagnosis of stunt phytoplasma have been largely by nested polymerase chain reaction (nPCR) targeting the 16S rRNA gene. However, the method is laborious, costly and technically demanding. This investigation has developed a simpler but effective phytoplasma diagnostic tool, called; loop-mediated isothermal amplification of DNA (LAMP). The assay was tested on 8 symptomatic and 8 asymptomatic plants, while its detection limit was compared to nested PCR using samples serially diluted from 3 ng/μl to 0.38 pg/μl. Molecular typing of LAMP products was determined by BsrI restriction digestion and Southern blot analysis. The assay sensitivity, positive and negative predictive values were estimated, while the specificity was tested on 11 phytoplasma groups. LAMP was specific to 5 phytoplasma groups: 16SrVI, X, XI and XVI. BsrI restriction digestion produced two predicted fragments, and there was specific binding of probe DNA to the LAMP amplicons in Southern blot analysis. The assay sensitivity was 100%, while the positive and negative predictive values were 63 and 100% respectively. LAMP was 20-fold more sensitive than nested PCR. This study validates LAMP for routine diagnosis of Napier stunt and other closely related phytoplasmas. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Beauveria keratitis and biopesticides: case histories and a random amplification of polymorphic DNA comparison.

    Science.gov (United States)

    Pariseau, Brett; Nehls, Sarah; Ogawa, Gregory S H; Sutton, Deanna A; Wickes, Brian L; Romanelli, Anna M

    2010-02-01

    The purposes of this study were to describe 2 contact lens-associated Beauveria keratitis cases and to compare the isolates of 3 contact lens-associated Beauveria keratitis cases with Beauveria-based biopesticides using random amplification of polymorphic DNA (RAPD). A 55-year-old diabetic woman from New Mexico and a 31-year-old healthy woman from southern Wisconsin developed soft contact lens-related corneal ulcers unresponsive to topical moxifloxacin and prednisolone acetate drops. Their corneal cultures grew B. bassiana. These isolates, an isolate from a third soft contact lens-related Beauveria keratitis case, and Beauveria-based biopesticides sold in the United States were analyzed using morphological features, DNA sequencing, and RAPD. A PubMed, Cochrane Library, OVID, UpToDate, and Google search using the term "Beauveria" found only 9 reported Beauveria keratitis infections. Patient 1 responded to topical natamycin, ketoconazole, and 200 mg oral ketoconazole twice daily before developing a secondary bacterial infection requiring penetrating keratoplasty. After subsequent cataract surgery, the best-corrected visual acuity was 20/20. Patient 2 was treated with topical natamycin, topical amphotericin, and 200 mg oral voriconazole twice daily for 1 month with residual scarring and a best-corrected visual acuity of 20/25. RAPD showed that all isolates were unrelated. Although earlier reported Beauveria keratitis cases occurred after corneal injury in patients who did not wear contact lenses, 3 recent patients wore soft contact lenses and denied trauma, mirroring a changing trend in microbial keratitis. RAPD analysis showed that the Beauveria isolates were unrelated to one another and to Beauveria-based biopesticides. In Patient 2, oral voriconazole worked well.

  18. Helicase Dependent Isothermal Amplification of DNA and RNA using Self-Avoiding Molecular Recognition Systems

    Science.gov (United States)

    Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M.; Hoshika, Shuichi; Frye, Carole; Benner, Steven A.

    2015-01-01

    Assays that target DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low resource environments, requiring equipment and power that may not be available in these environments. However, isothermal procedures that avoid thermal cycling are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a “self avoiding molecular recognition system” (SAMRS) eliminates these artifacts to give clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3′-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, something difficult to achieve with HDA using standard primers. This shows that SAMRS-HDA is a more versatile approach than standard HDA with a broader applicability for xNA-targeted diagnostics and research. PMID:25953623

  19. Loop-Mediated Isothermal Amplification Targeting Actin DNA of Trichomonas vaginalis.

    Science.gov (United States)

    Goo, Youn-Kyoung; Shin, Won-Sik; Yang, Hye-Won; Joo, So-Young; Song, Su-Min; Ryu, Jae-Sook; Kong, Hyun-Hee; Lee, Won-Ki; Chung, Dong-Il; Hong, Yeonchul

    2016-06-01

    Trichomoniasis caused by Trichomonas vaginalis is a common sexually transmitted disease. Its association with several health problems, including preterm birth, pelvic inflammatory disease, cervical cancer, and transmission of human immunodeficiency virus, emphasizes the importance of improved access to early and accurate detection of T. vaginalis. In this study, a rapid and efficient loop-mediated isothermal amplification-based method for the detection of T. vaginalis was developed and validated, using vaginal swab specimens from subjects suspected to have trichomoniasis. The LAMP assay targeting the actin gene was highly sensitive with detection limits of 1 trichomonad and 1 pg of T. vaginalis DNA per reaction, and specifically amplified the target gene only from T. vaginalis. Validation of this assay showed that it had the highest sensitivity and better agreement with PCR (used as the gold standard) compared to microscopy and multiplex PCR. This study showed that the LAMP assay, targeting the actin gene, could be used to diagnose early infections of T. vaginalis. Thus, we have provided an alternative molecular diagnostic tool and a point-of-care test that may help to prevent trichomoniasis transmission and associated complications.

  20. Analysis of bacterial core communities in the central Baltic by comparative RNA-DNA-based fingerprinting provides links to structure-function relationships.

    Science.gov (United States)

    Brettar, Ingrid; Christen, Richard; Höfle, Manfred G

    2012-01-01

    Understanding structure-function links of microbial communities is a central theme of microbial ecology since its beginning. To this end, we studied the spatial variability of the bacterioplankton community structure and composition across the central Baltic Sea at four stations, which were up to 450 km apart and at a depth profile representative for the central part (Gotland Deep, 235 m). Bacterial community structure was followed by 16S ribosomal RNA (rRNA)- and 16S rRNA gene-based fingerprints using single-strand conformation polymorphism (SSCP) electrophoresis. Species composition was determined by sequence analysis of SSCP bands. High similarities of the bacterioplankton communities across several hundred kilometers were observed in the surface water using RNA- and DNA-based fingerprints. In these surface communities, the RNA- and DNA-based fingerprints resulted in very different pattern, presumably indicating large difference between the active members of the community as represented by RNA-based fingerprints and the present members represented by the DNA-based fingerprints. This large discrepancy changed gradually over depth, resulting in highly similar RNA- and DNA-based fingerprints in the anoxic part of the water column below 130 m depth. A conceivable mechanism explaining this high similarity could be the reduced oxidative stress in the anoxic zone. The stable communities on the surface and in the anoxic zone indicate the strong influence of the hydrography on the bacterioplankton community structure. Comparative analysis of RNA- and DNA-based community structure provided criteria for the identification of the core community, its key members and their links to biogeochemical functions.

  1. A dual amplification strategy for DNA detection combining bio-barcode assay and metal-enhanced fluorescence modality.

    Science.gov (United States)

    Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na

    2014-11-11

    Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.

  2. Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform.

    Science.gov (United States)

    Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

    2014-10-01

    In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LIb) in sweet potato. Using 38 cultivars, we identified 2,024 insertion sites in the two families with an Illumina MiSeq sequencing platform. Of these insertion sites, 91.4% appeared to be polymorphic among the cultivars and 376 cultivar-specific insertion sites were identified, which were converted directly into cultivar-specific sequence-characterized amplified region (SCAR) markers. A phylogenetic tree was constructed using these insertion sites, which corresponded well with known pedigree information, thereby indicating their suitability for genetic diversity studies. Thus, the genome-wide comparative analysis of active retrotransposon insertion sites using the bench-top MiSeq sequencing platform is highly effective for DNA fingerprinting without any requirement for whole genome sequence information. This approach may facilitate the development of practical polymerase chain reaction-based cultivar diagnostic system and could also be applied to the determination of genetic relationships. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. Visual Detection of Potato leafroll virus by One-step Reverse Transcription Loop-Mediated Isothermal Amplification of DNA with Hydroxynaphthol Blue Dye

    NARCIS (Netherlands)

    Ahmadi, S.; Almasi, A.M.; Fatehi, F.; Struik, P.C.; Moradi, A.

    2013-01-01

    Loop-mediated isothermal amplification (LAMP) assay is a novel technique for amplifying DNA under constant temperature, with high specificity, sensitivity, rapidity and efficiency. We applied reverse transcription loop-mediated isothermal amplification (RT-LAMP) to visually detect Potato leafroll

  4. Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

    Directory of Open Access Journals (Sweden)

    KUSUMADEWI SRI YULITA

    2011-07-01

    Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

  5. Robust and efficient direct multiplex amplification method for large-scale DNA detection of blood samples on FTA cards

    International Nuclear Information System (INIS)

    Jiang Bowei; Xiang Fawei; Zhao Xingchun; Wang Lihua; Fan Chunhai

    2013-01-01

    Deoxyribonucleic acid (DNA) damage arising from radiations widely occurred along with the development of nuclear weapons and clinically wide application of computed tomography (CT) scan and nuclear medicine. All ionizing radiations (X-rays, γ-rays, alpha particles, etc.) and ultraviolet (UV) radiation lead to the DNA damage. Polymerase chain reaction (PCR) is one of the most wildly used techniques for detecting DNA damage as the amplification stops at the site of the damage. Improvements to enhance the efficiency of PCR are always required and remain a great challenge. Here we establish a multiplex PCR assay system (MPAS) that is served as a robust and efficient method for direct detection of target DNA sequences in genomic DNA. The establishment of the system is performed by adding a combination of PCR enhancers to standard PCR buffer, The performance of MPAS was demonstrated by carrying out the direct PCR amplification on l.2 mm human blood punch using commercially available primer sets which include multiple primer pairs. The optimized PCR system resulted in high quality genotyping results without any inhibitory effect indicated and led to a full-profile success rate of 98.13%. Our studies demonstrate that the MPAS provides an efficient and robust method for obtaining sensitive, reliable and reproducible PCR results from human blood samples. (authors)

  6. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  7. Optimization of loop-mediated isothermal amplification (LAMP) assays for the detection of Leishmania DNA in human blood samples.

    Science.gov (United States)

    Abbasi, Ibrahim; Kirstein, Oscar D; Hailu, Asrat; Warburg, Alon

    2016-10-01

    Visceral leishmaniasis (VL), one of the most important neglected tropical diseases, is caused by Leishmania donovani eukaryotic protozoan parasite of the genus Leishmania, the disease is prevalent mainly in the Indian sub-continent, East Africa and Brazil. VL can be diagnosed by PCR amplifying ITS1 and/or kDNA genes. The current study involved the optimization of Loop-mediated isothermal amplification (LAMP) for the detection of Leishmania DNA in human blood or tissue samples. Three LAMP systems were developed; in two of those the primers were designed based on shared regions of the ITS1 gene among different Leishmania species, while the primers for the third LAMP system were derived from a newly identified repeated region in the Leishmania genome. The LAMP tests were shown to be sufficiently sensitive to detect 0.1pg of DNA from most Leishmania species. The green nucleic acid stain SYTO16, was used here for the first time to allow real-time monitoring of LAMP amplification. The advantage of real time-LAMP using SYTO 16 over end-point LAMP product detection is discussed. The efficacy of the real time-LAMP tests for detecting Leishmania DNA in dried blood samples from volunteers living in endemic areas, was compared with that of qRT-kDNA PCR. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Amplification of pico-scale DNA mediated by bacterial carrier DNA for small-cell-number transcription factor ChIP-seq

    DEFF Research Database (Denmark)

    Jakobsen, Janus S; Bagger, Frederik O; Hasemann, Marie S

    2015-01-01

    BACKGROUND: Chromatin-Immunoprecipitation coupled with deep sequencing (ChIP-seq) is used to map transcription factor occupancy and generate epigenetic profiles genome-wide. The requirement of nano-scale ChIP DNA for generation of sequencing libraries has impeded ChIP-seq on in vivo tissues of low...... transcription factor (CEBPA) and histone mark (H3K4me3) ChIP. We further demonstrate that genomic profiles are highly resilient to changes in carrier DNA to ChIP DNA ratios. CONCLUSIONS: This represents a significant advance compared to existing technologies, which involve either complex steps of pre...... cell numbers. RESULTS: We describe a robust, simple and scalable methodology for ChIP-seq of low-abundant cell populations, verified down to 10,000 cells. By employing non-mammalian genome mapping bacterial carrier DNA during amplification, we reliably amplify down to 50 pg of ChIP DNA from...

  9. HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways

    Science.gov (United States)

    Guo, Fang; Zhao, Qiong; Cheng, Junjun; Qi, Yonghe; Su, Qing; Wei, Lai; Li, Wenhui; Chang, Jinhong

    2017-01-01

    Hepatitis B virus (HBV) core protein assembles viral pre-genomic (pg) RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs) and sulfamoylbenzamides (SBAs), have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or “empty” capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc) DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B. PMID:28945802

  10. HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways.

    Science.gov (United States)

    Guo, Fang; Zhao, Qiong; Sheraz, Muhammad; Cheng, Junjun; Qi, Yonghe; Su, Qing; Cuconati, Andrea; Wei, Lai; Du, Yanming; Li, Wenhui; Chang, Jinhong; Guo, Ju-Tao

    2017-09-01

    Hepatitis B virus (HBV) core protein assembles viral pre-genomic (pg) RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs) and sulfamoylbenzamides (SBAs), have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or "empty" capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc) DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B.

  11. HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways.

    Directory of Open Access Journals (Sweden)

    Fang Guo

    2017-09-01

    Full Text Available Hepatitis B virus (HBV core protein assembles viral pre-genomic (pg RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs and sulfamoylbenzamides (SBAs, have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or "empty" capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B.

  12. Detection of a new submicroscopic Norrie disease deletion interval with a novel DNA probe isolated by differential Alu PCR fingerprint cloning

    NARCIS (Netherlands)

    Bergen, A. A.; Wapenaar, M. C.; Schuurman, E. J.; Diergaarde, P. J.; Lerach, H.; Monaco, A. P.; Bakker, E.; Bleeker-Wagemakers, E. M.; van Ommen, G. J.

    1993-01-01

    Differential Alu PCR fingerprint cloning was used to isolate a DNA probe from the Xp11.4-->p11.21 region of the human X chromosome. This novel sequence, cpXr318 (DXS742), detects a new submicroscopic deletion interval at the Norrie disease locus (NDP). Combining our data with the consensus genetic

  13. Multiplex Ligation-Dependent Probe Amplification Technique for Copy Number Analysis on Small Amounts of DNA Material

    DEFF Research Database (Denmark)

    Sørensen, Karina; Andersen, Paal; Larsen, Lars

    2008-01-01

    The multiplex ligation-dependent probe amplification (MLPA) technique is a sensitive technique for relative quantification of up to 50 different nucleic acid sequences in a single reaction, and the technique is routinely used for copy number analysis in various syndromes and diseases. The aim...... of the study was to exploit the potential of MLPA when the DNA material is limited. The DNA concentration required in standard MLPA analysis is not attainable from dried blood spot samples (DBSS) often used in neonatal screening programs. A novel design of MLPA probes has been developed to permit for MLPA...... analysis on small amounts of DNA. Six patients with congenital adrenal hyperplasia (CAH) were used in this study. DNA was extracted from both whole blood and DBSS and subjected to MLPA analysis using normal and modified probes. Results were analyzed using GeneMarker and manual Excel analysis. A total...

  14. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Science.gov (United States)

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

    2012-05-01

    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Direct PCR amplification of DNA from human bloodstains, saliva, and touch samples collected with microFLOQ® swabs.

    Science.gov (United States)

    Ambers, Angie; Wiley, Rachel; Novroski, Nicole; Budowle, Bruce

    2018-01-01

    Previous studies have shown that nylon flocked swabs outperform traditional fiber swabs in DNA recovery due to their innovative design and lack of internal absorbent core to entrap cellular materials. The microFLOQ ® Direct swab, a miniaturized version of the 4N6 FLOQSwab ® , has a small swab head that is treated with a lysing agent which allows for direct amplification and DNA profiling from sample collection to final result in less than two hours. Additionally, the microFLOQ ® system subsamples only a minute portion of a stain and preserves the vast majority of the sample for subsequent testing or re-analysis, if desired. The efficacy of direct amplification of DNA from dilute bloodstains, saliva stains, and touch samples was evaluated using microFLOQ ® Direct swabs and the GlobalFiler™ Express system. Comparisons were made to traditional methods to assess the robustness of this alternate workflow. Controlled studies with 1:19 and 1:99 dilutions of bloodstains and saliva stains consistently yielded higher STR peak heights than standard methods with 1ng input DNA from the same samples. Touch samples from common items yielded single source and mixed profiles that were consistent with primary users of the objects. With this novel methodology/workflow, no sample loss occurs and therefore more template DNA is available during amplification. This approach may have important implications for analysis of low quantity and/or degraded samples that plague forensic casework. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  17. Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.

    Science.gov (United States)

    Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

    2010-12-01

    Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin.

  18. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Science.gov (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

    2015-11-01

    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  19. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae)

    Science.gov (United States)

    1975-01-01

    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  20. By-product formation in repetitive PCR amplification of DNA libraries during SELEX.

    Science.gov (United States)

    Tolle, Fabian; Wilke, Julian; Wengel, Jesper; Mayer, Günter

    2014-01-01

    The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments. Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation and improving the success rate of aptamer selection.

  1. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

    Science.gov (United States)

    Zhu, X Q; Gasser, R B

    1998-06-01

    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  2. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  3. Effects of humic acid on DNA quantification with Quantifiler® Human DNA Quantification kit and short tandem repeat amplification efficiency.

    Science.gov (United States)

    Seo, Seung Bum; Lee, Hye Young; Zhang, Ai Hua; Kim, Hye Yeon; Shin, Dong Hoon; Lee, Soong Deok

    2012-11-01

    Correct DNA quantification is an essential part to obtain reliable STR typing results. Forensic DNA analysts often use commercial kits for DNA quantification; among them, real-time-based DNA quantification kits are most frequently used. Incorrect DNA quantification due to the presence of PCR inhibitors may affect experiment results. In this study, we examined the alteration degree of DNA quantification results estimated in DNA samples containing a PCR inhibitor by using a Quantifiler® Human DNA Quantification kit. For experiments, we prepared approximately 0.25 ng/μl DNA samples containing various concentrations of humic acid (HA). The quantification results were 0.194-0.303 ng/μl at 0-1.6 ng/μl HA (final concentration in the Quantifiler reaction) and 0.003-0.168 ng/μl at 2.4-4.0 ng/μl HA. Most DNA quantity was undetermined when HA concentration was higher than 4.8 ng/μl HA. The C (T) values of an internal PCR control (IPC) were 28.0-31.0, 36.5-37.1, and undetermined at 0-1.6, 2.4, and 3.2 ng/μl HA. These results indicate that underestimated DNA quantification results may be obtained in the DNA sample with high C (T) values of IPC. Thus, researchers should carefully interpret the DNA quantification results. We additionally examined the effects of HA on the STR amplification by using an Identifiler® kit and a MiniFiler™ kit. Based on the results of this study, it is thought that a better understanding of various effects of HA would help researchers recognize and manipulate samples containing HA.

  4. By-Product Formation in Repetitive PCR Amplification of DNA Libraries during SELEX

    DEFF Research Database (Denmark)

    Tolle, Fabian; Wilke, Julian; Wengel, Jesper

    2014-01-01

    The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recogniz......The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target......-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments....... Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation...

  5. Characterization of Pediococcus acidilactici strains isolated from rainbow trout (Oncorhynchus mykiss) feed and larvae: safety, DNA fingerprinting, and bacteriocinogenicity.

    Science.gov (United States)

    Araújo, Carlos; Muñoz-Atienza, Estefanía; Poeta, Patrícia; Igrejas, Gilberto; Hernández, Pablo E; Herranz, Carmen; Cintas, Luis M

    2016-05-03

    The use of lactic acid bacteria (LAB) as probiotics constitutes an alternative or complementary strategy to chemotherapy and vaccination for disease control in aquaculture. The objectives of this work were (1) the in vitro safety assessment of 8 Pediococcus acidilactici strains isolated from rainbow trout (Oncorhynchus mykiss, Walbaum) feed and larvae; (2) the evaluation of their genetic relatedness; (3) the study of their antimicrobial/bacteriocin activity against fish pathogens; and (4) the biochemical and genetic characterization of the bacteriocin produced by the strain displaying the greatest antimicrobial activity. Concerning the safety assessment, none of the pediococci showed antibiotic resistance nor produced hemolysin or gelatinase, degraded gastric mucin, or deconjugated bile salts. Four strains (50%) produced tyramine or putrescine, but the corresponding genes were not amplified by PCR. Enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) fingerprinting allowed clustering of the pediococci into 2 well-defined groups (68% similarity). From the 8 pediococci displaying direct antimicrobial activity against at least 3 out of 9 fish pathogens, 6 strains (75%) were identified as bacteriocin producers. The bacteriocin produced by P. acidilactici L-14 was purified, and mass spectrometry and DNA sequencing revealed its identity to pediocin PA-1 (PedPA-1). Altogether, our results allowed the identification of 4 (50%) putatively safe pediococci, including 2 bacteriocinogenic strains. ERIC-PCR fingerprinting was a valuable tool for genetic profiling of P. acidilactici strains. This work reports for the first time the characterization of a PedPA-1-producing P. acidilactici strain isolated from an aquatic environment (rainbow trout larvae), which shows interesting properties related to its potential use as a probiotic in aquaculture.

  6. DNA Fingerprinting Abnormalities Can Distinguish Ulcerative Colitis Patients with Dysplasia and Cancer from Those Who Are Dysplasia/Cancer-Free

    Science.gov (United States)

    Chen, Ru; Rabinovitch, Peter S.; Crispin, David A.; Emond, Mary J.; Koprowicz, Kent M.; Bronner, Mary P.; Brentnall, Teresa A.

    2003-01-01

    Patients with extensive ulcerative colitis (UC) of longer than 8 years duration are at high risk for the development of colorectal cancer. The cancers in these patients appear to develop in a stepwise manner with progressive histological changes from negative for dysplasia → indefinite for dysplasia → dysplasia → cancer. The aim of this study was to determine the timing and extent of genomic instability in the progression of UC dysplasia and cancer. Using two polymerase chain reaction (PCR)-based DNA fingerprinting methods, arbitrarily primed PCR and intersimple sequence repeat PCR, we assessed DNA sequence variation in biopsies across the spectrum of cancerous, dysplastic, and nondysplastic mucosa. UC patients with dysplasia/cancer had substantial genomic instability in both their dysplastic and nondysplastic colonic mucosa, whereas instability was not present in the majority of UC patients without dysplasia/cancer. The degree of instability in nondysplastic tissue was similar to that of dysplastic/cancerous mucosa from the same patient, suggesting that this instability was widespread and reached the maximum level early in neoplastic progression. These results suggest that UC patients who develop dysplasia or cancer have an underlying process of genomic instability in their colonic mucosa whereas UC patients who are dysplasia-free do not. PMID:12547724

  7. Comparison of chickpea rhizobia isolates from diverse Portuguese natural populations based on symbiotic effectiveness and DNA fingerprint.

    Science.gov (United States)

    Laranjo, M; Branco, C; Soares, R; Alho, L; Carvalho, M D E; Oliveira, S

    2002-01-01

    To test the hypothesis that differences in chickpea yields obtained in four distinct Portuguese regions (Beja, Elvas-Casas Velhas, Elvas-Estação Nacional de Melhoramento de Plantas (ENMP) and Evora) could be due to variation between the natural rhizobia populations. Estimation of the size of the different rhizobial populations showed that Elvas-ENMP population was the largest one. Elvas-ENMP population also revealed a higher proportion of isolates carrying more than one plasmid. Assessment of genetic diversity of the native rhizobia populations by a DNA fingerprinting PCR method, here designated as DAPD (Direct Amplified Polymorphic DNA), showed a higher degree of variation in Elvas-ENMP and Beja populations. The symbiotic effectiveness (SE) of 39 isolates was determined and ranged 13-34%. Statistical analysis showed that SE was negatively correlated with plasmid number of the isolate. The largest indigenous rhizobia population was found in Elvas-ENMP. DAPD pattern and plasmid profile analysis both suggested a higher genetic diversity among the populations of Elvas-ENMP and Beja. No relationship was found between SE of the isolates and their origin site. The large native population, rather than the symbiotic performance of individual rhizobia, could contribute to the higher chickpea yields obtained in Elvas-ENMP.

  8. A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

    Science.gov (United States)

    Gadkar, Vijay J; Filion, Martin

    2013-06-01

    In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

  9. Social Fingerprinting: detection of spambot groups through DNA-inspired behavioral modeling

    DEFF Research Database (Denmark)

    Cresci, Stefano; Di Pietro, Roberto; Petrocchi, Marinella

    2017-01-01

    Spambot detection in online social networks is a long-lasting challenge involving the study and design of detection techniques capable of efficiently identifying ever-evolving spammers. Recently, a new wave of social spambots has emerged, with advanced human-like characteristics that allow them...... to go undetected even by current state-of-the-art algorithms. In this paper, we show that efficient spambots detection can be achieved via an in-depth analysis of their collective behaviors exploiting the digital DNA technique for modeling the behaviors of social network users. Inspired by its...... biological counterpart, in the digital DNA representation the behavioral lifetime of a digital account is encoded in a sequence of characters. Then, we define a similarity measure for such digital DNA sequences. We build upon digital DNA and the similarity between groups of users to characterize both genuine...

  10. Development of Gene Expression Fingerprints for Identification of Environmental Contaminants Using cDNA Arrays

    National Research Council Canada - National Science Library

    Inouye, L

    2004-01-01

    ...) to develop cDNA array-based assays that map gene expression from contaminant exposures. Results substantiate that distinct gene expression profiles exist for major contaminant classes such as PARs, PCBs, and PCDD/Fs...

  11. Anonymous letters? DNA and fingerprints technologies combined to solve a case.

    Science.gov (United States)

    Barbaro, A; Cormaci, P; Teatino, A; La Marca, A; Barbaro, A

    2004-12-02

    Two brothers, living in two different cities, received two different anonymous letters. We performed latent prints development and DNA research on the letters and also on a glass used by a cousin suspected to be the letters' sender.

  12. Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

    Science.gov (United States)

    Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

    2016-11-01

    A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

  13. DNA fingerprinting and new tools for fine-scale discrimination of Arabidopsis thaliana accessions.

    Science.gov (United States)

    Simon, Matthieu; Simon, Adeline; Martins, Fréderic; Botran, Lucy; Tisné, Sébastien; Granier, Fabienne; Loudet, Olivier; Camilleri, Christine

    2012-03-01

    One of the main strengths of Arabidopsis thaliana as a model species is the impressive number of public resources available to the scientific community. Exploring species genetic diversity--and therefore adaptation--relies on collections of individuals from natural populations taken from diverse environments. Nevertheless, due to a few mislabeling events or genotype mixtures, some variants available in stock centers have been misidentified, causing inconsistencies and limiting the potential of genetic analyses. To improve the identification of natural accessions, we genotyped 1311 seed stocks from our Versailles Arabidopsis Stock Center and from other collections to determine their molecular profiles at 341 single nucleotide polymorphism markers. These profiles were used to compare genotypes at both the intra- and inter-accession levels. We confirmed previously described inconsistencies and revealed new ones, and suggest likely identities for accessions whose lineage had been lost. We also developed two new tools: a minimal fingerprint computation to quickly verify the identity of an accession, and an optimized marker set to assist in the identification of unknown or mixed accessions. These tools are available on a dedicated web interface called ANATool (https://www.versailles.inra.fr/ijpb/crb/anatool) that provides a simple and efficient means to verify or determine the identity of A. thaliana accessions in any laboratory, without the need for any specific or expensive technology. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  14. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis

    Energy Technology Data Exchange (ETDEWEB)

    Santiago-Felipe, S.; Tortajada-Genaro, L.A.; Puchades, R.; Maquieira, A., E-mail: amaquieira@qim.upv.es

    2014-02-06

    Graphical abstract: -- Highlights: •Recombinase polymerase amplification is a powerful DNA method operating at 40 °C. •The combination RPA–ELISA gives excellent performances for high-throughput analysis. •Screening of food safety threats has been done using standard laboratory equipment. •Allergens, GMOs, bacteria, and fungi have been successfully determined. -- Abstract: Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR–ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA–ELISA combination is proposed for amplification at a low, constant temperature (40 °C) in a short time (40 min), for the hybridisation of labelled products to specific 5′-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA–ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA–ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings.

  15. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis

    International Nuclear Information System (INIS)

    Santiago-Felipe, S.; Tortajada-Genaro, L.A.; Puchades, R.; Maquieira, A.

    2014-01-01

    Graphical abstract: -- Highlights: •Recombinase polymerase amplification is a powerful DNA method operating at 40 °C. •The combination RPA–ELISA gives excellent performances for high-throughput analysis. •Screening of food safety threats has been done using standard laboratory equipment. •Allergens, GMOs, bacteria, and fungi have been successfully determined. -- Abstract: Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR–ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA–ELISA combination is proposed for amplification at a low, constant temperature (40 °C) in a short time (40 min), for the hybridisation of labelled products to specific 5′-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA–ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA–ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings

  16. DNA fingerprinting secondary transfer from different skin areas: Morphological and genetic studies.

    Science.gov (United States)

    Zoppis, Silvia; Muciaccia, Barbara; D'Alessio, Alessio; Ziparo, Elio; Vecchiotti, Carla; Filippini, Antonio

    2014-07-01

    The correct identification of the biological samples under analysis is crucial in forensic investigation in that it represents the pivotal issue attesting that the resulting genetic profiles are fully reliable in terms of weight of the evidence. The study reported herein shows that "touch DNA" secondary transfer is indeed possible from person to person and, in turn, from person to object depending on the specific sebaceous or non-sebaceous skin area previously touched. In addition, we demonstrate the presence of fragmented single stranded DNA specifically immunodetected in the vast majority of cells forming the sebaceous gland but not in the epidermis layers, strongly indicating that sebaceous fluid represents an important vector responsible for DNA transfer. In view of our results, forensic investigations need to take into account that the propensity to leave behind genetic material through contact could depend from the individual ability to shed sebaceous fluid on the skin surface. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. II. Isothermal signal amplification in process of DNA analysis by minisequencing].

    Science.gov (United States)

    Dmitrienko, E V; Khomiakova, E A; Pyshnaia; Bragin, A G; Vedernikov, V E; Pyshnyĭ, D V

    2010-01-01

    The isothermal amplification of reporter signal via limited probe extension (minisequencing) upon hybridization of nucleic acids has been studied. The intensity of reporter signal has been shown to increase due to enzymatic labeling of multiple probes upon consecutive hybridization with one DNA template both in homophase and heterophase assays using various kinds of detection signal: radioisotope label, fluorescent label, and enzyme-linked assay. The kinetic scheme of the process has been proposed and kinetic parameters for each step have been determined. The signal intensity has been shown to correlate with physicochemical characteristics of both complexes: probe/DNA and product/DNA. The maximum intensity has been observed at minimal difference between the thermodynamic stability of these complexes, provided the reaction temperature has been adjusted near their melting temperature values; rising or lowering the reaction temperature reduces the amount of reporting product. The signal intensity has been shown to decrease significantly upon hybridization with the DNA template containing single-nucleotide mismatches. Limited probe extension assay is useful not only for detection of DNA template but also for its quantitative characterization.

  18. Usefulness of the DNA-fingerprinting pattern and the multilocus enzyme electrophoresis profile in the assessment of outbreaks of meningococcal disease

    DEFF Research Database (Denmark)

    Weis, N; Lind, I

    1996-01-01

    cases were identical to the outbreak strain. None of the local serogroup C carrier strains isolated during the outbreak of serogroup C disease were identical to the outbreak strain. Both DNA-fingerprinting and MEE improved the differentiation of meningococci when compared with phenotypic......The objective of the study was to assess whether genotypic characterization by means of DNA-fingerprinting pattern (DFP) and multilocus enzyme electrophoresis (MEE) profile as compared to phenotypic characterization would improve the differentiation of Neisseria meningitidis strains associated...... in each outbreak were designated the index strains. Among the remaining 55 outbreak strains 52 were either DFP-identical or DFP-indistinguishable when compared with the one relevant out of the 4 index strains. This was only the case for 17 of the 37 strains isolated from sporadic cases caused by the same...

  19. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    International Nuclear Information System (INIS)

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong

    2013-01-01

    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  20. Signal-off Electrochemiluminescence Biosensor Based on Phi29 DNA Polymerase Mediated Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Chen, Anyi; Gui, Guo-Feng; Zhuo, Ying; Chai, Ya-Qin; Xiang, Yun; Yuan, Ruo

    2015-06-16

    A target induced cycling strand displacement amplification (SDA) mediated by phi29 DNA polymerase (phi29) was first investigated and applied in a signal-off electrochemiluminescence (ECL) biosensor for microRNA (miRNA) detection. Herein, the target miRNA triggered the phi29-mediated SDA which could produce amounts of single-stranded DNA (assistant probe) with accurate and comprehensive nucleotide sequence. Then, the assistant probe hybridized with the capture probe and the ferrocene-labeled probe (Fc-probe) to form a ternary "Y" structure for ECL signal quenching by ferrocene. Therefore, the ECL intensity would decrease with increasing concentration of the target miRNA, and the sensitivity of biosensor would be promoted on account of the efficient signal amplification of the target induced cycling reaction. Besides, a self-enhanced Ru(II) ECL system was designed to obtain a stable and strong initial signal to further improve the sensitivity. The ECL assay for miRNA-21 detection is developed with excellent sensitivity of a concentration variation from 10 aM to 1.0 pM and limit of detection down to 3.3 aM.

  1. Comparison of DNA aneuploidy, chromosome 1 abnormalities, MYCN amplification and CD44 expression as prognostic factors in neuroblastoma.

    Science.gov (United States)

    Christiansen, H; Sahin, K; Berthold, F; Hero, B; Terpe, H J; Lampert, F

    1995-01-01

    A comparison of the prognostic impact of five molecular variables in a large series was made, including tests of their nonrandom association and multivariate analysis. Molecular data were available for 377 patients and MYCN amplification, cytogenetic chromosome 1p deletion, loss of chromosome 1p heterozygosity, DNA ploidy and CD44 expression were investigated. Their interdependence and influence on event-free survival was tested uni- and multivariately using Pearson's chi 2-test, Kaplan-Meier estimates, log rank tests and the Cox's regression model. MYCN amplification was present in 18% (58/322) of cases and predicted poorer prognosis in localised (P < 0.001), metastatic (P = 0.002) and even 4S (P = 0.040) disease. CD44 expression was found in 86% (127/148) of cases, and was a marker for favourable outcome in patients with neuroblastoma stages 1-3 (P = 0.003) and 4 (P = 0.017). Chromosome 1p deletion was cytogenetically detected in 51% (28/55), and indicated reduced event-free survival in localised neuroblastoma (P = 0.020). DNA ploidy and loss of heterozygosity on chromosome 1p were of less prognostic value. Most factors of prognostic significance were associated with each other. By multivariate analysis, MYCN was selected as the only relevant factor. Risk estimation of high discriminating power is, therefore, possible for patients with localised and metastatic neuroblastoma using stage and MYCN.

  2. Accurate and precise DNA quantification in the presence of different amplification efficiencies using an improved Cy0 method.

    Science.gov (United States)

    Guescini, Michele; Sisti, Davide; Rocchi, Marco B L; Panebianco, Renato; Tibollo, Pasquale; Stocchi, Vilberto

    2013-01-01

    Quantitative real-time PCR represents a highly sensitive and powerful technology for the quantification of DNA. Although real-time PCR is well accepted as the gold standard in nucleic acid quantification, there is a largely unexplored area of experimental conditions that limit the application of the Ct method. As an alternative, our research team has recently proposed the Cy0 method, which can compensate for small amplification variations among the samples being compared. However, when there is a marked decrease in amplification efficiency, the Cy0 is impaired, hence determining reaction efficiency is essential to achieve a reliable quantification. The proposed improvement in Cy0 is based on the use of the kinetic parameters calculated in the curve inflection point to compensate for efficiency variations. Three experimental models were used: inhibition of primer extension, non-optimal primer annealing and a very small biological sample. In all these models, the improved Cy0 method increased quantification accuracy up to about 500% without affecting precision. Furthermore, the stability of this procedure was enhanced integrating it with the SOD method. In short, the improved Cy0 method represents a simple yet powerful approach for reliable DNA quantification even in the presence of marked efficiency variations.

  3. Small sample whole-genome amplification

    Science.gov (United States)

    Hara, Christine; Nguyen, Christine; Wheeler, Elizabeth; Sorensen, Karen; Arroyo, Erin; Vrankovich, Greg; Christian, Allen

    2005-11-01

    Many challenges arise when trying to amplify and analyze human samples collected in the field due to limitations in sample quantity, and contamination of the starting material. Tests such as DNA fingerprinting and mitochondrial typing require a certain sample size and are carried out in large volume reactions; in cases where insufficient sample is present whole genome amplification (WGA) can be used. WGA allows very small quantities of DNA to be amplified in a way that enables subsequent DNA-based tests to be performed. A limiting step to WGA is sample preparation. To minimize the necessary sample size, we have developed two modifications of WGA: the first allows for an increase in amplified product from small, nanoscale, purified samples with the use of carrier DNA while the second is a single-step method for cleaning and amplifying samples all in one column. Conventional DNA cleanup involves binding the DNA to silica, washing away impurities, and then releasing the DNA for subsequent testing. We have eliminated losses associated with incomplete sample release, thereby decreasing the required amount of starting template for DNA testing. Both techniques address the limitations of sample size by providing ample copies of genomic samples. Carrier DNA, included in our WGA reactions, can be used when amplifying samples with the standard purification method, or can be used in conjunction with our single-step DNA purification technique to potentially further decrease the amount of starting sample necessary for future forensic DNA-based assays.

  4. DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

    OpenAIRE

    Antonio, May A. D.; Hillier, Sharon L.

    2003-01-01

    Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identifie...

  5. Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis

    NARCIS (Netherlands)

    Wang, G.; van Dam, A. P.; Spanjaard, L.; Dankert, J.

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA

  6. Epidemiologic Investigation of Riemerella anatipestifer in a Commercial Duck Company by Serotyping and DNA Fingerprinting

    Science.gov (United States)

    A commercial duck company that raises approximately two million Pekin ducks per year experienced an outbreak of Riemerella anatipestifer(RA)on nine farms over a one year period. Due to concerns that the bacteria was being spread from farm to farm, an investigation using serotyping and DNA fingerprin...

  7. Evidence of transmission of Mycobacterium tuberculosis by random amplified polymorphic DNA (RAPD) fingerprinting in Taipei City, Taiwan.

    Science.gov (United States)

    Harn, H J; Shen, K L; Ho, L I; Yu, K W; Liu, G C; Yueh, K C; Lee, J H

    1997-01-01

    AIMS: To determine, by strain identification of Mycobacterium tuberculosis, whether transmission has occurred between individuals or whether new strains are present. METHODS: A rapid protocol for random amplified polymorphic DNA (RAPD) analysis was developed. This protocol was applied to 64 strains of M tuberculosis that had been confirmed by culture and microbiological methods. RESULTS: There are five groups of M tuberculosis prevalent in Taipei city, Taiwan. The major types are groups I and III. Groups I and II had been prevalent until the end of last year when, according to our group analysis, they had been eradicated. However, group III was continuously present from the middle of 1995 to the middle of 1996, and group IV was present at the end of both years, which indicated that both groups were transmitted continuously. These clustered strains had demographic characteristics consistent with a finding of transmission tuberculosis. Also, there were 13 of 64 strains with unique RAPD fingerprints that were inferred to be due primarily to the reactivation of infection. In the drug resistance analysis, the major type represented included group III and part of group IV. CONCLUSIONS: Our preliminary data imply, not only that the prevalence of M tuberculosis in Taipei city is due to transmission rather than reactivation, but that drug resistance also may play a role in tuberculosis transmission. Images PMID:9378819

  8. Potential of Start Codon Targeted (SCoT) markers for DNA fingerprinting of newly synthesized tritordeums and their respective parents.

    Science.gov (United States)

    Cabo, Sandra; Ferreira, Luciana; Carvalho, Ana; Martins-Lopes, Paula; Martín, António; Lima-Brito, José Eduardo

    2014-08-01

    Hexaploid tritordeum (H(ch)H(ch)AABB; 2n = 42) results from the cross between Hordeum chilense (H(ch)H(ch); 2n = 14) and cultivated durum wheat (Triticum turgidum ssp. durum (AABB; 2n = 28). Morphologically, tritordeum resembles the wheat parent, showing promise for agriculture and wheat breeding. Start Codon Targeted (SCoT) polymorphism is a recently developed technique that generates gene-targeted markers. Thus, we considered it interesting to evaluate its potential for the DNA fingerprinting of newly synthesized hexaploid tritordeums and their respective parents. In this study, 60 SCoT primers were tested, and 18 and 19 of them revealed SCoT polymorphisms in the newly synthesized tritordeum lines HT27 and HT22, respectively, and their parents. An analysis of the presence/absence of bands among tritordeums and their parents revealed three types of polymorphic markers: (i) shared by tritordeums and one of their parents, (ii) exclusively amplified in tritordeums, and (iii) exclusively amplified in the parents. No polymorphism was detected among individuals of each parental species. Three SCoT markers were exclusively amplified in tritordeums of lines HT22 and HT27, being considered as polyploidization-induced rearrangements. About 70% of the SCoT markers of H. chilense origin were not transmitted to the allopolyploids of both lines, and most of the SCoTs scored in the newly synthesized allopolyploids originated from wheat, reinforcing the potential use of tritordeum as an alternative crop.

  9. Tip-enhanced fluorescence with radially polarized illumination for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA

    Science.gov (United States)

    Wei, Shih-Chung; Chuang, Tsung-Liang; Wang, Da-Shin; Lu, Hui-Hsin; Gu, Frank X.; Sung, Kung-Bin; Lin, Chii-Wann

    2015-02-01

    A tip nanobiosensor for monitoring DNA replication was presented. The effects of excitation power and polarization on tip-enhanced fluorescence (TEF) were assessed with the tip immersed in fluorescein isothiocyanate solution first. The photon count rose on average fivefold with radially polarized illumination at 50 mW. We then used polymerase-functionalized tips for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA. The amplicon-SYBR Green I complex was detected and compared to real-time loop-mediated isothermal amplification. The signals of the reaction using 4 and 0.004 ng/μl templates were detected 10 and 30 min earlier, respectively. The results showed the potential of TEF in developing a nanobiosensor for real-time DNA amplification.

  10. DNA amplification of a further exon of Duchenne muscular dystrophy locus increase possibilities for deletion screening

    Energy Technology Data Exchange (ETDEWEB)

    Speer, A.; Rosenthal, A.; Billwitz, H.; Hanke, R.; Forrest, S.M; Love, D.; Davies, K.E.; Coutelle, C. (John Radcliffe Hospital, Oxford (England))

    1989-06-26

    The data of Chamberlain et al allow the detection of 76% of deletions in the region Cf56A/Cf23a identified by hybridization in their patients. The authors have generated two oligonucleotides allowing the amplification of a further exon which is included in the 3.4 kb hybridization of fragment of Cf56a. This exon is deleted in about 10% of their patients.

  11. DNA methylation fingerprint of neuroblastoma reveals new biological and clinical insights

    Directory of Open Access Journals (Sweden)

    Soledad Gómez

    2015-09-01

    We have analyzed the DNA methylome of neuroblastoma using high-density microarrays (Infinium Human Methylation 450k BeadChip to define the epigenetic landscape of this pediatric tumor and its potential clinicopathological impact. Here, we provide the detail of methods and quality control parameters of the microarray data used for the study. Methylation data has been deposited at NCBI Gene Expression Omnibus data repository, accession number GSE54719; superseries record GSE54721.

  12. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

    International Nuclear Information System (INIS)

    Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.

    1986-01-01

    The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells

  13. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA.

    Science.gov (United States)

    Amaradasa, B S; Horvath, B J; Lakshman, D K; Warnke, S E

    2013-01-01

    Rhizoctonia blight is a common and serious disease of many turfgrass species. The most widespread causal agent, Thanatephorus cucumeris (anamorph: R. solani), consists of several genetically different subpopulations. In addition, Waitea circinata varieties zeae, oryzae and circinata (anamorph: Rhizoctonia spp.) also can cause the disease. Accurate identification of the causal pathogen is important for effective management of the disease. It is challenging to distinguish the specific causal pathogen based on disease symptoms or macroscopic and microscopic morphology. Traditional methods such as anastomosis reactions with tester isolates are time consuming and sometimes difficult to interpret. In the present study universally primed PCR (UP-PCR) fingerprinting was used to assess genetic diversity of Rhizoctonia spp. infecting turfgrasses. Eighty-four Rhizoctonia isolates were sampled from diseased turfgrass leaves from seven distinct geographic areas in Virginia and Maryland. Rhizoctonia isolates were characterized by ribosomal DNA internal transcribed spacer (rDNA-ITS) region and UP-PCR. The isolates formed seven clusters based on ITS sequences analysis and unweighted pair group method with arithmetic mean (UPGMA) clustering of UP-PCR markers, which corresponded well with anastomosis groups (AGs) of the isolates. Isolates of R. solani AG 1-IB (n = 18), AG 2-2IIIB (n = 30) and AG 5 (n = 1) clustered separately. Waitea circinata var. zeae (n = 9) and var. circinata (n = 4) grouped separately. A cluster of six isolates of Waitea (UWC) did not fall into any known Waitea variety. The binucleate Rhizoctonia-like fungi (BNR) (n = 16) clustered into two groups. Rhizoctonia solani AG 2-2IIIB was the most dominant pathogen in this study, followed by AG 1-IB. There was no relationship between the geographic origin of the isolates and clustering of isolates based on the genetic associations. To our knowledge this is the first time UP-PCR was used to characterize Rhizoctonia

  15. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    Science.gov (United States)

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

    2015-11-15

    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

  17. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    Science.gov (United States)

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  18. Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

    Science.gov (United States)

    Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

    2017-11-01

    In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

  19. Fingerprinting DNA oxidation processes: IR characterization of the 5-methyl-2'-deoxycytidine radical cation.

    Science.gov (United States)

    Bucher, Dominik B; Pilles, Bert M; Pfaffeneder, Toni; Carell, Thomas; Zinth, Wolfgang

    2014-02-24

    Methylated cytidine plays an important role as an epigenetic signal in gene regulation. Its oxidation products are assumed to be involved in active demethylation processes but also in damaging DNA. Here, we report the photochemical production of the 5-methyl-2'-deoxycytidine radical cation via a two-photon ionization process. The radical cation is detected by time-resolved IR spectroscopy and identified by band assignment using density functional theory calculations. Two final oxidation products are characterized with liquid chromatography coupled to mass spectrometry. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    International Nuclear Information System (INIS)

    Zhao, Jingjin; Ma, Yefei; Kong, Rongmei; Zhang, Liangliang; Yang, Wen; Zhao, Shulin

    2015-01-01

    Herein, we introduced a tungsten disulfide (WS 2 ) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS 2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS 2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS 2 nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA glycosylase

  1. Stock characterization and improvement: DNA fingerprinting and cold tolerance of Populus and Salix clones

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Dolly; Hubbes, M.; Zsuffa, L. [Toronto Univ., ON (Canada). Faculty of Forestry; Tsarouhas, V.; Gullberg, U. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics; Howe, G.; Hackett, W.; Gardner, G.; Furnier, G. [Minnesota Univ., St. Paul, MN (United States). Dept. of Forest Resources; Tuskan, G. [Oak Ridge National Lab., TN (United States)

    1998-12-31

    Molecular characterization of advanced-generation pedigrees and evaluation of cold tolerance are two aspects of Populus and Salix genetic improvement programmes worldwide that have traditionally received little emphasis. As such, chloroplast DNA markers were tested as a means of determining multi-generation parental contributions to hybrid progeny. Likewise, greenhouse, growth chamber and field studies were used to assess cold tolerance in Populus and Salix. Chloroplast DNA markers did not reveal size polymorphisms among four tested Populus species, but did produce sequence polymorphisms between P. maximowiczii and P. trichocarpa. Additional crosses between multiple genotypes from each species are being used to evaluate the utility of the detected polymorphism for ascertaining parentage within interspecific crosses. Short-day, cold tolerance greenhouse studies revealed that bud set date and frost damage are moderately heritable and genetically correlated in Populus. The relationship between greenhouse and field studies suggests that factors other than short days contribute to cold tolerance in Populus. In Salix, response to artificial fall conditioning varied among full-sibling families, with the fastest growing family displaying the greatest amount of cold tolerance 26 refs, 3 tabs

  2. Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

    Science.gov (United States)

    Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

    2009-07-01

    Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

  3. 45,X product of conception after preimplantation genetic diagnosis and euploid embryo transfer: evidence of a spontaneous conception confirmed by DNA fingerprinting.

    Science.gov (United States)

    Bettio, Daniela; Capalbo, Antonio; Albani, Elena; Rienzi, Laura; Achille, Valentina; Venci, Anna; Ubaldi, Filippo Maria; Levi Setti, Paolo Emanuele

    2016-09-06

    Preimplantation genetic screening (PGS) provides an opportunity to eliminate a potential implantation failure due to aneuploidy in infertile couples. Some studies clearly show that twins following single embryo transfer (SET) can be the result of a concurrent natural conception and an incidence as high as 1 in 5 twins has been reported. In our case PGS was performed on trophectoderm (TE) biopsies by quantitative polymerase chain reaction (qPCR). The product of conception (POC) was cytogenetically investigated after selection of the placental villi by means of the direct method. Molecular cytogenetic characterization of the POC was performed by fluorescence in situ hybridization (FISH) and array-comparative genomic hybridization (a-CGH) analyses. To investigate the possibility of a spontaneous conception, a panel of 40 single nucleotide polymorphisms (SNPs) was used to compare genetic similarity between the DNA of the POC and the DNA leftover of the TE biopsy. We describe a 36-year old infertile woman undergoing PGS who had a spontaneous abortion after a single euploid embryo transfer on a spontaneous cycle. The POC showed a 45,X karyotype confirmed by FISH and a-CGH. DNA fingerprinting demonstrated a genetic similarity of 75 % between the DNA of the POC and TE biopsy, consistent with a sibling status. All supernumerary euploid embryos were also tested showing a non-self relationship with the POC, excluding a mix-up event at the time of fetal embryo transfer. DNA fingerprinting of the transferred blastocyst and POC, confirmed the occurrence of a spontaneous conception. This case challenges the assumption that a pregnancy after assisted reproductive technology (ART) is always a result of ART, and strengthens the importance to avoid intercourses during PGS and natural transfer cycles. Moreover, cytogenetic analysis of the POCs is strongly recommended along with fingerprinting children born after PGS to see what the concordance is between the embryo transferred and

  4. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  5. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  7. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  8. DNA Fingerprinting to monitor grizzly bear populations in the Greater Glacier Area

    Science.gov (United States)

    Kendall, Katherine; Dave, Schirokauer; Peterson, Kris; Waits, Lisette P.

    2001-01-01

    A study area of 8,100 km² (2 million acres) was established where 126 8 x 8 km (64 km²) grid cells were identified for placement of traps. Trapping was carried out during five 2- week trap sessions. Some 620 hair traps were placed in the field; samples were retrieved between May 19th and August 12th, 1998. Approximately 7,200 hair samples were collected that year. Hair was found at 80% of the traps where the average number of hair samples per trap site was 14. Forty percent of the samples had 5 or more hair follicles. Preliminary results of sampling indicate that DNA was extracted from 90-100% of the hair samples (N=300). Eight hundred miles of trail were surveyed between June 1 and October 9. Thirteen hundred hair samples were collected from rub trees along trails. Seven hundred scat samples were collected from trails.

  9. Genetic diversity of Clavispora lusitaniae isolated from Agave fourcroydes Lem, as revealed by DNA fingerprinting.

    Science.gov (United States)

    Pérez-Brito, Daisy; Magaña-Alvarez, Anuar; Lappe-Oliveras, Patricia; Cortes-Velazquez, Alberto; Torres-Calzada, Claudia; Herrera-Suarez, Teófilo; Larqué-Saavedra, Alfonso; Tapia-Tussell, Raul

    2015-01-01

    This study characterized Clavispora lusitaniae strains isolated from different stages of the processing and early fermentation of a henequen (Agave fourcroydes) spirit produced in Yucatan, Mexico using a molecular technique. Sixteen strains identified based on morphological features, obtained from different substrates, were typed molecularly. Nine different versions of the divergent D1/D2 domain of the large-subunit ribosomal DNA sequence were identified among the C. lusitaniae strains. The greatest degree of polymorphism was found in the 90-bp structural motif of the D2 domain. The MSP-PCR technique was able to differentiate 100% of the isolates. This study provides significant insight into the genetic diversity of the mycobiota present during the henequen fermentation process, especially that of C. lusitaniae, for which only a few studies in plants have been published. The applied MSP-PCR markers were very efficient in revealing olymorphisms between isolates of this species.

  10. Olive oil DNA fingerprinting by multiplex SNP genotyping on fluorescent microspheres.

    Science.gov (United States)

    Kalogianni, Despina P; Bazakos, Christos; Boutsika, Lemonia M; Targem, Mehdi Ben; Christopoulos, Theodore K; Kalaitzis, Panagiotis; Ioannou, Penelope C

    2015-04-01

    Olive oil cultivar verification is of primary importance for the competitiveness of the product and the protection of consumers and producers from fraudulence. Single-nucleotide polymorphisms (SNPs) have emerged as excellent DNA markers for authenticity testing. This paper reports the first multiplex SNP genotyping assay for olive oil cultivar identification that is performed on a suspension of fluorescence-encoded microspheres. Up to 100 sets of microspheres, with unique "fluorescence signatures", are available. Allele discrimination was accomplished by primer extension reaction. The reaction products were captured via hybridization on the microspheres and analyzed, within seconds, by a flow cytometer. The "fluorescence signature" of each microsphere is assigned to a specific allele, whereas the signal from a reporter fluorophore denotes the presence of the allele. As a model, a panel of three SNPs was chosen that enabled identification of five common Greek olive cultivars (Adramytini, Chondrolia Chalkidikis, Kalamon, Koroneiki, and Valanolia).

  11. [Analysis of diversity of vaginal microbiota in healthy Chinese women by using DNA-fingerprinting].

    Science.gov (United States)

    Xiao, Bing-bing; Liao, Qin-ping

    2012-04-18

    To analyze the diversity of healthy women's vaginal dominant flora in different physiological states with PCR-denaturing gradient gel electrophoresis (PCR-DGGE), to establish the basis for the future study of lower genital tract infections, and to provide a theoretical basis for the development of vaginal probiotics adapted to Chinese females. Women who underwent routine gynecologic examinations in Peking University First Hospital from October 2009 to January 2010 were enrolled, including 30 at reproductive age and 30 at post menopause age. Vaginal samples were collected and then total bacterial DNA was extracted. Universal bacterial primers were used to amplify the V3 region of 16S rDNA gene. PCR products were analyzed by denatured gradient gel electrophoresis (DGGE). Featured bands on DGGE were recovered, cloned and sequenced. Alignment with known sequence was made by using Blast on GenBank to identify bacterial strains so as to analyze the diversity of healthy women's vaginal dominant flora in different physiological states. (1) Vaginal flora in healthy Chinese women at their reproductive age were relatively simple, Lactobacillus were the dominant bacteria. Common bacteria included: Lactobacillus crispatus, Lactobacillus iners,and Lactobacillus gasseri. While L. iners were the dominant vaginal bacteria that could not be recognized by traditional method. (2) Vaginal bacteria in the women at post menopause age were more complex than in those at reproductive age. Common bacteria included: Lactobacillus iners, Lactobacillus crispatus, Escherichia coli, Streptococcus agalactiae, Streptococcus gallolyticus, Veillonella sp., Streptococcus intermedius, Streptococcus anginosus, Prevotella sp., Anaerococcus lactolyticus and Bacteroides fragilis. Based on the DGGE analysis, the most common vaginal bacteria in Chinese healthy women at reproductive age are Lactobacillus crispatus, Lactobacillus iners,and Lactobacillus gasseri. the most common vaginal bacteria in healthy post

  12. Preparation of genomic DNA from a single species of uncultured magnetotactic bacterium by multiple-displacement amplification.

    Science.gov (United States)

    Arakaki, Atsushi; Shibusawa, Mie; Hosokawa, Masahito; Matsunaga, Tadashi

    2010-03-01

    Magnetotactic bacteria comprise a phylogenetically diverse group that is capable of synthesizing intracellular magnetic particles. Although various morphotypes of magnetotactic bacteria have been observed in the environment, bacterial strains available in pure culture are currently limited to a few genera due to difficulties in their enrichment and cultivation. In order to obtain genetic information from uncultured magnetotactic bacteria, a genome preparation method that involves magnetic separation of cells, flow cytometry, and multiple displacement amplification (MDA) using phi29 polymerase was used in this study. The conditions for the MDA reaction using samples containing 1 to 100 cells were evaluated using a pure-culture magnetotactic bacterium, "Magnetospirillum magneticum AMB-1," whose complete genome sequence is available. Uniform gene amplification was confirmed by quantitative PCR (Q-PCR) when 100 cells were used as a template. This method was then applied for genome preparation of uncultured magnetotactic bacteria from complex bacterial communities in an aquatic environment. A sample containing 100 cells of the uncultured magnetotactic coccus was prepared by magnetic cell separation and flow cytometry and used as an MDA template. 16S rRNA sequence analysis of the MDA product from these 100 cells revealed that the amplified genomic DNA was from a single species of magnetotactic bacterium that was phylogenetically affiliated with magnetotactic cocci in the Alphaproteobacteria. The combined use of magnetic separation, flow cytometry, and MDA provides a new strategy to access individual genetic information from magnetotactic bacteria in environmental samples.

  13. Microsatellite DNA fingerprinting, differentiation, and genetic relationships of clones, cultivars, and varieties of six poplar species from three sections of the genus Populus.

    Science.gov (United States)

    Rahman, Muhammad H; Rajora, Om P

    2002-12-01

    Accurate identification of Populus clones and cultivars is essential for effective selection, breeding, and genetic resource management programs. The unit of cultivation and breeding in poplars is a clone, and individual cultivars are normally represented by a single clone. Microsatellite DNA markers of 10 simple sequence repeat loci were used for genetic fingerprinting and differentiation of 96 clones/cultivars and varieties belonging to six Populus species (P. deltoides, P. nigra, P. balsamifera, P. trichocarpa, P. grandidentata, and P maximowiczii) from three sections of the genus. All 96 clones/cultivars could be uniquely fingerprinted based on their single- or multilocus microsatellite genotypes. The five P. grandidentata clones could be differentiated based on their single-locus genotypes, while six clones of P. trichocarpa and 11 clones of P. maximowiczii could be identified by their two-locus genotypes. Twenty clones of P. deltoides and 25 clones of P. nigra could be differentiated by their multilocus genotypes employing three loci, and 29 clones of P. balsamifera required the use of multilocus genotypes at five loci for their genetic fingerprinting and differentiation. The loci PTR3, PTR5, and PTR7 were found to be the most informative for genetic fingerprinting and differentiation of the clones. The mean number of alleles per locus ranged from 2.9 in P. trichocarpa or P. grandidentata to 6.0 in P. balsamifera and 11.2 in 96 clones of the six species. The mean number of observed genotypes per locus ranged from 2.4 in P. grandidentata to 7.4 in P. balsamifera and 19.6 in 96 clones of the six species. The mean number of unique genotypes per locus ranged from 1.3 in P. grandidentata to 3.9 in P. deltoides and 8.8 in 96 clones of the six species. The power of discrimination of the microsatellite DNA markers in the 96 clones ranged from 0.726 for PTR4 to 0.939 for PTR7, with a mean of 0.832 over the 10 simple sequence repeat loci. Clones/cultivars from the same

  14. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  15. Persistence and dynamics of DNA damage signal amplification determined by microcolony formation and live-cell imaging

    International Nuclear Information System (INIS)

    Oka, Yasuyoshi; Yamauchi, Motohiro; Suzuki, Masatoshi; Yamashita, Shunichi; Suzuki, Keiji

    2011-01-01

    Cell cycle checkpoints are essential cellular process protecting the integrity of the genome from DNA damaging agents. In the present study, we developed a microcolony assay, in which normal human diploid fibroblast-like cells exposed to ionizing radiation, were plated onto coverslips at very low density (3 cells/cm 2 ). Cells were grown for up to 3 days, and phosphorylated ataxia-telangiectasia mutated (ATM) at Ser1981 and 53BP1 foci were analyzed as the markers for an amplified DNA damage signal. We observed a dose-dependent increase in the fraction of non-dividing cells, whose increase was compromised by knocking down p53 expression. While large persistent foci were predominantly formed in non-dividing cells, we observed some growing colonies that contained cells with large foci. As each microcolony was derived from a single cell, it appeared that some cells could proliferate with large foci. A live-imaging analysis using hTERT-immortalized normal human diploid cells transfected with the EGFP-tagged 53BP1 gene revealed that the formation of persistent large foci was highly dynamic. Delayed appearance and disappearance of large foci were frequently observed in exposed cells visualized 12-72 hours after X-irradiation. Thus, our results indicate that amplified DNA damage signal could be ignored, which may be explained in part by the dynamic nature of the amplification process. (author)

  16. Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

    Science.gov (United States)

    Wen, Yan; Xing, Yan; Yuan, Lian-Chao; Liu, Jian; Zhang, Ying; Li, Huan-Ying

    2013-01-01

    We evaluated the sensitivity and specificity of a nested-polymerase chain reaction (PCR) method for detection of Mycobacterium leprae DNA from whole blood. Whole-blood specimens were subjected to nested-PCR amplification of M. leprae repeat DNA sequences in 49 multibacillary (MB) and 30 paucibacillary (PB) leprosy patients, 96 household contacts (HHCs), 18 tuberculosis (TB) patients, and 35 normal healthy individuals. M. leprae DNA was detected in 95.92% (47/49) of MB, 70% (21/30) of PB, and 6.25% (6/96) of HHC, but it was not detected in 18 TB or 35 normal controls. The sensitivities of the anti-bovine serum albumin (ND-O-BSA) immunoglobulin M (IgM) and antifusion protein of ML0405-ML2331 IgG for MB were 97.96% and 89.8%, and these values for PB were 70% and 53.33%. However, the ND-O-BSA enzyme-linked immunosorbent assay (ELISA) had lower specificity, with relatively high false-positive results for TB patients (16.67%) and normal healthy controls (10%). Based on these promising findings, we propose the use of nested PCR of whole-blood samples along with ELISA test for early detection of leprosy cases. PMID:23478578

  17. A method for release and multiple strand amplification of small quantities of DNA from endospores of the fastidious bacterium Pasteuria penetrans.

    Science.gov (United States)

    Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R

    2010-05-01

    To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.

  18. Optimization of DNA recovery and amplification from non-carbonized archaeobotanical remains

    DEFF Research Database (Denmark)

    Wales, Nathan; Andersen, Kenneth; Cappellini, Enrico

    2014-01-01

    Ancient DNA (aDNA) recovered from archaeobotanical remains can provide key insights into many prominent archaeological research questions, including processes of domestication, past subsistence strategies, and human interactions with the environment. However, it is often difficult to isolate a...... extracted from non-charred ancient plant remains. Based upon the criteria of resistance to enzymatic inhibition, behavior in quantitative real-time PCR, replication fidelity, and compatibility with aDNA damage, we conclude these polymerases have nuanced properties, requiring researchers to make educated...... on the interactions between humans and past plant communities....

  19. A clinical and bacteriologic investigation of invasive streptococcal infections in Japan on the basis of serotypes, toxin production, and genomic DNA fingerprints.

    Science.gov (United States)

    Nakashima, K; Ichiyama, S; Iinuma, Y; Hasegawa, Y; Ohta, M; Ooe, K; Shimizu, Y; Igarashi, H; Murai, T; Shimokata, K

    1997-08-01

    In a survey of invasive streptococcal infections in Japan, we analyzed isolates of Streptococcus pyogenes collected between 1992 and 1994. Genomic DNA fingerprints produced by pulsed-field gel electrophoresis (PFGE) were compared by computer-assisted analysis. Conventional serologic M types were subdivided into PFGE types showing close genetic similarity. Among the 42 isolates from patients with invasive diseases, 16 PFGE types were identified and genetic diversity was clearly demonstrated. Identical fingerprints were observed in both invasive and noninvasive isolates. Only 43% of invasive isolates produced streptococcal pyrogenic exotoxin A (SPE A), and 31% did not contain the speA gene. These findings suggest that the dissemination of a specific clone is not sufficient to explain all cases of these diseases in Japan and pose a question as to the role of SPE A as a major virulent factor. Bacterial factors other than SPE A and host factors should be considered in evaluation of the pathogenesis of the diseases.

  20. Clonality Analysis of Helicobacter pylori in Patients Isolated from Several Biopsy Specimens and Gastric Juice in a Japanese Urban Population by Random Amplified Polymorphic DNA Fingerprinting

    Directory of Open Access Journals (Sweden)

    Nariaki Toita

    2013-01-01

    Full Text Available Background. The number of Helicobacter pylori clones infecting a single host has been discussed in numerous reports. The number has been suggested to vary depending on the regions in the world. Aim. The purpose of this study was to examine the number of clones infecting a single host in a Japanese urban population. Materials and Methods. Thirty-one Japanese patients undergoing upper gastrointestinal endoscopy were enrolled in this study. H. pylori isolates (total 104 strains were obtained from biopsy specimens (antrum, corpus, and duodenum and gastric juice. Clonal diversity was examined by the random amplified polymorphic DNA (RAPD fingerprinting method. Results. The RAPD fingerprinting patterns of isolates from each patient were identical or very similar. And the isolates obtained from several patients with 5- to 9-year intervals showed identical or very similar RAPD patterns. Conclusion. Each Japanese individual of an urban population is predominantly infected with a single H. pylori clone.

  1. DNA methylation and genetic diversity analysis of genus Cycas in ...

    African Journals Online (AJOL)

    10 Cycas species as well as one subspecies localized in Thailand were studied using the methylation sensitive amplification polymorphism (MSAP) technique. 11 MSAP primer combinations were used and 720 MSAP bands were generated. The percentages of DNA methylation estimated from MSAP fingerprints were in ...

  2. Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang

    2016-01-19

    MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way.

  3. Typing for HLA-DPB1*03 and HLA-DPB1*06 using allele-specific DNA in vitro amplification and allele-specific oligonucleotide probes. Detection of "new" DPB1*06 variants

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    DP gene typing using in vitro DNA amplification combined with sequence-specific oligonucleotide probes has recently been reported. The resulting DNA amplification was specific for the HLA-DPB locus. Typing for the individual DPB alleles was exclusively dependent on the hybridizations of the probe...

  4. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  5. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    OpenAIRE

    Panan Kanchanaphum

    2018-01-01

    This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP), and LAMP-Lateral Flow Dipstick (LFD). For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, w...

  6. Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA.

    Science.gov (United States)

    Santos, Carla R; Franciscatto, Laura G; Barcellos, Regina B; Almeida, Sabrina E M; Rossetti, Maria Lucia R

    2012-01-01

    This study aimed to evaluate the use of the FTA elute card(TM) impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

  7. Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA

    OpenAIRE

    Santos, Carla R.; Franciscatto, Laura G.; Barcellos, Regina B.; Almeida, Sabrina E. M; Rossetti, Maria Lucia R.

    2012-01-01

    This study aimed to evaluate the use of the FTA elute cardTM impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

  8. Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA

    Directory of Open Access Journals (Sweden)

    Carla R. Santos

    2012-03-01

    Full Text Available This study aimed to evaluate the use of the FTA elute cardTM impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

  9. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  10. Histone H1 couples initiation and amplification of ubiquitin signalling after DNA damage

    DEFF Research Database (Denmark)

    Thorslund, Tina; Ripplinger, Anita; Hoffmann, Saskia

    2015-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions that trigger non-proteolytic ubiquitylation of adjacent chromatin areas to generate binding sites for DNA repair factors. This depends on the sequential actions of the E3 ubiquitin ligases RNF8 and RNF168 (refs 1-6), and UBC13 (also...... known as UBE2N), an E2 ubiquitin-conjugating enzyme that specifically generates K63-linked ubiquitin chains. Whereas RNF168 is known to catalyse ubiquitylation of H2A-type histones, leading to the recruitment of repair factors such as 53BP1 (refs 8-10), the critical substrates of RNF8 and K63-linked...

  11. Enzymatic Amplification of DNA/RNA Hybrid Molecular Beacon Signaling in Nucleic Acid Detection

    OpenAIRE

    Jacroux, Thomas; Rieck, Daniel C.; Cui, Rong; Ouyang, Yexin; Dong, Wen-Ji

    2012-01-01

    A rapid assay operable under isothermal or non-isothermal conditions is described wherein the sensitivity of a typical molecular beacon (MB) system is improved by utilizing thermostable RNase H to enzymatically cleave an MB comprised of a DNA stem and RNA loop (R/D-MB). Upon hybridization of the R/D-MB to target DNA, there was a modest increase in fluorescence intensity (~5.7x above background) due to an opening of the probe and concomitant reduction in the Förster resonance energy transfer e...

  12. Amplification of Mycoplasma haemofelis DNA by a PCR for point-of-care use.

    Science.gov (United States)

    Hawley, Jennifer; Yaaran, Tal; Maurice, Sarah; Lappin, Michael R

    2018-01-01

    We compared a qualitative in-clinic (IC)-PCR for the detection of Mycoplasma haemofelis DNA with the results of a commercial qualitative laboratory-based, conventional (c)PCR. In order to determine the specificity of both tests, Bartonella spp. samples were included. Forty-three previously tested blood samples with known PCR results for hemoplasmas and Bartonella spp. were selected. The samples were split between 2 laboratories. At the first laboratory, DNA was purified and run on 2 cPCR assays for the detection of hemoplasmas and Bartonella spp. At the second laboratory, DNA was purified using 2 purification protocols and both run in the IC-PCR assay. The cPCR results confirmed that 18 samples were positive for M. haemofelis, 5 for ' Candidatus M. haemominutum', 8 for Bartonella henselae, 2 for Bartonella clarridgeiae, and 10 were negative for both genera. No mixed infections were observed. The IC-PCR assay for the detection of M. haemofelis had a sensitivity of 94.4% and specificity of 96%, when using the same DNA purification method as the first laboratory. Using the second purification method, the sensitivity of the IC-PCR assay was 77.8% and specificity was 96%. Bartonella species were not detected by the IC-PCR M. haemofelis assay. The IC-PCR assay decreased the amount of time to final result compared to a cPCR assay.

  13. The Interplay Between Estrogen and Replication Origins in Breast Cancer DNA Amplification

    Science.gov (United States)

    2014-11-01

    using the CHEF Genomic DNA Plug Kit (Biorad), following the manufacturer’s instructions. Briefly, after the labeling, cells were washed twice with...with BD-CellQuest software. What opportunities for training and professional development has the project provided? During the funded project period I

  14. Whole genome amplification and microsatellite genotyping of herbarium DNA revealed the identity of an ancient grapevine cultivar

    Science.gov (United States)

    Malenica, Nenad; Šimon, Silvio; Besendorfer, Višnja; Maletić, Edi; Karoglan Kontić, Jasminka; Pejić, Ivan

    2011-09-01

    Reconstruction of the grapevine cultivation history has advanced tremendously during the last decade. Identification of grapevine cultivars by using microsatellite DNA markers has mostly become a routine. The parentage of several renowned grapevine cultivars, like Cabernet Sauvignon and Chardonnay, has been elucidated. However, the assembly of a complete grapevine genealogy is not yet possible because missing links might no longer be in cultivation or are even extinct. This problem could be overcome by analyzing ancient DNA from grapevine herbarium specimens and other historical remnants of once cultivated varieties. Here, we present the first successful genotyping of a grapevine herbarium specimen and the identification of the corresponding grapevine cultivar. Using a set of nine grapevine microsatellite markers, in combination with a whole genome amplification procedure, we found the 90-year-old Tribidrag herbarium specimen to display the same microsatellite profile as the popular American cultivar Zinfandel. This work, together with information from several historical documents, provides a new clue of Zinfandel cultivation in Croatia as early as the beginning of fifteenth century, under the native name Tribidrag. Moreover, it emphasizes substantial information potential of existing grapevine and other herbarium collections worldwide.

  15. The development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of abalone herpesvirus DNA.

    Science.gov (United States)

    Chen, M H; Kuo, S T; Renault, T; Chang, P H

    2014-02-01

    A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of abalone herpesvirus DNA. Two pairs of primers were designed, based on the sequence of the DNA polymerase gene of abalone herpesvirus. The reaction temperature and time were optimized to 63°C and 60min, respectively. LAMP amplicons were analyzed by 2% agarose gel electrophoresis or by visual inspection of a colour change emitted by fluorescent dye. The method developed was specific for the detection of abalone herpesvirus, without cross-reactions with other tested herpesviruses including ostreid herpesvirus 1 (OsHV-1), European eel herpesvirus, koi herpesvirus (KHV) and an avian herpesvirus. The LAMP assay was 100 folds more sensitive than a conventional PCR and 10 folds less sensitive than a SYBR Green PCR. These results indicate that the developed LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of abalone herpesvirus. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling

    Directory of Open Access Journals (Sweden)

    Hammond Richard

    2010-02-01

    Full Text Available Abstract Background Nucleic acid based recognition of viral sequences can be used together with label-free biosensors to provide rapid, accurate confirmation of viral infection. To enhance detection sensitivity, gold nanoparticles can be employed with mass-sensitive acoustic biosensors (such as a quartz crystal microbalance by either hybridising nanoparticle-oligonucleotide conjugates to complimentary surface-immobilised ssDNA probes on the sensor, or by using biotin-tagged target oligonucleotides bound to avidin-modified nanoparticles on the sensor. We have evaluated and refined these signal amplification assays for the detection from specific DNA sequences of Herpes Simplex Virus (HSV type 1 and defined detection limits with a 16.5 MHz fundamental frequency thickness shear mode acoustic biosensor. Results In the study the performance of semi-homogeneous and homogeneous assay formats (suited to rapid, single step tests were evaluated utilising different diameter gold nanoparticles at varying DNA concentrations. Mathematical models were built to understand the effects of mass transport in the flow cell, the binding kinetics of targets to nanoparticles in solution, the packing geometries of targets on the nanoparticle, the packing of nanoparticles on the sensor surface and the effect of surface shear stiffness on the response of the acoustic sensor. This lead to the selection of optimised 15 nm nanoparticles that could be used with a 6 minute total assay time to achieve a limit of detection sensitivity of 5.2 × 10-12 M. Larger diameter nanoparticles gave poorer limits of detection than smaller particles. The limit of detection was three orders of magnitude lower than that observed using a hybridisation assay without nanoparticle signal amplification. Conclusions An analytical model was developed to determine optimal nanoparticle diameter, concentration and probe density, which allowed efficient and rapid optimisation of assay parameters

  17. Investigation of genomic instability by assay of DNA fingerprint from the offspring of male mice exposed to chronic low-level γ-radiation

    International Nuclear Information System (INIS)

    Bezlepkin, V.G.; Vasil'eva, G.V.; Lomaeva, M.G.; Sirota, N.P.; Gaziev, A.I.

    2000-01-01

    By polymerase chain reaction with arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F 1 generation) from male parents of mice exposed to chronic low-dose γ-radiation was studied. Male mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old mice progeny for DNA separation. Primer in the AP-PCR was 20-mer oligonucleotide flanking the micro-satellite locus Atplb2 on chromosome 11 of the mouse. Comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of micro-satellite-associated sequences in the genome of the offspring of males exposed to 25 and 50 cGy. DNA-fingerprints of the offspring of male mice exposed to chronic irradiation doses 10 and 25 cGy. 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of non-parent bands. Result of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-dose radiation prior to fertilization [ru

  18. Use of LH-PCR as a DNA fingerprint technique to trace sediment-associated microbial communities from various land uses

    Science.gov (United States)

    Joe-Strack, J. A.; Petticrew, E. L.

    2012-04-01

    The search for new techniques to effectively and efficiently trace sediment from its source along catchment pathways continues, with a range of new methods being developed and tested annually. A relatively recent approach marries genetic techniques to sediment analysis in order to characterize and differentiate the bacterial populations associated with soil and/or sediment originating from specific locations. Here we present the preliminary results of DNA fingerprint profiles of soil and sediment-associated bacterial communities in and around two different industrial land uses in the central interior of British Columbia, a feedlot and a copper/gold mining site. We assessed the naturally varying 16S rDNA gene using amplicon length heterogeneity-polymerase chain reaction (LH-PCR). Statistical differences between bacterial community profiles were investigated using a suite of methods of which non-metric multidimensional scaling (NMS) and indicator species analysis (ISA) were the most useful. Stronger statistical results were observed for the feedlot data set with spatial differences observed from the source location and within the adjacent creek. Results from the mine site were more difficult to assess although responses were detected in downstream waterways. While bacterial DNA fingerprinting of soil and sediment appears to be a promising tracing technique issues of scale and transferability may limit its use. Lessons learned from this preliminary study will be presented.

  19. Yersinia pestis detection by loop-mediated isothermal amplification combined with magnetic bead capture of DNA

    Directory of Open Access Journals (Sweden)

    Na Feng

    Full Text Available ABSTRACT We developed a loop-mediated isothermal amplification (LAMP assay for the detection of Y. pestis by targeting the 3a sequence on chromosome. All 11 species of the genus Yersinia were used to evaluate the specificity of LAMP and PCR, demonstrating that the primers had a high level of specificity. The sensitivity of LAMP or PCR was 2.3 or 23 CFU for pure culture, whereas 2.3 × 104 or 2.3 × 106 CFU for simulated spleen and lung samples. For simulated liver samples, the sensitivity of LAMP was 2.3 × 106 CFU, but PCR was negative at the level of 2.3 × 107 CFU. After simulated spleen and lung samples were treated with magnetic beads, the sensitivity of LAMP or PCR was 2.3 × 103 or 2.3 × 106 CFU, whereas 2.3 × 105 or 2.3 × 107 CFU for magnetic bead-treated liver samples. These results indicated that some components in the tissues could inhibit LAMP and PCR, and liver tissue samples had a stronger inhibition to LAMP and PCR than spleen and lung tissue samples. LAMP has a higher sensitivity than PCR, and magnetic bead capture of DNAs could remarkably increase the sensitivity of LAMP. LAMP is a simple, rapid and sensitive assay suitable for application in the field or poverty areas.

  20. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

  1. Microfluidic method for rapid turbidimetric detection of the DNA of Mycobacterium tuberculosis using loop-mediated isothermal amplification in capillary tubes

    International Nuclear Information System (INIS)

    Rafati, Adele; Gill, Pooria

    2015-01-01

    We describe a microfluidic method for rapid isothermal turbidimetric detection of the DNA of Mycobacterium tuberculosis. Loop-mediated isothermal amplification is accomplished in capillary tubes for amplifying DNA in less than 15 min, and sensitivity and specificity were compared to conventional loop-mediated isothermal amplification (LAMP). The method can detect as little as 1 pg mL −1 DNA in a sample. Results obtained with clinical specimens indicated 90 % sensitivity and 95 % specificity for microfluidic LAMP in comparison to culture methods. No interference occurred due to the presence of nonspecific DNAs. The findings demonstrate the power of the new microfluidic LAMP test for rapid molecular detection of microorganisms even when using bare eyes. (author)

  2. Contribution of gold nanoparticles to the catalytic DNA strand displacement in leakage reduction and signal amplification.

    Science.gov (United States)

    Wang, Bei; Zhou, Xiang; Yao, Dongbao; Sun, Xianbao; He, Miao; Wang, Xiaojing; Yin, Xue; Liang, Haojun

    2017-10-03

    A new model using a gold nanoparticle (AuNP)-DNA system to constrain leakage and improve efficiency of catalytic toehold-mediated strand displacement reactions was outlined. A 10-bp spacer on AuNPs and fourfold amount of fuels were determined for good performance of this model with an optimized toehold strategy. After the reaction at 25 °C for 10 h, a 258 pM target could be identified, which is a remarkable improvement compared with the traditional AuNP-DNA system without fuel. Moreover, this model was also studied to differentiate specific single nucleotide polymorphism on target with superior selection factors. This model may help by introducing a proposition of target detection to guide further investigation.

  3. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  4. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

    Science.gov (United States)

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

    1974-01-01

    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  5. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

    Science.gov (United States)

    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap

    2015-01-01

    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  6. Enhanced DNA Profiling of the Semen Donor in Late Reported Sexual Assaults: Use of Y-Chromosome-Targeted Pre-amplification and Next Generation Y-STR Amplification Systems.

    Science.gov (United States)

    Hanson, Erin K; Ballantyne, Jack

    2016-01-01

    In some cases of sexual assault the victim may not report the assault for several days after the incident due to various factors. The ability to obtain an autosomal STR profile of the semen donor from a living victim rapidly diminishes as the post-coital interval is extended due to the presence of only a small amount of male DNA amidst an overwhelming amount of female DNA. Previously, we have utilized various technological tools to overcome the limitations of male DNA profiling in extended interval post-coital samples including the use of Y-chromosome STR profiling, cervical sample, and post-PCR purification permitting the recovery of Y-STR profiles of the male DNA from samples collected 5-6 days after intercourse. Despite this success, the reproductive biology literature reports the presence of spermatozoa in the human cervix up to 7-10 days post-coitus. Therefore, novel and improved methods for recovery of male profiles in extended interval post-coital samples were required. Here, we describe enhanced strategies, including Y-chromosome-targeted pre-amplification and next generation Y-STR amplification kits, that have resulted in the ability to obtain probative male profiles from samples collected 6-9 days after intercourse.

  7. Preliminary evaluation of the use of soil bacterial 16S rDNA DNA markers in sediment fingerprinting in two small endorheic lagoons in southern Spain

    Science.gov (United States)

    Gomez, Jose Alfonso; Landa del Castillo, Blanca; Guzman, Gema; Petticrew, Ellen L.; Owens, Phillip N.

    2016-04-01

    127 % in Dulce and from 80 to 117 % in Zóñar. These rangesare within values reported for other soil chemical and physical properties, although the higher values are above the most commonly reported CVs which tend to be in the range from 30 to 80 %. Some groups, that are relatively stable to the normalization process, can provide enough information for solving a mixing model, although the specific groups vary between the two catchments as expected from previous studies. Overall, all the models for Zóñar tended to provide similar results with low contributions from source areas 1 and 2, and a much larger contribution from source area 3. For this solution, the mixing model was able to replicate the values of all the OTUs included in the model. The predicted values for Dulce were not as stable. The model with 10 OTUs were similar with a very low contribution from source area 2, a moderate contribution from source area 3 and a maximum contribution from source area 1. However, these values differed from those with only three OTUs, and they also differed between themselves when the normalized and non-normalized values were used. This solution also seemed to replicate the averaged measured values of most of the OTÚs included in the model. These preliminary results demonstrate the potential of soil bacterial 16S rDNA in sediment fingerprinting studies, although some questions need to be addressed in more detail, including: the temporal evolution of the distribution of the bacterial markers with soil depth; the implications of selective transport by runoff; and the relatively large variability of counts among samples from the same area. We are currently repeating the sampling in one of the subcatchments to provide some insight into these issues. Key words: sediment, fingerprinting, soil, microbial, DNA, lagoon References Joe-Strack, J.A., Petticrew, E.L. 2012. Use of LH-PCR as a DNA fingerprint technique to trace sediment-associated microbial communities from various land

  8. Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

    Science.gov (United States)

    In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

  9. DNA-based detection of chromosome deletion and amplification: diagnostic and mechanistic significance

    International Nuclear Information System (INIS)

    Latt, S.A.; Lalande, M.; Donlon, T.

    1986-01-01

    This paper describes a few of the many possible examples in which application of a molecular cytogenetic approach can ultimately lead to a new, important understanding about the statics and dynamics of human chromosome structure. In the case of retinoblastoma, cytological observations of deletions and linkage analysis have positioned the retinoblastoma locus to bank 13q14. This locus is grossly deleted in some spontaneous tumors. It is still necessary to locate more precisely and characterize the nature of the retinoblastoma locus, as well as the basis for the heterogeneity in deletions removing one copy of this locus. One is left with the possibility that those deletions that may be observed cytologically reflect but the tip of the iceberg of deletions; detection of others may require molecular probes. A related question is the nature of the DNA sequences at the deletion boundaries and the role they play in promoting these deletions

  10. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: liangzhang319@163.com [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  11. DNA Amplification Techniques for the Detection of Toxoplasma gondii Tissue Cysts in Meat Producing Animals: A Narrative Review Article

    Directory of Open Access Journals (Sweden)

    Farooq RIAZ

    2016-12-01

    Full Text Available Background: Toxoplasma gondii is an intracellular parasite, which infects one-third population of world. Humans and animals acquire infection by ingesting oocytes from feces of cats or by meat of other animals having cysts that may lead to congenital, ocular or cephalic toxoplasmosis. Either it is important to detect T. gondii from meat of food animals from retail shops or directly at slaughterhouses, which is meant for export.Methods: The current research was done without time limitation using such terms as follows: “Toxoplasma gondii”, “Meat”, “Tissue cyst”, “PCR”, “LAMP”, “Screening” and “Immunological assay” alone or in combination, in English language. The used electronic databases for searching included as follows: PubMed, Scopus, Google Scholar, Web of Science and Science Direct. The searches were limited to the published papers to English language.Results: Sensitivity of different molecular techniques for diagnosis of Toxoplasma is real-time PCR > LAMP > conventional PCR. In addition to these DNA analysis tools, bioassay in mice and cats is considered as “gold standard” to detect T. gondii. Conclusion: This review article will help the readers for grasping advantages and limitations of different diagnostic tools for screening meat samples for T. gondii. This review also makes bibliography about the type of meat sample to be processed for diagnosis and different primers or sequences to be targeted for T. gondii by number of researches for its detection from meat or tissue sample using DNA amplification techniques.

  12. Helicase-Dependent Isothermal Amplification of DNA and RNA by Using Self-Avoiding Molecular Recognition Systems.

    Science.gov (United States)

    Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M; Hoshika, Shuichi; Frye, Carole B; Benner, Steven A

    2015-06-15

    Assays that detect DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low-resource environments, and requires equipment and power that might not be available in these environments. Isothermal procedures, which avoid thermal cycling, are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a "self avoiding molecular recognition system" (SAMRS) eliminates these artifacts and gives clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3'-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, difficult to achieve with HDA using standard primers. Thus, SAMRS-HDA is a more versatile approach than standard HDA, with a broader applicability for xNA-targeted diagnostics and research. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran

    2006-01-01

    Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

  14. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  15. AgNPs-3D nanostructure enhanced electrochemiluminescence of CdSe quantum dot coupled with strand displacement amplification for sensitive biosensing of DNA

    International Nuclear Information System (INIS)

    Jiao, Meng; Jie, Guifen; Tan, Lu; Niu, Shuyan

    2017-01-01

    A novel strategy using Ag nanoparticles-3D (AgNPs-3D) nanostructure enhanced electrochemiluminescence (ECL) of CdSe quantum dots (QDs) coupled with strand displacement amplification (SDA) for sensitive biosensing of DNA was successfully designed. The prepared CdSe QDs with intense ECL were assembled on the poly (diallyldimethylammonium chloride) (PDDA) graphene oxide (GO) nanocomposites modified electrode, then gold nanoparticles (NPs) as the quenching probe was conjugated to the QDs, ECL signal was efficiently quenched. The target DNA induced cycling SDA and generated a large number of DNA s1. The released DNA s1 could open the hairpin DNA with quenching probe. So the presence of low levels of target DNA can potentially result in a significant enhancement of ECL signal. Furthermore, large number of AgNPs were then in situ reduced in the 3D DNA skeleton on the electrode, which dramaticlly enhanced ECL signal of QDs owing to the excellent electrical conductivity, and the much amplified ECL signal change has a quantitative relation with the target DNA. So by combining the AgNPs-3D nanostructure and cycling SDA to achieve greatly amplified detection of DNA, the promising ECL strategy could provide a highly sensitive platform for various biomolecules and has a good prospect for clinical diagnosis in the future. - Graphical abstract: A novel strategy using AgNPs-3D nanostructure enhanced electrochemiluminescence of CdSe quantum dot coupled with DNA strand displacement amplification for sensitive biosensing of DNA was successfully designed, the proposed biosensor can be expected to be an emerging alternative for straightforward nucleic acid detection in complex samples with an easy and rapid way. - Highlights: • AgNPs-3D nanostructure for enhancing ECL signal of CdSe QDs was successfully designed. • A new dual amplification strategy for detection of DNA by using AgNPs-3D nanostructure coupled with SDA was developed. • It is for the first time AgNPs-3D nanostructure

  16. Rolling cycle amplification based single-color quantum dots–ruthenium complex assembling dyads for homogeneous and highly selective detection of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Su, Chen; Liu, Yufei; Ye, Tai; Xiang, Xia; Ji, Xinghu; He, Zhike, E-mail: zhkhe@whu.edu.cn

    2015-01-01

    Graphical abstract: A universal, label-free, homogeneous, highly sensitive, and selective fluorescent biosensor for DNA detection is developed by using rolling-circle amplification (RCA) based single-color quantum dots–ruthenium complex (QDs–Ru) assembling dyads. - Highlights: • The single-color QDs–Ru assembling dyads were applied in homogeneous DNA assay. • This biosensor exhibited high selectivity against base mismatched sequences. • This biosensor could be severed as universal platform for the detection of ssDNA. • This sensor could be used to detect the target in human serum samples. • This DNA sensor had a good selectivity under the interference of other dsDNA. - Abstract: In this work, a new, label-free, homogeneous, highly sensitive, and selective fluorescent biosensor for DNA detection is developed by using rolling-circle amplification (RCA) based single-color quantum dots–ruthenium complex (QDs–Ru) assembling dyads. This strategy includes three steps: (1) the target DNA initiates RCA reaction and generates linear RCA products; (2) the complementary DNA hybridizes with the RCA products to form long double-strand DNA (dsDNA); (3) [Ru(phen){sub 2}(dppx)]{sup 2+} (dppx = 7,8-dimethyldipyrido [3,2-a:2′,3′-c] phenanthroline) intercalates into the long dsDNA with strong fluorescence emission. Due to its strong binding propensity with the long dsDNA, [Ru(phen){sub 2}(dppx)]{sup 2+} is removed from the surface of the QDs, resulting in restoring the fluorescence of the QDs, which has been quenched by [Ru(phen){sub 2}(dppx)]{sup 2+} through a photoinduced electron transfer process and is overlaid with the fluorescence of dsDNA bonded Ru(II) polypyridyl complex (Ru-dsDNA). Thus, high fluorescence intensity is observed, and is related to the concentration of target. This sensor exhibits not only high sensitivity for hepatitis B virus (HBV) ssDNA with a low detection limit (0.5 pM), but also excellent selectivity in the complex matrix. Moreover

  17. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    OpenAIRE

    Wang, Huiping; Kong, Fanrong; Sorrell, Tania C; Wang, Bin; McNicholas, Paul; Pantarat, Namfon; Ellis, David; Xiao, Meng; Widmer, Fred; Chen, Sharon CA

    2009-01-01

    Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA)-based method to detect a series of mutations in th...

  18. Centrifugal LabTube platform for fully automated DNA purification and LAMP amplification based on an integrated, low-cost heating system.

    Science.gov (United States)

    Hoehl, Melanie M; Weißert, Michael; Dannenberg, Arne; Nesch, Thomas; Paust, Nils; von Stetten, Felix; Zengerle, Roland; Slocum, Alexander H; Steigert, Juergen

    2014-06-01

    This paper introduces a disposable battery-driven heating system for loop-mediated isothermal DNA amplification (LAMP) inside a centrifugally-driven DNA purification platform (LabTube). We demonstrate LabTube-based fully automated DNA purification of as low as 100 cell-equivalents of verotoxin-producing Escherichia coli (VTEC) in water, milk and apple juice in a laboratory centrifuge, followed by integrated and automated LAMP amplification with a reduction of hands-on time from 45 to 1 min. The heating system consists of two parallel SMD thick film resistors and a NTC as heating and temperature sensing elements. They are driven by a 3 V battery and controlled by a microcontroller. The LAMP reagents are stored in the elution chamber and the amplification starts immediately after the eluate is purged into the chamber. The LabTube, including a microcontroller-based heating system, demonstrates contamination-free and automated sample-to-answer nucleic acid testing within a laboratory centrifuge. The heating system can be easily parallelized within one LabTube and it is deployable for a variety of heating and electrical applications.

  19. Morphology-Controlled 9,10-Diphenylanthracene Nanoblocks as Electrochemiluminescence Emitters for MicroRNA Detection with One-Step DNA Walker Amplification.

    Science.gov (United States)

    Liu, Jia-Li; Tang, Zhi-Ling; Zhang, Jia-Qi; Chai, Ya-Qin; Zhuo, Ying; Yuan, Ruo

    2018-04-17

    The electrochemiluminescence (ECL) properties of polycyclic aromatic hydrocarbons (PAHs) are excellent on account of the high photoluminescence quantum yield. However, the poor solubility and radical instability of PAHs in the aqueous solution severely restricted further biological application. Here 9,10-diphenylanthracene (DPA) nanoblocks (NBs) with good dispersibility and stability in aqueous solution were prepared according to morphology-controlled technology employing water-soluble polymers as a protectant. Furthermore, an ECL "off-on" switch biosensor was developed based on a novel ECL ternary system with DPA NBs as luminophore, dissolved O 2 as coreactant, and Pt-Ag alloy nanoflowers as the coreaction accelerator, which achieved a high-intense initial ECL signal. Subsequently, the Fc-DNA as ECL signal quencher was assembled on the electrode surface to quench the initial ECL signal for a "signal-off" state. Meanwhile, DNA swing arm was modified on the electrode surface for one-step DNA walker amplification. Interestingly, in the presence of miRNA-141 and T7 Exo, the one-step DNA walker amplification was executed to recover a strong ECL signal as a "signal-on" state by the digestion of Fc-DNA. Thus the developed ECL "off-on" switch biosensor possesses a detection limit down to 29.5 aM for ultrasensitive detection of miRNA-141, which is expected to be applicable to the detection of miRNA in clinic tumor cells.

  20. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  1. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    Science.gov (United States)

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  2. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    Science.gov (United States)

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-07-01

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  3. Methods to determine the transcriptomes of trypanosomes in mixtures with mammalian cells: the effects of parasite purification and selective cDNA amplification.

    Directory of Open Access Journals (Sweden)

    Julius Mulindwa

    2014-04-01

    Full Text Available Patterns of gene expression in cultured Trypanosoma brucei bloodstream and procyclic forms have been extensively characterized, and some comparisons have been made with trypanosomes grown to high parasitaemias in laboratory rodents. We do not know, however, to what extent these transcriptomes resemble those in infected Tsetse flies - or in humans or cattle, where parasitaemias are substantially lower. For clinical and field samples it is difficult to characterize parasite gene expression because of the large excess of host cell RNA. We have here examined two potential solutions to this problem for bloodstream form trypanosomes, assaying transcriptomes by high throughput cDNA sequencing (RNASeq. We first purified the parasites from blood of infected rats. We found that a red blood cell lysis procedure affected the transcriptome substantially more than purification using a DEAE cellulose column, but that too introduced significant distortions and variability. As an alternative, we specifically amplified parasite sequences from a mixture containing a 1000-fold excess of human RNA. We first purified polyadenylated RNA, then made trypanosome-specific cDNA by priming with a spliced leader primer. Finally, the cDNA was amplified using nested primers. The amplification procedure was able to produce samples in which 20% of sequence reads mapped to the trypanosome genome. Synthesis of the second cDNA strand with a spliced leader primer, followed by amplification, is sufficiently reproducible to allow comparison of different samples so long as they are all treated in the same way. However, SL priming distorted the abundances of the cDNA products and definitely cannot be used, by itself, to measure absolute mRNA levels. The amplification method might be suitable for clinical samples with low parasitaemias, and could also be adapted for other Kinetoplastids and to samples from infected vectors.

  4. Asexual populations of the human malaria parasite, Plasmodium falciparum, use a two-step genomic strategy to acquire accurate, beneficial DNA amplifications.

    Directory of Open Access Journals (Sweden)

    Jennifer L Guler

    Full Text Available Malaria drug resistance contributes to up to a million annual deaths. Judicious deployment of new antimalarials and vaccines could benefit from an understanding of early molecular events that promote the evolution of parasites. Continuous in vitro challenge of Plasmodium falciparum parasites with a novel dihydroorotate dehydrogenase (DHODH inhibitor reproducibly selected for resistant parasites. Genome-wide analysis of independently-derived resistant clones revealed a two-step strategy to evolutionary success. Some haploid blood-stage parasites first survive antimalarial pressure through fortuitous DNA duplications that always included the DHODH gene. Independently-selected parasites had different sized amplification units but they were always flanked by distant A/T tracks. Higher level amplification and resistance was attained using a second, more efficient and more accurate, mechanism for head-to-tail expansion of the founder unit. This second homology-based process could faithfully tune DNA copy numbers in either direction, always retaining the unique DNA amplification sequence from the original A/T-mediated duplication for that parasite line. Pseudo-polyploidy at relevant genomic loci sets the stage for gaining additional mutations at the locus of interest. Overall, we reveal a population-based genomic strategy for mutagenesis that operates in human stages of P. falciparum to efficiently yield resistance-causing genetic changes at the correct locus in a successful parasite. Importantly, these founding events arise with precision; no other new amplifications are seen in the resistant haploid blood stage parasite. This minimizes the need for meiotic genetic cleansing that can only occur in sexual stage development of the parasite in mosquitoes.

  5. Malaria prevalence defined by microscopy, antigen detection, DNA amplification and total nucleic acid amplification in a malaria-endemic region during the peak malaria transmission season.

    Science.gov (United States)

    Waitumbi, John N; Gerlach, Jay; Afonina, Irina; Anyona, Samuel B; Koros, Joseph N; Siangla, Joram; Ankoudinova, Irina; Singhal, Mitra; Watts, Kate; Polhemus, Mark E; Vermeulen, Nicolaas M; Mahoney, Walt; Steele, Matt; Domingo, Gonzalo J

    2011-07-01

    To determine the malaria prevalence by microscopy, antigen detection and nucleic acid detection in a defined subpopulation in a Plasmodium falciparum-endemic region during the peak transmission season. Blood specimens were collected in a cross-sectional study involving children aged 5-10 years (n = 195) presenting with acute fever to two clinics in Western Kenya. All specimens underwent microscopy, HRP2 and aldolase antigen detection by enzyme immunoassay (EIA), parasite-specific DNA and total nucleic acid (RNA and DNA) by real-time PCR (qPCR) and reverse-transcriptase PCR (qRT-PCR). Microscopy detected 65/195 cases of malaria infection [95% confidence interval (CI) 52-78]. HRP2 and aldolase EIA had similar sensitivity levels detecting antigen in 65/195 (95% CI, 52-78) and 57/195 (95% CI, 45-70) cases. Discordants in antigen detection vs. microscopy occurred at Detection of total nucleic acid allowed a 3 log lower limit of detection than just DNA detection by real-time PCR in vitro. In clinical specimens, 114/195 (95% CI, 100-127) were qPCR positive (DNA), and 187/195 (95% CI, 179-191) were qRT-PCR positive (DNA plus RNA). The prevalence of submicroscopic malaria infection was significantly higher when detecting total nucleic acid than just DNA in this outpatient population during the high transmission season. Defining standards for submicroscopic infection will be important for control programmes, diagnostics development efforts and molecular epidemiology studies. © 2011 Blackwell Publishing Ltd.

  6. An optimized protocol for DNA extraction from wheat seeds and Loop-Mediated Isothermal Amplification (LAMP) to detect Fusarium graminearum contamination of wheat grain.

    Science.gov (United States)

    Abd-Elsalam, Kamel; Bahkali, Ali; Moslem, Mohamed; Amin, Osama E; Niessen, Ludwig

    2011-01-01

    A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs) were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP) procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  7. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Science.gov (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  8. 3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

    2017-12-01

    5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The full-length E1-circumflexE4 protein of human papillomavirus type 18 modulates differentiation-dependent viral DNA amplification and late gene expression

    International Nuclear Information System (INIS)

    Wilson, Regina; Ryan, Gordon B.; Knight, Gillian L.; Laimins, Laimonis A.; Roberts, Sally

    2007-01-01

    Activation of the productive phase of the human papillomavirus (HPV) life cycle in differentiated keratinocytes is coincident with high-level expression of E1-circumflexE4 protein. To determine the role of E1-circumflexE4 in the HPV replication cycle, we constructed HPV18 mutant genomes in which expression of the full-length E1-circumflexE4 protein was abrogated. Undifferentiated keratinocytes containing mutant genomes showed enhanced proliferation when compared to cells containing wildtype genomes, but there were no differences in maintenance of viral episomes. Following differentiation, cells with mutant genomes exhibited reduced levels of viral DNA amplification and late gene expression, compared to wildtype genome-containing cells. This indicates that HPV18 E1-circumflexE4 plays an important role in regulating HPV late functions, and it may also function in the early phase of the replication cycle. Our finding that full-length HPV18 E1-circumflexE4 protein plays a significant role in promoting viral genome amplification concurs with a similar report with HPV31, but is in contrast to an HPV11 study where viral DNA amplification was not dependent on full-length E1-circumflexE4 expression, and to HPV16 where only C-terminal truncations in E1-circumflexE4 abrogated vegetative genome replication. This suggests that type-specific differences exist between various E1-circumflexE4 proteins

  10. Fluorescent Quantification of DNA Based on Core-Shell Fe3O4@SiO2@Au Nanocomposites and Multiplex Ligation-Dependent Probe Amplification.

    Science.gov (United States)

    Fan, Jing; Yang, Haowen; Liu, Ming; Wu, Dan; Jiang, Hongrong; Zeng, Xin; Elingarami, Sauli; Ll, Zhiyang; Li, Song; Liu, Hongna; He, Nongyue

    2015-02-01

    In this research, a novel method for relative fluorescent quantification of DNA based on Fe3O4@SiO2@Au gold-coated magnetic nanocomposites (GMNPs) and multiplex ligation- dependent probe amplification (MLPA) has been developed. With the help of self-assembly, seed-mediated growth and chemical reduction method, core-shell Fe3O4@SiO2@Au GMNPs were synthesized. Through modified streptavidin on the GMNPs surface, we obtained a bead chip which can capture the biotinylated probes. Then we designed MLPA probes which were tagged with biotin or Cy3 and target DNA on the basis of human APP gene sequence. The products from the thermostable DNA ligase induced ligation reactions and PCR amplifications were incubated with SA-GMNPs. After washing, magnetic separation, spotting, the fluorescent scanning results showed our method can be used for the relative quantitative analysis of the target DNA in the concentration range of 03004~0.5 µM.

  11. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties.

    Science.gov (United States)

    Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.

  12. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  13. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Panan Kanchanaphum

    2018-01-01

    Full Text Available This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP, and LAMP-Lateral Flow Dipstick (LFD. For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, wood, clay, and tile. Then, the samples were stored at room temperature for 1, 7, 30, and 60 day(s. After the DNA amplification, the gel electrophoresis process was applied to detect LAMP product. The LFD was combined with the LAMP to detect LAMP product on the male cloth samples. For the male samples, the time course of detection on the first and seventh days indicated positive for both LAMP and PCR products on all the surfaces while no DNA amplification was found on any of the female samples. On day 30, positive LAMP product was still found on all the male samples. However, it had faded on the tiles. Moreover, all the male samples, which had tested positive for PCR product, were blurred and unclear. On day 60, LAMP product was still found on all the male samples. Conversely, the PCR method resulted in no bands showing for any of the male samples. However, the LAMP-LFD method detected product on all the male samples of cloth. The results show that the LAMP is an effective, practical, and reliable molecular-biological method. Moreover, the LFD can increase the efficiency and sensitivity of the LAMP, making it more suitable for field studies because gel electrophoresis apparatus is not required.

  14. Target-induced formation of gold amalgamation on DNA-based sensing platform for electrochemical monitoring of mercury ion coupling with cycling signal amplification strategy

    International Nuclear Information System (INIS)

    Chen, Jinfeng; Tang, Juan; Zhou, Jun; Zhang, Lan; Chen, Guonan; Tang, Dianping

    2014-01-01

    Graphical abstract: -- Highlights: •We report a new electrochemical sensing protocol for the detection of mercury ion. •Gold amalgamation on DNA-based sensing platform was used as nanocatalyst. •The signal was amplified by cycling signal amplification strategy. -- Abstract: Heavy metal ion pollution poses severe risks in human health and environmental pollutant, because of the likelihood of bioaccumulation and toxicity. Driven by the requirement to monitor trace-level mercury ion (Hg 2+ ), herein we construct a new DNA-based sensor for sensitive electrochemical monitoring of Hg 2+ by coupling target-induced formation of gold amalgamation on DNA-based sensing platform with gold amalgamation-catalyzed cycling signal amplification strategy. The sensor was simply prepared by covalent conjugation of aminated poly-T (25) oligonucleotide onto the glassy carbon electrode by typical carbodiimide coupling. Upon introduction of target analyte, Hg 2+ ion was intercalated into the DNA polyion complex membrane based on T–Hg 2+ –T coordination chemistry. The chelated Hg 2+ ion could induce the formation of gold amalgamation, which could catalyze the p-nitrophenol with the aid of NaBH 4 and Ru(NH 3 ) 6 3+ for cycling signal amplification. Experimental results indicated that the electronic signal of our system increased with the increasing Hg 2+ level in the sample, and has a detection limit of 0.02 nM with a dynamic range of up to 1000 nM Hg 2+ . The strategy afforded exquisite selectivity for Hg 2+ against other environmentally related metal ions. In addition, the methodology was evaluated for the analysis of Hg 2+ in spiked tap-water samples, and the recovery was 87.9–113.8%

  15. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

    Science.gov (United States)

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

    2014-09-15

    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Target-induced formation of gold amalgamation on DNA-based sensing platform for electrochemical monitoring of mercury ion coupling with cycling signal amplification strategy

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jinfeng; Tang, Juan; Zhou, Jun; Zhang, Lan; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2014-01-31

    Graphical abstract: -- Highlights: •We report a new electrochemical sensing protocol for the detection of mercury ion. •Gold amalgamation on DNA-based sensing platform was used as nanocatalyst. •The signal was amplified by cycling signal amplification strategy. -- Abstract: Heavy metal ion pollution poses severe risks in human health and environmental pollutant, because of the likelihood of bioaccumulation and toxicity. Driven by the requirement to monitor trace-level mercury ion (Hg{sup 2+}), herein we construct a new DNA-based sensor for sensitive electrochemical monitoring of Hg{sup 2+} by coupling target-induced formation of gold amalgamation on DNA-based sensing platform with gold amalgamation-catalyzed cycling signal amplification strategy. The sensor was simply prepared by covalent conjugation of aminated poly-T{sub (25)} oligonucleotide onto the glassy carbon electrode by typical carbodiimide coupling. Upon introduction of target analyte, Hg{sup 2+} ion was intercalated into the DNA polyion complex membrane based on T–Hg{sup 2+}–T coordination chemistry. The chelated Hg{sup 2+} ion could induce the formation of gold amalgamation, which could catalyze the p-nitrophenol with the aid of NaBH{sub 4} and Ru(NH{sub 3}){sub 6}{sup 3+} for cycling signal amplification. Experimental results indicated that the electronic signal of our system increased with the increasing Hg{sup 2+} level in the sample, and has a detection limit of 0.02 nM with a dynamic range of up to 1000 nM Hg{sup 2+}. The strategy afforded exquisite selectivity for Hg{sup 2+} against other environmentally related metal ions. In addition, the methodology was evaluated for the analysis of Hg{sup 2+} in spiked tap-water samples, and the recovery was 87.9–113.8%.

  17. Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA.

    Science.gov (United States)

    Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J

    2013-12-07

    LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

  18. Detection of Panton-Valentine Leukocidin DNA from methicillin-resistant Staphylococcus aureus by resistive pulse sensing and loop-mediated isothermal amplification with gold nanoparticles

    International Nuclear Information System (INIS)

    Yang, Alice Kar Lai; Lu, Haifei; Wu, Shu Yuen; Kwok, Ho Chin; Ho, Ho Pui; Yu, Samuel; Cheung, Anthony Ka Lun; Kong, Siu Kai

    2013-01-01

    Graphical abstract: -- Highlights: •A novel diagnostic assay is developed to detect the MRSA's Panton-Valentine Leukocidin toxin. •Detection is based on target DNA amplification at one single temperature at 65 °C by LAMP. •Amplicons are then hybridized with 2 Au-nanoparticles with specific DNA probes for sensing. •The supra-assemblies are subsequently sensed by resistive pulse sensing. •Detection limit: ∼200 copies of DNA; time for detection: completed within 2 h. -- Abstract: This report describes a novel diagnostic assay for rapid detection of the Panton-Valentine Leukocidin (PVL) toxin of methicillin-resistant Staphylococcus aureus (MRSA) utilizing resistive pulse sensing (RPS), loop-mediated isothermal DNA amplification (LAMP) in combination with gold nanoparticles (AuNPs). The PVL DNA from MRSA was specifically amplified by LAMP using four primers at one temperature (65 °C). The DNA products with biotin were then conjugated to a first AuNP1 (55 ± 2 nm) through biotin–avidin binding. A second AuNP2 (30 ± 1.5 nm) coated with a specific DNA probe hybridized with the LAMP DNA products at the loop region to enhance assay sensitivity and specificity, to generate supra-AuNP1-DNA-AuNP2 assemblies. Scanning electron microscopy confirmed the presence of these supra-assemblies. Using RPS, detection and quantitation of the agglomerated AuNPs were performed by a tunable fluidic nanopore sensor. The results demonstrate that the LAMP-based RPS sensor is sensitive and rapid for detecting the PVL DNA. This technique could achieve a limit of detection (LOD) up to about 500 copies of genomic DNA from the bacteria MRSA MW2 and the detection can be completed within two hours with a straightforward signal-to-readout setup. It is anticipated that this LAMP-based AuNP RPS may become an effective tool for MRSA detection and a potential platform in clinical laboratory to report the presence or absence of other types of infectious agents

  19. Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

    Science.gov (United States)

    Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

    2015-02-15

    In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Real-time monitoring of mycobacterium genomic DNA with target-primed rolling circle amplification by a Au nanoparticle-embedded SPR biosensor.

    Science.gov (United States)

    Xiang, Yang; Zhu, Xiaoyan; Huang, Qing; Zheng, Junsong; Fu, Weiling

    2015-04-15

    In this study, we developed a surface plasmon resonance (SPR) DNA biosensor array based on target-primed rolling circle amplification (RCA) for isothermal and rapid detection of two pathogenic mycobacteria, Mycobacterium tuberculosis complex (MTBC) and Mycobacterium avium complex (MAC).The species-specific padlock probe (PLP) was designed to target the sequence in 16S-23S rRNA gene internal transcribed spacer (ITS). After ligation, the circularized PLP could be primed by the target sequence to initial RCA. The RCA performed simultaneously with the cleavage reaction to produce small fragments of single strand DNA which immediately hybridized with the probe immobilized on the sensor chip without denaturation. This process caused SPR angle changes on the chip surface, which made the detection for analysis from the solution achievable, and dynamic real-time RCA monitoring of mycobacterium possible. Besides, Au nanoparticles (AuNPs) were directly assembled onto the surface of the sensor chip via hexanedithiol (HDT) for the enhancement of sensitivity as a label-free detection system. Experimental results show that the signal enhancement by the target-primed RCA together with AuNPs-embedded surface caused at least10-fold increased sensitivity as compared with conventional RCA on bare SPR chip method. Within 40min amplification duration as low as 20amol of synthetic targets and 10(4)CFUmL(-1) of genomic DNA from clinical samples can be detected. The proposed method not only provides a simple design idea for liquid-phase amplification monitoring, but also apply it in clinical pathogen detection, which holds great promise in ultrasensitive bioassay in the future. Copyright © 2014. Published by Elsevier B.V.

  1. Fingerprinting of near-homogeneous DNA ligase I and II from human cells. Similarity of their AMP-binding domains.

    Science.gov (United States)

    Yang, S W; Becker, F F; Chan, J Y

    1990-10-25

    DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel

  2. Ultrasensitive electrochemical biosensor for detection of DNA from Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification.

    Science.gov (United States)

    Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan

    2014-09-02

    A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.

  3. Loop-Mediated Isothermal Amplification on Crude DNA as a Point-of-Care Test for the Diagnosis of Mycoplasma-Related Vaginitis During Early Pregnancy.

    Science.gov (United States)

    Wang, Yichao; Zhang, Bumei; Sun, Yan; Liu, Yunde; Gu, Yajun

    2017-12-20

    Mycoplasma-related vaginitis gradually has been growing as a threat in adults-genitourinary infection contributes to funisitis, spontaneous abortion, and low birth weight. Until now, use of loop-mediated isothermal amplification (LAMP) to detect Ureaplasma urealyticum (UU), Mycoplasma hominis (MH), or Mycoplasma genitalium (MG) has been reported by some researchers. However, previous studies focused on purified DNA as the template for LAMP assay, which is usually extracted via commercial kit. We developed a LAMP assay for rapid detection of UU, MH, and MG genital mycoplasmas using a simple boiling method for DNA extraction, in a cohort of pregnant women with mycoplasma-related vaginitis. We monitored amplicons with the naked eye using SYBR Green I. The cohort in our study showed a prevalence of 22.6% in pregnant women, as detected by UU-LAMP assay. Compared to the polymerase chain reaction (PCR) test with purified DNA, the sensitivity of the UU-LAMP in clinical specimens with crude DNA was 87.5% (95% confidence interval [CI], 64.6%->99.9). For crude DNA specimens, UU-LAMP was more sensitive and reliable than PCR, with a higher agreement rate (96.8%) and Youden index value (0.88). As a point-of-care test, LAMP is a useful, specific, and efficient way to detect genital mycoplasmas in resource-limited settings, especially for crude DNA. © American Society for Clinical Pathology 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  4. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  5. Cognitive Fingerprints

    Science.gov (United States)

    2015-03-25

    is another cognitive fingerprint that has been used extensively for authorship . This work has been ex- tended to authentication by relating keyboard...this work is the inference of high-level features such as personality, gender , and dominant hand but those features have not been integrated to date

  6. Comparison between the DNA Fingerprints Obtained from the Yellow Vein Mosaic Disease Tolerant Okra Mutants and Their Parental Variety

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Puripunyavanich, Vichai; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen

    2006-01-01

    The yellow vein mosaic disease (YVMD) is a widespread disease that is found among export orchards of okra. In this report, we studied gamma radiation-induced YVMD tolerant okra mutants and other commercial okra varieties at DNA level. We found that DNA extraction method that utilized sodium dodecyl sulfate and potassium acetate to precipitate other biomolecules was a suitable method to use for DNA finger printing of okra. The MFLP finger printing technique was superior to the AFLP technique in finding polymorphisms among different okra varieties. Also polymorphisms between the YVMD-tolerant mutant lines and their parental variety could be detected, indicating that gamma radiation could induce some changes at DNA level in these plants

  7. Detection of Bartonella henselae DNA in clinical samples including peripheral blood of immune competent and immune compromised patients by three nested amplifications

    Directory of Open Access Journals (Sweden)

    Karina Hatamoto Kawasato

    2013-02-01

    Full Text Available Bacteria of the genus Bartonella are emerging pathogens detected in lymph node biopsies and aspirates probably caused by increased concentration of bacteria. Twenty-three samples of 18 patients with clinical, laboratory and/or epidemiological data suggesting bartonellosis were subjected to three nested amplifications targeting a fragment of the 60-kDa heat shock protein (HSP, the internal transcribed spacer 16S-23S rRNA (ITS and the cell division (FtsZ of Bartonella henselae, in order to improve detection in clinical samples. In the first amplification 01, 04 and 05 samples, were positive by HSP (4.3%, FtsZ (17.4% and ITS (21.7%, respectively. After the second round six positive samples were identified by nested-HSP (26%, eight by nested-ITS (34.8% and 18 by nested-FtsZ (78.2%, corresponding to 10 peripheral blood samples, five lymph node biopsies, two skin biopsies and one lymph node aspirate. The nested-FtsZ was more sensitive than nested-HSP and nested-ITS (p < 0.0001, enabling the detection of Bartonella henselae DNA in 15 of 18 patients (83.3%. In this study, three nested-PCR that should be specific for Bartonella henselae amplification were developed, but only the nested-FtsZ did not amplify DNA from Bartonella quintana. We conclude that nested amplifications increased detection of B. henselae DNA, and that the nested-FtsZ was the most sensitive and the only specific to B. henselae in different biological samples. As all samples detected by nested-HSP and nested-ITS, were also by nested-FtsZ, we infer that in our series infections were caused by Bartonella henselae. The high number of positive blood samples draws attention to the use of this biological material in the investigation of bartonellosis, regardless of the immune status of patients. This fact is important in the case of critically ill patients and young children to avoid more invasive procedures such as lymph nodes biopsies and aspirates.

  8. Towards secondary fingerprint classification

    CSIR Research Space (South Africa)

    Msiza, IS

    2011-07-01

    Full Text Available an accuracy figure of 76.8%. This small difference between the two figures is indicative of the validity of the proposed secondary classification module. Keywords?fingerprint core; fingerprint delta; primary classifi- cation; secondary classification I..., namely, the fingerprint core and the fingerprint delta. Forensically, a fingerprint core is defined as the innermost turning point where the fingerprint ridges form a loop, while the fingerprint delta is defined as the point where these ridges form a...

  9. Pasteurella multocida isolated from wild birds of North America: a serotype and DNA fingerprint study of isolates from 1978 to 1993

    Science.gov (United States)

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Serotype and DNA fingerprint methods were used to study Pasteurella multocida isolated from 320 wild birds of North America. Isolates were collected during 1978-93. The HhaI profiles of 314 isolates matched the HhaI profile of somatic reference type 1, strain X-73; somatic type 1 antigen was expressed by 310 isolates, and the serotype of four isolates was undetected. Differentiation of the 314 isolates was observed by digestion of DNA with HpaII. None of the HpaII profiles matched the HpaII profile of X-73 (designated HhaI 001/HpaII 001). Three HpaII profiles were recognized among the somatic type 1 isolates: HpaII 002 (n = 18), HpaII 003 (n = 122), and HpaII 004 (n = 174). Profile HpaII 002 was found among isolates collected during 1979-83. Profile HpaII 003 was identified from isolates collected during 1979-89, with the exception of two isolates in 1992. The HpaII 004 profile was identified from isolates collected during 1983-93. Of the six remaining isolates, four expressed somatic type 4 and had HhaI profiles identical to the somatic type 4 reference strain P-1662 profile (designated HhaI 004); these isolates were differentiated by digestion of DNA with HpaII. One isolate was identified as serotype F:11, and another was serotype A:3,4. In the present study, 314 of 316 (99.4%) isolates from wild birds in the Central, Mississippi, and Pacific flyways during 1978-93, were P. multocida somatic type 1.

  10. Parallel solid-phase isothermal amplification and detection of multiple DNA targets in microliter-sized wells of a digital versatile disc

    International Nuclear Information System (INIS)

    Santiago-Felipe, Sara; Tortajada-Genaro, Luis Antonio; Puchades, Rosa; Maquieira, Ángel

    2016-01-01

    An integrated method for the parallelized detection of multiple DNA target sequences is presented by using microstructures in a digital versatile disc (DVD). Samples and reagents were managed by using both the capillary and centrifugal forces induced by disc rotation. Recombinase polymerase amplification (RPA), in a bridge solid phase format, took place in separate wells, which thereby modified their optical properties. Then the DVD drive reader recorded the modifications of the transmitted laser beam. The strategy allowed tens of genetic determinations to be made simultaneously within <2 h, with small sample volumes (3 μL), low manipulation and at low cost. The method was applied to high-throughput screening of relevant safety threats (allergens, GMOs and pathogenic bacteria) in food samples. Satisfactory results were obtained in terms of sensitivity (48.7 fg of DNA) and reproducibility (below 18 %). This scheme warrants cost-effective multiplex amplification and detection and is perceived to represent a viable tool for screening of nucleic acid targets. (author)

  11. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    Science.gov (United States)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  12. SSR-Based DNA Fingerprinting and Diversity Assessment Among Indian Germplasm of Euryale ferox: an Aquatic Underutilized and Neglected Food Crop.

    Science.gov (United States)

    Kumar, Nitish; Shikha, Divya; Kumari, Swati; Choudhary, Binod Kumar; Kumar, Lokendra; Singh, Indu Shekhar

    2017-10-30

    Euryale ferox is native to Southeast Asia and China, and it is one of the important aquatic food crops propagated mostly in eastern part of India. The aim of the present study was to characterize and evaluate the genetic diversity of ex situ collections of E. ferox germplasm from different geographical states of India using microsatellite (simple sequence repeats (SSRs)) markers. Ten SSR markers were analyzed to assess DNA fingerprinting and genetic diversity of 16 cultivated germplasm of E. ferox. Total 37 polymorphic alleles were recorded with an average of 3.7 allele frequency per primer. The polymorphic information content value varied from 0.204 to 0.735 with mean of 0.448. A high range of heterozygosity (Ho 0.228; He 0.512) was detected in the present study. The neighbor-joining (N-J) tree and the principle coordinate analysis showed that the germplasm divided in to three main clusters. The results of the present investigation comply that SSR markers are effective for computing genetic assessment of genetic diversity and similarity with classifying cultivated varieties of E. ferox. Evaluation of genetic diversity among Indian E. ferox germplasm could provide useful information for genetic improvement.

  13. Intrafamilial, Preferentially Mother-to-Child and Intraspousal, Helicobacter pylori Infection in Japan Determined by Mutilocus Sequence Typing and Random Amplified Polymorphic DNA Fingerprinting.

    Science.gov (United States)

    Yokota, Shin-ichi; Konno, Mutsuko; Fujiwara, Shin-ichi; Toita, Nariaki; Takahashi, Michiko; Yamamoto, Soh; Ogasawara, Noriko; Shiraishi, Tsukasa

    2015-10-01

    The infection route of Helicobacter pylori has been recognized to be mainly intrafamilial, preferentially mother-to-child, especially in developed countries. To determine the transmission route, we examined whether multilocus sequence typing (MLST) was useful for analysis of intrafamilial infection. The possibility of intraspousal infection was also evaluated. Clonal relationships between strains derived from 35 index Japanese pediatric patients, and their family members were analyzed by two genetic typing procedures, MLST and random amplified polymorphic DNA (RAPD) fingerprinting. Mostly coincident results were obtained by MLST and RAPD. By MLST, the allele of loci in the isolates mostly matched between the index child and both the father and mother for 9 (25.7%) of the 35 patients, between the index child and the mother for 25 (60.0%) of the 35 patients. MLST is useful for analyzing the infection route of H. pylori as a highly reproducible method. Intrafamilial, especially mother-to-children and sibling, infection is the dominant transmission route. Intraspousal infection is also thought to occur in about a quarter in the Japanese families. © 2015 John Wiley & Sons Ltd.

  14. Target-induced formation of gold amalgamation on DNA-based sensing platform for electrochemical monitoring of mercury ion coupling with cycling signal amplification strategy.

    Science.gov (United States)

    Chen, Jinfeng; Tang, Juan; Zhou, Jun; Zhang, Lan; Chen, Guonan; Tang, Dianping

    2014-01-31

    Heavy metal ion pollution poses severe risks in human health and environmental pollutant, because of the likelihood of bioaccumulation and toxicity. Driven by the requirement to monitor trace-level mercury ion (Hg(2+)), herein we construct a new DNA-based sensor for sensitive electrochemical monitoring of Hg(2+) by coupling target-induced formation of gold amalgamation on DNA-based sensing platform with gold amalgamation-catalyzed cycling signal amplification strategy. The sensor was simply prepared by covalent conjugation of aminated poly-T(25) oligonucleotide onto the glassy carbon electrode by typical carbodiimide coupling. Upon introduction of target analyte, Hg(2+) ion was intercalated into the DNA polyion complex membrane based on T-Hg(2+)-T coordination chemistry. The chelated Hg(2+) ion could induce the formation of gold amalgamation, which could catalyze the p-nitrophenol with the aid of NaBH4 and Ru(NH3)6(3+) for cycling signal amplification. Experimental results indicated that the electronic signal of our system increased with the increasing Hg(2+) level in the sample, and has a detection limit of 0.02nM with a dynamic range of up to 1000nM Hg(2+). The strategy afforded exquisite selectivity for Hg(2+) against other environmentally related metal ions. In addition, the methodology was evaluated for the analysis of Hg(2+) in spiked tap-water samples, and the recovery was 87.9-113.8%. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Investigating Intraspecific Variation of Acidovorax avenae subsp. citrulli Using DNA Fingerprinting and Whole Cell Fatty Acid Analysis.

    Science.gov (United States)

    Walcott, R R; Langston, D B; Sanders, F H; Gitaitis, R D

    2000-02-01

    ABSTRACT To assess the diversity of Acidovorax avenae subsp. citrulli, 121 strains from watermelon, cantaloupe, and pumpkin were compared using pulse field gel electrophoresis of SpeI-digested DNA and gas chromatographic analysis of fatty acid methyl esters. Twenty-nine unique DNA fragments resulted from DNA digestion, and 14 distinct haplotypes were observed. Based on cluster analysis, two subgroups, I and II, were recognized, which accounted for 84.8% (eight haplotypes) and 15.2% (six haplotypes) of the strains, respectively. Results of cellular fatty acid analysis varied quantitatively and qualitatively for the A. avenae subsp. citrulli strains and supported the existence of the two subgroups. Group I includes strains from cantaloupe and pumpkin as well as the ATCC type strain, which was first described in the United States in 1978, whereas group II represents the typical watermelon fruit blotch-causing strains that appeared in the mainland United States in 1989. Knowledge of the two A. avenae subsp. citrulli groups may be useful in screening for watermelon fruit blotch resistance.

  16. Amplified amperometric aptasensor for selective detection of protein using catalase-functional DNA-PtNPs dendrimer as a synergetic signal amplification label.

    Science.gov (United States)

    Zhang, Juan; Yuan, Yali; biXie, Shun; Chai, Yaqin; Yuan, Ruo

    2014-10-15

    In this work, we present a new strategy to construct an electrochemical aptasensor for sensitive detection of platelet-derived growth factor BB (PDGF-BB) based on the synergetic amplification of a three-dimensional (3D) nanoscale catalase (CAT) enzyme-functional DNA-platinum nanoparticles (PtNPs) dendrimer through autonomous layer-by-layer assembly. Firstly, polyamidoaminedendrimer (PAMAM) with a hyper-branched and three-dimensional structure was served as nanocarriers to coimmobilize a large number of PDGF-BB binding aptamer (PBA II) and ssDNA 1 (S1) to form PBA II-PAMAM-S1 bioconjugate. In the presence of PDGF-BB, the bioconjugate was self-assembled on the electrode by sandwich assay. Following that, the carried S1 propagated a chain reaction of hybridization events between CAT-PtNPs-S1 and CAT-PtNPs-ssDNA 2 (S2) to form a 3D nanoscale CAT-functional PtNPs-DNA dendrimer, which successfully immobilized substantial CAT enzyme and PtNPs with superior catalysis activity. In this process, the formed negatively charged double-helix DNA could cause the intercalation of hexaammineruthenium(III) chloride (RuHex) into the groove via electrostatic interactions. Thus, numerous RuHex redox probes and CAT were decorated inside/outside of the dendrimer. In the presence of H2O2 in electrolytic cell, the synergistic reaction of CAT and PtNPs towards electrocatalysis could further amplify electrochemical signal. Under optimal condition, the CAT-PtNPs-DNA dendrimer-based sensing system presented a linear dependence between the reduction peak currents and logarithm of PDGF-BB concentrations in the range of 0.00005-35 nM with a relatively low detection limit of 0.02 pM. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  18. Comparison of DNA Microarray, Loop-Mediated Isothermal Amplification (LAMP) and Real-Time PCR with DNA Sequencing for Identification of Fusarium spp. Obtained from Patients with Hematologic Malignancies.

    Science.gov (United States)

    de Souza, Marcela; Matsuzawa, Tetsuhiro; Sakai, Kanae; Muraosa, Yasunori; Lyra, Luzia; Busso-Lopes, Ariane Fidelis; Levin, Anna Sara Shafferman; Schreiber, Angélica Zaninelli; Mikami, Yuzuru; Gonoi, Tohoru; Kamei, Katsuhiko; Moretti, Maria Luiza; Trabasso, Plínio

    2017-08-01

    The performance of three molecular biology techniques, i.e., DNA microarray, loop-mediated isothermal amplification (LAMP), and real-time PCR were compared with DNA sequencing for properly identification of 20 isolates of Fusarium spp. obtained from blood stream as etiologic agent of invasive infections in patients with hematologic malignancies. DNA microarray, LAMP and real-time PCR identified 16 (80%) out of 20 samples as Fusarium solani species complex (FSSC) and four (20%) as Fusarium spp. The agreement among the techniques was 100%. LAMP exhibited 100% specificity, while DNA microarray, LAMP and real-time PCR showed 100% sensitivity. The three techniques had 100% agreement with DNA sequencing. Sixteen isolates were identified as FSSC by sequencing, being five Fusarium keratoplasticum, nine Fusarium petroliphilum and two Fusarium solani. On the other hand, sequencing identified four isolates as Fusarium non-solani species complex (FNSSC), being three isolates as Fusarium napiforme and one isolate as Fusarium oxysporum. Finally, LAMP proved to be faster and more accessible than DNA microarray and real-time PCR, since it does not require a thermocycler. Therefore, LAMP signalizes as emerging and promising methodology to be used in routine identification of Fusarium spp. among cases of invasive fungal infections.

  19. Amplification success rate of DNA from museum skin collections: a case study of stoats from 18 museums

    Czech Academy of Sciences Publication Activity Database

    Martínková, Natália; Searle, J. B.

    2006-01-01

    Roč. 6, č. 4 (2006), s. 1014-1017 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z60930519 Keywords : ancient DNA * mitochondrial DNA, * Mustela erminea * museum collections * polymerase chain reaction Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.220, year: 2006

  20. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    Science.gov (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  1. Fissile fingerprints

    International Nuclear Information System (INIS)

    Edwards, R.

    1995-01-01

    This article looks at recent research which may allow police and customs officers to detect smuggled weapons-grade plutonium and uranium. Contrary to popular opinion, nuclear materials do not have a nuclear ''fingerprint'' but enough information can be gleaned from sources to confirm what has been learnt from other data. Indeed, two leading nuclear laboratories can look at the same analytical results and draw different conclusions. The case of a lead cylinder seized from a German garage is examined to illustrate the confusion. (UK)

  2. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

    Science.gov (United States)

    Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

    2016-12-15

    Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

    Science.gov (United States)

    Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L

    2016-05-01

    Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.

  4. Comparison of mutans streptococcal strains of father, mother, and child in indian families using chromosomal DNA fingerprinting.

    Science.gov (United States)

    Katre, Amar N; Damle, Sg

    2013-09-01

    It is now understood and accepted that there is a direct transmission of mutans streptococci (MS) from the mother to the child. There is also a direct correlation between the levels of MS in the mother and the caries status of the child. Advanced technologies in molecular biology like chromosomal DNA fngerprinting have established beyond doubt that the mother and the child bear similar strains of MS. A study was designed with the aim of comparing the MS strains between the father, mother and the child in Indian families. A group of 20 Indian families comprising of the father, mother and child were selected and divided into caries free and caries active groups. Mixed salivary samples were collected from the individuals and were cultured for the growth of Mutans streptococci. The colonies were counted on a colony counter and a comparison was made between the mutans streptococcal counts of the mother and the caries status of the child. Further, the genotypes of the father, mother and the child were isolated and compared using the technique of chromosomal DNA fngerprinting. Following electrophoresis, the band pattern obtained was compared for similarities or differences. The results of the same were tabulated and evaluated statistically. When the colony counts of the mother (in CFU/ml) were compared with the 'dft' status of the child, a positive correlation was seen in group II. Intergroup comparison using the unpaired T test was statistically signifcant. Electrophoretic analysis of the chromosomal DNA on the agarose gels revealed identical band patterns in 13 mother-child pairs, which was statistically signifcant. Three of the father-child pairs showed identical band patterns, which was statistically signifcant. Intergroup comparison using Chi-square test was not statistically signifcant. One may conclude that irrespective of the caries status of the child, majority of the mother child pairs share identical strains of MS and hence the mother is the primary source of

  5. Simultaneous use of multiplex ligation-dependent probe amplification assay and flow cytometric DNA ploidy analysis in patients with acute leukemia.

    Science.gov (United States)

    Reyes-Núñez, Virginia; Galo-Hooker, Evelyn; Pérez-Romano, Beatriz; Duque, Ricardo E; Ruiz-Arguelles, Alejandro; Garcés-Eisele, Javier

    2018-01-01

    The aim of this work was to simultaneously use multiplex ligation-dependent probe amplification (MLPA) assay and flow cytometric DNA ploidy analysis (FPA) to detect aneuploidy in patients with newly diagnosed acute leukemia. MLPA assay and propidium iodide FPA were used to test samples from 53 consecutive patients with newly diagnosed acute leukemia referred to our laboratory for immunophenotyping. Results were compared by nonparametric statistics. The combined use of both methods significantly increased the rate of detection of aneuploidy as compared to that obtained by each method alone. The limitations of one method are somehow countervailed by the other and vice versa. MPLA and FPA yield different yet complementary information concerning aneuploidy in acute leukemia. The simultaneous use of both methods might be recommended in the clinical setting. © 2017 International Clinical Cytometry Society. © 2017 International Clinical Cytometry Society.

  6. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    Science.gov (United States)

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

    International Nuclear Information System (INIS)

    Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

    2005-01-01

    The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

  8. Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

    Science.gov (United States)

    Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

    2018-09-15

    Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Use of novel DNA fingerprinting techniques for the detection and characterization of genetic variation in vegetatively propagated crops. Proceedings of a final research co-ordination meeting

    International Nuclear Information System (INIS)

    1998-10-01

    Vegetative propagated crops, such as banana and platain, sweet potato, yam, sugarcane and cassava, represent important sources of food in the developing countries. Although some of these crops may produce seeds, they must for practical purposes be propagated vegetatively. As normal plant breeding strategies based on genetic hybridization are of limited value or not applicable to such crops, it is necessary to assess the genetic diversity already existing in these crops and to design breeding strategies accordingly. If the existing genetic variation is shown to be too narrow for breeding purposes, one promising possibility for the introduction of genetic variability is the use of mutations induced by radiation or chemical mutagens. This CRP focused on: the detection of genetic diversity induced by mutagenic treatment or in vitro culture; the development of crop-specific markers; and increasing co-operation between molecular biologists in advanced laboratories and plant breeders and molecular biologists in the developing countries. The success of this CRP is evidenced by the introduction and application of new molecular methods by laboratories in developing countries, specially for the analysis of local crop genetic diversity. These exciting preliminary results show the potential for applications in crop improvement but much work remains to be done. Many of the vegetatively propagated species are ''orphan crops'', under-investigated on the international level. The development of new uses of transgenesis for the development of edible vaccines should not be overlooked. The challenge that remains is in the application of these new tools for practical end-user oriented improvements in vegetatively propagated crops. The present publication summarizes the third and final Research Co-ordination Meeting on the Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops

  10. Use of novel DNA fingerprinting techniques for the detection and characterization of genetic variation in vegetatively propagated crops. Proceedings of a final research co-ordination meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-10-01

    Vegetative propagated crops, such as banana and platain, sweet potato, yam, sugarcane and cassava, represent important sources of food in the developing countries. Although some of these crops may produce seeds, they must for practical purposes be propagated vegetatively. As normal plant breeding strategies based on genetic hybridization are of limited value or not applicable to such crops, it is necessary to assess the genetic diversity already existing in these crops and to design breeding strategies accordingly. If the existing genetic variation is shown to be too narrow for breeding purposes, one promising possibility for the introduction of genetic variability is the use of mutations induced by radiation or chemical mutagens. This CRP focused on: the detection of genetic diversity induced by mutagenic treatment or in vitro culture; the development of crop-specific markers; and increasing co-operation between molecular biologists in advanced laboratories and plant breeders and molecular biologists in the developing countries. The success of this CRP is evidenced by the introduction and application of new molecular methods by laboratories in developing countries, specially for the analysis of local crop genetic diversity. These exciting preliminary results show the potential for applications in crop improvement but much work remains to be done. Many of the vegetatively propagated species are ``orphan crops``, under-investigated on the international level. The development of new uses of transgenesis for the development of edible vaccines should not be overlooked. The challenge that remains is in the application of these new tools for practical end-user oriented improvements in vegetatively propagated crops. The present publication summarizes the third and final Research Co-ordination Meeting on the Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops Refs, figs, tabs

  11. Changes in DNA methylation fingerprint of Quercus ilex trees in response to experimental field drought simulating projected climate change.

    Science.gov (United States)

    Rico, L; Ogaya, R; Barbeta, A; Peñuelas, J

    2014-03-01

    Rapid genetic changes in plants have been reported in response to current climate change. We assessed the capacity of trees in a natural forest to produce rapid acclimation responses based on epigenetic modifications. We analysed natural populations of Quercus ilex, the dominant tree species of Mediterranean forests, using the methylation-sensitive amplified polymorphism (MSAP) technique to assess patterns and levels of methylation in individuals from unstressed forest plots and from plots experimentally exposed to drought for 12 years at levels projected for the coming decades. The percentage of hypermethylated loci increased, and the percentage of fully methylated loci clearly decreased in plants exposed to drought. Multivariate analyses exploring the status of methylation at MSAP loci also showed clear differentiation depending on stress. The PCA scores for the MSAP profiles clearly separated the genetic from the epigenetic structure, and also significantly separated the samples within each group in response to drought. Changes in DNA methylation highlight the large capacity of plants to rapidly acclimate to changing environmental conditions, including trees with long life spans, and our results demonstrate those changes. These changes, although unable to prevent the decreased growth and higher mortality associated with this experimental drought, occurred together with a dampening in such decreases as the long-term treatment progressed. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  12. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  13. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability