WorldWideScience

Sample records for distemper virus infection

  1. Fatal canine distemper virus infection of giant pandas in China

    OpenAIRE

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-01-01

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possess...

  2. Canine distemper virus infection with secondary Bordetella bronchiseptica pneumonia in dogs

    OpenAIRE

    Headley,Selwyn Arlington; Graça,Dominguita Lühers; Costa,Mateus Matiuzzi da; Vargas,Agueda Castagna de

    1999-01-01

    Canine distemper virus infection and secondary Bordetella bronchiseptica pneumonia are described in mongrel dogs. Canine distemper was characterised by nonsuppurative demyelinating encephalitis with typical inclusion bodies in astrocytes. B. bronchiseptica was isolated from areas of purulent bronchopneumonia.

  3. Astrocytic infection in canine distemper virus-induced demyelination.

    Science.gov (United States)

    Mutinelli, F; Vandevelde, M; Griot, C; Richard, A

    1989-01-01

    Acute canine distemper virus (CDV)-induced demyelinating lesions were examined with double-labelling immunocytochemistry simultaneously demonstrating CDV antigen and glial fibrillary acidid protein (GFAP) as marker for astrocytes. It was shown that 64% of all astrocytes within the demyelinating lesions were infected and that 95% of all infected cells counted in the lesions were astrocytes. These results suggest that the astrocyte is the main target for CDV and that astroglial infection may play an important role in the mechanism of demyelination.

  4. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2013-02-01

    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.

  5. Oligodendroglial pathology in canine distemper virus infection in vitro.

    Science.gov (United States)

    Zurbriggen, A; Vandevelde, M; Dumas, M; Griot, C; Bollo, E

    1987-01-01

    Dog brain cell cultures were infected with different canine distemper virus (CDV) strains to study the oligodendrocytes, which were characterized with eight different antibodies to cover the whole oligodendroglial population in the culture. A few weeks after infection all oligodendroglial cell types started to degenerate and disappeared from the culture. However, since no CDV protein could be demonstrated in the degenerating oligodendrocytes with extensive double-labelling studies, this lesion can not be explained as being a result of cytolytic infection. This conclusion was further supported in experiments with plaque-forming CDV, in which viral replication is restricted to the cytolytic areas only; oligodendrocytes also degenerated in virus-free areas between the plaques. The hypothesis of toxic factors released by other infected cell types in the culture leading to secondary damage of the oligodendrocyte could not be confirmed by transferring supernatants from infected to normal cultures. Whereas the presence of toxic factors can not be completely excluded, the possibility of an abortive infection of the oligodendrocytes with no or very limited viral protein synthesis is discussed.

  6. Fatal canine distemper virus infection of giant pandas in China

    Science.gov (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-01-01

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

  7. Fatal canine distemper virus infection of giant pandas in China.

    Science.gov (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-06-16

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species.

  8. Canine distemper virus ISCOMS induce protection in harbour seals (Phoca vitulina) against phocid distemper but still allow subsequent infection with phocid distemper virus-1.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); E.J. Vedder (Lies); C. Örvell; T. Barrett (Thomas); A.D.M.E. Osterhaus (Albert); M.W.G. van de Bildt (Marco)

    1992-01-01

    textabstractA candidate canine distemper virus (CDV) ISCOM vaccine has been shown to be effective in protecting harbour seals (Phoca vitulina) from phocid distemper in 1988. However, of the 35 harbour seals receiving this vaccine upon admission to a seal rehabilitation and research centre

  9. Unusual Necrotizing Encephalitis in Raccoons and Skunks Concurrently Infected With Canine Distemper Virus and Sarcocystis sp.

    Science.gov (United States)

    Kubiski, S V; Sisó, S; Church, M E; Cartoceti, A N; Barr, B; Pesavento, P A

    2016-05-01

    Canine distemper virus commonly infects free-ranging, terrestrial mesopredators throughout the United States. Due to the immunosuppressive effects of the virus, concurrent opportunistic infections are also common. Among these, secondary systemic protozoal infections have been described in a number of species. We report an unusual presentation of necrotizing encephalitis associated withSarcocystissp in four raccoons and one skunk concurrently infected with canine distemper virus. Lesions were characterized by variably sized necrotizing cavitations composed of abundant mineral admixed with inflammatory cells and protozoa.Sarcocystissp was confirmed via immunohistochemistry using a monoclonal antibody toSarcocystis neurona The pathologic changes are similar to lesions in human AIDS patients infected withToxoplasma gondii. © The Author(s) 2015.

  10. Canine Distemper Virus (CDV) immune-stimulating complexes (iscoms), but not measles virus iscoms, protect dogs against CDV infection.

    NARCIS (Netherlands)

    P. de Vries (Petra); F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)

    1988-01-01

    textabstractThe potential of immune-stimulating complexes (iscoms), a novel form of antigenic presentation, for the induction of protective immunity against morbillivirus infection was shown by immunizing dogs with canine distemper virus (CDV) iscoms, which contained the fusion (F) protein and a

  11. Analysis of infection epidemiological distemper virus, dogs in the municipality of Garanhuns, Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Érica Chaves Lúcio

    2014-06-01

    Full Text Available Distemper is caused by a Morbillivirus and has worldwide distribution, the dog being the major reservoir for this virus. Transmission occurs by aerosols and the virus can be excreted at the end of the acute phase. It is a disease with no predilection for race, age or sex; however the literature suggests that puppies are most affected. In this study were analyzed serum samples from pet dogs in the city districts and neighborhoods of Garanhuns Boa Vista, Cohab 1, Cohab 2, Magano and center during the period from August to December 2012. Samples were collected from dogs older than three months, not vaccinated against distemper. To produce the maps of geographical distribution of animals were collected coordinates for each home visit. Of the samples analyzed, 90.38% were positive, and 28.72% had high antibody concentration, 47.88% and 23.40% average concentration or low. By analyzing the distribution by districts observed a higher prevalence of infection in neighborhoods with Cohab 2 100.00% and Cohab 1 with 96.00%; Boa Vista with 93.10%; Magano with 78.26%; center with 50.00%. This study did not identify any variable associated with infection related to sex and 100.0% of the animals, including positive and negative, were not castrated. It was shown that 75.0% of the animals had never been taken to the veterinarian, and of these, 94.8% were positive, a fact that may be related to higher seropositivity in these animals. The results of this study show that the canine distemper virus is widespread in the canine population of Garanhuns, Pernambuco, highlights the importance of epidemiological studies to characterize the real situation of infection by this virus in canine populations, in order to reduce damage to animal health caused by this agent.

  12. Ultrastructural and biochemical findings in brain cell cultures infected with canine distemper virus.

    Science.gov (United States)

    Glaus, T; Griot, C; Richard, A; Althaus, U; Herschkowitz, N; Vandevelde, M

    1990-01-01

    To study the pathomechanism of demyelination in canine distemper (CD), dog brain cell cultures were infected with virulent A75/17-CD virus (CDV) and examined ultrastructurally. Special attention was paid to the oligodendrocytes, which were specifically immunolabelled. In addition, cerebroside sulfotransferase (CST), an enzyme specific for oligodendrocyte activity was assayed during the course of the infection. Infection and maturation as well as CDV-induced changes were found in astrocytes and brain macrophages. Infection of oligodendrocytes was rarely seen, although CST activity of the culture markedly decreased and vacuolar degeneration of these cells occurred, resulting in their complete disappearance. We concluded that the degeneration of oligodendrocytes and demyelination is not due to direct virus-oligodendrocyte interaction, but due to CDV-induced events in other glial cells.

  13. Lymphotropism and host responses during acute wild-type canine distemper virus infections in a highly susceptible natural host

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Jensen, Trine Hammer

    2009-01-01

    The mechanisms behind the in vivo virulence of immunosuppressive wild-type Morbillivirus infections are still not fully understood. To investigate lymphotropism and host responses we have selected the natural host model of canine distemper virus (CDV) infection in mink. This model displays...

  14. Fatal vaccine-induced canine distemper virus infection in black-footed ferrets

    Science.gov (United States)

    Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.

    1976-01-01

    Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

  15. Measles vaccination of nonhuman primates provides partial protection against infection with canine distemper virus

    NARCIS (Netherlands)

    R.D. de Vries (Rory); M. Ludlow (Martin); R.J. Verbugh (Joyce); G. van Amerongen (Geert); S. Yüksel (Selma); D.T. Nguyen (Tien); S. McQuaid (Stephen); A.D.M.E. Osterhaus (Albert); W.P. Duprex (Paul); R.L. de Swart (Rik)

    2014-01-01

    textabstractMeasles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus

  16. Pathogenesis of canine distemper virus in experimentally infected raccoon dogs, foxes, and minks.

    Science.gov (United States)

    Zhao, Jianjun; Shi, Ning; Sun, Yangang; Martella, Vito; Nikolin, Veljko; Zhu, Chunsheng; Zhang, Hailing; Hu, Bo; Bai, Xue; Yan, Xijun

    2015-10-01

    Canine distemper virus (CDV) infects a broad range of carnivores and causes a highly contagious disease with severe immunosuppression. The disease severity markedly varies in different species. To investigate the pathogenesis of CDV in raccoon dog (Nyctereutes procyonoides), fox (Vulpes vulpes) and mink (Neovison vison) species, three groups of CDV sero-negative animals were infected with CDV strain LN(10)1. This CDV strain belongs to the Asia-1 genotype, which is epidemiologically predominant in carnivores in China. CDV infection provoked marked differences in virulence in the three species that were studied. Raccoon dogs developed fever, severe conjunctivitis, and pathological lesions, with 100% (5/5) mortality and with high viral RNA loads in organs within 15 days post infection (dpi). In infected foxes, the onset of the disease was delayed, with 40% (2/5) mortality by 21 dpi. Infected minks developed only mild clinical signs and pathological lesions, and mortality was not observed. Raccoon dogs and foxes showed more severe immune suppression (lymphopenia, decreased lymphocyte proliferation, viremia and low-level virus neutralizing antibodies) than minks. We also observed a distinct pattern of cytokine mRNA transcripts at different times after infection. Decreased IFN-γ and IL-4 mRNA responses were evident in the animals with fatal disease, while up-regulation of these cytokines was observed in the animals surviving the infection. Increased TNF-α response was detected in animals with mild or severe clinical signs. Based on the results, we could distinguish three different patterns of disease after experimental CDV infection, e.g. a mild form in minks, a moderate form in foxes and a severe disease in raccoon dogs. The observed differences in susceptibility to CDV could be related to distinct host cytokine profiles. Comparative evaluation of CDV pathogenesis in various animal species is pivotal to generate models suitable for the evaluation of CDV

  17. Antiviral antibodies stimulate production of reactive oxygen species in cultured canine brain cells infected with canine distemper virus.

    Science.gov (United States)

    Bürge, T; Griot, C; Vandevelde, M; Peterhans, E

    1989-06-01

    Canine distemper is characterized mainly by respiratory, enteric, and nervous symptoms. Infection of the central nervous system results in demyelination, to which inflammation has been shown to contribute significantly. It has been proposed that macrophages play a major role as effector cells in this process. We report that cultured dog brain cells contain a population of macrophages capable of producing reactive oxygen species as measured by luminol-dependent chemiluminescence. In cultures infected with canine distemper virus, a burst of reactive oxygen is triggered by antiviral antibody. This response depends on the presence of viral antigens on the surfaces of infected cells and is mediated by the interaction of antigen-bound antibody with Fc receptors on the macrophages. Since there is no evidence in vitro or in vivo that oligodendrocytes, the cells forming myelin, are infected, our observation supports the hypothesis that "innocent bystander killing" is important in demyelination caused by canine distemper virus. Reactive oxygen species released from macrophages may contribute to destruction of myelin.

  18. Dynamic changes of Foxp3(+) regulatory T cells in spleen and brain of canine distemper virus-infected dogs.

    Science.gov (United States)

    Qeska, V; Barthel, Y; Iseringhausen, M; Tipold, A; Stein, V M; Khan, M A; Baumgärtner, W; Beineke, A

    2013-12-15

    Canine distemper virus (CDV) infection causes immunosuppression and demyelinating leukoencephalitis in dogs. In viral diseases, an ambiguous function of regulatory T cells (Treg), with both beneficial effects by reducing immunopathology and detrimental effects by inhibiting antiviral immunity, has been described. However, the role of Treg in the pathogenesis of canine distemper remains unknown. In order to determine the effect of CDV upon immune homeostasis, the amount of Foxp3(+) Treg in spleen and brain of naturally infected dogs has been determined by immunohistochemistry. In addition, splenic cytokine expression has been quantified by reverse transcriptase polymerase chain reaction. Splenic depletion of Foxp3(+) Treg was associated with an increased mRNA-expression of tumor necrosis factor and decreased transcription of interleukin-2 in the acute disease phase, indicative of disturbed immunological counter regulation in peripheral lymphoid organs. In the brain, a lack of Foxp3(+) Treg in predemyelinating and early demyelinating lesions and significantly increased infiltrations of Foxp3(+) Treg in chronic demyelinating lesions were observed. In conclusion, disturbed peripheral and CNS immune regulation associated with a reduction of Treg represents a potential prerequisite for excessive neuroinflammation and early lesion development in canine distemper leukoencephalitis. © 2013 Elsevier B.V. All rights reserved.

  19. Molecular characterization of complete genome of a canine distemper virus associated with fatal infection in dogs in Gabon, Central Africa.

    Science.gov (United States)

    Maganga, Gael D; Labouba, Ingrid; Ngoubangoye, Barthélémy; Nkili-Meyong, Andriniaina A; Obame Ondo, Daniel; Leroy, Eric M; Berthet, Nicolas

    2018-03-02

    Canine distemper (CD) is the most deadly disease in dogs with mortality rates reaching 50%. The pathological agent, the CD virus (CDV), generally causes a severe systemic disease, although the nervous form can coexist with the acute catarrhal form in the same individual. In this study, we describe an outbreak of 18 cases of CD that occurred in 2015 in a German Shepherd dog population in northwestern Gabon. In addition, we determined the sequence of the CDV genotype associated with this fatal distemper infection in Gabon and compared it with other published CDV sequences. The CDV was detected using RT-PCR on cDNA from RNA of harvested brains and other organs. The identification was confirmed by sequencing amplicons. Moreover, we obtained the whole genome sequence using high-throughput sequencing. Phylogenetic analysis revealed that Gabonese CDV strain clustered with European strains belonging to the Europe genotype. This study provided the first molecular detection of the CDV strain associated with this fatal distemper infection in Central Africa region. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

    Science.gov (United States)

    Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

    2016-11-01

    The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pcanine distemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

  1. Occurrence and geographical distribution of Canine Distemper Virus infection in red foxes (Vulpes vulpes) of Saxony-Anhalt, Germany.

    Science.gov (United States)

    Denzin, N; Herwig, V; van der Grinten, E

    2013-02-22

    Canine Distemper Virus (CDV) infects dogs and a variety of carnivore species. In Saxony-Anhalt, a federal state of Germany, 761 foxes were examined for CDV infection, using real-time polymerase chain reaction (PCR), in the years 2010 and 2011. A prevalence of 30.5% was found for the whole time period without significant changes in prevalence between 2010 and 2011. The relative risk (RR) of a fox to test positive for CDV varied markedly within the area of the state and was significantly increased in some regions. The latter was confirmed by a spatial cluster test that identified a significant cluster (pSaxony-Anhalt. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

    OpenAIRE

    Headley,Selwyn Arlington; Saito,Taís Berelli

    2003-01-01

    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  3. Impacts of canine distemper virus infection on the giant panda population from the perspective of gut microbiota.

    Science.gov (United States)

    Zhao, Na; Li, Meng; Luo, Jing; Wang, Supen; Liu, Shelan; Wang, Shan; Lyu, Wenting; Chen, Lin; Su, Wen; Ding, Hua; He, Hongxuan

    2017-01-04

    The recent increase in infectious disease outbreaks has been directly linked to the global loss of biodiversity and the decline of some endangered species populations. Between December 2014 and March 2015, five captive giant pandas died due to canine distemper virus (CDV) infection in China. CDV has taken a heavy toll on tigers and lions in recent years. Here, we describe the first gut microbiome diversity study of CDV-infected pandas. By investigating the influence of CDV infection on gut bacterial communities in infected and uninfected individuals and throughout the course of infection, we found that CDV infection distorted the gut microbiota composition by reducing the prevalence of the dominant genera, Escherichia and Clostridium, and increasing microbial diversity. Our results highlight that increases in intestinal inflammation and changes in the relative abundances of pathogen-containing gut communities occur when individuals become infected with CDV. These results may provide new insights into therapeutics that target the microbiota to attenuate the progression of CDV disease and to reduce the risk of gut-linked disease in individuals with CDV. In addition, our findings underscore the need for better information concerning the dynamics of infection and the damage caused by pathogens in panda populations.

  4. The fusion protein of wild-type canine distemper virus is a major determinant of persistent infection

    International Nuclear Information System (INIS)

    Plattet, Philippe; Rivals, Jean-Paul; Zuber, BenoIt; Brunner, Jean-Marc; Zurbriggen, Andreas; Wittek, Riccardo

    2005-01-01

    The wild-type A75/17 canine distemper virus (CDV) strain induces a persistent infection in the central nervous system but infects cell lines very inefficiently. In contrast, the genetically more distant Onderstepoort CDV vaccine strain (OP-CDV) induces extensive syncytia formation. Here, we investigated the roles of wild-type fusion (F WT ) and attachment (H WT ) proteins in Vero cells expressing, or not, the canine SLAM receptor by transfection experiments and by studying recombinants viruses expressing different combinations of wild-type and OP-CDV glycoproteins. We show that low fusogenicity is not due to a defect of the envelope proteins to reach the cell surface and that H WT determines persistent infection in a receptor-dependent manner, emphasizing the role of SLAM as a potent enhancer of fusogenicity. However, importantly, F WT reduced cell-to-cell fusion independently of the cell surface receptor, thus demonstrating that the fusion protein of the neurovirulent A75/17-CDV strain plays a key role in determining persistent infection

  5. [Canine distemper virus--an agent looking for new hosts].

    Science.gov (United States)

    Baumgärtner, W; Alldinger, S; Beineke, A; Gröters, S; Herden, C; Kaim, U; Müller, G; Seeliger, F; Van Moll, P; Wohlsein, P

    2003-04-01

    Canine distemper is caused by the canine distemper virus (CDV), a RNA virus belonging to the genus Morbillivirus of the family Paramyxoviridae. The genus Morbillivirus includes measles virus, Rinderpest virus and peste-des-petits-ruminants virus. The host spectrum of CDV, which includes numerous families of Carnivores, has been changed in the last years and distemper-like diseases have been observed in numerous other species. These include epidemics in large felids, marine mammals and javelinas. Different viruses have been isolated from pinnipeds including a seal-specific isolate, termed phocine distemper virus 1, PDV-1, and a CDV strain, named PDV-2. Retrospective analysis of previous epidemics among marine mammals in various regions of the world provide evidence for the occurrence of so far unrecognized morbillivirus epidemics. In some including the mass mortalities of Baikal and Caspian seals and of large felids in the Serengeti, terrestrial carnivores including dogs and wolves have been suspected as a vector for the infectious agent. However, in other epidemics among marine mammals the source of infection remains unknown including both seal epidemics in northwestern Europe in 1988 and 2002. It remains to be determined whether a morbillivirus from other marine mammals or terrestrial carnivores caused the infection in this unprotected seal populations.

  6. Pneumonia due to Talaromyces marneffei in a Dog from Southern Brazil with Concomitant Canine Distemper Virus Infection.

    Science.gov (United States)

    Headley, S A; Pretto-Giordano, L G; Lima, S C; Suhett, W G; Pereira, A H T; Freitas, L A; Suphoronski, S A; Oliveira, T E S; Alfieri, A F; Pereira, E C; Vilas-Boas, L A; Alfieri, A A

    2017-07-01

    The pathological and molecular findings associated with Talaromyces marneffei-induced pneumonia with concomitant infection by canine distemper virus (CDV) are described in a dog. The principal pathological alteration occurred in the lungs. Histopathology confirmed multifocal granulomatous pneumonia associated with numerous intralesional and intracellular septate fission cells consistent with T. marneffei. A molecular assay designed to amplify a partial fragment of the 18S rRNA gene of T. marneffei provided positive results from two fungal cultures derived from the lung. Sequencing and phylogenetic analyses confirmed the results of polymerase chain reaction (PCR). Furthermore, antigens of the CDV N protein were identified within the bronchial epithelium by immunohistochemistry and a PCR assay amplified the CDV N gene from hepatic and pulmonary fragments. Collectively, the pathological and molecular techniques confirmed a diagnosis of T. marneffei-induced pneumonia with concomitant infection by CDV. These findings represent the first description of pulmonary penicilliosis in the dog and extend the geographical niche of this emerging infectious pathogen. In this case, infection by CDV may have induced immunosuppression, which facilitated the development of pulmonary penicilliosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Phocine distemper Virus: Current knowledge and future directions

    NARCIS (Netherlands)

    P. Duignan; M.-F. Van Bressem (Marie-Françoise); J.D. Baker (Jason); M. Barbieri (Michelle); K.M. Colegrove (Kathleen M); S. De Guise (Sylvain); R.L. de Swart (Rik); G. di Guardo (Giovanni); A.P. Dobson (Andrew); W.P. Duprex (Paul); G. Early (Greg); D. Fauquier (Deborah); T. Goldstein (Tracey); S.J. Goodman (Simon J.); B.T. Grenfell (Bryan); K.R. Groch (Kátia R.); F. Gulland (Frances); A. Hall (Ailsa); B.A. Jensen (Brenda A.); K. Lamy (Karina); K. Matassa (Keith); S. Mazzariol (Sandro); S.E. Morris (Sinead E.); O. Nielsen (Ole); D. Rotstein (David); T.K. Rowles (Teresa K); J. Saliki (Jeremy); U. Siebert (Ursula); T. Waltzek (Thomas); J.F.X. Wellehan (James F. X.)

    2014-01-01

    textabstractPhocine distemper virus (PDV) was first recognized in 1988 following a massive epidemic in harbor and grey seals in north-western Europe. Since then, the epidemiology of infection in North Atlantic and Arctic pinnipeds has been investigated. In the western North Atlantic endemic

  8. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  9. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR for diagnosis of natural infection with canine distemper virus

    Directory of Open Access Journals (Sweden)

    Wong Min-Liang

    2010-06-01

    Full Text Available Abstract Background Canine distemper virus (CDV is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR of the matrix (M gene to the fusion (F gene (designated M-F UTR in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  10. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Science.gov (United States)

    Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

  11. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  12. Serological and demographic evidence for domestic dogs as a source of canine distemper virus infection for Serengeti wildlife.

    Science.gov (United States)

    Cleaveland, S; Appel, M G; Chalmers, W S; Chillingworth, C; Kaare, M; Dye, C

    2000-03-15

    Following an epidemic of canine distemper virus (CDV) in Serengeti lions in 1994, the role of domestic dogs in the epidemiology of the disease was investigated by serological and demographic analyses. From 1992 to 1994, data were collected from two domestic dog populations bordering the Serengeti National Park. Several lines of evidence indicated that patterns of CDV infection differed significantly between higher-density dog populations of Serengeti District to the west of the park and lower-density populations of Ngorongoro District to the south-east: (a) CDV age-seroprevalence patterns differed significantly between years in Ngorongoro District populations but not in Serengeti District populations; (b) CDV seropositive pups (Ngorongoro District only in 1994, whereas a proportion of pups in Serengeti District were seropositive in each year of the study; (c) in Ngorongoro District, the proportion of deaths attributed to disease was significantly higher in 1994 than in 1993, whereas in Serengeti District, there was no significant difference in disease-related mortality between years; (d) in Ngorongoro District, significantly more CDV seronegative dogs than seropositive dogs died in 1994, whereas there was no difference in survival of CDV seropositives and seronegatives between years in Serengeti District. We concluded that, between 1992 and 1994, CDV persisted in higher-density dog populations of Serengeti District, but occurred only sporadically in lower-density Ngorongoro District populations. Data from Ngorongoro District are consistent with exposure of dogs to CDV in 1991 and 1994, but not in 1992 and 1993. These findings suggest that higher-density domestic dog populations to the west of the Serengeti National Park were a more likely source of CDV infection for wildlife during 1994 than lower-density pastoralist dogs to the south and east of the park.

  13. Frequency of Virus Coinfection in Raccoons ( Procyon lotor) and Striped Skunks ( Mephitis mephitis) During a Concurrent Rabies and Canine Distemper Outbreak.

    Science.gov (United States)

    Jardine, Claire M; Buchanan, Tore; Ojkic, Davor; Campbell, G Douglas; Bowman, Jeff

    2018-03-08

    Rabies and canine distemper virus infections in wildlife share similar presenting signs. Canine distemper virus was detected using real-time PCR of conjunctival swabs in rabies positive raccoons (22/32) and skunks (7/34) during a concurrent rabies and canine distemper outbreak in Ontario, Canada in 2015-2016. Coinfections with both viruses should be considered, particularly in distemper endemic areas that are at risk of rabies incursion.

  14. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

    Science.gov (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

    2017-06-01

    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  15. Chronic encephalomyelitis caused by canine distemper virus in a Bengal tiger.

    Science.gov (United States)

    Blythe, L L; Schmitz, J A; Roelke, M; Skinner, S

    1983-12-01

    A chronic progressive neurologic disease was observed and monitored for 18 months in a young, tamed Bengal tiger. Clinical, serologic, and neuropathologic evidence of canine distemper virus infection was seen. Clinical signs included convulsions, myoclonus, and slowly progressive ataxia. Marked increases in neutralizing antibodies against canine distemper virus were seen in the serum and cerebrospinal fluid. Neuropathologic findings were nonsuppurative meningoencephalomyelitis, with perivascular cuffing, demyelination, and inclusion bodies typical of canine distemper virus. It was concluded that, in light of this case and an earlier report of canine distemper in lion cubs, vaccination of this subgroup of carnivores with a killed vaccine may be beneficial if exposure to other animals susceptible to canine distemper is anticipated.

  16. Advances in canine distemper virus pathogenesis research: a wildlife perspective.

    Science.gov (United States)

    Loots, Angelika K; Mitchell, Emily; Dalton, Desiré L; Kotzé, Antoinette; Venter, Estelle H

    2017-03-01

    Canine distemper virus (CDV) has emerged as a significant disease of wildlife, which is highly contagious and readily transmitted between susceptible hosts. Initially described as an infectious disease of domestic dogs, it is now recognized as a global multi-host pathogen, infecting and causing mass mortalities in a wide range of carnivore species. The last decade has seen the effect of numerous CDV outbreaks in various wildlife populations. Prevention of CDV requires a clear understanding of the potential hosts in danger of infection as well as the dynamic pathways CDV uses to gain entry to its host cells and its ability to initiate viral shedding and disease transmission. We review recent research conducted on CDV infections in wildlife, including the latest findings on the causes of host specificity and cellular receptors involved in distemper pathogenesis.

  17. Canine distemper virus (CDV) in another big cat: should CDV be renamed carnivore distemper virus?

    Science.gov (United States)

    Terio, Karen A; Craft, Meggan E

    2013-09-17

    One of the greatest threats to the conservation of wild cat populations may be dogs or, at least, one of their viruses. Canine distemper virus (CDV), a single-stranded RNA virus in the Paramyxoviridae family and genus Morbillivirus, infects and causes disease in a variety of species, not just canids. An outbreak of CDV in wild lions in the Serengeti, Tanzania, in 1994 was a wake-up call for conservationists, as it demonstrated that an infectious disease could swiftly impact a previously healthy felid population. To understand how this virus causes disease in noncanid hosts, researchers have focused on specific mutations in the binding site of the CDV hemagglutinin gene. Now, Seimon et al. provide information on CDV in its latest feline victim, the endangered wild Amur tiger (Panthera tigris altaica) [T. A. Seimon et al., mBio 4(4):e00410-13, 2013, doi:10.1128/mBio.00410-13]. Their findings of CDV strains infecting tigers, in combination with recent information from other felids, paints a different picture, one in which CDV strains from a variety of geographic lineages and with a variety of amino acid residues in the hemagglutinin gene binding site can infect cats and cause disease. Although CDV has been known as a multihost disease since its discovery in domestic dogs in 1905, perhaps it is time to reconsider whether these noncanid species are not just incidental or "spillover" hosts but, rather, a normal part of the complex ecology of this infectious disease.

  18. Establishment of reverse transcription loop-mediated isothermal amplification for rapid detection and differentiation of canine distemper virus infected and vaccinated animals.

    Science.gov (United States)

    Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong

    2015-06-01

    Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  20. Comparison of reverse-transcription real-time PCR and immunohistochemistry for the detection of canine distemper virus infection in raccoons in Ontario, Canada.

    Science.gov (United States)

    Nemeth, Nicole M; Oesterle, Paul T; Campbell, G Douglas; Ojkic, Davor; Jardine, Claire M

    2018-03-01

    Canine distemper virus (CDV) is a widespread morbillivirus that causes subclinical to fatal infections in domestic and wild carnivores. Raccoons ( Procyon lotor) are CDV reservoirs and suffer from associated disease. Aspects of pathogenesis may lead to difficulty in the interpretation of commonly used testing modalities, such as reverse-transcription real-time (RT-rt)PCR and immunohistochemistry (IHC). The reliance upon such tests is greater for wildlife, which are often submitted as carcasses with no clinical history. We compared CDV RT-rtPCR results to immunohistochemistry (the gold standard) in tissues from 74 raccoons. These tests had high kappa agreement (lymph node: 0.9335; lung: 0.8671) and a negative correlation between IHC score and threshold cycle (Ct) value for lymph node and lung (Spearman rank correlation coefficient [ r s ] = -0.8555 and -0.8179, respectively; p < 0.00001). An RT-rtPCR Ct value of 30 in lung and lymph node with sensitivity and specificity of 92.3 and 92.6% and 86.8 and 96.4%, respectively, was suitable for determining CDV involvement. Conjunctival swabs provide an alternative for distemper diagnosis, as there was a strong correlation between Ct values of conjunctival swabs and tissues ( r s = -0.8498, p < 0.00001, n = 46). This information will aid in more efficient and accurate diagnoses in individuals, small-scale outbreaks, and epidemiologic investigations in wildlife.

  1. Immunohistochemical detection of autophagy-related microtubule-associated protein 1 light chain 3 (LC3) in the cerebellums of dogs naturally infected with canine distemper virus.

    Science.gov (United States)

    Kabak, Y B; Sozmen, M; Yarim, M; Guvenc, T; Karayigit, M O; Gulbahar, M Y

    2015-01-01

    We investigated the expression of microtubule-associated protein 1 light chain 3 (LC3) protein in the cerebellums of dogs infected with canine distemper virus (CDV) using immunohistochemistry to detect autophagy. The cerebellums of 20 dogs infected with CDV were used. Specimens showing demyelination of white matter were considered to have an acute infection, whereas specimens showing signs of severe perivascular cuffing and demyelination of white matter were classified as having chronic CDV. Cerebellar sections were immunostained with CDV and LC3 antibodies. The cytoplasm of Purkinje cells, granular layer cells, motor neurons in large cerebellar ganglia and some neurons in white matter were positive for the LC3 antibody in both the control and CDV-infected dogs. In the infected cerebellums, however, white matter was immunostained more intensely, particularly the neurons and gemistocytic astrocytes in the demyelinated areas, compared to controls. Autophagy also was demonstrated in CDV-positive cells using double immunofluorescence staining. Our findings indicate that increased autophagy in the cerebellum of dogs naturally infected with CDV may play a role in transferring the virus from cell to cell.

  2. Canine Distemper Virus (CDV) in Another Big Cat: Should CDV Be Renamed Carnivore Distemper Virus?

    Science.gov (United States)

    Terio, Karen A.; Craft, Meggan E.

    2013-01-01

    ABSTRACT One of the greatest threats to the conservation of wild cat populations may be dogs or, at least, one of their viruses. Canine distemper virus (CDV), a single-stranded RNA virus in the Paramyxoviridae family and genus Morbillivirus, infects and causes disease in a variety of species, not just canids. An outbreak of CDV in wild lions in the Serengeti, Tanzania, in 1994 was a wake-up call for conservationists, as it demonstrated that an infectious disease could swiftly impact a previously healthy felid population. To understand how this virus causes disease in noncanid hosts, researchers have focused on specific mutations in the binding site of the CDV hemagglutinin gene. Now, Seimon et al. provide information on CDV in its latest feline victim, the endangered wild Amur tiger (Panthera tigris altaica) [T. A. Seimon et al., mBio 4(4):e00410-13, 2013, doi:10.1128/mBio.00410-13]. Their findings of CDV strains infecting tigers, in combination with recent information from other felids, paints a different picture, one in which CDV strains from a variety of geographic lineages and with a variety of amino acid residues in the hemagglutinin gene binding site can infect cats and cause disease. Although CDV has been known as a multihost disease since its discovery in domestic dogs in 1905, perhaps it is time to reconsider whether these noncanid species are not just incidental or “spillover” hosts but, rather, a normal part of the complex ecology of this infectious disease. PMID:24045642

  3. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  4. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  5. Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe

    Directory of Open Access Journals (Sweden)

    P.J. Kelly

    2005-06-01

    Full Text Available Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54. These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role that the virus might play in the high mortality rate of the dog population on communal land warrants further investigation.

  6. Tumour necrosis factor-alpha-induced protein 8 (TNFAIP8) expression associated with cell survival and death in cancer cell lines infected with canine distemper virus.

    Science.gov (United States)

    Garcia, J A; Ferreira, H L; Vieira, F V; Gameiro, R; Andrade, A L; Eugênio, F R; Flores, E F; Cardoso, T C

    2017-06-01

    Oncolytic virotherapy is a novel strategy for treatment of cancer in humans and companion animals as well. Canine distemper virus (CDV), a paramyxovirus, has proven to be oncolytic through induction of apoptosis in canine-derived tumour cells, yet the mechanism behind this inhibitory action is poorly understood. In this study, three human mammary tumour cell lines and one canine-derived adenofibrosarcoma cell line were tested regarding to their susceptibility to CDV infection, cell proliferation, apoptosis, mitochondrial membrane potential and expression of tumour necrosis factor-alpha-induced protein 8 (TNFAIP8). CDV replication-induced cytopathic effect, decrease of cell proliferation rates, and >45% of infected cells were considered death and/or under late apoptosis/necrosis. TNFAIP8 and CDVM gene expression were positively correlated in all cell lines. In addition, mitochondrial membrane depolarization was associated with increase in virus titres (p < 0.005). Thus, these results strongly suggest that both human and canine mammary tumour cells are potential candidates for studies concerning CDV-induced cancer therapy. © 2015 John Wiley & Sons Ltd.

  7. Canine Distemper Virus Infection Leads to an Inhibitory Phenotype of Monocyte-Derived Dendritic Cells In Vitro with Reduced Expression of Co-Stimulatory Molecules and Increased Interleukin-10 Transcription

    Science.gov (United States)

    Herder, Vanessa; Stein, Veronika M.; Tipold, Andrea; Urhausen, Carola; Günzel-Apel, Anne-Rose; Rohn, Karl; Baumgärtner, Wolfgang; Beineke, Andreas

    2014-01-01

    Canine distemper virus (CDV) exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs), responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper. PMID:24769532

  8. Canine distemper virus infection leads to an inhibitory phenotype of monocyte-derived dendritic cells in vitro with reduced expression of co-stimulatory molecules and increased interleukin-10 transcription.

    Directory of Open Access Journals (Sweden)

    Visar Qeska

    Full Text Available Canine distemper virus (CDV exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs, responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper.

  9. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  10. Vaccination of harbour seals (Phoca vitulina) against phocid distemper with two different inactivated canine distemper virus (CDV) vaccines.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); M.W.G. van de Bildt (Marco); H.N. Brugge; P.J.H. Reijnders; E.J. Vedder (Lies); J. Kuiper; P. de Vries (Petra); J. Groen (Jan); H.C. Walvoort; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)

    1989-01-01

    textabstractTwo inactivated canine distemper virus (CDV) vaccines--an adjuvanted whole inactivated virus and a subunit ISCOM preparation--were tested for their ability to induce protective immunity in harbour seals (Phoca vitulina) against phocid distemper, a disease that recently killed greater

  11. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)

    1996-01-01

    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  12. Optic neuritis caused by canine distemper virus in a Jack Russell terrier

    Science.gov (United States)

    Richards, Tara R.; Whelan, Nick C.; Pinard, Chantale L.; Alcala, Fernanda Castillo; Wolfe, Katheryn C.

    2011-01-01

    An atypical case of canine distemper (CD) was diagnosed in a vaccinated healthy adult dog. The patient was presented circling, seizuring, and blind. Postmortem examination resulted in a diagnosis of CD. Optic neuritis was diagnosed, a finding not previously described in the context of CD virus infection presenting solely with neurological signs. PMID:21731093

  13. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  14. Possible lin between elevated accumulation of trace elements and canine distemper virus infection in the Caspian seals (Phoca caspica) stranded in 2000 and 2001

    Science.gov (United States)

    Shinsuke, T.; Takashi, K.; Yasumi, A.; Tokutaka, I.; Reiji, K.

    2003-05-01

    In the Caspian Sea, a die-off of thousands of Caspian seals (Phoca caspica) occurred in 1997 and 2000. While a direct cause for these deaths seems to be canine distemper virus (CDV) infection, immunosuppression due to environmental pollutants is considered as one of the possible explanations for the development of the disease. The purpose of this work is to examine whether exposure to trace metals could be one of the factors involved in the mass mortality of Caspian seals. Concentrations of 13 trace elements weredetermined in liver, kidney and muscle of Caspian seals found stranded along the coasts of the Caspian Sea in 2000 and 2001. Concentrations of toxic elemen ts (Ag, Cd, Hg, Tl and Pb) in the Caspian seals collected in 2000 and 2001 were comparable to or lower than those in healthy Caspian seals collected in 1993 and 1998 and in seals from other regions, suggesting that these elements would not be the causative agent for the death of Caspian seals. In contrast, Zn and Fe concentrations in the stranded Caspian seals were apparently higher than those in seals from other locations. These results suggest the disturbance in homeostatic control and nutritional statu s of essential elements in the stranded Caspian seals.

  15. Canine distemper virus-induced depletion of uninfected lymphocytes is associated with apoptosis.

    Science.gov (United States)

    Schobesberger, Martina; Summerfield, Artur; Doherr, Marcus G; Zurbriggen, Andreas; Griot, Christian

    2005-03-10

    Canine distemper virus (CDV), a negative stranded RNA morbillivirus, causes a multisystemic disease in dogs, which is associated with a severe immune suppression. The aim of the study was to examine the influence of early CDV infection on leukocyte depletion, lymphopenia and virus-induced cell death in dogs infected with a virulent CDV strain. From 10 infected dogs, peripheral blood leukocytes were harvested periodically, phenotyped and analyzed for CDV antigen content and apoptosis using Annexin V-FITC and propidium iodide labeling. CDV infection induced a severe CD3+ T cell and CD21+ B cell depletion in all animals at 3 days post-infection (d.p.i.). For dogs with severe distemper, developing virus persistence in the lymphoid tissue and central nervous system, this lymphopenia lasted until the end of the experiment. Increased levels of lymphocyte apoptosis were found at 3 d.p.i., and monocyte apoptosis at 6 d.p.i. This was more prominent in the group of animals with severe distemper. At 3 d.p.i. no leukocyte infection was detectable indicating that the early lymphocyte depletion and apoptosis was not a direct consequence of virus infection. Taken together, our results demonstrate that CDV-induced lymphopenia is an early event and that the degree of lymphocyte depletion correlates with the severity of disease and virus persistence in the lymphoid tissue and central nervous system.

  16. Recombinant rabies virus expressing the H protein of canine distemper virus protects dogs from the lethal distemper challenge.

    Science.gov (United States)

    Wang, Feng-Xue; Zhang, Shu-Qin; Zhu, Hong-Wei; Yang, Yong; Sun, Na; Tan, Bin; Li, Zhen-Guang; Cheng, Shi-Peng; Fu, Zhen F; Wen, Yong-Jun

    2014-12-05

    The rabies virus (RV) vector LBNSE expressing foreign antigens have shown considerable promise as vaccines against viral and bacteria diseases, which is effective and safe. We produced a new RV-based vaccine vehicle expressing 1.824 kb hemagglutinin (H) gene of the canine distemper virus (CDV) by reverse genetics technology. The recombinant virus LBNSE-CDV-H retained growth properties similar to those of vector LBNSE both in BSR and mNA cell culture. The H gene of CDV was expressed and detected by immunostaining. To compare the immunogenicity of LBNSE-CDV-H, dogs were immunized with each of these recombinant viruses by intramuscular (i.m.). The dogs were bled at third weeks after the immunization for the measurement of virus neutralizing antibody (VNA) and then challenged with virulent virus (ZJ 7) at fourth weeks. The parent virus (LBNSE) without expression of any foreign molecules was included for comparison. Dogs inoculated with LBNSE-CDV-H showed no any signs of disease and exhibited seroconversion against both RV and CDV H protein. The LBNSE-CDV-H did not cause disease in dogs and conferred protection from challenge with a lethal wild type CDV strain, demonstrating its potential value for wildlife conservation efforts. Together, these studies suggest that recombinant RV expressing H protein from CDV stimulated high levels of adaptive immune responses (VNA), and protected all dogs challenge infection. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Canine Distemper Virus Infects Canine Keratinocytes and Immune Cells by Using Overlapping and Distinct Regions Located on One Side of the Attachment Protein▿

    Science.gov (United States)

    Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

    2011-01-01

    The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439

  18. A recombinant canine distemper virus expressing a modified rabies virus glycoprotein induces immune responses in mice.

    Science.gov (United States)

    Li, Zhili; Wang, Jigui; Yuan, Daoli; Wang, Shuang; Sun, Jiazeng; Yi, Bao; Hou, Qiang; Mao, Yaping; Liu, Weiquan

    2015-06-01

    Canine distemper virus (CDV) and rabies virus (RV) are two important pathogens of the dog. CDV, a member of the morbillivirus genus, has shown promise as an expression vector. The glycoprotein from RV is a main contributor to protective immunity and capable of eliciting the production of virus-neutralizing antibodies. In this study, we recovered an attenuated strain of canine distemper virus and constructed a recombinant virus, rCDV-RV-G, expressing a modified (R333Q) rabies virus glycoprotein (RV-G) of RV Flury strain LEP. RV-G expression by the recombinant viruses was confirmed. Furthermore, G was proved to be incorporated into the surface of CDV particles. While replication of the recombinant virus was slightly reduced compared with the parental CDV, it stably expressed the RV-G over ten serial passages. Inoculation of mice induced specific neutralizing antibodies against both RV-G and CDV. Therefore, the rCDV-RV-G has the potential as a vaccine that may be used to control rabies virus infection in dogs and other animals.

  19. Phocine Distemper Virus: Current Knowledge and Future Directions

    Directory of Open Access Journals (Sweden)

    Pádraig J. Duignan

    2014-12-01

    Full Text Available Phocine distemper virus (PDV was first recognized in 1988 following a massive epidemic in harbor and grey seals in north-western Europe. Since then, the epidemiology of infection in North Atlantic and Arctic pinnipeds has been investigated. In the western North Atlantic endemic infection in harp and grey seals predates the European epidemic, with relatively small, localized mortality events occurring primarily in harbor seals. By contrast, PDV seems not to have become established in European harbor seals following the 1988 epidemic and a second event of similar magnitude and extent occurred in 2002. PDV is a distinct species within the Morbillivirus genus with minor sequence variation between outbreaks over time. There is now mounting evidence of PDV-like viruses in the North Pacific/Western Arctic with serological and molecular evidence of infection in pinnipeds and sea otters. However, despite the absence of associated mortality in the region, there is concern that the virus may infect the large Pacific harbor seal and northern elephant seal populations or the endangered Hawaiian monk seals. Here, we review the current state of knowledge on PDV with particular focus on developments in diagnostics, pathogenesis, immune response, vaccine development, phylogenetics and modeling over the past 20 years.

  20. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

    Science.gov (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

    2012-07-20

    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. In search of virus carriers of the 1988 and 2002 phocine distemper virus outbreaks in European harbour seals

    NARCIS (Netherlands)

    Kreutzer, M.; Kreutzer, R.; Siebert, U.; Muller, G.; Reijnders, P.J.H.; Brasseur, S.M.J.M.; Harkonen, T.; Dietz, R.; Sonne, C.; Born, E.W.; Baumgartner, W.

    2008-01-01

    European harbour seal (Phoca vitulina) populations decreased substantially during the phocine distemper virus (PDV) outbreaks of 1988 and 2002. Different hypotheses have stated that various seals and terrestrial carnivore species might be the source of infection. To further analyse these hypotheses,

  2. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

    that the farmed mink and wild fox population were infected by identical viruses which strongly indicate an epidemiological link between these populations. Accordingly, diseased and dead foxes were observed in some of the mink herds in connection to the outbreak. The Danish virus strain clustered phylogenetically......Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... between mink farms during outbreaks....

  3. Identification of a genetic variant of canine distemper virus from ...

    African Journals Online (AJOL)

    Dr Woma T Y

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and ... from living dogs were limited to blood in heparin-containing tubes and spleen from dogs that were .... coverage of more than 90% (Gustafson et al., 1987). Assuming that quality,.

  4. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions

  5. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  6. Cross-species transmission of canine distemper virus-an update.

    Science.gov (United States)

    Beineke, Andreas; Baumgärtner, Wolfgang; Wohlsein, Peter

    2015-12-01

    Canine distemper virus (CDV) is a pantropic morbillivirus with a worldwide distribution, which causes fatal disease in dogs. Affected animals develop dyspnea, diarrhea, neurological signs and profound immunosuppression. Systemic CDV infection, resembling distemper in domestic dogs, can be found also in wild canids (e.g. wolves, foxes), procyonids (e.g. raccoons, kinkajous), ailurids (e.g. red pandas), ursids (e.g. black bears, giant pandas), mustelids (e.g. ferrets, minks), viverrids (e.g. civets, genets), hyaenids (e.g. spotted hyenas), and large felids (e.g. lions, tigers). Furthermore, besides infection with the closely related phocine distemper virus, seals can become infected by CDV. In some CDV outbreaks including the mass mortalities among Baikal and Caspian seals and large felids in the Serengeti Park, terrestrial carnivores including dogs and wolves have been suspected as vectors for the infectious agent. In addition, lethal infections have been described in non-carnivore species such as peccaries and non-human primates demonstrating the remarkable ability of the pathogen to cross species barriers. Mutations affecting the CDV H protein required for virus attachment to host-cell receptors are associated with virulence and disease emergence in novel host species. The broad and expanding host range of CDV and its maintenance within wildlife reservoir hosts considerably hampers disease eradication.

  7. Histopathology and immunohistochemistry of canine distemper virus-induced footpad hyperkeratosis (hard Pad disease) in dogs with natural canine distemper.

    Science.gov (United States)

    Koutinas, A F; Baumgärtner, W; Tontis, D; Polizopoulou, Z; Saridomichelakis, M N; Lekkas, S

    2004-01-01

    Hard pad disease represents an uncommon manifestation of canine distemper virus (CDV) infection with a still uncertain pathogenesis. To study the pathogenesis of this uncommon, virally induced cutaneous lesion, the footpads of 19 dogs with naturally occurring distemper were investigated for histologic changes and distribution pattern of CDV antigen. All dogs displayed clinical signs of distemper, which had lasted from 10 to 75 days. Overt digital hyperkeratosis was observed in 12 animals (group A), whereas the footpads of the remaining seven dogs appeared normal macroscopically (group B). Orthokeratotic hyperkeratosis (12/12; 100%), irregular acanthosis (11/12; 92%), thickened rete ridges (10/12; 83%), and mild mononuclear perivascular (10/ 12; 83%) and periadnexal (7/12; 58%) dermatitis were the most common findings in dogs with hard pad disease. Surprisingly, orthokeratotic hyperkeratosis (5/7; 71%), irregular acanthosis (5/7; 71%), and thickened rete ridges (4/7; 57%) were also seen in the dogs without clinical evidence of digital hyperkeratosis. CDV-specific inclusion bodies and ballooning degeneration were not observed in the footpad epidermis of the 19 dogs. Immunohis-tochemistry revealed that CDV antigen was most frequently found in the stratum spinosum and granulosum and in the epithelial cells of the eccrine sweat glands and only rarely in the basal layer. Fibroblasts, pericytes, endothelial cells, and hair follicles were also positive in some animals. Despite the obvious difference regarding the macroscopic picture, the microscopic changes were less prominent between the animal groups. The selective infection of keratinocytes in the stratum spinosum might be the key event for the development of hard pad disease in the dog.

  8. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  9. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  10. Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA.

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2016-01-01

    Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release.

  11. Canine distemper virus induces apoptosis in cervical tumor derived cell lines

    Directory of Open Access Journals (Sweden)

    Rajão Daniela S

    2011-06-01

    Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

  12. 6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro.

    Science.gov (United States)

    de Carvalho, Otávio Valério; Félix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, Márcia Rogéria; Bressan, Gustavo Costa; Pena, Lindomar José; Silva-Júnior, Abelardo

    2017-06-26

    Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic strategies synergizing with vaccine programs for effectively controlling canine distemper. 6-methylmercaptopurine riboside (6MMPr) is a modified thiopurine nucleoside with known antiviral properties against certain RNA viruses. We tested the inhibitory effects of 6MMPr against a wild-type CDV strain infection in cell culture. We measured infectious particle production and viral RNA levels in treated and untreated CDV-infected cells. Ribavirin (RIB) was used as a positive control. Here, we report for the first time the antiviral effects of 6MMPr against canine distemper virus (CDV) in vitro. 6MMPr was able to reduce viral RNA levels and to inhibit the production of infectious CDV particles. The therapeutic selectivity of 6MMPr was approximately six times higher than that of ribavirin. Our results indicate that 6MMPr has high anti-CDV potential and warrants further testing against other paramyxoviruses, as well as clinical testing of the compound against CDV.

  13. Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J; von Messling, Veronika

    2017-04-15

    The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant vaccine strain rabies virus particles, which concurrently display the protective CDV and RABV glycoprotein antigens. The recombinant viruses replicated to near-wild-type titers, and the heterologous glycoproteins were efficiently expressed and incorporated in the viral particles. Immunization of ferrets with beta-propiolactone-inactivated recombinant virus particles elicited protective RABV antibody titers, and animals immunized with a combination of CDV attachment protein- and fusion protein-expressing recombinant viruses were protected from lethal CDV challenge. However, animals that were immunized with only a RABV expressing the attachment protein of CDV vaccine strain Onderstepoort succumbed to infection with a more recent wild-type strain, indicating that immune responses to the more conserved fusion protein contribute to protection against heterologous CDV strains. IMPORTANCE Rabies virus and canine distemper virus (CDV) cause high mortality rates and death in many carnivores. While rabies vaccines are inactivated and thus have an excellent safety profile and high stability, live-attenuated CDV vaccines can retain residual virulence in highly susceptible species. Here we generated recombinant inactivated rabies viruses that carry one of the CDV glycoproteins on their surface. Ferrets immunized twice with a mix of recombinant rabies viruses carrying the CDV fusion and attachment glycoproteins were protected from lethal CDV challenge, whereas all animals that received

  14. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg

    NARCIS (Netherlands)

    B.C. Damien; S. Losch; J. Mossong; C.P. Muller (Claude); A.D.M.E. Osterhaus (Albert); B.E.E. Martina (Byron)

    2002-01-01

    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled

  15. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg.

    NARCIS (Netherlands)

    B.C. Damien; B.E.E. Martina (Byron); S. Losch; A.D.M.E. Osterhaus (Albert); C.P. Muller (Claude)

    2002-01-01

    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled

  16. Characterization of a novel Canine distemper virus causing disease in wildlife.

    Science.gov (United States)

    Pope, Jenny P; Miller, Debra L; Riley, Matthew C; Anis, Eman; Wilkes, Rebecca P

    2016-09-01

    Canine distemper virus (CDV) is a common cause of a multisystemic disease in both domestic dogs and wildlife species, including raccoons and foxes. Outbreaks of CDV in domestic dogs in eastern Tennessee have occurred since 2012, and it was determined that these outbreaks resulted from a novel genotype of CDV. We hypothesized that this virus is also infecting area wildlife and may be a source of the virus for these outbreaks in dogs. From 2013 to 2014, autopsies were performed and tissues collected from raccoons (Procyon lotor; n = 50) and gray foxes (Urocyon cinereoargenteus; n = 8) for CDV testing. A real-time reverse transcription PCR was used to document the presence of CDV in tissue samples, and a portion of the virus was subsequently sequenced for phylogenetic analysis. A high percentage of wildlife, both with (86%) and without (55%) clinical signs, tested positive for CDV, with the majority (77%) testing positive for the novel genotype. Microscopic findings, including syncytia in the lungs and viral inclusion bodies in urothelium, astrocytes, neurons, and bronchiolar epithelium, were also consistent with canine distemper. Minimal inflammation in the central nervous system of affected animals was indicative of the acute neurologic form of the disease. Pneumonia and parasitism were also commonly found in CDV-infected animals. Based on these results, CDV appears to be prevalent in eastern Tennessee wildlife. Subclinical or clinically recovered shedders are a potential source of this novel genotype for domestic dogs, and this genotype is genetically distinct from vaccine strains. © 2016 The Author(s).

  17. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Genotyping of canine distemper virus strains circulating in Brazil from 2008 to 2012.

    Science.gov (United States)

    Budaszewski, Renata da Fontoura; Pinto, Luciane Dubina; Weber, Matheus Nunes; Caldart, Eloiza Teles; Alves, Christian Diniz Beduschi Travassos; Martella, Vito; Ikuta, Nilo; Lunge, Vagner Ricardo; Canal, Cláudio Wageck

    2014-02-13

    Canine distemper virus (CDV) is a major pathogen of dogs and represents a serious threat to both unvaccinated and vaccinated animals. This study surveyed dogs with or without clinical signs related to canine distemper from different regions of Brazil from 2008 to 2012. A total of 155 out of 386 animals were found to be CDV positive by RT-PCR; 37 (23.8%) dogs were asymptomatic at the time of sampling, and 90 (58%) displayed clinical signs suggestive of distemper. Nineteen (12.2%) dogs had a record of complete vaccination, 15 (9.6%) had an incomplete vaccination protocol, and 76 (49%) had no vaccination record. Based on the sequence analysis of the complete hemagglutinin gene of 13 samples, 12 of the strains were characterized as Genotype South America-I/Europe. Considering criteria of at least 95% nucleotide identity to define a genotype and 98% to define a subgenotype, South America-I/Europe sequences segregated into eight different phylogenetically well-defined clusters that circulated or co-circulated in distinct geographical areas. Together, these findings highlight the relevance of CDV infection in Brazilian dogs, demonstrate the predominance of one genotype in Brazil and support the need to intensify the current control measures. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Early life DNA vaccination with the H gene of Canine distemper virus induces robust protection against distemper

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2009-01-01

    Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...... demonstrate that early life DNA vaccination with the H gene of a CDV vaccine strain induced robust protective immunity against a recent wild type CDV....

  20. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  1. SLAM- and nectin-4-independent noncytolytic spread of canine distemper virus in astrocytes.

    Science.gov (United States)

    Alves, Lisa; Khosravi, Mojtaba; Avila, Mislay; Ader-Ebert, Nadine; Bringolf, Fanny; Zurbriggen, Andreas; Vandevelde, Marc; Plattet, Philippe

    2015-05-01

    Measles and canine distemper viruses (MeV and CDV, respectively) first replicate in lymphatic and epithelial tissues by using SLAM and nectin-4 as entry receptors, respectively. The viruses may also invade the brain to establish persistent infections, triggering fatal complications, such as subacute sclerosis pan-encephalitis (SSPE) in MeV infection or chronic, multiple sclerosis-like, multifocal demyelinating lesions in the case of CDV infection. In both diseases, persistence is mediated by viral nucleocapsids that do not require packaging into particles for infectivity but are directly transmitted from cell to cell (neurons in SSPE or astrocytes in distemper encephalitis), presumably by relying on restricted microfusion events. Indeed, although morphological evidence of fusion remained undetectable, viral fusion machineries and, thus, a putative cellular receptor, were shown to contribute to persistent infections. Here, we first showed that nectin-4-dependent cell-cell fusion in Vero cells, triggered by a demyelinating CDV strain, remained extremely limited, thereby supporting a potential role of nectin-4 in mediating persistent infections in astrocytes. However, nectin-4 could not be detected in either primary cultured astrocytes or the white matter of tissue sections. In addition, a bioengineered "nectin-4-blind" recombinant CDV retained full cell-to-cell transmission efficacy in primary astrocytes. Combined with our previous report demonstrating the absence of SLAM expression in astrocytes, these findings are suggestive for the existence of a hitherto unrecognized third CDV receptor expressed by glial cells that contributes to the induction of noncytolytic cell-to-cell viral transmission in astrocytes. While persistent measles virus (MeV) infection induces SSPE in humans, persistent canine distemper virus (CDV) infection causes chronic progressive or relapsing demyelination in carnivores. Common to both central nervous system (CNS) infections is that

  2. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

    Science.gov (United States)

    Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

  3. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Directory of Open Access Journals (Sweden)

    Jonathan H Epstein

    Full Text Available Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus, Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1 canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2 Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8 and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7. In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3 and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83. Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  4. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Science.gov (United States)

    Epstein, Jonathan H; Baker, Michelle L; Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A; Dubovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D; Davies, Angela J; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  5. Experimental canine distemper infection as a means of demonstrating latent effects of subacute lead intoxication

    Energy Technology Data Exchange (ETDEWEB)

    White, D.J.; McLeod, S.

    1976-01-01

    Observations on the response of the body to experimental infection with distemper virus in dogs previously dosed subacutely with lead have demonstrated a latent effect of lead on several body systems. Effects which indicated a relationship to earlier treatment with lead included evidence for stimulation of haemoglobin synthesis, changes to red blood cells resulting in increased destruction, increased vulnerability of the parenchymatous cells of the liver to damage, reduction in the weight of the skeleton and thyroid, an increase in weight of the thymus and brain and histopathological changes in the thymus. 21 references, 2 figures, 1 table.

  6. In vitro antiviral efficacy of caffeic acid against canine distemper virus.

    Science.gov (United States)

    Wu, Zong-Mei; Yu, Zhen-Jiang; Cui, Zhen-Qiang; Peng, Lu-Yuan; Li, Hao-Ran; Zhang, Chun-Lei; Shen, Hai-Qing; Yi, Peng-Fei; Fu, Ben-Dong

    2017-09-01

    Canine distemper (CD) is a highly contagious disease caused by the canine distemper virus (CDV), and mortality can be as high as 100%. However, there is no specific treatment for CD. In this study, the antiviral activity of the caffeic acid against CDV was evaluated in vitro. The results showed that the IC 50 of the caffeic acid against CDV at 1 and 2 h post infection (PI) is 23.3 and 32.3 μg/mL, respectively. Consistently, at 1 and 2 h PI, the caffeic acid exhibited a reduced (23.3-57.0% and 37.2-38.1%) viral inhibitory effect in vero cells. Furthermore, the caffeic acid plus Ribavirin (RBV) has greater antiviral activity against CDV than the caffeic acid or RBV individually. In addition, the caffeic acid reduced the total viral RNA synthesis by 59-86% at 24-72 h. Therefore, our data provided the experimental evidence that the caffeic acid effectively inhibited CDV infection in vero cells, which may potentially be used to treat clinical disease associated with CDV infection. Copyright © 2017. Published by Elsevier Ltd.

  7. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  8. Demyelination precedes oligodendrocyte loss in canine distemper virus-induced encephalitis.

    Science.gov (United States)

    Schobesberger, M; Zurbriggen, A; Doherr, M G; Weissenböck, H; Vandevelde, M; Lassmann, H; Griot, C

    2002-01-01

    Canine distemper virus (CDV), a negative-stranded RNA morbillivirus, causes a persistent infection within the central nervous system resulting in a progressive, multifocal demyelinating disease. Demyelination is thought to be caused by a selective alteration of the myelin-producing oligodendrocytes. Metabolic impairment and morphological changes of the oligodendrocytes after CDV infection have previously been observed in vitro as well as in vivo. Until now it has been suggested that the oligodendrocytes completely disappear from CDV-induced demyelinating lesions. However, ultrastructural analysis in brain tissue sections and immunohistochemical examination of oligodendrocytes in dog brain cell cultures contradicted these observations. In this study oligodendrocytes from different categories of CDV-induced lesions were examined by in situ hybridization for proteolipid protein mRNA and--as a new tool employed on canine brain tissue sections--by immunohistochemistry using a monoclonal antibody against 2',3'-cyclic nucleotide 3'-phosphodiesterase, a myelin-specific enzyme. A down-regulation in the myelin gene transcription was detected already before demyelination occurred. However, a decrease in the number of oligodendrocytes was not observed until demyelination became evident. Although there was further depletion of oligodendrocytes in plaques with progressive demyelination, we demonstrated for the first time that these cells were still present in a significant amount even in chronic, completely demyelinated distemper lesions.

  9. In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.

    Science.gov (United States)

    Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo

    2014-10-01

    Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.

  10. Toxoplasmosis in distemper virus infected dogs/ Toxoplasmose em cães co-infectados com o vírus da cinomose

    Directory of Open Access Journals (Sweden)

    Aristeu Vieira da Silva

    2002-05-01

    Full Text Available This report shows four cases of dog´s toxoplasmosis, pointing that the neurologic signalment of toxoplasmosis and distemper is quite indistinguishable. The anmnestic data of flesh-eating and cat contact is linked with easier suspect of toxoplasmosis, reinforced by the presence of linfadenopathy, pneumonia and neurologic signs. A treatment proposal is offered, being a preventive measure to toxoplasmosis in distemper dogs, according to the clinician diagnostic conditions.Relatam-se quatro casos de toxoplasmose em cães, evidenciando-se a sintomatologia nervosa indistinguível daquela causada pela cinomose de forma isolada e mostrando a ocorrência concomitante das duas enfermidades. Sugere-se que os dados de anamnese, como hábitos de carnivorismo e contato com gatos, aliados a sinais clínicos como linfadenopatia, pneumonia, secreção ocular purulenta e distúrbios neurológicos, favoreçam a suspeita clínica de toxoplasmose. Propõe-se um tratamento, preventivo para a toxoplasmose, nos cães com cinomose, baseado nas condições de diagnóstico disponíveis pelo clínico.

  11. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny Infecção pelo vírus da cinomose canina em um furão (Galictis cuja: primeiro relato e filogenia viral

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2013-02-01

    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.Doenças infecciosas em animais selvagens têm aumentado devido às alterações em seu habitat e ao maior contato com animais domésticos. A cinomose já foi descrita em diversas espécies de carnívoros selvagens, representando uma ameaça à conservação da vida selvagem. Nesse estudo é descrito o primeiro caso de infecção pelo vírus da cinomose em um furão (Galictis cuja. Um indivíduo de vida livre, sem sinais clínicos aparentes, apresentou morte súbita após um dia em cativeiro. Foi realizado o diagnóstico molecular para detecção do vírus da cinomose canina, sendo o resultado positivo. A filogenia do vírus indicou que cães domésticos foram a provável fonte de infecção.

  12. Recombinant canine distemper virus strain snyder hill expressing green or red fluorescent proteins causes meningoencephalitis in the ferret

    NARCIS (Netherlands)

    M. Ludlow (Martin); D.T. Nguyen (Tien); D. Silin; O. Lyubomska; R.D. de Vries (Rory); V. von Messling; S. McQuaid (Stephen); R.L. de Swart (Rik); W.P. Duprex (Paul)

    2012-01-01

    textabstractThe propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDVSH) and show that this virus rapidly

  13. SEROLOGIC RESPONSE TO CANINE DISTEMPER VACCINATION IN CAPTIVE LINNAEUS'S TWO-TOED SLOTHS ( CHOLOEPUS DIDACTYLUS) AFTER A FATAL CANINE DISTEMPER VIRUS OUTBREAK.

    Science.gov (United States)

    Sheldon, Julie D; Cushing, Andrew C; Wilkes, Rebecca P; Anis, Eman; Dubovi, Edward J

    2017-12-01

    Canine distemper virus (CDV) affects many wild and captive, nondomestic species worldwide but has not been previously reported in Xenarthra. Paucity of information on vaccination safety and efficacy presents challenges for disease prevention in captive collections. CDV infections and subsequent mortalities in five captive Linnaeus's two-toed sloths ( Choloepus didactylus) in eastern Tennessee are reported. Clinical signs included oculonasal discharge, oral ulcerations, and diarrhea, and the diagnosis was confirmed by necropsy, histopathology, immunohistochemistry, virus isolation, and polymerase chain reaction. Viral sequencing identified the strain to be consistent with a new CDV lineage currently affecting domestic dogs and wildlife in Tennessee. Seven sloths were examined and vaccinated using a recombinant CDV vaccine on days 0 and 21. Subsequent blood samples showed increased titers in 3/4 sloths. Based on the outbreak and serologic findings postvaccination without adverse effects, the authors recommend recombinant CDV vaccination in sloths exposed to known carriers of CDV.

  14. CANINE DISTEMPER VIRUS ANTIBODY TITERS IN DOMESTIC CATS AFTER DELIVERY OF A LIVE ATTENUATED VIRUS VACCINE.

    Science.gov (United States)

    Ramsay, Edward; Sadler, Ryan; Rush, Robert; Seimon, Tracie; Tomaszewicz, Ania; Fleetwood, Ellen A; McAloose, Denise; Wilkes, Rebecca P

    2016-06-01

    Three methods for delivering a live attenuated canine distemper virus (CDV) vaccine to domestic cats ( Felis catus ) were investigated, as models for developing vaccination protocols for tigers (Panthera tigris). Twenty domestic cats were randomly divided into four treatment groups: saline injection (negative controls); and oral, intranasal, and subcutaneous vaccinates. Cats were injected with saline or a CDV vaccine (Nobivac DP, Merck) at wk 0 and 4. Blood and nasal swabs were collected at wk 0 (prior to the initial vaccination) and weekly thereafter for 9 wk. Urine samples were collected on wk 1 to 9 after initial vaccination. Forty-nine weeks following the initial vaccination series, three cats from the subcutaneous group and three cats from the intranasal group were revaccinated. Blood was collected immediately prior, and 7 and 21 days subsequent to revaccination. Nasal swabs and urine samples were collected from each cat prior to wk 49 revaccination and daily for 7 days thereafter. Nasal swabs and urine were analyzed by quantitative PCR for vaccine virus presence. Sera were tested for CDV antibodies by virus neutralization. All cats were sero-negative for CDV antibodies at the beginning of the study, and saline-injected cats remained sero-negative throughout the study. A dramatic anamnestic response was seen following wk 4 subcutaneous vaccinations, with titers peaking at wk 6 (geometric mean = 2,435.5). Following wk 49 revaccination, subcutaneous vaccinates again mounted impressive titers (wk 52 geometric mean = 2,048). Revaccination of the intranasal group cats at wk 49 produced a small increase in titers (wk 52 geometric mean = 203). CDV viral RNA was detected in six nasal swabs but no urine samples, demonstrating low viral shedding postvaccination. The strong antibody response to subcutaneous vaccination and the lack of adverse effects suggest this vaccine is safe and potentially protective against CDV infection in domestic cats.

  15. Distemper virus as a cause of central nervous disease and death in badgers (Meles meles) in Denmark

    DEFF Research Database (Denmark)

    Hammer, Anne Sofie; Dietz, H. H.; Andersen, T. H.

    2004-01-01

    During the summer of 2002 a distemper-like disease was observed in the free-ranging badger population in Denmark. It was characterised by grand seizures, abnormal behaviour and death; the badgers all had severe chronic pneumonia and some had non-suppurative encephalomyelitis. in this study, eight...... of the affected badgers were examined by gross pathological, histological, immunohistological, bacteriological, parasitological and virological methods, and were diagnosed with distemper; canine distemper virus was identified....

  16. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden

    2002-07-01

    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  17. Canine distemper virus-immune complexes induce bystander degeneration of oligodendrocytes.

    Science.gov (United States)

    Botteron, C; Zurbriggen, A; Griot, C; Vandevelde, M

    1992-01-01

    Demyelination in chronic canine distemper encephalitis may be the result of a bystander effect in which the antiviral immune response is involved. In the present report we demonstrate that canine distemper virus-antiviral antibody immune complexes induce oligodendroglial degeneration in mixed brain cell cultures, particularly at the level of the cell processes. The involvement of macrophages as effector cells in this process was confirmed by depletion of these cells from the cultures which prevented the immune complex-mediated oligodendroglial degeneration. Canine distemper virus-immune complex-induced oligodendroglial pathology is thought to be mediated by toxic factors released from stimulated macrophages, this bystander effect demonstrated here in vitro may be relevant to the mechanisms of demyelination in vivo, in which virus persistence plays an important role.

  18. Canine Distemper Virus in Wild Felids of Costa Rica.

    Science.gov (United States)

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

    2016-04-28

    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

  19. Viral Oncolysis — Can Insights from Measles Be Transferred to Canine Distemper Virus?

    Directory of Open Access Journals (Sweden)

    Stefanie Lapp

    2014-06-01

    Full Text Available Neoplastic diseases represent one of the most common causes of death among humans and animals. Currently available and applied therapeutic options often remain insufficient and unsatisfactory, therefore new and innovative strategies and approaches are highly needed. Periodically, oncolytic viruses have been in the center of interest since the first anecdotal description of their potential usefulness as an anti-tumor treatment concept. Though first reports referred to an incidental measles virus infection causing tumor regression in a patient suffering from lymphoma several decades ago, no final treatment concept has been developed since then. However, numerous viruses, such as herpes-, adeno- and paramyxoviruses, have been investigated, characterized, and modified with the aim to generate a new anti-cancer treatment option. Among the different viruses, measles virus still represents a highly interesting candidate for such an approach. Numerous different tumors of humans including malignant lymphoma, lung and colorectal adenocarcinoma, mesothelioma, and ovarian cancer, have been studied in vitro and in vivo as potential targets. Moreover, several concepts using different virus preparations are now in clinical trials in humans and may proceed to a new treatment option. Surprisingly, only few studies have investigated viral oncolysis in veterinary medicine. The close relationship between measles virus (MV and canine distemper virus (CDV, both are morbilliviruses, and the fact that numerous tumors in dogs exhibit similarities to their human counterpart, indicates that both the virus and species dog represent a highly interesting translational model for future research in viral oncolysis. Several recent studies support such an assumption. It is therefore the aim of the present communication to outline the mechanisms of morbillivirus-mediated oncolysis and to stimulate further research in this potentially expanding field of viral oncolysis in a highly

  20. Viral Oncolysis — Can Insights from Measles Be Transferred to Canine Distemper Virus?

    Science.gov (United States)

    Lapp, Stefanie; Pfankuche, Vanessa M.; Baumgärtner, Wolfgang; Puff, Christina

    2014-01-01

    Neoplastic diseases represent one of the most common causes of death among humans and animals. Currently available and applied therapeutic options often remain insufficient and unsatisfactory, therefore new and innovative strategies and approaches are highly needed. Periodically, oncolytic viruses have been in the center of interest since the first anecdotal description of their potential usefulness as an anti-tumor treatment concept. Though first reports referred to an incidental measles virus infection causing tumor regression in a patient suffering from lymphoma several decades ago, no final treatment concept has been developed since then. However, numerous viruses, such as herpes-, adeno- and paramyxoviruses, have been investigated, characterized, and modified with the aim to generate a new anti-cancer treatment option. Among the different viruses, measles virus still represents a highly interesting candidate for such an approach. Numerous different tumors of humans including malignant lymphoma, lung and colorectal adenocarcinoma, mesothelioma, and ovarian cancer, have been studied in vitro and in vivo as potential targets. Moreover, several concepts using different virus preparations are now in clinical trials in humans and may proceed to a new treatment option. Surprisingly, only few studies have investigated viral oncolysis in veterinary medicine. The close relationship between measles virus (MV) and canine distemper virus (CDV), both are morbilliviruses, and the fact that numerous tumors in dogs exhibit similarities to their human counterpart, indicates that both the virus and species dog represent a highly interesting translational model for future research in viral oncolysis. Several recent studies support such an assumption. It is therefore the aim of the present communication to outline the mechanisms of morbillivirus-mediated oncolysis and to stimulate further research in this potentially expanding field of viral oncolysis in a highly suitable

  1. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H

    2009-01-01

    of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...

  2. Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA

    Directory of Open Access Journals (Sweden)

    Lednicky John A

    2004-09-01

    Full Text Available Abstract Background Mortality rates have differed during distemper outbreaks among free-ranging raccoons (Procyon lotor living around a large Chicago-area zoo, and appeared higher in year 2001 than in 1998 and 2000. We hypothesized that a more lethal variant of the local Canine distemper virus (CDV lineage had emerged in 2001, and sought the genetic basis that led to increased virulence. However, a more complex model surfaced during preliminary analyses of CDV genomic sequences in infected tissues and of virus isolated in vitro from the raccoons. Results Phylogenetic analyses of subgenomic CDV fusion (F -, phosphoprotein (P -, and complete hemagglutinin (H – gene sequences indicated that distinct American CDV lineages caused the distemper epizootics. The 1998 outbreak was caused by viruses that are likely from an old CDV lineage that includes CDV Snyder Hill and Lederle, which are CDV strains from the early 1950's. The 2000 and 2001 viruses appear to stem from the lineage of CDV A75/17, which was isolated in the mid 1970's. Only the 2001 viruses formed large syncytia in brain and/or lung tissue, and during primary isolation in-vitro in Vero cells, demonstrating at least one phenotypic property by which they differed from the other viruses. Conclusions Two different American CDV lineages caused the raccoon distemper outbreaks. The 1998 viruses are genetically distant to the 2000/2001 viruses. Since CDV does not cause persistent infections, the cycling of different CDV lineages within the same locale suggests multiple reintroductions of the virus to area raccoons. Our findings establish a precedent for determining whether the perceived differences in mortality rates are actual and attributable in part to inherent differences between CDV strains arising from different CDV lineages.

  3. Evidence of Two Cocirculating Canine Distemper Virus Strains in Mesocarnivores from Northern Colorado.

    Science.gov (United States)

    Wostenberg, Darren J; Walker, Nikki; Fox, Karen A; Spraker, Terry R; Piaggio, Antoinette J; Gilbert, Amy

    2018-03-02

    Canine distemper virus (CDV) is a highly contagious pathogen that principally infects wildlife and domestic carnivores. Peridomestic species such as raccoons ( Procyon lotor) experience outbreaks with high mortality. Clinical signs of infection include anorexia, fever, respiratory infection, and neurologic complications. Although not zoonotic, CDV poses a high risk to unvaccinated domestic animals and the conservation of endangered species. During 2013-2016, we opportunistically collected wild and domestic carnivore specimens through a rabies surveillance program in northern Colorado. Brainstem and cerebellar tissue samples were independently tested for rabies and CDV by fluorescent antibody test. We tested a total of 478 animals for CDV, comprised of 10 wild and domestic carnivore species. A total of 24% (71/300) raccoons and 4% (1/26) coyotes ( Canis latrans) tested positive for CDV, but coinfection with rabies virus was not observed among CDV-positive animals. We extracted RNA from positive tissues, and a reverse-transcription PCR was used to create complementary DNA. We amplified and sequenced the hemagglutinin gene from 60 CDV-positive tissues, and a median joining network and maximum likelihood phylogenetic tree revealed two major lineages among samples. Phylogenetic analysis indicated that our sequences were most similar to: 1) the America-2 ( n=55) and 2) the America-3 ( n=5) CDV lineages circulating in North America. Our results indicated two distinct and distantly related clades of CDV overlapping geographically and temporally among raccoon populations in northern Colorado.

  4. Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

    Directory of Open Access Journals (Sweden)

    Yamaguchi Ryoji

    2009-10-01

    Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

  5. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

    Science.gov (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

    2015-04-17

    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Expression of canine distemper virus receptor nectin-4 in the central nervous system of dogs.

    Science.gov (United States)

    Pratakpiriya, Watanyoo; Ping Teh, Angeline Ping; Radtanakatikanon, Araya; Pirarat, Nopadon; Thi Lan, Nguyen; Takeda, Makoto; Techangamsuwan, Somporn; Yamaguchi, Ryoji

    2017-03-23

    Canine distemper virus (CDV) exhibits lymphotropic, epitheliotropic, and neurotropic nature, and causes a severe systemic infection in susceptible animals. Initially, signaling lymphocyte activation molecule (SLAM) expressed on immune cells has been identified as a crucial cellular receptor for CDV. Currently, nectin-4 expressed in epithelia has been shown to be another receptor for CDV. Our previous study demonstrated that neurons express nectin-4 and are infected with CDV. In this study, we investigated the distribution pattern of nectin-4 in various cell types in the canine central nervous system and showed its relation to CDV infection to further clarify the pathology of disease. Histopathological, immunohistochemical and immunofluorescent analyses were done using formalin-fixed paraffin-embedded tissues of CDV-infected dogs. Dual staining of nectin-4 and CDV antigen or nectin-4 and brain cell markers was performed. Nectin-4 was detected in ependymal cells, epithelia of choroid plexus, meningeal cells, neurons, granular cells, and Purkinje's cells. CDV antigens were detected in these nectin-4-positive cells, further suggesting contribution of nectin-4 for the CDV neurovirulence. On the other hand, astrocytes did not express nectin-4, although they were frequently infected with CDV. Since astrocytes are negative for SLAM expression, they must express an unidentified CDV receptor, which also contributes to CDV neurovirulence.

  7. Complete Genomic Sequence of Canine Distemper Virus from an Ethiopian Wolf.

    Science.gov (United States)

    Marston, Denise A; Watson, Jemma; Wise, Emma L; Ellis, Richard J; Bedin, Eric; Ayalew, Girma; Abute, Muktar; de Lamballerie, Xavier; Fooks, Anthony R; Sillero-Zubiri, Claudio; Banyard, Ashley C

    2017-07-20

    Canine distemper virus (CDV) has been implicated in population declines of wildlife, including many threatened species. Here we present the full genome of CDV from an Ethiopian wolf, Canis simensis , the world's rarest and most endangered canid. © Crown copyright 2017.

  8. Complete Genomic Sequence of Canine Distemper Virus from an Ethiopian Wolf

    Science.gov (United States)

    Watson, Jemma; Wise, Emma L.; Ellis, Richard J.; Bedin, Eric; Ayalew, Girma; Abute, Muktar; de Lamballerie, Xavier; Fooks, Anthony R.; Sillero-Zubiri, Claudio; Banyard, Ashley C.

    2017-01-01

    ABSTRACT Canine distemper virus (CDV) has been implicated in population declines of wildlife, including many threatened species. Here we present the full genome of CDV from an Ethiopian wolf, Canis simensis, the world’s rarest and most endangered canid. PMID:28729263

  9. Avaliação da urina e de leucócitos como amostras biológicas para a detecção ante mortem do vírus da cinomose canina por RT-PCR em cães naturalmente infectados Evaluation of the urine and leucocytes as biological samples for ante mortem detection of canine distemper virus by RT-PCR assay in naturally infected dogs

    Directory of Open Access Journals (Sweden)

    F.J. Negrão

    2007-02-01

    Full Text Available Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of the canine distemper virus (CDV by a reverse transcription-polymerase chain reaction (RT-PCR assay. One hundred and eighty eight dogs with clinical symptoms of distemper, were distributed in three groups. The group A was constituted of 93 dogs with systemic signs of distemper; the group B by 11 dogs with neurological signs, and the group C by 84 dogs that presented simultaneously systemic and neurological signs. In 66.5% (125/188 of the dogs was amplified an amplicon with 287 base pair of the CDV nucleoprotein gene. In 60.8% (76/125 of the animals the CDV was detected simultaneously in the urine and leucocytes, and in 39.2% (49/125 of the dogs just a type of clinical sample (urine: n=37; leucocytes: n=12 was positive. These results demonstrate that the different forms of clinical distemper disease can hinder the choice of only one type of clinical sample to carry out the ante mortem etiological diagnosis of CDV infection, and false-negative results can be generated.

  10. Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

    Science.gov (United States)

    Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

    2015-10-01

    Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

  11. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.

    Science.gov (United States)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete

    2015-03-10

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Development and characterization of neutralizing monoclonal antibodies against canine distemper virus hemagglutinin protein.

    Science.gov (United States)

    Bi, Zhenwei; Xia, Xingxia; Wang, Yongshan; Mei, Yongjie

    2015-04-01

    Canine distemper virus (CDV) causes a serious multisystemic disease in dogs and other carnivora. Hemagglutinin (H) protein-specific antibodies are mainly responsible for protective immunity against CDV infection. In the present study, six neutralizing MAbs to the H protein of CDV were newly obtained and characterized by immunizing BALB/c mice with a recent Chinese field isolate. Competitive binding inhibition assay revealed that they recognized four distinct antigenic regions of the H protein. Immunofluorescence assay and western blotting showed that all MAbs recognize the conformational rather than the linear epitopes of the H protein. Furthermore, in immunofluorescence and virus neutralization assays, two of the MAbs were found to react only with the recent Chinese field isolate and not with older CDV strains, including vaccine strain Onderstepoort, indicating there are neutralization-related antigenic variations between the recent Chinese field isolate and the older CDV strains examined in this study. The newly established MAbs are useful for differentiating the expanding CDV strains and could be used in immunotherapy and immunodiagnosis against infection with CDV. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.

  13. CANINE DISTEMPER VIRUS IN A WILD FAR EASTERN LEOPARD ( PANTHERA PARDUS ORIENTALIS).

    Science.gov (United States)

    Sulikhan, Nadezhda S; Gilbert, Martin; Blidchenko, Ekaterina Yu; Naidenko, Sergei V; Ivanchuk, Galina V; Gorpenchenko, Tatiana Yu; Alshinetskiy, Mikhail V; Shevtsova, Elena I; Goodrich, John M; Lewis, John C M; Goncharuk, Mikhail S; Uphyrkina, Olga V; Rozhnov, Vyatcheslav V; Shedko, Sergey V; McAloose, Denise; Miquelle, Dale G

    2018-01-01

    The critically endangered population of Far Eastern leopards ( Panthera pardus orientalis) may number as few as 60 individuals and is at risk from stochastic processes such as infectious disease. During May 2015, a case of canine distemper virus (CDV) was diagnosed in a wild leopard exhibiting severe neurologic disease in the Russian territory of Primorskii Krai. Amplified sequences of the CDV hemagglutinin gene and phosphoprotein gene aligned within the Arctic-like clade of CDV, which includes viruses from elsewhere in Russia, China, Europe, and North America. Histologic examination of cerebral tissue revealed perivascular lymphoid cuffing and demyelination of the white matter consistent with CDV infection. Neutralizing antibodies against CDV were detected in archived serum from two wild Far Eastern leopards sampled during 1993-94, confirming previous exposure in the population. This leopard population is likely too small to maintain circulation of CDV, suggesting that infections arise from spillover from more-abundant domestic or wild carnivore reservoirs. Increasing the population size and establishment of additional populations of leopards would be important steps toward securing the future of this subspecies and reducing the risk posed by future outbreaks of CDV or other infectious diseases.

  14. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    Directory of Open Access Journals (Sweden)

    Sudarisman

    2006-03-01

    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  15. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  16. The V protein of canine distemper virus is required for virus replication in human epithelial cells.

    Directory of Open Access Journals (Sweden)

    Noriyuki Otsuki

    Full Text Available Canine distemper virus (CDV becomes able to use human receptors through a single amino acid substitution in the H protein. In addition, CDV strains possessing an intact C protein replicate well in human epithelial H358 cells. The present study showed that CDV strain 007Lm, which was isolated from lymph node tissue of a dog with distemper, failed to replicate in H358 cells, although it possessed an intact C protein. Sequence analyses suggested that a cysteine-to-tyrosine substitution at position 267 of the V protein caused this growth defect. Analyses using H358 cells constitutively expressing the CDV V protein showed that the V protein with a cysteine, but not that with a tyrosine, at this position effectively blocked the interferon-stimulated signal transduction pathway, and supported virus replication of 007Lm in H358 cells. Thus, the V protein as well as the C protein appears to be functional and essential for CDV replication in human epithelial cells.

  17. Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

    Science.gov (United States)

    Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

    2015-05-15

    Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Ribavirin and boceprevir are able to reduce Canine distemper virus growth in vitro.

    Science.gov (United States)

    Lanave, Gianvito; Cavalli, Alessandra; Martella, Vito; Fontana, Tommaso; Losappio, Ruggero; Tempesta, Maria; Decaro, Nicola; Buonavoglia, Domenico; Camero, Michele

    2017-10-01

    Canine distemper virus (CDV) is a major infectious disease of dogs. Although vaccines were successful to control CDV spread in canine population, the disease is still common and may pose a threat to unvaccinated dogs. In the attempt to develop specific anti-viral therapeutic tools, the efficacy of several molecules against CDV has been investigated in vitro. In this study the antiviral efficacy in vitro against CDV of ribavirin and boceprevir alone or in combination was evaluated. CDV growth in VERO cells was inhibited by ribavirin, by boceprevir and by a combination of the two molecules at non-cytotoxic concentrations, as evaluated by end-point viral titration in cell monolayers and by quantification of viral RNA using quantitative RT-PCR. By end-point titration, a statistically significant reduction in CDV replication was observed only using ribavirin and boceprevir in combination. By quantitative RT-PCR, a significant reduction of viral growth was observed either in cells treated with ribavirin or boceprevir or with both the two molecules. The association of ribavirin or boceprevir was able to decrease CDV growth by up to 3.4458 logs with respect to untreated infected cells, chiefly at the highest virus dilutions. The results obtained in this study may constitute an important basis for the development of CDV therapies. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2015-01-01

    with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected...... against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces......Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

  20. Analisis Faktor Risiko Penyakit Distemper pada Anjing di Denpasar

    Directory of Open Access Journals (Sweden)

    I Gusti Made Krisna Erawan

    2009-09-01

    Full Text Available A study was conducted to identify the risk factors of canine distemper in Denpasar, Bali. Risk factorsfor canine distemper were characterized using hospital records of private veterinary practitioners. Thisstudy showed that there was no difference in the susceptibility to canine distemper virus infection betweenmales and females. The occurrence of canine distemper disease is not significantly affected by the season.The risk of canine distemper disease for young dogs, between 0 and 1 year was 4.95-fold increase ascompared the risk of disease for dogs that were older than 1 year (Oods-Ratio: 4.95. Incomplete vaccinationwas associated with a 3.77-fold increase in the risk of canine distemper (Oods-Ratio: 3.77.

  1. Toxoplasma gondii genotyping in a dog co-infected with distemper virus and ehrlichiosis rickettsia Genotipagem de Toxoplasma gondii em cão co-infectado com o vírus da cinomose e a rickettsia da erliquiose

    Directory of Open Access Journals (Sweden)

    Leandro d'Arc Moretti

    2006-12-01

    Full Text Available This paper reports a toxoplasmosis, erhlichiosis and distemper co-infection in a dog with an exuberant neuropathological clinical picture. Primary involvement was discussed based on information collected in the analysis of the clinical case, such as neurological impairment, epidemiological data, poor immunoprophylactic scheme of the dog affected and the role of these diseases on immunosuppression. Canine distemper and ehrlichiosis were diagnosed based on epidemiologic data, clinical signs, hematological and cytological evaluation. Toxoplasma gondii was isolated and genetically characterized as Type I using restriction analysis (RFLP with SAG-2 genes. Immunosuppression features of both dogs and human beings are discussed, as well as implications on animal and public health. This is the first report on toxoplasmosis, ehrlichiosis and distemper co-infection in a dog in Brazil, associated with genotyping determination of the T. gondii strain involved.Este artigo relata a co-infecção tripla pelos agentes da cinomose, erliquiose e toxoplasmose em um cão com acentuado quadro clínico neuropático. Discute-se a doença primária baseando-se em dados clínicos, epidemiológicos, no protocolo imunoprofilático inadequado e no papel daquelas doenças na imunossupressão. A cinomose e a erliquiose foram diagnosticadas mediante a situação epidemiológica da região e sinais clínicos compatíveis, aliados aos achados de hemograma e citologia. Utilizando-se a análise de restrição (RFLP com os genes SAG-2, caracterizou-se geneticamente a linhagem de Toxoplasma gondii isolada, como pertencente ao Tipo I. Discutem-se aspectos de imunossupressão, tanto em cães quanto em seres humanos, bem como suas implicações em saúde pública e animal. Este é o primeiro relato de infecção tripla pelos agentes da toxoplasmose, erliquiose e cinomose no Brasil, associado com a genotipificação da estirpe de T. gondii envolvida.

  2. Morbillivirus Experimental Animal Models: Measles Virus Pathogenesis Insights from Canine Distemper Virus.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; von Messling, Veronika

    2016-10-11

    Morbilliviruses share considerable structural and functional similarities. Even though disease severity varies among the respective host species, the underlying pathogenesis and the clinical signs are comparable. Thus, insights gained with one morbillivirus often apply to the other members of the genus. Since the Canine distemper virus (CDV) causes severe and often lethal disease in dogs and ferrets, it is an attractive model to characterize morbillivirus pathogenesis mechanisms and to evaluate the efficacy of new prophylactic and therapeutic approaches. This review compares the cellular tropism, pathogenesis, mechanisms of persistence and immunosuppression of the Measles virus (MeV) and CDV. It then summarizes the contributions made by studies on the CDV in dogs and ferrets to our understanding of MeV pathogenesis and to vaccine and drugs development.

  3. Morbillivirus Experimental Animal Models: Measles Virus Pathogenesis Insights from Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Renata da Fontoura Budaszewski

    2016-10-01

    Full Text Available Morbilliviruses share considerable structural and functional similarities. Even though disease severity varies among the respective host species, the underlying pathogenesis and the clinical signs are comparable. Thus, insights gained with one morbillivirus often apply to the other members of the genus. Since the Canine distemper virus (CDV causes severe and often lethal disease in dogs and ferrets, it is an attractive model to characterize morbillivirus pathogenesis mechanisms and to evaluate the efficacy of new prophylactic and therapeutic approaches. This review compares the cellular tropism, pathogenesis, mechanisms of persistence and immunosuppression of the Measles virus (MeV and CDV. It then summarizes the contributions made by studies on the CDV in dogs and ferrets to our understanding of MeV pathogenesis and to vaccine and drugs development.

  4. Canine distemper virus: an emerging disease in wild endangered Amur tigers (Panthera tigris altaica).

    Science.gov (United States)

    Seimon, Tracie A; Miquelle, Dale G; Chang, Tylis Y; Newton, Alisa L; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

    2013-08-13

    Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and reverse transcription-PCR (RT-PCR) were performed on tissues from 5 affected tigers that died or were destroyed in 2001, 2004, or 2010. Our results reveal canine distemper virus (CDV) infection as the cause of neurologic disease in two tigers and definitively establish infection in a third. Nonsuppurative encephalitis with demyelination, eosinophilic nuclear viral inclusions, and positive immunolabeling for CDV by IHC and ISH were present in the two tigers with available brain tissue. CDV phosphoprotein (P) and hemagglutinin (H) gene products were obtained from brains of these two tigers by RT-PCR, and a short fragment of CDV P gene sequence was detected in lymph node tissue of a third tiger. Phylogenetically, Amur tiger CDV groups with an Arctic-like strain in Baikal seals (Phoca siberica). Our results, which include mapping the location of positive tigers and recognition of a cluster of cases in 2010, coupled with a lack of reported CDV antibodies in Amur tigers prior to 2000 suggest wide geographic distribution of CDV across the tiger range and recent emergence of CDV as a significant infectious disease threat to endangered Amur tigers in the Russian Far East. Recognition of disease emergence in wildlife is a rare occurrence. Here, for the first time, we identify and characterize a canine distemper virus (CDV), the second most common cause of infectious disease death in domestic dogs and a viral disease of global importance in common and endangered carnivores, as the etiology of

  5. Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

    Directory of Open Access Journals (Sweden)

    Ryuichi Miura

    Full Text Available Canine distemper virus (CDV vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively. Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

  6. Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

    Science.gov (United States)

    Miura, Ryuichi; Kooriyama, Takanori; Yoneda, Misako; Takenaka, Akiko; Doki, Miho; Goto, Yasuyuki; Sanjoba, Chizu; Endo, Yasuyuki; Fujiyuki, Tomoko; Sugai, Akihiro; Tsukiyama-Kohara, Kyoko; Matsumoto, Yoshitsugu; Sato, Hiroki; Kai, Chieko

    2015-01-01

    Canine distemper virus (CDV) vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively). Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears) with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

  7. Detection of IgM antibodies against canine distemper virus in dog and mink sera employing enzyme-linked immunosorbent assay (ELISA).

    Science.gov (United States)

    Blixenkrone-Møller, M; Pedersen, I R; Appel, M J; Griot, C

    1991-01-01

    An enzyme-linked immunosorbent assay (ELISA) for the detection of IgM antibodies against canine distemper virus (CDV) in canine and mink serum is described. The diagnostic potential of this technique was evaluated by analyzing sera from natural or experimental infections in dog and mink and negative control sera. These results were compared with results obtained in the developed CDV IgG ELISA and in the virus neutralization test. The IgM test, which requires only a single serum specimen, is a useful method for diagnosing current or recent CDV infections in dog and mink.

  8. Utility of two modified-live virus canine distemper vaccines in wild-caught fishers (Martes pennanti).

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2016-12-01

    Canine distemper virus (CDV) infects families in the order Carnivora. As a preventive measure, vaccinations against CDV are frequently given to mustelids in captive environments. Our objectives were to compare the utility between two modified-live virus canine distemper vaccines (MLV CDV's), Fervac-D® (no longer manufactured) and Galaxy-D® (now manufactured by MSD Animal Health as part of a multivalent vaccine), in developing an immune response in wild-caught fishers. The Pennsylvania Fisher Reintroduction Project (PFRP) used 14 wild-caught fishers during one year of the project to evaluate the utility of vaccinations against CDV as part of any reintroduction project. Fishers were injected subcutaneously in the nape of the neck with their designated vaccine. Fervac-D® did not effectively stimulate development of a serologic antibody response, whereas Galaxy-D® had adequate seroconversion or rise of titer levels to suggest that the general use of MLV CDV may be suitable in fishers pending further studies. We recommend that future studies be conducted, evaluating the use of currently produced vaccines in fishers. Future research should also focus on the length of days required between administration of primary and booster vaccines to achieve sufficient immune response. If only primary doses are required, then hard-release reintroduction projects for fishers could be recommended. If primary and booster vaccines are required then soft-release reintroduction projects should be recommended that include captive management periods, allowing for appropriate vaccination intervals needed to maximize the probability of protection against CDV.

  9. Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

    Science.gov (United States)

    2013-01-01

    Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

  10. Infection studies in mink with seal-derived morbillivirus

    DEFF Research Database (Denmark)

    Blixenkrone-Møller, M; Svansson, V; Have, P.

    1989-01-01

    Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper.......Morbillivirus derived from diseased harbour seals (Phoca vitulina) has characteristics of acute virulent canine distemper virus infection in mink. The infection induced a disease resembling the acute systemic and nervous form of canine distemper....

  11. Canine distemper viral infection threatens the giant panda population in China.

    Science.gov (United States)

    Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

    2017-12-26

    We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas ( Ailuropoda melanoleuca ) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin ( H ) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population.

  12. Canine distemper viral infection threatens the giant panda population in China

    Science.gov (United States)

    Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

    2017-01-01

    We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas (Ailuropoda melanoleuca) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin (H) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population. PMID:29371956

  13. Canine distemper virus-associated encephalitis in free-living lynx (Lynx canadensis) and bobcats (Lynx rufus) of eastern Canada.

    Science.gov (United States)

    Daoust, Pierre-Yves; McBurney, Scott R; Godson, Dale L; van de Bildt, Marco W G; Osterhaus, Albert D M E

    2009-07-01

    Between 1993 and 1999, encephalitis caused by morbillivirus was diagnosed by immunohistochemistry and histology in six lynx (Lynx canadensis) and one bobcat (Lynx rufus) in the eastern Canadian provinces of New Brunswick and Nova Scotia. Five of the six cases in lynx occurred within an 11-mo period in 1996-97. A second bobcat with encephalitis caused by unidentified protozoa and a nematode larva also had immunohistochemical evidence of neurologic infection by morbillivirus. The virus was identified as canine distemper virus (CDV) by reverse transcriptase polymerase chain reaction and nucleotide sequencing in four of five animals from which frozen tissue samples were available, and it was isolated in cell culture from one of them. To our knowledge, this is the first report of disease caused by CDV in free-living felids in North America.

  14. Short communication. Occurrence of different Canine distemper virus lineages in Italian dogs

    Directory of Open Access Journals (Sweden)

    Andrea Balboni

    2014-09-01

    Full Text Available This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic‑like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic‑like‑CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

  15. Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.

    Science.gov (United States)

    Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z

    2015-04-10

    The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

  16. Homologous recombination is a force in the evolution of canine distemper virus.

    Science.gov (United States)

    Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing

    2017-01-01

    Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.

  17. Black-backed jackal exposure to rabies virus, canine distemper virus, and Bacillus anthracis in Etosha National Park, Namibia.

    Science.gov (United States)

    Bellan, Steve E; Cizauskas, Carrie A; Miyen, Jacobeth; Ebersohn, Karen; Küsters, Martina; Prager, K C; Van Vuuren, Moritz; Sabeta, Claude; Getz, Wayne M

    2012-04-01

    Canine distemper virus (CDV) and rabies virus (RABV) occur worldwide in wild carnivore and domestic dog populations and pose threats to wildlife conservation and public health. In Etosha National Park (ENP), Namibia, anthrax is endemic and generates carcasses frequently fed on by an unusually dense population of black-backed jackals (Canis mesomelas). Using serology, phylogenetic analyses (on samples obtained from February 2009-July 2010), and historical mortality records (1975-2011), we assessed jackal exposure to Bacillus anthracis (BA; the causal bacterial agent of anthrax), CDV, and RABV. Prevalence of antibodies against BA (95%, n = 86) and CDV (71%, n = 80) was relatively high, while that of antibodies against RABV was low (9%, n = 81). Exposure to BA increased significantly with age, and all animals >6 mo old were antibody-positive. As with BA, prevalence of antibodies against CDV increased significantly with age, with similar age-specific trends during both years of the study. No significant effect of age was found on the prevalence of antibodies against RABV. Three of the seven animals with antibodies against RABV were monitored for more than 1 yr after sampling and showed no signs of active infection. Mortality records revealed that rabid animals are destroyed nearly every year inside the ENP tourist camps. Phylogenetic analyses demonstrated that jackal RABV in ENP is part of the same transmission cycle as other dog-jackal RABV cycles in Namibia.

  18. Canine distemper virus as a threat to wild tigers in Russia and across their range.

    Science.gov (United States)

    Gilbert, Martin; Soutyrina, Svetlana V; Seryodkin, Ivan V; Sulikhan, Nadezhda; Uphyrkina, Olga V; Goncharuk, Mikhail; Matthews, Louise; Cleaveland, Sarah; Miquelle, Dale G

    2015-07-01

    Canine distemper virus (CDV) has recently been identified in populations of wild tigers in Russia and India. Tiger populations are generally too small to maintain CDV for long periods, but are at risk of infections arising from more abundant susceptible hosts that constitute a reservoir of infection. Because CDV is an additive mortality factor, it could represent a significant threat to small, isolated tiger populations. In Russia, CDV was associated with the deaths of tigers in 2004 and 2010, and was coincident with a localized decline of tigers in Sikhote-Alin Biosphere Zapovednik (from 25 tigers in 2008 to 9 in 2012). Habitat continuity with surrounding areas likely played an important role in promoting an ongoing recovery. We recommend steps be taken to assess the presence and the impact of CDV in all tiger range states, but should not detract focus away from the primary threats to tigers, which include habitat loss and fragmentation, poaching and retaliatory killing. Research priorities include: (i) recognition and diagnosis of clinical cases of CDV in tigers when they occur; and (ii) collection of baseline data on the health of wild tigers. CDV infection of individual tigers need not imply a conservation threat, and modeling should complement disease surveillance and targeted research to assess the potential impact to tiger populations across the range of ecosystems, population densities and climate extremes occupied by tigers. Describing the role of domestic and wild carnivores as contributors to a local CDV reservoir is an important precursor to considering control measures. © 2015 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.

  19. Delineating morbillivirus entry, dissemination and airborne transmission by studying in vivo competition of multicolor canine distemper viruses in ferrets.

    Science.gov (United States)

    de Vries, Rory D; Ludlow, Martin; de Jong, Alwin; Rennick, Linda J; Verburgh, R Joyce; van Amerongen, Geert; van Riel, Debby; van Run, Peter R W A; Herfst, Sander; Kuiken, Thijs; Fouchier, Ron A M; Osterhaus, Albert D M E; de Swart, Rik L; Duprex, W Paul

    2017-05-01

    Identification of cellular receptors and characterization of viral tropism in animal models have vastly improved our understanding of morbillivirus pathogenesis. However, specific aspects of viral entry, dissemination and transmission remain difficult to recapitulate in animal models. Here, we used three virologically identical but phenotypically distinct recombinant (r) canine distemper viruses (CDV) expressing different fluorescent reporter proteins for in vivo competition and airborne transmission studies in ferrets (Mustela putorius furo). Six donor ferrets simultaneously received three rCDVs expressing green, red or blue fluorescent proteins via conjunctival (ocular, Oc), intra-nasal (IN) or intra-tracheal (IT) inoculation. Two days post-inoculation sentinel ferrets were placed in physically separated adjacent cages to assess airborne transmission. All donor ferrets developed lymphopenia, fever and lethargy, showed progressively increasing systemic viral loads and were euthanized 14 to 16 days post-inoculation. Systemic replication of virus inoculated via the Oc, IN and IT routes was detected in 2/6, 5/6 and 6/6 ferrets, respectively. In five donor ferrets the IT delivered virus dominated, although replication of two or three different viruses was detected in 5/6 animals. Single lymphocytes expressing multiple fluorescent proteins were abundant in peripheral blood and lymphoid tissues, demonstrating the occurrence of double and triple virus infections. Transmission occurred efficiently and all recipient ferrets showed evidence of infection between 18 and 22 days post-inoculation of the donor ferrets. In all cases, airborne transmission resulted in replication of a single-colored virus, which was the dominant virus in the donor ferret. This study demonstrates that morbilliviruses can use multiple entry routes in parallel, and co-infection of cells during viral dissemination in the host is common. Airborne transmission was efficient, although transmission of

  20. Delineating morbillivirus entry, dissemination and airborne transmission by studying in vivo competition of multicolor canine distemper viruses in ferrets.

    Directory of Open Access Journals (Sweden)

    Rory D de Vries

    2017-05-01

    Full Text Available Identification of cellular receptors and characterization of viral tropism in animal models have vastly improved our understanding of morbillivirus pathogenesis. However, specific aspects of viral entry, dissemination and transmission remain difficult to recapitulate in animal models. Here, we used three virologically identical but phenotypically distinct recombinant (r canine distemper viruses (CDV expressing different fluorescent reporter proteins for in vivo competition and airborne transmission studies in ferrets (Mustela putorius furo. Six donor ferrets simultaneously received three rCDVs expressing green, red or blue fluorescent proteins via conjunctival (ocular, Oc, intra-nasal (IN or intra-tracheal (IT inoculation. Two days post-inoculation sentinel ferrets were placed in physically separated adjacent cages to assess airborne transmission. All donor ferrets developed lymphopenia, fever and lethargy, showed progressively increasing systemic viral loads and were euthanized 14 to 16 days post-inoculation. Systemic replication of virus inoculated via the Oc, IN and IT routes was detected in 2/6, 5/6 and 6/6 ferrets, respectively. In five donor ferrets the IT delivered virus dominated, although replication of two or three different viruses was detected in 5/6 animals. Single lymphocytes expressing multiple fluorescent proteins were abundant in peripheral blood and lymphoid tissues, demonstrating the occurrence of double and triple virus infections. Transmission occurred efficiently and all recipient ferrets showed evidence of infection between 18 and 22 days post-inoculation of the donor ferrets. In all cases, airborne transmission resulted in replication of a single-colored virus, which was the dominant virus in the donor ferret. This study demonstrates that morbilliviruses can use multiple entry routes in parallel, and co-infection of cells during viral dissemination in the host is common. Airborne transmission was efficient, although

  1. Canine Distemper Outbreak in Rhesus Monkeys, China

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

  2. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread.

    Science.gov (United States)

    Delpeut, Sebastien; Noyce, Ryan S; Richardson, Christopher D

    2014-04-01

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... susceptibility. (i) A constant virus-varying serum neutralization test in tissue culture using 50 to 300 TCID50.... 113.201 Section 113.201 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE..., Killed Virus, shall be prepared from virus-bearing cell culture fluids. Only Master Seed Virus which has...

  4. Emergence of canine distemper virus strains with modified molecular signature and enhanced neuronal tropism leading to high mortality in wild carnivores.

    Science.gov (United States)

    Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P

    2012-11-01

    An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.

  5. Climate extremes promote fatal co-infections during canine distemper epidemics in African lions.

    Science.gov (United States)

    Munson, Linda; Terio, Karen A; Kock, Richard; Mlengeya, Titus; Roelke, Melody E; Dubovi, Edward; Summers, Brian; Sinclair, Anthony R E; Packer, Craig

    2008-06-25

    Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV) epidemic in Serengeti lions (Panthera leo) coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five "silent" CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer). As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality events may become

  6. Climate extremes promote fatal co-infections during canine distemper epidemics in African lions.

    Directory of Open Access Journals (Sweden)

    Linda Munson

    Full Text Available Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV epidemic in Serengeti lions (Panthera leo coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five "silent" CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer. As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality

  7. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

    Directory of Open Access Journals (Sweden)

    Tan Bin

    2011-11-01

    Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  8. Epidemiological features and the neuropathological manifestations of canine distemper virus-induced infections in Brazil: a reviewAspectos epidemiológicos e as manifestações neuropatológicas associadas à infecção pelo vírus da cinomose canina no Brasil: uma revisão

    Directory of Open Access Journals (Sweden)

    Selwyn Arligton Headley

    2012-10-01

    Full Text Available This article provides a critical review of current epidemiological trends of canine distemper virus (CDV and syndromes related to canine distemper encephalitis (CDE with specific reference to the situation in Brazil. Epidemiological data relative to susceptible animal populations, prevalence, seasonal occurrence, and age-related patterns associated with CDV are discussed. The participation of mongrel dogs in maintaining CDV within rural and semi-urban canine populations and their importance in the epidemiology of canine distemper is highlighted. The economic impact of treating the clinical manifestations associated with CDV-induced infections in Brazil is estimated. Additionally, neurological and neuropathological manifestations of CDV in Brazil are discussed, and a novel manifestation of CDE is proposed. Esse manuscrito fornece uma revisão crítica das tendências epidemiológicas associadas ao vírus da cinomose canina (CDV e às síndromes relacionadas à encefalite por cinomose com referência específica à situação no Brasil. Os dados epidemiológicos relativos às populações de animais suscetíveis, prevalência, sazonalidade e os padrões relacionados à idade foram discutidos. Também é enfocada nessa revisão a participação de cães de rua na manutenção do CDV nas populações caninas nas áreas rurais e nas regiões semiurbanas e a sua importância na epidemiologia da cinomose. Foi ainda estimado o impacto econômico relacionado ao tratamento das manifestações clínicas associadas à cinomose no Brasil. Adicionalmente, as manifestações neurológicas e neuropatológicas da cinomose no Brasil são discutidas e uma manifestação neuropatológica inédita da infecção é sugerida.

  9. Transcriptional Changes in Canine Distemper Virus-Induced Demyelinating Leukoencephalitis Favor a Biphasic Mode of Demyelination

    Science.gov (United States)

    Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

    2014-01-01

    Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms “viral replication” and “humoral immune response” as well as down-regulated genes functionally related to “metabolite and energy

  10. Transcriptional changes in canine distemper virus-induced demyelinating leukoencephalitis favor a biphasic mode of demyelination.

    Directory of Open Access Journals (Sweden)

    Reiner Ulrich

    Full Text Available Canine distemper virus (CDV-induced demyelinating leukoencephalitis in dogs (Canis familiaris is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms "viral replication" and "humoral immune response" as well as down-regulated genes functionally related to "metabolite and energy

  11. Clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from Hungary to Switzerland

    OpenAIRE

    Willi, Barbara; Spiri, A M; Meli, Marina L; Grimm, Felix; Beatrice, Laura; Riond, Barbara; Bley, T; Jordi, R; Dennler, Matthias; Hofmann-Lehmann, Regina

    2015-01-01

    BACKGROUND Canine distemper virus (CDV) is a major pathogen of dogs and wild carnivores worldwide. In Switzerland, distemper in domestic dogs is rarely reported. In recent years, the import of dogs from Eastern Europe to Switzerland has steadily increased. In the present study, we describe a distemper outbreak in 15 rescue dogs that were imported from Hungary to Switzerland by an animal welfare organisation. The data on vaccination and medical history were recorded (14 dogs), and the samples...

  12. Influence of vaccine strains on the evolution of canine distemper virus.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; Streck, André Felipe; Nunes Weber, Matheus; Maboni Siqueira, Franciele; Muniz Guedes, Rafael Lucas; Wageck Canal, Cláudio

    2016-07-01

    Canine distemper virus (CDV) is a major dog pathogen belonging to the genus Morbillivirus of the family Paramyxoviridae. CDV causes disease and high mortality in dogs and wild carnivores. Although homologous recombination has been demonstrated in many members of Paramyxoviridae, these events have rarely been reported for CDV. To detect potential recombination events, the complete CDV genomes available in GenBank up to June 2015 were screened using distinct algorithms to detect genetic conversions and incongruent phylogenies. Eight putative recombinant viruses derived from different CDV genotypes and different hosts were detected. The breakpoints of the recombinant strains were primarily located on fusion and hemagglutinin glycoproteins. These results suggest that homologous recombination is a frequent phenomenon in morbillivirus populations under natural replication, and CDV vaccine strains might play an important role in shaping the evolution of this virus.

  13. Canine distemper infections, with special reference to South Africa, with a review of the literature : review article

    Directory of Open Access Journals (Sweden)

    A.L. Leisewitz

    2001-07-01

    Full Text Available Canine distemper virus is a member of the genus Morbillivirus of the family Paramyxoviridaethat causes severe disease in dogs and a range of wild mammals. The clinical signs relate essentially to the respiratory, gastrointestinal and central nervous systems. In South Africa, infection with Ehrlichia canis and canine parvovirus may present similarly. Many dogs will initially present with a wide range of central nervous system signs without any history of systemic disease. A recent South African study evaluating ante mortem diagnosis highlighted the importance of recognising clinical signs, cerebrospinal fluid IgG titres, serum IgM titres and immunocytochemistry of epithelial tissue. A 2-year retrospective evaluation of cerebrospinal fluid samples collected from dogs presented to the Onderstepoort Veterinary Academic Hospital indicates that distemper infection is common, and this disease should routinely be suspected in cases of diverse neurological disease in dogs. The South African dog population is specifically at high risk for the disease because of the large pool of unvaccinated, reproductively-active dogs that expose the wildlife resources of the country to risk of fatal disease. Outbreaks of disease in dogs continue to occur in developed and developing communities in both vaccinated and unvaccinated dogs worldwide, and have also been described in a wide range of free-ranging wildlife, including seals, dolphins and lions, and in endangered zoo animals. Modified live virus vaccines have contributed markedly to disease control in the dog population but have caused mortality in some wild carnivores. New recombinant vaccines are being developed that will be safe in wild animals. The pathogenesis of CNS demyelination has been compared to various important demyelinating diseases in humans and, amongst other things, relates to down-regulation of the oligodendrocyte gene coding for myelin synthesis and non-immunocyte CNS cell expression of type II

  14. Prevalence of phocine distemper virus specific antibodies: Bracing for the next seal epizootic in North-Western Europe

    NARCIS (Netherlands)

    R. Bodewes (Rogier); D. Morick; M.W.G. van de Bildt (Marco); N. Osinga (Nynke); A.R. García (Ana Rubio); G.J.S. Contreras (Guillermo J. Sánchez); S.L. Smits (Saskia); L.A. Reperant (Leslie); T. Kuiken (Thijs); A.D.M.E. Osterhaus (Albert)

    2013-01-01

    textabstractIn 1988 and 2002, two major phocine distemper virus (PDV) outbreaks occurred in harbour seals (Phoca vitulina) in north-western European coastal waters, causing the death of tens of thousands seals. Here we investigated whether PDV is still circulating among seals of the Dutch coastal

  15. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...... is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV....... The DNA vaccine-induced immunity protected the natural host against disease development....

  16. Detection of Arctic and European cluster of canine distemper virus in north and center of Iran.

    Science.gov (United States)

    Namroodi, Somayeh; Rostami, Amir; Majidzadeh-Ardebili, Keyvan; Ghalyanchi Langroudi, Arash; Morovvati, Abbas

    2015-01-01

    Canine distemper virus (CDV) creates a very contagious viral multi-systemic canine distemper (CD) disease that affects most species of Carnivora order. The virus is genetically heterogeneous, particularly in section of the hemagglutinin (H) gene. Sequence analysis of the H gene can be useful to investigate distinction of various lineages related to geographical distribution and CDV molecular epidemiology. Since vaccination program is conducted only in large cities of Iran, CD still remains as one of the major causes of death in dogs in this country. In order to monitor H gene, CDV has been detected in 14 out of 19 sampled dogs through the amplification of nucleoprotein (NP) gene in nested-PCR assay. In the next step 665 bp of H gene was amplified in 9 out of 14 NP-gene positive dogs. Phylogenetic analysis distinguished two distinct CDV genotypes in Iran. JN941238 has been embedded in European cluster and JN941239 has been embedded in Arctic cluster. Nucleic analysis has been shown high difference among both Iranian CDV lineages with CDV vaccine strains.

  17. Estimating the potential impact of canine distemper virus on the Amur tiger population (Panthera tigris altaica in Russia.

    Directory of Open Access Journals (Sweden)

    Martin Gilbert

    Full Text Available Lethal infections with canine distemper virus (CDV have recently been diagnosed in Amur tigers (Panthera tigris altaica, but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ, and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy.

  18. Estimating the Potential Impact of Canine Distemper Virus on the Amur Tiger Population (Panthera tigris altaica) in Russia

    Science.gov (United States)

    Gilbert, Martin; Miquelle, Dale G.; Goodrich, John M.; Reeve, Richard; Cleaveland, Sarah; Matthews, Louise; Joly, Damien O.

    2014-01-01

    Lethal infections with canine distemper virus (CDV) have recently been diagnosed in Amur tigers (Panthera tigris altaica), but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ), and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead) model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s) and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy. PMID:25354196

  19. Estimating the potential impact of canine distemper virus on the Amur tiger population (Panthera tigris altaica) in Russia.

    Science.gov (United States)

    Gilbert, Martin; Miquelle, Dale G; Goodrich, John M; Reeve, Richard; Cleaveland, Sarah; Matthews, Louise; Joly, Damien O

    2014-01-01

    Lethal infections with canine distemper virus (CDV) have recently been diagnosed in Amur tigers (Panthera tigris altaica), but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ), and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead) model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s) and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy.

  20. Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

    Science.gov (United States)

    Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

    2015-09-01

    The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. © 2015 The Author(s).

  1. Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

    Directory of Open Access Journals (Sweden)

    L. Pavlačík

    2007-01-01

    Full Text Available A group of five ferrets vaccinated against the canine distemper virus (CDV was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vaccination and then at 30-day intervals (sampling 1 to 12. The whole experimental cycle covered the period of one year from primary vaccination (till the age of 1 year and 6 weeks. Serum samples were analysed for anti-CDV virus-neutralisation antibodies using a virus-neutralisation test using the Onderstepoort CDV strain. All ferrets had zero virus-neutralisation antibody titres before primary vaccination. Two ferrets produced virus-neutralisation antibodies as a response to first revaccination. A stable antibody level (titre 256 was maintained between months 4 and 11 after primary vaccination and a sudden increase in antibody titre (titres 512 and 1024 - 2048 occurred in both animals in months 11 and 12. The reason for the abrupt rise in antibody titres in the two animals remains unclear. No anti-CDV seroconversion was observed in the three remaining animals. Regarding the results obtained in this study we do not consider commonly recommended vaccination with a live attenuated anti-CDV vaccine as an effective method of antibodies induction against distemper in young ferrets.

  2. Studi Histopatologi Limpa Anjing Penderita Distemper Dikaitkan Dengan Sebaran Sel-Sel Radang Pada Otak Dan Paru (HISTOPHATOLOGICAL STUDY OF SPLEEN ON DOGS INFECTED WITH DISTEMPER ASSOCIATED TO INFLAMATION IN THE BRAIN AND LUNGS

    Directory of Open Access Journals (Sweden)

    Muhamad Furkam Fadilah

    2015-08-01

    Full Text Available This study aim was to determine the distribution of inflammatory cells in canine distemper in terms of the level of inflammation in the spleen, brain and lungs. The sample used 20 infected dogs wihich from the spleens, brains, and lungs of the dogs were collected. These organs were processed for histophatological observation using harris hematoxilyn-eosyn stain. The inflammation of the organs examined by using binocular microscope with 200X magnification. the results showed that inflammation was observed in the spleens: 9 samples (45% showed the presence of lymphoidcells that experienced a mild inflammation 7 (35% moderate inflammation, and 4 (20% severe inflammation in brain, 3 samples (15% did not show observe inflammation, 12 (60% mild, 5(25% moderate inflammation, and not observed any severe inflammation in brain, pulmonary: 6(30% mild inflammation, 11 (55% moderate inflammation, and 3 (15% severe inflammation. It can be concluded that the inflammation was observed microscopically in the spleen, brain and lungin the dog that infected with canine distemper virus

  3. Arctic lineage-canine distemper virus as a cause of death in Apennine wolves (Canis lupus) in Italy.

    Science.gov (United States)

    Di Sabatino, Daria; Lorusso, Alessio; Di Francesco, Cristina E; Gentile, Leonardo; Di Pirro, Vincenza; Bellacicco, Anna Lucia; Giovannini, Armando; Di Francesco, Gabriella; Marruchella, Giuseppe; Marsilio, Fulvio; Savini, Giovanni

    2014-01-01

    Canine distemper virus (CDV) infection is a primary threat affecting a wide number of carnivore species, including wild animals. In January 2013, two carcasses of Apennine wolves (Canis lupus) were collected in Ortona dei Marsi (L'Aquila province, Italy) by the local Veterinary Services. CDV was immediately identified either by RT-PCR or immunohistochemistry in lung and central nervous tissue samples. At the same time, severe clinical signs consistent with CDV infection were identified and taped (Videos S1-S3) from three wolves rescued in the areas surrounding the National Parks of the Abruzzi region by the Veterinary Services. The samples collected from these symptomatic animals also turned out CDV positive by RT-PCR. So far, 30 carcasses of wolves were screened and CDV was detected in 20 of them. The sequencing of the haemagglutinin gene and subsequent phylogenetic analysis demonstrated that the identified virus belonged to the CDV Arctic lineage. Strains belonging to this lineage are known to circulate in Italy and in Eastern Europe amongst domestic dogs. To the best of our knowledge this is the first report of CDV Arctic lineage epidemics in the wild population in Europe.

  4. Arctic lineage-canine distemper virus as a cause of death in Apennine wolves (Canis lupus in Italy.

    Directory of Open Access Journals (Sweden)

    Daria Di Sabatino

    Full Text Available Canine distemper virus (CDV infection is a primary threat affecting a wide number of carnivore species, including wild animals. In January 2013, two carcasses of Apennine wolves (Canis lupus were collected in Ortona dei Marsi (L'Aquila province, Italy by the local Veterinary Services. CDV was immediately identified either by RT-PCR or immunohistochemistry in lung and central nervous tissue samples. At the same time, severe clinical signs consistent with CDV infection were identified and taped (Videos S1-S3 from three wolves rescued in the areas surrounding the National Parks of the Abruzzi region by the Veterinary Services. The samples collected from these symptomatic animals also turned out CDV positive by RT-PCR. So far, 30 carcasses of wolves were screened and CDV was detected in 20 of them. The sequencing of the haemagglutinin gene and subsequent phylogenetic analysis demonstrated that the identified virus belonged to the CDV Arctic lineage. Strains belonging to this lineage are known to circulate in Italy and in Eastern Europe amongst domestic dogs. To the best of our knowledge this is the first report of CDV Arctic lineage epidemics in the wild population in Europe.

  5. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Molecular characterization of canine distemper virus circulating in ...

    African Journals Online (AJOL)

    not exactly known. Eye swab from live animals (10 from Addis Ababa 5 from Nekemte and 5 from Bedele) and tissue samples (liver, kidney, lymph node and brain) from Nekemte and Bedele) were collected and tested using antigen detection fast kit. Virus isolation and molecular characterization was carried on these canine

  7. Influence of experimental distemper infection on the distribution of lead in dogs previously subacutely intoxicated with lead carbonate

    Energy Technology Data Exchange (ETDEWEB)

    White, D.J.; Marshall, A.J.; McLeod, S.

    1975-01-01

    The ability of experimental canine distemper infection to mobilize body lead deposits has been studied in Beagle dogs previously subacutely intoxicated with lead carbonate. For comparative purposes dogs were included which had either received lead only or distemper only or remained undosed. It was found that in dogs predosed with lead, distemper infection resulted in a significant increase in lead levels in blood and urine; this coincided with the peak body temperatures reached on the third day post infection. It was also found that the lead content of the liver and bone of these dogs was considerably higher than that of dogs receiving lead alone; at the same time bone phosphorus showed a marked decrease while bone calcium values remained similar to undosed controls.

  8. Phylogenetic evidence of canine distemper virus in Serengeti's lions.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); M.J.G. Appel (Max); M.E. Roelke-Parker (Melody); T. Barrett (Thomas); A.D.M.E. Osterhaus (Albert)

    1995-01-01

    textabstractRecently an epizootic, reported to be due to a morbillivirus infection, affected the lion population of the Tanzanian Serengeti National Park. A morbillivirus phosphoprotein (P) gene fragment was amplified by PCR from tissue samples of several affected lions. Sequencing of the

  9. Persistence of canine distemper virus in the Greater Yellowstone Ecosystem's carnivore community

    Science.gov (United States)

    Almberg, E.S.; Cross, P.C.; Smith, D.W.

    2010-01-01

    Canine distemper virus (CDV) is an acute, highly immunizing pathogen that should require high densities and large populations of hosts for long-term persistence, yet CDV persists among terrestrial carnivores with small, patchily distributed groups. We used CDV in the Greater Yellowstone ecosystem's (GYE) wolves (Canis lupus) and coyotes (Canis latrans) as a case study for exploring how metapopulation structure, host demographics, and multi-host transmission affect the critical community size and spatial scale required for CDV persistence. We illustrate how host spatial connectivity and demographic turnover interact to affect both local epidemic dynamics, such as the length and variation in inter-epidemic periods, and pathogen persistence using stochastic, spatially explicit susceptible-exposed-infectious-recovered simulation models. Given the apparent absence of other known persistence mechanisms (e.g., a carrier or environmental state, densely populated host, chronic infection, or a vector), we suggest that CDV requires either large spatial scales or multi-host transmission for persistence. Current GYE wolf populations are probably too small to support endemic CDV. Coyotes are a plausible reservoir host, but CDV would still require 50 000-100 000 individuals for moderate persistence (>50% over 10 years), which would equate to an area of 1-3 times the size of the GYE (60000-200000 km2). Coyotes, and carnivores in general, are not uniformly distributed; therefore, this is probably a gross underestimate of the spatial scale of CDV persistence. However, the presence of a second competent host species can greatly increase the probability of long-term CDV persistence at much smaller spatial scales. Although no management of CDV is currently recommended for the GYE, wolf managers in the region should expect periodic but unpredictable CDV-related population declines as often as every 2-5 years. Awareness and monitoring of such outbreaks will allow corresponding

  10. In vitro inhibition of canine distemper virus by flavonoids and phenolic acids: implications of structural differences for antiviral design.

    Science.gov (United States)

    Carvalho, O V; Botelho, C V; Ferreira, C G T; Ferreira, H C C; Santos, M R; Diaz, M A N; Oliveira, T T; Soares-Martins, J A P; Almeida, M R; Silva, A

    2013-10-01

    Infection caused by canine distemper virus (CDV) is a highly contagious disease with high incidence and lethality in the canine population. Antiviral activity of flavonoids quercetin, morin, rutin and hesperidin, and phenolic cinnamic, trans-cinnamic and ferulic acids were evaluated in vitro against the CDV using the time of addition assay to determine which step of the viral replicative cycle was affected. All flavonoids displayed great viral inhibition when they were added at the times 0 (adsorption) and 1h (penetration) of the viral replicative cycle. Both quercetin and hesperidin presented antiviral activity at the time 2h (intracellular). In the other hand, cinnamic acid showed antiviral activity at the times 0 and 2h while trans-cinnamic acid showed antiviral effect at the times -1h (pre-treatment) and 0 h. Ferulic acid inhibited CDV replicative cycle at the times 0 and 1h. Our study revealed promising candidates to be considered in the treatment of CDV. Structural differences among compounds and correlation to their antiviral activity were also explored. Our analysis suggest that these compounds could be useful in order to design new antiviral drugs against CDV as well as other viruses of great meaning in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Virus Infection

    Directory of Open Access Journals (Sweden)

    Hiroshi Abe

    2013-01-01

    Full Text Available Of 168 patients with chronic hepatitis B virus (HBV infection-related liver disease, 20 patients who had received 100 mg of lamivudine plus 10 mg/day of adefovir dipivoxil (ADV (ADV group and 124 patients who had received 0.5 mg/day of entecavir or 100 mg/day of lamivudine (non-ADV group for >1 year were enrolled. For comparative analyses, 19 well-matched pairs were obtained from the groups by propensity scores. At the time of enrollment, serum creatinine and phosphate concentrations were similar between the ADV and non-ADV groups; however, urinary phosphate ( and serum bone-specific alkaline phosphatase (BAP ( concentrations were significantly higher in the ADV group than in the non-ADV group. Serum BAP was significantly higher at the time of enrollment than before ADV administration in the ADV group (, although there was no significant change in serum BAP concentration in the non-ADV group. There was a significant positive correlation between the period of ADV therapy and ΔBAP (, . Serum BAP concentration increased before increase in serum creatinine concentration and was useful for early detection of adverse events and for developing adequate measures for continuing ADV for chronic HBV infection-related liver disease.

  12. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause...... of the increasing number of CDV-related diseases in dogs. The H gene shows the greatest extent of genetic variation that allows for distinction of various lineages, according to a geographical pattern of distribution and irrespective of the species of identification. In the present study, hemagglutinin (H) genes...... obtained from field strains detected from clinical specimens of Italian dogs were analyzed genetically. Phylogenetic analysis revealed that a homogeneous group of CDV strains is widespread in Italian dogs, all which are included into the European lineage. Unexpectedly, strains 179/04 and 48/05 clustered...

  13. Prevalence of antibodies against canine distemper virus and canine parvovirus among foxes and wolves from Spain.

    Science.gov (United States)

    Sobrino, R; Arnal, M C; Luco, D F; Gortázar, C

    2008-01-01

    Viral diseases can influence the population dynamics of wild carnivores and can have effects on carnivore conservation. Hence, a serologic survey was conducted in an opportunistic sample of 137 foxes (Vulpes vulpes) and 37 wolves (Canis lupus) in Spain for 1997-2007 to detect antibodies against canine distemper virus (CDV) and against canine parvovirus (CPV) by indirect ELISA. Antibodies against CDV were detected in 18.7% of the analyzed animals and antibodies against CPV in 17.2%. There was no difference in antibody prevalence to CDV between both species, even in the same region (P>0.05), but there was a significant difference in antibody prevalence to CPV between foxes (5.1%) and wolves (62.2%) (Pwolf populations there was significantly higher antibody prevalence against CPV (PIberian wolf population. The implications of these results are briefly discussed.

  14. Prevalence of phocine distemper virus specific antibodies: bracing for the next seal epizootic in north-western Europe.

    Science.gov (United States)

    Bodewes, Rogier; Morick, Danny; van de Bildt, Marco Wg; Osinga, Nynke; Rubio García, Ana; Sánchez Contreras, Guillermo J; Smits, Saskia L; Reperant, Leslie Ap; Kuiken, Thijs; Osterhaus, Albert Dme

    2013-01-01

    In 1988 and 2002, two major phocine distemper virus (PDV) outbreaks occurred in harbour seals (Phoca vitulina) in north-western European coastal waters, causing the death of tens of thousands seals. Here we investigated whether PDV is still circulating among seals of the Dutch coastal waters and whether seals have protective serum-antibodies against PDV. Therefore seal serum samples, collected from 2002 to 2012, were tested for the presence of PDV-neutralizing antibodies. Antibodies were detected in most seals in 2002 and 2003 while after 2003 antibodies were detected only in seals less than two month-old and adult seals that probably had survived the 2002 PDV-epizootic. We estimated the current proportion of seals with antibodies against PDV at 11%. These findings suggest that at present the vast majority of seals are not immune to PDV infection. PDV re-introduction in this area may cause a major epizootic with infection of >80% and mass-mortality of >50% of the population.

  15. Parasites in harbour seals ( Phoca vitulina) from the German Wadden Sea between two Phocine Distemper Virus epidemics

    Science.gov (United States)

    Lehnert, K.; Raga, J. A.; Siebert, U.

    2007-12-01

    Parasites were collected from 107 harbour seals ( Phoca vitulina) found on the coasts of Schleswig-Holstein, Germany, between 1997 and 2000. The prevalence of the parasites and their associated pathology were investigated. Eight species of parasites, primarily nematodes, were identified from the examined organs: two anisakid nematodes ( Pseudoterranova decipiens (sensu lato) , Contracaecum osculatum (sensu lato)) from the stomach, Otostrongylus circumlitus (Crenosomatidae) and Parafilaroides gymnurus (Filaroididae) from the respiratory tract, one filarioid nematode ( Acanthocheilonema spirocauda) from the heart, two acanthocephalans, Corynosoma strumosum and C. semerme (Polymorphidae), from the intestine and an ectoparasite, Echinophthirius horridus (Anoplura, Insecta). Lungworm infection was the most prominent parasitological finding and secondary bacterial bronchopneumonia the most pathogenic lesion correlated with the parasites. Heavy nematode burdens in the respiratory tract were highly age-related and more frequent in young seals. A positive correlation was observed between high levels of pulmonary infection and severity of bronchopneumonia. The prevalence of lungworms in this study was higher than in seals that died during the 1988/1989 Phocine Distemper Virus epidemic, and the prevalence of acanthocephalans and heartworms had decreased compared to findings from the first die-off.

  16. The quest for a safe and effective canine distemper virus vaccine for black-footed ferrets

    Science.gov (United States)

    Wimsatt, Jeffrey; Biggins, Dean E.; Williams, Elizabeth S.; Becerra, Victor M.

    2006-01-01

    Canine distemper virus (CDV) causes a systemic disease that is highly virulent to mustelids and other carnivore (Order Carnivora) species and is found worldwide. Endemic canine distemper in wild and domestic carnivores in the United States has made reintroduction of endangered black-footed ferrets (Mustela nigripes) difficult in the absence of safe and effective CDV vaccines and vaccination practices. Toward this end, researchers have explored appropriate animal models and vaccine preparations in highly susceptible species. Published studies involving domestic ferrets (M. putorius furo) using Galaxy-D® and evaluating a recombinant canarypox-vectored vaccine for oral administration are reviewed. In addition, we present new findings in domestic and black-footed ferrets and Siberian polecats (M. eversmannii) that have extended our understanding of CDV in the black-footed ferret and other at-risk carnivore species. Original research presented here includes trials that determined an effective challenge dose (by route) of virulent CDV in domestic ferrets and Siberian polecats; the low likelihood of collateral vaccination with Galaxy-D; the adverse effect of modified-live virus boostering in black-footed ferrets receiving killed vaccine previously and the response of Siberian polecats receiving canarypoxvectored recombinant CDV vaccine (reCDV); the absence of an effect of reCDV vaccination on conception, pregnancy, and neonatal growth in Siberian polecats; and the apparent inefficacy of active reCDV vaccination during the period of passive immunity in young Siberian polecats. In the final section, we discuss emerging concerns and avenues for disease intervention that may present new opportunities to solve problems in vaccine safety, vaccine availability, field vaccine delivery, and other therapeutic modalities.

  17. Experimental adaptation of wild-type canine distemper virus (CDV to the human entry receptor CD150.

    Directory of Open Access Journals (Sweden)

    Maria Bieringer

    Full Text Available Canine distemper virus (CDV, a close relative of measles virus (MV, is widespread and well known for its broad host range. When the goal of measles eradication may be achieved, and when measles vaccination will be stopped, CDV might eventually cross the species barrier to humans and emerge as a new human pathogen. In order to get an impression how fast such alterations may occur, we characterized required adaptive mutations to the human entry receptors CD150 (SLAM and nectin-4 as first step to infect human target cells. Recombinant wild-type CDV-A75/17(red adapted quickly to growth in human H358 epithelial cells expressing human nectin-4. Sequencing of the viral attachment proteins (hemagglutinin, H, and fusion protein, F genes revealed that no adaptive alteration was required to utilize human nectin-4. In contrast, the virus replicated only to low titres (10(2 pfu/ml in Vero cells expressing human CD150 (Vero-hSLAM. After three passages using these cells virus was adapted to human CD150 and replicated to high titres (10(5 pfu/ml. Sequence analyses revealed that only one amino acid exchange in the H-protein at position 540 Asp→Gly (D540G was required for functional adaptation to human CD150. Structural modelling suggests that the adaptive mutation D540G in H reflects the sequence alteration from canine to human CD150 at position 70 and 71 from Pro to Leu (P70L and Gly to Glu (G71E, and compensates for the gain of a negative charge in the human CD150 molecule. Using this model system our data indicate that only a minimal alteration, in this case one adaptive mutation, is required for adaptation of CDV to the human entry receptors, and help to understand the molecular basis why this adaptive mutation occurs.

  18. How Behavioral Changes Can Indicate Serious Cerebral Pathology: A Case Report of Concomitant Olfactory Neuroblastoma and Distemper Virus Encephalitis in a Swiss Shepherd Dog.

    Science.gov (United States)

    Candini, Dario; Biasato, Ilaria; Dell'Armelina Rocha, Paulo Ricardo; Grego, Elena; Capucchio, Maria Teresa; Vercelli, Cristina

    2017-08-28

    Behavioral alterations in dogs are not easy to understand and cure. The situation is more difficult when an encephalitis due to Canine Distemper Virus (CDV) and a concomitant olfactory neuroblastoma are present. This case report deals with the story of a 5-year-old Swiss shepherd dog with behavioral changes, seizures, epistaxis and ataxia. Following clinical and laboratory exams, a suspected diagnosis of CDV infection was hypothesized, and a therapy based on Ω-interferon was administered. Every supporting therapy failed and the worsening of the clinical conditions led to the euthanasia of the patient. A neoformation in the right frontal lobe was found post mortem. Histopathology and immunohistochemistry investigation showed a non-suppurative demyelinating encephalitis, suggestive of CDV infection, and a desmoplastic epithelioid olfactory neuroblastoma. To the best of authors' knowledge, this is the first clinical pathological report of a non-suppurative encephalitis due to CDV infection and olfactory neuroblastoma in a dog.

  19. Dynamics of a morbillivirus at the domestic-wildlife interface: Canine distemper virus in domestic dogs and lions.

    Science.gov (United States)

    Viana, Mafalda; Cleaveland, Sarah; Matthiopoulos, Jason; Halliday, Jo; Packer, Craig; Craft, Meggan E; Hampson, Katie; Czupryna, Anna; Dobson, Andrew P; Dubovi, Edward J; Ernest, Eblate; Fyumagwa, Robert; Hoare, Richard; Hopcraft, J Grant C; Horton, Daniel L; Kaare, Magai T; Kanellos, Theo; Lankester, Felix; Mentzel, Christine; Mlengeya, Titus; Mzimbiri, Imam; Takahashi, Emi; Willett, Brian; Haydon, Daniel T; Lembo, Tiziana

    2015-02-03

    Morbilliviruses cause many diseases of medical and veterinary importance, and although some (e.g., measles and rinderpest) have been controlled successfully, others, such as canine distemper virus (CDV), are a growing concern. A propensity for host-switching has resulted in CDV emergence in new species, including endangered wildlife, posing challenges for controlling disease in multispecies communities. CDV is typically associated with domestic dogs, but little is known about its maintenance and transmission in species-rich areas or about the potential role of domestic dog vaccination as a means of reducing disease threats to wildlife. We address these questions by analyzing a long-term serological dataset of CDV in lions and domestic dogs from Tanzania's Serengeti ecosystem. Using a Bayesian state-space model, we show that dynamics of CDV have changed considerably over the past three decades. Initially, peaks of CDV infection in dogs preceded those in lions, suggesting that spill-over from dogs was the main driver of infection in wildlife. However, despite dog-to-lion transmission dominating cross-species transmission models, infection peaks in lions became more frequent and asynchronous from those in dogs, suggesting that other wildlife species may play a role in a potentially complex maintenance community. Widespread mass vaccination of domestic dogs reduced the probability of infection in dogs and the size of outbreaks but did not prevent transmission to or peaks of infection in lions. This study demonstrates the complexity of CDV dynamics in natural ecosystems and the value of long-term, large-scale datasets for investigating transmission patterns and evaluating disease control strategies.

  20. Dynamics of a morbillivirus at the domestic–wildlife interface: Canine distemper virus in domestic dogs and lions

    Science.gov (United States)

    Viana, Mafalda; Matthiopoulos, Jason; Halliday, Jo; Packer, Craig; Craft, Meggan E.; Hampson, Katie; Czupryna, Anna; Dobson, Andrew P.; Dubovi, Edward J.; Ernest, Eblate; Fyumagwa, Robert; Hoare, Richard; Hopcraft, J. Grant C.; Horton, Daniel L.; Kaare, Magai T.; Kanellos, Theo; Lankester, Felix; Mentzel, Christine; Mlengeya, Titus; Mzimbiri, Imam; Takahashi, Emi; Willett, Brian; Haydon, Daniel T.; Lembo, Tiziana

    2015-01-01

    Morbilliviruses cause many diseases of medical and veterinary importance, and although some (e.g., measles and rinderpest) have been controlled successfully, others, such as canine distemper virus (CDV), are a growing concern. A propensity for host-switching has resulted in CDV emergence in new species, including endangered wildlife, posing challenges for controlling disease in multispecies communities. CDV is typically associated with domestic dogs, but little is known about its maintenance and transmission in species-rich areas or about the potential role of domestic dog vaccination as a means of reducing disease threats to wildlife. We address these questions by analyzing a long-term serological dataset of CDV in lions and domestic dogs from Tanzania’s Serengeti ecosystem. Using a Bayesian state–space model, we show that dynamics of CDV have changed considerably over the past three decades. Initially, peaks of CDV infection in dogs preceded those in lions, suggesting that spill-over from dogs was the main driver of infection in wildlife. However, despite dog-to-lion transmission dominating cross-species transmission models, infection peaks in lions became more frequent and asynchronous from those in dogs, suggesting that other wildlife species may play a role in a potentially complex maintenance community. Widespread mass vaccination of domestic dogs reduced the probability of infection in dogs and the size of outbreaks but did not prevent transmission to or peaks of infection in lions. This study demonstrates the complexity of CDV dynamics in natural ecosystems and the value of long-term, large-scale datasets for investigating transmission patterns and evaluating disease control strategies. PMID:25605919

  1. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup Infecção simultânea por vírus da cinomose e da parvovirose associada à necrose cardíaca em um canino

    Directory of Open Access Journals (Sweden)

    Selwyn Arlington Headley

    2003-12-01

    Full Text Available Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a dual infection of canine distemper virus and canine parvovirus.Descreve-se a infecção simultânea de cinomose e parvovirose associada à degeneração e necrose do miocárdio em um cão. Clinicamente, o cão apresentou mioclonias, nistagmo, hipoplasia do esmalte dentário, pústulas abdominais e ulceração bilateral da córnea. Foram observadas encefalite desmielinzante, degeneração e necrose do miocárdio com mineralização, e necrose, hemorragia e fusão das vilosidades intestinais. As lesões observadas neste cão são características com uma infecção pelos vírus da cinomose e da parvovirose.

  2. Achados patológicos e imuno-histoquímicos em cães infectados naturalmente pelo vírus da cinomose canina Pathologic and immunohistochemistry findings in dogs naturally infected by canine distemper virus

    Directory of Open Access Journals (Sweden)

    Luciana Sonne

    2009-02-01

    Full Text Available A cinomose canina é uma doença viral e afeta principalmente os sistemas respiratório, gastrintestinal e nervoso. Neste trabalho foram analisados os achados patológicos e imuno-histoquímicos de 54 cães com cinomose de um total de 760 cães necropsiados no período de julho de 2006 a outubro de 2007. As lesões macroscópicas observadas foram caracterizadas por corrimento ocular e nasal mucopurulentas, hiperqueratose dos coxins digitais, pulmões avermelhados e não colapsados, atrofia do timo, conteúdo intestinal diarréico e placas de Peyer proeminentes. Os achados histológicos caracterizavam-se principalmente por pneumonia intersticial, rarefação linfóide, desmielinização da substância branca, manguitos perivasculares e corpúsculos de inclusão intranucleares e intracitoplasmáticos, que se localizam principalmente na mucosa do estômago, epitélios da bexiga, brônquios e bronquíolos, pelve renal, coxins digitais, pálpebra, orelha e tonsila no sistema nervoso central e em células mononucleares dos linfonodos, baço e tonsilas. Os tecidos foram marcados pela técnica imuno-histoquímica utilizando anticorpo monoclonal anti-cinomose canina. O coxim digital foi o tecido com maior número de casos marcados positivamente (67,4% dos casos, seguido pelo estômago com 62,7%. A imuno-histoquímica mostrou ser uma ferramenta importante para o estudo da distribuição do antígeno em cães infectados pela cinomose bem como indicou o melhor tecido para a confirmação do diagnóstico de casos suspeitos.Canine distemper is a viral disease that affects mainly respiratory, gastrointestinal and nervous system. The present study analyzes pathologic and immunohistochemical findings in 54 dogs with canine distemper of a total of 760 canine necropsies performed from July 2006 to October 2007. The gross lesions were characterized by mucopurulent oculonasal discharge, hyperkeratosis of footpads, red and not collapsed lungs, thymic atrophy, watery

  3. Recent host range expansion of canine distemper virus and variation in its receptor, the signaling lymphocyte activation molecule, in carnivores.

    Science.gov (United States)

    Ohishi, Kazue; Suzuki, Rintaro; Maeda, Taro; Tsuda, Miwako; Abe, Erika; Yoshida, Takao; Endo, Yasuyuki; Okamura, Maki; Nagamine, Takashi; Yamamoto, Hanae; Ueda, Miya; Maruyama, Tadashi

    2014-07-01

    The signaling lymphocyte activation molecule (SLAM) is a receptor for morbilliviruses. To understand the recent host range expansion of canine distemper virus (CDV) in carnivores, we determined the nucleotide sequences of SLAMs of various carnivores and generated three-dimensional homology SLAM models. Thirty-four amino acid residues were found for the candidates binding to CDV on the interface of the carnivore SLAMs. SLAM of the domestic dog (Canis lupus familiaris) were similar to those of other members of the suborder Caniformia, indicating that the animals in this group have similar sensitivity to dog CDV. However, they were different at nine positions from those of felids. Among the nine residues, four of domestic cat (Felis catus) SLAM (72, 76, 82, and 129) and three of lion (Panthera leo persica) SLAM (72, 82, and 129) were associated with charge alterations, suggesting that the felid interfaces have lower affinities to dog CDV. Only the residue at 76 was different between domestic cat and lion SLAM interfaces. The domestic cat SLAM had threonine at 76, whereas the lion SLAM had arginine, a positively charged residue like that of the dog SLAM. The cat SLAM with threonine is likely to have lower affinity to CDV-H and to confer higher resistance against dog CDV. Thus, the four residues (72, 76, 82, and 129) on carnivore SLAMs are important for the determination of affinity and sensitivity with CDV. Additionally, the CDV-H protein of felid strains had a substitution of histidine for tyrosine at 549 of dog CDV-H and may have higher affinity to lion SLAM. Three-dimensional model construction is a new risk assessment method of morbillivirus infectivity. Because the method is applicable to animals that have no information about virus infection, it is especially useful for morbillivirus risk assessment and wildlife conservation.

  4. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread

    International Nuclear Information System (INIS)

    Delpeut, Sebastien; Noyce, Ryan S.; Richardson, Christopher D.

    2014-01-01

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. - Highlights: • PVRL4 (nectin-4) is the epithelial cell receptor for measles and canine distemper viruses. • V domain of PVRL4 is critical for CDV entry, cell-to-cell spread, and syncytia formation. • Chimeric PVRL1 backbone substituted with the V domain of PVRL4 can function as a receptor. • Amino acids (F132/P133/A134/G135) within the V domain are essential for PVRL4 receptor activity. • Amino acids (P493/Y539) within CDV H protein are essential for PVRL4 receptor interaction

  6. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread

    Energy Technology Data Exchange (ETDEWEB)

    Delpeut, Sebastien; Noyce, Ryan S. [The Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); IWK Health Centre, Canadian Center for Vaccinology, Goldbloom Pavilion, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); Richardson, Christopher D., E-mail: chris.richardson@dal.ca [The Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); IWK Health Centre, Canadian Center for Vaccinology, Goldbloom Pavilion, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); The Department of Pediatrics, Dalhousie University, Halifax, Nova Scotia (Canada)

    2014-04-15

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. - Highlights: • PVRL4 (nectin-4) is the epithelial cell receptor for measles and canine distemper viruses. • V domain of PVRL4 is critical for CDV entry, cell-to-cell spread, and syncytia formation. • Chimeric PVRL1 backbone substituted with the V domain of PVRL4 can function as a receptor. • Amino acids (F132/P133/A134/G135) within the V domain are essential for PVRL4 receptor activity. • Amino acids (P493/Y539) within CDV H protein are essential for PVRL4 receptor interaction.

  7. Canine Distemper

    Science.gov (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  8. Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010).

    Science.gov (United States)

    Nouvellet, Pierre; Donnelly, Christl A; De Nardi, Marco; Rhodes, Chris J; De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni

    2013-01-01

    Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.

  9. Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010.

    Directory of Open Access Journals (Sweden)

    Pierre Nouvellet

    Full Text Available Since 2006 the red fox (Vulpes vulpes population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV. Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.

  10. Urban domestic dog populations as a source of canine distemper virus for wild carnivores in the Coquimbo region of Chile.

    Science.gov (United States)

    Acosta-Jamett, G; Chalmers, W S K; Cunningham, A A; Cleaveland, S; Handel, I G; Bronsvoort, B M deC

    2011-09-28

    Urban areas can support dog populations dense enough to maintain canine distemper virus (CDV) and can be a source of infection for rural dogs and free-ranging carnivores. The aim of this study was to investigate the relationships between urban and rural domestic dog and wild carnivore populations and their effects on the epidemiology of CDV to explain retrospectively a CD outbreak in wild foxes in 2003. From 2005 to 2007 a cross-sectional household questionnaire survey was conducted in Coquimbo and Ovalle cities, in three towns and in rural sites along two transects from these cities to the Fray Jorge National Park (FJNP) in the Coquimbo region, Chile. Blood samples were collected from unvaccinated dogs at surveyed households and from free-ranging foxes in rural areas along the transects. The seroprevalence of CDV in domestic dogs was higher in urban than in rural areas and in the later was highest in dogs born before 2001-2002. The seroprevalence of CDV in foxes was higher in areas closer to human settlements. A high seroprevalence in dogs born before 2001-2002 further supports a link between CDV patterns in rural dog and fox populations. In our study area, urban dogs are proposed to be the source of CDV infection to wild carnivores. The large dog population size and density detected in Coquimbo and Ovalle provides optimal conditions for maintaining a large and dense susceptible population of dogs, which can act as a reservoir for highly infectious diseases and could have been the source of infection in the CD outbreak in wild foxes. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Rabies and Canine Distemper Virus Epidemics in the Red Fox Population of Northern Italy (2006–2010)

    Science.gov (United States)

    De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni

    2013-01-01

    Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006–2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures. PMID:23630599

  12. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  13. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  14. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

    2017-08-15

    Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

  15. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  16. Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa.

    Science.gov (United States)

    Loots, Angelika K; Du Plessis, Morné; Dalton, Desiré Lee; Mitchell, Emily; Venter, Estelle H

    2017-07-06

    Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. Copyright © 2017 Loots et al.

  17. Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa

    Science.gov (United States)

    Loots, Angelika K.; Du Plessis, Morné; Mitchell, Emily; Venter, Estelle H.

    2017-01-01

    ABSTRACT Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. PMID:28684581

  18. 9 CFR 113.302 - Distemper Vaccine-Mink.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Distemper Vaccine-Mink. 113.302... Virus Vaccines § 113.302 Distemper Vaccine—Mink. Distemper Vaccine—Mink shall be prepared from virus... immunogenic shall be used for preparing the production seed virus for vaccine production. All serials of...

  19. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  20. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  1. Prevalence of antibodies to canine parvovirus and distemper virus in wolves in the Canadian Rocky Mountains.

    Science.gov (United States)

    Nelson, Brynn; Hebblewhite, Mark; Ezenwa, Vanessa; Shury, Todd; Merrill, Evelyn H; Paquet, Paul C; Schmiegelow, Fiona; Seip, Dale; Skinner, Geoff; Webb, Nathan

    2012-01-01

    Wild carnivores are often exposed to diseases via contact with peridomestic host species that travel through the wildland-urban interfaces. To determine the antibody prevalences and relationships to human activity for two common canid pathogens, we sampled 99 wolves (Canis lupus) from 2000 to 2008 for antibodies to canine parvovirus (CPV) and canine distemper virus (CDV) in Banff and Jasper National Parks and surrounding areas of the Canadian Rockies. This population was the source for wolves reintroduced into the Northern Rockies of the US. Of 99 wolves sampled, 94 had detectable antibody to CPV (95%), 24 were antibody-positive for CDV (24%), and 24 had antibodies to both pathogens (24%). We tested whether antibody prevalences for CPV and CDV were higher closer to human activity (roads, town sites, First Nation reserves) and as a function of sex and age class. Wolves ≥2 yr old were more likely to be have antibodies to CPV. For CDV, male wolves, wolves ≥2 yr, and those closer to First Nation reserves were more likely to have antibodies. Overall, however, we found minimal support for human influence on antibody prevalence for CDV and CPV. The similarity between our antibody prevalence results and results from recent studies in Yellowstone National Park suggests that at least in the case of CDV, and perhaps CPV, these could be important pathogens with potential effects on wolf populations.

  2. Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas.

    Science.gov (United States)

    Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

    2017-08-15

    In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenuated combination CDV vaccine was used among almost all carnivore animals except for red pandas in which another recombinant combination CDV vaccine was used. However, about two months later, CDV re-emerged and caused the death among red pandas. Based on the vaccination records, the live combination vaccine could be considered an ideal weapon against CDV in zoo carnivore animals. Although the recombinant combination CDV vaccine was safe for red pandas, its protection effectiveness remains to be further investigated. Moreover, according to the outbreak interval time and sequence characterization, we suspected that stray cats circulating in the zoo were the intermediate host, which contributed to CDV spread from stray dogs to zoo animals. This study revealed the importance of vaccination and biosecurity for zoo animals.

  3. Sandwich-dot enzyme-linked immunosorbent assay for the detection of canine distemper virus

    Science.gov (United States)

    Li, Zhi; Zhang, Yanlong; Wang, Huiguo; Jin, Jinhua; Li, Wenzhe

    2013-01-01

    A sandwich-dot enzyme-linked immunosorbent assay (dot ELISA) was developed for the detection of canine distemper virus (CDV). In 56 dogs suspected to have CD the rates of detection of CDV antigen in samples of blood lymphocytes and palpebral conjunctiva by dot ELISA and ELISA were, respectively, 91% (49/54) and 81% (44/54) for the lymphocyte samples and 88% (28/32) and 75% (24/32) for the conjunctival samples. The CDV detection limits were 10 ng/50 μL for dot ELISA and 40 ng/50 μL for ELISA. The reliability of dot ELISA relative to electron microscopy was 96% with 22 samples: all 21 samples in which CDV particles were observed by electron microscopy yielded positive results with dot ELISA; the single sample in which particles were not observed yielded false-positive results with dot ELISA. The results indicate that the dot ELISA developed can serve as a reliable rapid diagnostic test in suspected cases of CD and also be useful for epidemiologic surveillance of the disease. PMID:24124274

  4. Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake

    Directory of Open Access Journals (Sweden)

    Gerardo Acosta-Jamett

    2013-08-01

    Full Text Available Following the earthquake and tsunami disaster in Chile in February 2010, residents of Dichato reported high morbidity and mortality in dogs, descriptions of which resembled canine distemper virus (CDV. To assess the situation, free vaccine clinics were offered in April and May. Owner information, dog history and signalment were gathered; dogs received physical examinations and vaccines protecting against CDV, and other common canine pathogens. Blood was collected to screen for IgM antibodies to CDV. In total, 208 dogs received physical exams and vaccines were given to 177. IgM antibody titres to CDV were obtained for 104 dogs. Fifty-four dogs (51.9% tested positive for CDV at the cut off titre of >1:50, but a total of 91.4% of dogs had a detectable titre >1:10. Most of the positive test results were in dogs less than 2 years of age; 33.5% had been previously vaccinated against CDV, and owners of 84 dogs (42.2% reported clinical signs characteristic of CDV in their dogs following the disaster. The presence of endemic diseases in dog populations together with poor pre-disaster free-roaming dog management results in a potential for widespread negative effects following disasters. Creation of preparedness plans that include animal welfare, disease prevention and mitigation should be developed.

  5. Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake.

    Science.gov (United States)

    Garde, Elena; Pérez, Guillermo; Acosta-Jamett, Gerardo; Bronsvoort, Barend Mark

    2013-08-27

    Following the earthquake and tsunami disaster in Chile in February 2010, residents of Dichato reported high morbidity and mortality in dogs, descriptions of which resembled canine distemper virus (CDV). To assess the situation, free vaccine clinics were offered in April and May. Owner information, dog history and signalment were gathered; dogs received physical examinations and vaccines protecting against CDV, and other common canine pathogens. Blood was collected to screen for IgM antibodies to CDV. In total, 208 dogs received physical exams and vaccines were given to 177. IgM antibody titres to CDV were obtained for 104 dogs. Fifty-four dogs (51.9%) tested positive for CDV at the cut off titre of >1:50, but a total of 91.4% of dogs had a detectable titre >1:10. Most of the positive test results were in dogs less than 2 years of age; 33.5% had been previously vaccinated against CDV, and owners of 84 dogs (42.2%) reported clinical signs characteristic of CDV in their dogs following the disaster. The presence of endemic diseases in dog populations together with poor pre-disaster free-roaming dog management results in a potential for widespread negative effects following disasters. Creation of preparedness plans that include animal welfare, disease prevention and mitigation should be developed.

  6. Canine Distemper Virus Fusion Activation: Critical Role of Residue E123 of CD150/SLAM.

    Science.gov (United States)

    Khosravi, Mojtaba; Bringolf, Fanny; Röthlisberger, Silvan; Bieringer, Maria; Schneider-Schaulies, Jürgen; Zurbriggen, Andreas; Origgi, Francesco; Plattet, Philippe

    2016-02-01

    Measles virus (MeV) and canine distemper virus (CDV) possess tetrameric attachment proteins (H) and trimeric fusion proteins, which cooperate with either SLAM or nectin 4 receptors to trigger membrane fusion for cell entry. While the MeV H-SLAM cocrystal structure revealed the binding interface, two distinct oligomeric H assemblies were also determined. In one of the conformations, two SLAM units were sandwiched between two discrete H head domains, thus spotlighting two binding interfaces ("front" and "back"). Here, we investigated the functional relevance of both interfaces in activating the CDV membrane fusion machinery. While alanine-scanning mutagenesis identified five critical regulatory residues in the front H-binding site of SLAM, the replacement of a conserved glutamate residue (E at position 123, replaced with A [E123A]) led to the most pronounced impact on fusion promotion. Intriguingly, while determination of the interaction of H with the receptor using soluble constructs revealed reduced binding for the identified SLAM mutants, no effect was recorded when physical interaction was investigated with the full-length counterparts of both molecules. Conversely, although mutagenesis of three strategically selected residues within the back H-binding site of SLAM did not substantially affect fusion triggering, nevertheless, the mutants weakened the H-SLAM interaction recorded with the membrane-anchored protein constructs. Collectively, our findings support a mode of binding between the attachment protein and the V domain of SLAM that is common to all morbilliviruses and suggest a major role of the SLAM residue E123, located at the front H-binding site, in triggering the fusion machinery. However, our data additionally support the hypothesis that other microdomain(s) of both glycoproteins (including the back H-binding site) might be required to achieve fully productive H-SLAM interactions. A complete understanding of the measles virus and canine distemper virus

  7. Dimerization Efficiency of Canine Distemper Virus Matrix Protein Regulates Membrane-Budding Activity.

    Science.gov (United States)

    Bringolf, Fanny; Herren, Michael; Wyss, Marianne; Vidondo, Beatriz; Langedijk, Johannes P; Zurbriggen, Andreas; Plattet, Philippe

    2017-08-15

    Paramyxoviruses rely on the matrix (M) protein to orchestrate viral assembly and budding at the plasma membrane. Although the mechanistic details remain largely unknown, structural data suggested that M dimers and/or higher-order oligomers may facilitate membrane budding. To gain functional insights, we employed a structure-guided mutagenesis approach to investigate the role of canine distemper virus (CDV) M protein self-assembly in membrane-budding activity. Three six-alanine-block (6A-block) mutants with mutations located at strategic oligomeric positions were initially designed. While the first one includes residues potentially residing at the protomer-protomer interface, the other two display amino acids located within two distal surface-exposed α-helices proposed to be involved in dimer-dimer contacts. We further focused on the core of the dimeric interface by mutating asparagine 138 (N138) to several nonconservative amino acids. Cellular localization combined with dimerization and coimmunopurification assays, performed under various denaturing conditions, revealed that all 6A-block mutants were impaired in self-assembly and cell periphery accumulation. These phenotypes correlated with deficiencies in relocating CDV nucleocapsid proteins to the cell periphery and in virus-like particle (VLP) production. Conversely, all M-N138 mutants remained capable of self-assembly, though to various extents, which correlated with proper accumulation and redistribution of nucleocapsid proteins at the plasma membrane. However, membrane deformation and VLP assays indicated that the M-N138 variants exhibiting the most reduced dimerization propensity were also defective in triggering membrane remodeling and budding, despite proper plasma membrane accumulation. Overall, our data provide mechanistic evidence that the efficiency of CDV M dimerization/oligomerization governs both cell periphery localization and membrane-budding activity. IMPORTANCE Despite the availability of

  8. Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen.

    Science.gov (United States)

    Athanasiou, Labrini V; Kantere, Maria C; Kyriakis, Constantinos S; Pardali, Dimitra; Adamama Moraitou, Katerina; Polizopoulou, Zoe S

    2017-11-29

    Canine distemper is a common and potentially lethal multisystemic disease caused by the Canine distemper virus (CDV). We evaluated the diagnostic performance of direct immunofluorescent assay (FA) and cytology to detect CDV antigen in conjunctival cells compared with an established polymerase chain reaction (PCR) detection assay used as a gold standard for CDV diagnosis. Samples were collected from 57 young dogs presenting with central nervous system signs compatible with distemper disease. Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using nylon-bristled cytobrushes for cytology and cotton swabs for FA and PCR. For the direct FA, samples were stained with anti-CDV polyclonal antiserum conjugated to fluorescein isothiocyanate and imaged using a fluorescent microscope. Out of 57 dogs tested, 19 were PCR positive (15 positive in direct FA and 4 positive in cytology, including one that was negative by PCR), whereas 37 dogs were negative in all methods. A good agreement was observed between the FA and PCR, with a κ-value of 0.833 (95% CI: 0.678-0.989). Meanwhile, there was poor agreement between cytology and PCR (κ-value of 0.164; 95% CI: -0.045 to 0.373) and a fair agreement between FA and cytology (κ-value of 0.231; 95% CI: -0.026 to 0.487). Our results indicated a poor performance of cytology for the detection of CDV antigen. In contrast, FA is a 100% specific and an adequately sensitive assay (sensitivity: 78.95%, negative likelihood ratio: 0.21, 95% CI: 0.09-0.50) for antemortem diagnosis of canine distemper.

  9. Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2007-06-01

    Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

  10. Soroprevalência das infecções por parvovírus, adenovírus, coronavírus canino e pelo vírus da cinomose em cães de Santa Maria, Rio Grande do Sul, Brasil Seroprevalence of parvovirus, adenovirus, coronavirus and canine distemper virus infections in dogs of Santa Maria, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Renata Dezengrini

    2007-02-01

    Full Text Available As infecções pelo vírus da cinomose (CDV, por parvovírus (CPV, adenovírus (CAV e coronavírus (CCoV são importantes causas de morbidade e de mortalidade em cães de todo o mundo, porém pouco se sabe sobre a sua incidência e prevalência no Brasil. Para determinar-se a prevalência dessas infecções na população canina de Santa Maria, RS, Brasil, amostras de sangue foram coletadas de 817 cães não-vacinados de 14 bairros do município e testadas para a presença de anticorpos específicos. Anticorpos contra o CDV foram detectados em 27,3% (223/817 das amostras, contra o CPV em 68,7% (561/817, contra o CAV em 43% (353/817 e contra o CCoV em 50,4% (412/817 dos cães. Observou-se um aumento gradativo da prevalência de anticorpos de acordo com a idade para o CDV, o CAV e o CCoV. Os índices de positividade para o CPV, o CAV e o CCoV foram um pouco superiores entre machos, e semelhantes entre os sexos para o CDV. Os animais que convivem com outros cães em casa ou na rua apresentaram prevalência maior de anticorpos para o CDV e o CCoV do que cães sem contato ou convívio, enquanto que, para o CPV e o CAV, não houve diferença. Esses resultados demonstram que esses vírus estão difundidos na população canina dos bairros da cidade. Por outro lado, demonstram também que uma parte considerável da população é soronegativa e, portanto, está desprotegida frente a esses agentes, indicando a necessidade de se ampliar a cobertura vacinal.Canine distemper virus (CDV, parvovirus (CPV, adenovirus (CAV and coronavirus (CCoV infections have been associated with significant morbidity and mortality among dogs worldwide yet very little is known about these infections in Brazil. As to determine the prevalence of these infections in the canine population of Santa Maria, RS, Brazil, 817 blood samples were collected from non-vaccinated dogs of 14 neighborhoods and tested for specific antibodies. Antibodies to CDV were detected in 27.3% (223/817 of

  11. Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Chriél, Mariann; Struve, Tina

    2014-01-01

    A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus...... full-length sequencing of the receptor binding surface protein hemagglutinin (H) was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical...... with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM) receptor binding region in most viruses from both mink and wildlife...

  12. Morphometric analysis of the thymus of puppies infected with the Snyder Hill Strain of canine distemper virus Análise morfométrica do timo de cães filhotes infectados com a amostra Snyder Hill do vírus de cinomose canina

    Directory of Open Access Journals (Sweden)

    C.M. Alves

    2006-08-01

    Full Text Available The thymic morphometry analysis was used for determining apoptosis and atrophy of the thymus of eight puppies inoculated with canine distemper virus (CDV. Three healthy dogs were used as negative controls. Sections, 5µm thick, were stained by HE and Shorr, and the latter were evaluated by morphometry. CDV nucleoprotein was detected by immunohistochemistry. Morphometric results confirmed lymphoid hypotrophy in CDV inoculated dog thymuses, more stroma, less parenchyma and higher apoptotic index/field than negative control (not inoculated puppies. Apoptosis plays a role in the mechanism of thymus atrophy that develops in canine distemper.Determinaram-se a apoptose e a atrofia no timo de oito cães novos, inoculados experimentalmente com o vírus de cinomose. Três cães saudáveis foram usados como controle negativo. Secções coradas pelo Shorr foram avaliadas por morfometria. A nucleoproteína viral foi detectada por imunoistoquímica. Os resultados morfométricos confirmaram a hipotrofia e mostraram que o timo dos cães inoculados tinha mais estroma, menos parênquima e maior índice apoptótico/campo que o dos animais-controle. Pode-se concluir que a apoptose desempenha importante papel no mecanismo de hipotrofia tímica que se desenvolve na cinomose.

  13. The role of canine distemper virus and persistent organic pollutants in mortality patterns of Caspian seals (Pusa caspica.

    Directory of Open Access Journals (Sweden)

    Susan C Wilson

    Full Text Available Persistent organic pollutants are a concern for species occupying high trophic levels since they can cause immunosuppression and impair reproduction. Mass mortalities due to canine distemper virus (CDV occurred in Caspian seals (Pusa caspica, in spring of 1997, 2000 and 2001, but the potential role of organochlorine exposure in these epizootics remains undetermined. Here we integrate Caspian seal mortality data spanning 1971-2008, with data on age, body condition, pathology and blubber organochlorine concentration for carcases stranded between 1997 and 2002. We test the hypothesis that summed PCB and DDT concentrations contributed to CDV associated mortality during epizootics. We show that age is the primary factor explaining variation in blubber organochlorine concentrations, and that organochlorine burden, age, sex, and body condition do not account for CDV infection status (positive/negative of animals dying in epizootics. Most animals (57%, n = 67 had PCB concentrations below proposed thresholds for toxic effects in marine mammals (17 µg/g lipid weight, and only 3 of 67 animals had predicted TEQ values exceeding levels seen to be associated with immune suppression in harbour seals (200 pg/g lipid weight. Mean organonchlorine levels were higher in CDV-negative animals indicating that organochlorines did not contribute significantly to CDV mortality in epizootics. Mortality monitoring in Azerbaijan 1971-2008 revealed bi-annual stranding peaks in late spring, following the annual moult and during autumn migrations northwards. Mortality peaks comparable to epizootic years were also recorded in the 1970s-1980s, consistent with previous undocumented CDV outbreaks. Gompertz growth curves show that Caspian seals achieve an asymptotic standard body length of 126-129 cm (n = 111. Males may continue to grow slowly throughout life. Mortality during epizootics may exceed the potential biological removal level (PBR for the population, but the low

  14. Prevalence of serum antibody titers against canine distemper virus and canine parvovirus in dogs hospitalized in an intensive care unit.

    Science.gov (United States)

    Mahon, Jennifer L; Rozanski, Elizabeth A; Paul, April L

    2017-06-15

    OBJECTIVE To determine the prevalence of dogs hospitalized in an intensive care unit (ICU) with serum antibody titers against canine distemper virus (CDV) and canine parvovirus (CPV). DESIGN Prospective observational study. ANIMALS 80 dogs. PROCEDURES Dogs hospitalized in an ICU for > 12 hours between February 1 and June 1, 2015, that had at least 0.25 mL of serum left over from diagnostic testing were eligible for study inclusion. Dogs with serum antibody titers > 1:32 (as determined by serum neutralization) and > 1:80 (as determined by hemagglutination inhibition) were considered seropositive for CDV and CPV, respectively. The date of last vaccination was obtained from the medical record of each dog. RESULTS Of the 80 dogs, 40 (50%) and 65 (81%) dogs were seropositive for CDV and CPV, respectively. Of the 40 dogs that were seronegative for CDV, 27 had been vaccinated against CDV within 3 years prior to testing. Of the 15 dogs that were seronegative for CPV, 3 had been vaccinated against CPV within 3 years prior to testing. Ten dogs were seronegative for both CDV and CPV. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated the prevalence of dogs hospitalized in an ICU that were seropositive for CDV and CPV was lower than expected given the high vaccination rate reported for dogs. Although the antibody titer necessary to prevent disease caused by CDV or CPV in critically ill dogs is unknown, adherence to infectious disease control guidelines is warranted when CDV- or CPV-infected dogs are treated in an ICU.

  15. The role of canine distemper virus and persistent organic pollutants in mortality patterns of Caspian seals (Pusa caspica).

    Science.gov (United States)

    Wilson, Susan C; Eybatov, Tariel M; Amano, Masao; Jepson, Paul D; Goodman, Simon J

    2014-01-01

    Persistent organic pollutants are a concern for species occupying high trophic levels since they can cause immunosuppression and impair reproduction. Mass mortalities due to canine distemper virus (CDV) occurred in Caspian seals (Pusa caspica), in spring of 1997, 2000 and 2001, but the potential role of organochlorine exposure in these epizootics remains undetermined. Here we integrate Caspian seal mortality data spanning 1971-2008, with data on age, body condition, pathology and blubber organochlorine concentration for carcases stranded between 1997 and 2002. We test the hypothesis that summed PCB and DDT concentrations contributed to CDV associated mortality during epizootics. We show that age is the primary factor explaining variation in blubber organochlorine concentrations, and that organochlorine burden, age, sex, and body condition do not account for CDV infection status (positive/negative) of animals dying in epizootics. Most animals (57%, n = 67) had PCB concentrations below proposed thresholds for toxic effects in marine mammals (17 µg/g lipid weight), and only 3 of 67 animals had predicted TEQ values exceeding levels seen to be associated with immune suppression in harbour seals (200 pg/g lipid weight). Mean organonchlorine levels were higher in CDV-negative animals indicating that organochlorines did not contribute significantly to CDV mortality in epizootics. Mortality monitoring in Azerbaijan 1971-2008 revealed bi-annual stranding peaks in late spring, following the annual moult and during autumn migrations northwards. Mortality peaks comparable to epizootic years were also recorded in the 1970s-1980s, consistent with previous undocumented CDV outbreaks. Gompertz growth curves show that Caspian seals achieve an asymptotic standard body length of 126-129 cm (n = 111). Males may continue to grow slowly throughout life. Mortality during epizootics may exceed the potential biological removal level (PBR) for the population, but the low frequency of

  16. Clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from Hungary to Switzerland.

    Science.gov (United States)

    Willi, Barbara; Spiri, Andrea M; Meli, Marina L; Grimm, Felix; Beatrice, Laura; Riond, Barbara; Bley, Tim; Jordi, Rolf; Dennler, Matthias; Hofmann-Lehmann, Regina

    2015-07-16

    Canine distemper virus (CDV) is a major pathogen of dogs and wild carnivores worldwide. In Switzerland, distemper in domestic dogs is rarely reported. In recent years, the import of dogs from Eastern Europe to Switzerland has steadily increased. In the present study, we describe a distemper outbreak in 15 rescue dogs that were imported from Hungary to Switzerland by an animal welfare organisation. The data on vaccination and medical history were recorded (14 dogs), and the samples were collected to investigate CDV and vector-borne infections (13 dogs) and canine parvovirus infection (12 dogs). The dogs were monitored for six months. One dog was euthanised directly after import. Thirteen dogs showed clinical signs after arrival, i.e., diarrhoea (57 %), coughing (43 %) and nasal and/or ocular discharge (21 %); radiographic findings that were compatible with bronchopneumonia were present in four dogs. CDV infection was diagnosed in 11 dogs (85 %); 10 dogs (91 %) tested PCR-positive in conjunctival swabs. Vector-borne infections (Babesia spp., Leishmania infantum, Dirofilaria immitis) were found in 4 dogs (31 %). Three dogs were hospitalized, and six dogs received ambulatory therapy for up to two months until recovery. None of the dogs developed neurological disease. CDV shedding was detected for a period of up to four months. Because dogs were put under strict quarantine until CDV shedding ceased, CDV did not spread to any other dogs. The CDV isolates showed 99 % sequence identity in the HA gene among each other and belonged to the Arctic-like lineage of CDV. The present study highlights the imminent risks of spreading contagious viral and vector-borne infections through the non-selective import of sick dogs and dogs with incomplete vaccination from Eastern Europe. CDV shedding was detected for several months after the cessation of clinical signs, which emphasised the roles of asymptomatic carriers in CDV epidemiology. A long-term follow-up using sensitive PCR and

  17. BLACK-BACKED JACKAL EXPOSURE TO RABIES VIRUS, CANINE DISTEMPER VIRUS, AND BACILLUS ANTHRACIS IN ETOSHA NATIONAL PARK, NAMIBIA

    Science.gov (United States)

    Bellan, Steve E.; Cizauskas, Carrie A.; Miyen, Jacobeth; Ebersohn, Karen; Küsters, Martina; Prager, Katie; Van Vuuren, Moritz; Sabeta, Claude; Getz, Wayne M.

    2017-01-01

    Canine distemper virus (CDV) and rabies virus (RABV) occur worldwide in wild carnivore and domestic dog populations and pose threats to wildlife conservation and public health. In Etosha National Park (ENP), Namibia, anthrax is endemic and generates carcasses frequently fed on by an unusually dense population of black-backed jackals (Canis mesomelas). Using serology and phylogenetic analyses (on samples obtained from February, 2009 to July, 2010), and historical mortality records (1975–2011), we assessed jackal exposure to Bacillus anthracis (BA; the causal bacterial agent of anthrax), CDV, and RABV. Seroprevalence to all three pathogens was relatively high with 95% (n = 86), 73% (n = 86), and 9% (n = 81) of jackals exhibiting antibodies to BA, CDV, and RABV, respectively. Exposure to BA, as assessed with an anti-Protective Antigen ELISA test, increased significantly with age and all animals >1 yr old tested positive. Seroprevalence of exposure to CDV also increased significantly with age, with similar age-specific trends during both years of the study. No significant effect of age was found on RABV seroprevalence. Three of the seven animals exhibiting immunity to RABV were monitored for more than one year after sampling and did not succumb to the disease. Mortality records revealed that rabid animals are destroyed nearly every year inside the ENP tourist camps. Phylogenetic analyses demonstrated that jackal RABV in ENP is part of the same transmission cycle as other dog-jackal RABV cycles in Namibia. PMID:22493112

  18. Viruses infecting reptiles.

    Science.gov (United States)

    Marschang, Rachel E

    2011-11-01

    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  19. Loss of virulence of canine distemper virus is associated with a structural change recognized by a monoclonal antibody.

    Science.gov (United States)

    Hamburger, D; Griot, C; Zurbriggen, A; Orvell, C; Vandevelde, M

    1991-08-15

    The monoclonal antibody (mAB) L1, which binds to the nucleocapsid protein of canine distemper virus (CDV), was shown to bind to avirulent CDV obtained after serial passages in Vero cells, but not to two different virulent demyelinating CDV-strains propagated in dog glial cell cultures. However, when both virulent CDV-strains were passaged through Vero cells they expressed, after a number of passages, an epitope recognized by mAB L1. The occurrence of the L1 epitope appeared to coincide with loss of virulence in animal inoculation experiments.

  20. Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

    Directory of Open Access Journals (Sweden)

    Mary M Melia

    Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.

  1. [Macrophages in central nervous canine distemper: friends or foes?].

    Science.gov (United States)

    Griot, C; Bürge, T; Brigger, S; Richard, A; Peterhans, E; Vandevelde, M

    1989-01-01

    Brain macrophages play an important role in the CNS. We review some biological aspects of brain macrophages in vivo and in vitro. The criteria and methods used for the identification of these cells are considered. They include some morphological features such as the use of histochemical and immunocytochemical techniques for internal and surface components. In the second part of this review, we describe the role of brain macrophages in canine distemper encephalitis as proposed earlier by us. Studies in cultured dog glial cells infected with canine distemper virus (CDV) have shown that brain macrophages stimulated by anti-CDV antibodies will release reactive oxygen species as measured by chemiluminescence. This response depends on the presence of viral antigens on the surfaces of infected cells and is mediated by the interaction of antigen-bound antibodies with Fc receptors on brain macrophages. These observations support the hypotheses that brain macrophages may contribute to the damage of the white matter observed in canine distemper encephalitis.

  2. Domestic dog origin of canine distemper virus in free-ranging wolves in Portugal as revealed by hemagglutinin gene characterization.

    Science.gov (United States)

    Müller, Alexandra; Silva, Eliane; Santos, Nuno; Thompson, Gertrude

    2011-07-01

    Serologic evidence for canine distemper virus (CDV) has been described in grey wolves but, to our knowledge, virus strains circulating in wolves have not been characterized genetically. The emergence of CDV in several non-dog hosts has been associated with amino acid substitutions at sites 530 and 549 of the hemagglutinin (H) protein. We sequenced the H gene of wild-type canine distemper virus obtained from two free-ranging Iberian wolves (Canis lupus signatus) and from one domestic dog (Canis familiaris). More differences were found between the two wolf sequences than between one of the wolves (wolf 75) and the dog. The latter two had a very high nucleotide similarity resulting in identical H gene amino acid sequences. Possible explanations include geographic and especially temporal proximity of the CDV obtained from wolf 75 and the domestic dog, taken in 2007-2008, as opposed to that from wolf 3 taken more distantly in 1998. Analysis of the deduced amino acids of the viral hemagglutinin revealed a glycine (G) and a tyrosine (Y) at amino acid positions 530 and 549, respectively, of the partial signaling lymphocytic activation molecule (SLAM)-receptor binding region which is typically found in viral strains obtained from domestic dogs. This suggests that the CDV found in these wolves resulted from transmission events from local domestic dogs rather than from wildlife species.

  3. Elements in the canine distemper virus M 3' UTR contribute to control of replication efficiency and virulence.

    Directory of Open Access Journals (Sweden)

    Danielle E Anderson

    Full Text Available Canine distemper virus (CDV is a negative-sense, single-stranded RNA virus within the genus Morbillivirus and the family Paramyxoviridae. The Morbillivirus genome is composed of six transcriptional units that are separated by untranslated regions (UTRs, which are relatively uniform in length, with the exception of the UTR between the matrix (M and fusion (F genes. This UTR is at least three times longer and in the case of CDV also highly variable. Exchange of the M-F region between different CDV strains did not affect virulence or disease phenotype, demonstrating that this region is functionally interchangeable. Viruses carrying the deletions in the M 3' UTR replicated more efficiently, which correlated with a reduction of virulence, suggesting that overall length as well as specific sequence motifs distributed throughout the region contribute to virulence.

  4. Identification of Key Residues in Virulent Canine Distemper Virus Hemagglutinin That Control CD150/SLAM-Binding Activity▿

    Science.gov (United States)

    Zipperle, Ljerka; Langedijk, Johannes P. M.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

    2010-01-01

    Morbillivirus cell entry is controlled by hemagglutinin (H), an envelope-anchored viral glycoprotein determining interaction with multiple host cell surface receptors. Subsequent to virus-receptor attachment, H is thought to transduce a signal triggering the viral fusion glycoprotein, which in turn drives virus-cell fusion activity. Cell entry through the universal morbillivirus receptor CD150/SLAM was reported to depend on two nearby microdomains located within the hemagglutinin. Here, we provide evidence that three key residues in the virulent canine distemper virus A75/17 H protein (Y525, D526, and R529), clustering at the rim of a large recessed groove created by β-propeller blades 4 and 5, control SLAM-binding activity without drastically modulating protein surface expression or SLAM-independent F triggering. PMID:20631152

  5. EVALUATION OF TWO CANINE DISTEMPER VIRUS VACCINES IN CAPTIVE TIGERS (PANTHERA TIGRIS).

    Science.gov (United States)

    Sadler, Ryan A; Ramsay, Edward; McAloose, Denise; Rush, Robert; Wilkes, Rebecca P

    2016-06-01

    Canine distemper virus (CDV) has caused clinical disease and death in nondomestic felids in both captive settings and in the wild. Outbreaks resulting in high mortality rates in tigers (Panthera tigris) have prompted some zoos to vaccinate tigers for CDV. In this study, six tigers received a recombinant canarypox-vectored CDV vaccine (1 ml s.c.) and were revaccinated with 3 ml s.c. (mean) 39 days later. Blood collection for CDV antibody detection via serum neutralization was performed on (mean) days 0, 26, and 66 post-initial vaccination. No tigers had detectable antibodies at days 0 or 26, and only two tigers had low (16 and 32) antibody titers at day 66. Eight additional tigers received a live, attenuated CDV vaccine (1 ml s.c.) on day 0 and were revaccinated with 1 ml s.c. (mean) 171 days later. Blood collection for CDV antibody detection via serum neutralization was performed on (mean) days 0, 26, 171, and 196. Seven of eight tigers receiving the live, attenuated vaccine had no detectable titers prior to vaccination, but all animals had titers of >128 (range 128-1,024) at day 26. At 171 days, all tigers still had detectable titers (geometric mean 69.8, range 16-256), and at 196 days (2 wk post-revaccination) all but two showed an increase to >128 (range 32-512). To determine safety, an additional 41 tigers were vaccinated with 2 ml of a recombinant vaccine containing only CDV components, and an additional 38 tigers received 1 ml of the live, attenuated vaccine, administered either subcutaneously or intramuscularly; no serious adverse effects were noted. Although both vaccines appear safe, the live, attenuated vaccine produced a stronger and more consistent serologic response in tigers.

  6. Molecular analysis of the N gene of canine distemper virus in dogs in Brazil

    Directory of Open Access Journals (Sweden)

    J.G. Castilho

    2007-06-01

    Full Text Available Eleven central-nervous-system samples collected from stray dogs between 2000 and 2004 were found positive by RT-PCR, which amplified a 480bp fragment of the N gene of canine distemper virus (CDV. Phylogenetic analysis based on partial N-gene sequences showed four major clusters. All dog strains segregated into cluster I, with a mean nucleotide identity of 95.8% and 95.6% with the Onderstepoort and Lederle vaccine strains, respectively. Cluster II contained all the raccoon-related strains, cluster III Orient strains and Cluster IV the Onderstepoort and Lederle vaccine strains, with a mean nucleotide identity of 99.7% between them. This is the first report of phylogenetic analysis of CDV strains in Brazil.Onze amostras de sistema nervoso central de cães coletados entre 2000 e 2004 foram positivas pela RT-PCR, a qual amplificou um fragmento de 480pb do gene N do vírus da cinomose canina (VCC. A análise filogenética baseada na seqüência parcial do gene N mostrou quatro principais agrupamentos genéticos. Todas as amostras de cães segregaram no agrupamento I, com identidade média de nucleotídeos de 95,8% e 95,6% com as amostras vacinais Onderstepoort e Lederle, respectivamente. O agrupamento II agregou todas as amostras relacionadas aos guaxinins. O agrupamento III agregou amostras orientais e o agrupamento IV agregou as amostras vacinais Onderstepoort e Lederle, com identidade média de nucleotídeos de 99,7% entre elas. Este é o primeiro relato de análise filogenética de amostras de VCC no Brasil.

  7. Phylogenetic features of hemagglutin gene in canine distemper virus strains from different genetic lineages.

    Science.gov (United States)

    Liao, Peng; Guo, Li; Wen, Yongjun; Yang, Yangling; Cheng, Shipeng

    2015-01-01

    In the present study, the genotype of two Canine distemper virus (CDV) strains, namely, ZJJ-SD and ZJJ-LN, were investigated, based on the whole hemagglutinin (HA) gene. The CDV strains were obtained from two foxes in Shandong Province and Liaoning Province in 2011. Phylogenetic analyses were carried out for 260 CDV strains worldwide, and a statistical analysis was performed in the amino acid substitutions at positions 530 and 549 of the HA protein. Phylogenetic analyses revealed that the two strains, ZJJ-SD and ZJJ-LN, belonged to the CDV Asia I lineage. Site 530 of HA protein was found to be relatively conserved within CDV lineages in different host species by combining the genetic sequence data with the published data from 260 CDV strains worldwide. The data analysis showed a bias toward the predicted substitution Y549H for the non-dog strains in Asia I and Europe lineages. The ratio of site 549 genetic drift in the HA gene were significantly different between dogs and non-dogs in the two lineages. The strain ZJJ-SD, from wild canid, has an Y549H substitution. It is one of three Y549H substitution for wild canids in Asia I lineages. Site 530 of HA protein was not immediately relative to CDV genetic drift from dogs to non-dogs. Statistical analysis indicated that non-dog strains have a high probability to contain Y549H than dog strains in Asia I and Europe lineages. Thus, site 549 is considered important in genetic drift from dogs to non-dogs, at least in Asia I and Europe lineages.

  8. Canine distemper virus in the Serengeti ecosystem: molecular adaptation to different carnivore species.

    Science.gov (United States)

    Nikolin, Veljko M; Olarte-Castillo, Ximena A; Osterrieder, Nikolaus; Hofer, Heribert; Dubovi, Edward; Mazzoni, Camila J; Brunner, Edgar; Goller, Katja V; Fyumagwa, Robert D; Moehlman, Patricia D; Thierer, Dagmar; East, Marion L

    2017-04-01

    Was the 1993/1994 fatal canine distemper virus (CDV) epidemic in lions and spotted hyaenas in the Serengeti ecosystem caused by the recent spillover of a virulent domestic dog strain or one well adapted to these noncanids? We examine this question using sequence data from 13 'Serengeti' strains including five complete genomes obtained between 1993 and 2011. Phylogenetic and haplotype network analyses reveal that strains from noncanids during the epidemic were more closely related to each other than to those from domestic or wild canids. All noncanid 'Serengeti' strains during the epidemic encoded: (1) one novel substitution G134S in the CDV-V protein; and (2) the rare amino acid combination 519I/549H at two sites under positive selection in the region of the CDV-H protein that binds to SLAM (CD 150) host cell receptors. Worldwide, only a few noncanid strains in the America II lineage encode CDV-H 519I/549H. All canid 'Serengeti' strains during the epidemic coded CDV-V 134G, and CDV-H 519R/549Y, or 519R/549H. A functional assay of cell entry revealed the highest performance by CDV-H proteins encoding 519I/549H in cells expressing lion SLAM receptors, and the highest performance by proteins encoding 519R/549Y, typical of dog strains worldwide, in cells expressing dog SLAM receptors. Our findings are consistent with an epidemic in lions and hyaenas caused by CDV variants better adapted to noncanids than canids, but not with the recent spillover of a dog strain. Our study reveals a greater complexity of CDV molecular epidemiology in multihost environments than previously thought. © 2016 John Wiley & Sons Ltd.

  9. Wildlife reservoirs of canine distemper virus resulted in a major outbreak in Danish farmed mink (Neovison vison.

    Directory of Open Access Journals (Sweden)

    Ramona Trebbien

    Full Text Available A major outbreak of canine distemper virus (CDV in Danish farmed mink (Neovison vison started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% - 99.62%. The study furthermore revealed that fleas (Ceratophyllus sciurorum contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks.

  10. Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

    Science.gov (United States)

    Trebbien, Ramona; Chriel, Mariann; Struve, Tina; Hjulsager, Charlotte Kristiane; Larsen, Gitte; Larsen, Lars Erik

    2014-01-01

    A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H) was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM) receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% – 99.62%). The study furthermore revealed that fleas (Ceratophyllus sciurorum) contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks. PMID:24454897

  11. Wildlife reservoirs of canine distemper virus resulted in a major outbreak in Danish farmed mink (Neovison vison).

    Science.gov (United States)

    Trebbien, Ramona; Chriel, Mariann; Struve, Tina; Hjulsager, Charlotte Kristiane; Larsen, Gitte; Larsen, Lars Erik

    2014-01-01

    A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H) was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM) receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% - 99.62%). The study furthermore revealed that fleas (Ceratophyllus sciurorum) contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks.

  12. Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

    Science.gov (United States)

    Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

    2014-12-05

    Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Dog overpopulation and burden of exposure to canine distemper virus and other pathogens on Santa Cruz Island, Galapagos.

    Science.gov (United States)

    Diaz, Nicole M; Mendez, Gabriella S; Grijalva, C Jaime; Walden, Heather S; Cruz, Marilyn; Aragon, Eduardo; Hernandez, Jorge A

    2016-01-01

    Dog overpopulation and diseases are hazards to native island species and humans on the Galapagos. Vaccination and importation of dogs are prohibited on the Galapagos. Risk management of these hazards requires the use of science-based risk assessment and risk communication. The objectives of the study reported here were (i) to estimate the human:dog ratio and (ii) the prevalence of and identify exposure factors associated with positive antibody titers to canine distemper virus (CDV) and other pathogens, as well as infection with intestinal parasites in owned dogs on Santa Cruz Island, Galapagos in September 2014. The observed human:dog ratio was 6.148:1 which extrapolates to 2503 dogs (two times more than a recent dog count conducted by Galapagos Biosecurity Agency in March 2014). The proportion of spayed female dogs (50%) was higher, compared to neutered male dogs (30%) (p=0.04). Prevalence of dogs with positive antibody titers to CDV was 36% (95% CI=26, 46%), to canine parvovirus was 89% (95% CI=82, 95%), and to canine adenovirus was 40% (95% CI=30, 51%). The frequency of seropositive dogs to CDV was lower in urban dogs (26%), compared to rural dogs (53%) (p<0.05). A positive interaction effect between rural residence and spay/neuter status on seropositivity to CDV was observed, which we discuss in this report. Because vaccination is prohibited, the dog population on Santa Cruz is susceptible to an outbreak of CDV (particularly among urban dogs) with potential spill over to marine mammals. Dog's age (1-2 or 3-14 years old, compared to younger dogs), and residence (rural, urban) were associated with positive antibody titers to parvovirus, adenovirus, Ehrlichia spp., or Anaplasma spp., as well as infection with Ancylostoma spp., an intestinal parasite in dogs that can be transmitted to humans, particularly children. These results provide the most comprehensive assessment of dog overpopulation and exposure to CDV and other pathogens on the Galapagos to date

  14. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

    2011-09-01

    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  15. Viruses infecting bivalve molluscs

    OpenAIRE

    Renault, Tristan; Novoa, Beatriz

    2004-01-01

    Bivalve molluscs are filter feeders and as a consequence they may bioaccumulate in their tissues viruses that infect humans and higher vertebrates. However, there have also been described mortalities of bivalve molluscs associated with viruses belonging to different families. Mass mortalities of adult Portuguese oysters, Crassostrea angulata, among French livestocks (between 1967 and 1973) were associated with irido-like virus infections. Herpesviruses were reported in the eastern oyster, Pac...

  16. Pesti Des Petits ruminants virus infection in animals

    Directory of Open Access Journals (Sweden)

    Chauhan H.C.

    2009-08-01

    Full Text Available For centuries morbillivirus infections have had a huge impact on both human beings and animals. Morbilliviruses are highly contagious pathogens that cause some of the most devastating viral diseases of humans and animals world wide. They include measles virus (MV, canine distemper virus (CDV, rinderpest virus (RPV and peste des petits ruminants (PPRV virus. Furthermore, new emerging infectious diseases of morbilliviruses with significant ecological consequences of marine mammals have been discovered in the past decades. Phocid distemper virus (PDV in seals and the cetacean morbillivirus (CMV have been found in dolphins, whales and porpoises. Peste des petits ruminants (PPR is a highly contagious ,infectious , an acute or sub acute viral disease of domestic and wild small ruminants characterized by fever, oculonasal discharges, stomatitis, conjunctivitis, gastroenteritis and pneumonia. Goats are more severely affected than sheep. It is also known as pseudorinderpest of small ruminants, pest of small ruminants, pest of sheep and goats, kata, stomatitis- pneumoentritis syndrome, contagious pustular stomatitis and pneumoentritis complex. It is one of the major notifiable diseases of the World Organization for Animal Health (OIE. [Vet. World 2009; 2(4.000: 150-155

  17. Canine distemper virus persistence in demyelinating encephalitis by swift intracellular cell-to-cell spread in astrocytes is controlled by the viral attachment protein.

    Science.gov (United States)

    Wyss-Fluehmann, Gaby; Zurbriggen, Andreas; Vandevelde, Marc; Plattet, Philippe

    2010-05-01

    The mechanism of viral persistence, the driving force behind the chronic progression of inflammatory demyelination in canine distemper virus (CDV) infection, is associated with non-cytolytic viral cell-to-cell spread. Here, we studied the molecular mechanisms of viral spread of a recombinant fluorescent protein-expressing virulent CDV in primary canine astrocyte cultures. Time-lapse video microscopy documented that CDV spread was very efficient using cell processes contacting remote target cells. Strikingly, CDV transmission to remote cells could occur in less than 6 h, suggesting that a complete viral cycle with production of extracellular free particles was not essential in enabling CDV to spread in glial cells. Titration experiments and electron microscopy confirmed a very low CDV particle production despite higher titers of membrane-associated viruses. Interestingly, confocal laser microscopy and lentivirus transduction indicated expression and functionality of the viral fusion machinery, consisting of the viral fusion (F) and attachment (H) glycoproteins, at the cell surface. Importantly, using a single-cycle infectious recombinant H-knockout, H-complemented virus, we demonstrated that H, and thus potentially the viral fusion complex, was necessary to enable CDV spread. Furthermore, since we could not detect CD150/SLAM expression in brain cells, the presence of a yet non-identified glial receptor for CDV was suggested. Altogether, our findings indicate that persistence in CDV infection results from intracellular cell-to-cell transmission requiring the CDV-H protein. Viral transfer, happening selectively at the tip of astrocytic processes, may help the virus to cover long distances in the astroglial network, "outrunning" the host's immune response in demyelinating plaques, thus continuously eliciting new lesions.

  18. Antagonistic Pleiotropy and Fitness Trade-Offs Reveal Specialist and Generalist Traits in Strains of Canine Distemper Virus

    Science.gov (United States)

    Nikolin, Veljko M.; Osterrieder, Klaus; von Messling, Veronika; Hofer, Heribert; Anderson, Danielle; Dubovi, Edward; Brunner, Edgar; East, Marion L.

    2012-01-01

    Theoretically, homogeneous environments favor the evolution of specialists whereas heterogeneous environments favor generalists. Canine distemper is a multi-host carnivore disease caused by canine distemper virus (CDV). The described cell receptor of CDV is SLAM (CD150). Attachment of CDV hemagglutinin protein (CDV-H) to this receptor facilitates fusion and virus entry in cooperation with the fusion protein (CDV-F). We investigated whether CDV strains co-evolved in the large, homogeneous domestic dog population exhibited specialist traits, and strains adapted to the heterogeneous environment of smaller populations of different carnivores exhibited generalist traits. Comparison of amino acid sequences of the SLAM binding region revealed higher similarity between sequences from Canidae species than to sequences from other carnivore families. Using an in vitro assay, we quantified syncytia formation mediated by CDV-H proteins from dog and non-dog CDV strains in cells expressing dog, lion or cat SLAM. CDV-H proteins from dog strains produced significantly higher values with cells expressing dog SLAM than with cells expressing lion or cat SLAM. CDV-H proteins from strains of non-dog species produced similar values in all three cell types, but lower values in cells expressing dog SLAM than the values obtained for CDV-H proteins from dog strains. By experimentally changing one amino acid (Y549H) in the CDV-H protein of one dog strain we decreased expression of specialist traits and increased expression of generalist traits, thereby confirming its functional importance. A virus titer assay demonstrated that dog strains produced higher titers in cells expressing dog SLAM than cells expressing SLAM of non-dog hosts, which suggested possible fitness benefits of specialization post-cell entry. We provide in vitro evidence for the expression of specialist and generalist traits by CDV strains, and fitness trade-offs across carnivore host environments caused by antagonistic

  19. Antagonistic pleiotropy and fitness trade-offs reveal specialist and generalist traits in strains of canine distemper virus.

    Directory of Open Access Journals (Sweden)

    Veljko M Nikolin

    Full Text Available Theoretically, homogeneous environments favor the evolution of specialists whereas heterogeneous environments favor generalists. Canine distemper is a multi-host carnivore disease caused by canine distemper virus (CDV. The described cell receptor of CDV is SLAM (CD150. Attachment of CDV hemagglutinin protein (CDV-H to this receptor facilitates fusion and virus entry in cooperation with the fusion protein (CDV-F. We investigated whether CDV strains co-evolved in the large, homogeneous domestic dog population exhibited specialist traits, and strains adapted to the heterogeneous environment of smaller populations of different carnivores exhibited generalist traits. Comparison of amino acid sequences of the SLAM binding region revealed higher similarity between sequences from Canidae species than to sequences from other carnivore families. Using an in vitro assay, we quantified syncytia formation mediated by CDV-H proteins from dog and non-dog CDV strains in cells expressing dog, lion or cat SLAM. CDV-H proteins from dog strains produced significantly higher values with cells expressing dog SLAM than with cells expressing lion or cat SLAM. CDV-H proteins from strains of non-dog species produced similar values in all three cell types, but lower values in cells expressing dog SLAM than the values obtained for CDV-H proteins from dog strains. By experimentally changing one amino acid (Y549H in the CDV-H protein of one dog strain we decreased expression of specialist traits and increased expression of generalist traits, thereby confirming its functional importance. A virus titer assay demonstrated that dog strains produced higher titers in cells expressing dog SLAM than cells expressing SLAM of non-dog hosts, which suggested possible fitness benefits of specialization post-cell entry. We provide in vitro evidence for the expression of specialist and generalist traits by CDV strains, and fitness trade-offs across carnivore host environments caused by

  20. Studi Histopatologi Limpa Anjing Penderita Distemper Dikaitkan Dengan Sebaran Sel-Sel Radang Pada Otak Dan Paru (HISTOPHATOLOGICAL STUDY OF SPLEEN ON DOGS INFECTED WITH DISTEMPER ASSOCIATED TO INFLAMATION IN THE BRAIN AND LUNGS)

    OpenAIRE

    Muhamad Furkam Fadilah; I Ketut Berata; I Made Kardena

    2015-01-01

    This study aim was to determine the distribution of inflammatory cells in canine distemper in terms of the level of inflammation in the spleen, brain and lungs. The sample used 20 infected dogs wihich from the spleens, brains, and lungs of the dogs were collected. These organs were processed for histophatological observation using harris hematoxilyn-eosyn stain. The inflammation of the organs examined by using binocular microscope with 200X magnification. the results showed that inflammation ...

  1. 6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro

    OpenAIRE

    de Carvalho, Ot?vio Val?rio; F?lix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, M?rcia Rog?ria; Bressan, Gustavo Costa; Pena, Lindomar Jos?; Silva-J?nior, Abelardo

    2017-01-01

    Background Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic stra...

  2. Protective levels of canine distemper virus antibody in an urban dog population using plaque reduction neutralization test

    Directory of Open Access Journals (Sweden)

    O.I. Oyedele

    2004-11-01

    Full Text Available Blood samples from 50 dogs were collected at three veterinary clinics in Ibadan and Abuja, Nigeria and the serum from each sample was evaluated serologically for neutralizing antibodies against canine distemper virus (CDV by the highly sensitive plaque reduction (PRN neutralization assay. Thirteen dogs had plaque reduction neutralization titres of 0-100, seven had titres of 100-1 000 while 30 had titres ranging from 1 000-6 000. The PRN titres of vaccinated dogs were found to be significantly higher than unvaccinated dogs. The widespread use of the highly reproducible PRN test for the evaluation of antibody response to CDV may be very important in the generation of international CDV positive serum standards that should help to improve pre-and post-vaccination testing of dogs worldwide.

  3. Serologic survey for canine distemper virus and canine parvovirus in free-ranging wild carnivores from Portugal.

    Science.gov (United States)

    Santos, Nuno; Almendra, Cláudia; Tavares, Luís

    2009-01-01

    A serologic survey for Canine distemper virus (CDV) and canine parvovirus (CPV) was performed on serum and lung extract from an opportunistic sample of 120 free-ranging wild carnivores (13 species) from Portugal, collected from 1995 to 2006. Antibodies to CDV were detected in wolf (Canis lupus; 3/27) and red fox (Vulpes vulpes; 2/22). Antibodies to CPV were detected in wolf (9/28), red fox (2/14), wildcat (Felis silvestris;1/8), genet (Genetta genetta; 17/18), and stone marten (Martes foina; 3/17). Antibodies to CPV were detected throughout the study, whereas for CDV antibodies were detected in 3 of 10 yr and only during winter. The extremely high CPV antibody prevalence in genets is unprecedented. Although based on a limited sample, these data suggest widespread exposure of free-ranging Iberian carnivores to CDV and CPV.

  4. Zika virus infection.

    Science.gov (United States)

    Pougnet, Laurence; Thill, Chloé; Pougnet, Richard; Auvinet, Henri; Giacardi, Christophe; Drouillard, Isabelle

    2016-12-01

    A 21-year old woman from New-Caledonia had 40 ̊C fever with vomiting, arthralgia, myalgia, and measles-like rash. Etiological analyses showed primary infection with Zika virus. Because of severe clinical presentation, she was hospitalized in the intensive care unit of the Brest military Hospital. Zika virus is mainly transmitted by Aedes mosquitoes. If they settle in Metropolitan France, Zika virus might also spread there.

  5. [ZIKA--VIRUS INFECTION].

    Science.gov (United States)

    Velev, V

    2016-01-01

    This review summarizes the knowledge of the scientific community for Zika-virus infection. It became popular because of severe congenital damage causes of CNS in newborns whose mothers are infected during pregnancy, as well as the risk of pandemic distribution. Discusses the peculiarities of the biology and ecology of vectors--blood-sucking mosquitoes Aedes; stages in the spread of infection and practical problems which caused during pregnancy. Attention is paid to the recommendations that allow leading national and international medical organizations to deal with the threat Zika-virus infection.

  6. GAMBARAN PATOLOGI PARU-PARU PADA ANJING LOKAL BALI YANG TERINFEKSI PENYAKIT DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Made Kardena

    2012-11-01

    Full Text Available Canine distemper is a contagious disease, which can infect any dog species includingdomestic dog in Bali. This research used ten domestic dogs in Bali, which were naturallyinfected with canine distemper virus and have been positively confirmed by laboratory testusing RT-PCR method. Lung tissue changes have been identified on gross pathologicalobservation, i.e.: on average the lungs were changed in color and size. The lungs mainlychanged into pale or darker; in addition, the lungs tended to become bigger. Mean while,the septa alveoli of the lungs observed thicker and were infiltrated by inflammatory cells.This tissue changes indicated that canine distemper virus which infected domestic dog inBali caused inflammatory reaction in lung, which is known as interstitial pneumoniainterstitial. These changes implied to be related to the disturbance of the respiration tract,which was accompanied by mucus-purulent exudates

  7. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

  8. Development of a novel real-time qPCR assay for the dual detection of canine and phocine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Linette Buxbom; Hjulsager, Charlotte Kristiane; Larsen, Helene

    conventional PCR assays with real-time PCR assays to obtain a uniform assay palette. The present work describes the development of a novel real-time RT-qPCR assay for the dual detection of canine and phocine distemper virus. The assay is relevant for the future detection of outbreaks of canine distemper virus...... influenza, a common differential diagnosis in mink and seals. Further testing is needed to determine the effects of PCR inhibitors in clinical samples. In addition, an elaborate panel of potential differential diagnostic agents must be tested in order to determine the assay specificity.......In a commercial diagnostic setting streamlining and optimization is an important factor when the goal is to provide high quality diagnostic results while remaining competitive. In the PCR diagnostics unit at DTU National Veterinary Institute part of this optimization programme is to replace...

  9. Canine Distemper in an isolated population of fishers (Martes pennanti) from California

    Science.gov (United States)

    Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda. Munson

    2012-01-01

    Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...

  10. Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

    Science.gov (United States)

    Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

    2013-08-01

    Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

  11. Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

    2012-10-01

    The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

  12. Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

    Science.gov (United States)

    Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

    2016-08-02

    In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

  13. Varicella zoster virus infection

    Science.gov (United States)

    Gershon, Anne A.; Breuer, Judith; Cohen, Jeffrey I.; Cohrs, Randall J.; Gershon, Michael D.; Gilden, Don; Grose, Charles; Hambleton, Sophie; Kennedy, Peter G. E.; Oxman, Michael N.; Seward, Jane F.; Yamanishi, Koichi

    2017-01-01

    Infection with varicella zoster virus (VZV) causes varicella (chickenpox), which can be severe in immunocompromised individuals, infants and adults. Primary infection is followed by latency in ganglionic neurons. During this period, no virus particles are produced and no obvious neuronal damage occurs. Reactivation of the virus leads to virus replication, which causes zoster (shingles) in tissues innervated by the involved neurons, inflammation and cell death — a process that can lead to persistent radicular pain (postherpetic neuralgia). The pathogenesis of postherpetic neuralgia is unknown and it is difficult to treat. Furthermore, other zoster complications can develop, including myelitis, cranial nerve palsies, meningitis, stroke (vasculopathy), retinitis, and gastroenterological infections such as ulcers, pancreatitis and hepatitis. VZV is the only human herpesvirus for which highly effective vaccines are available. After varicella or vaccination, both wild-type and vaccine-type VZV establish latency, and long-term immunity to varicella develops. However, immunity does not protect against reactivation. Thus, two vaccines are used: one to prevent varicella and one to prevent zoster. In this Primer we discuss the pathogenesis, diagnosis, treatment, and prevention of VZV infections, with an emphasis on the molecular events that regulate these diseases. For an illustrated summary of this Primer, visit: http://go.nature.com/14×VI1 PMID:27188665

  14. [Zika virus infection during pregnancy].

    Science.gov (United States)

    Picone, O; Vauloup-Fellous, C; D'Ortenzio, E; Huissoud, C; Carles, G; Benachi, A; Faye, A; Luton, D; Paty, M-C; Ayoubi, J-M; Yazdanpanah, Y; Mandelbrot, L; Matheron, S

    2016-05-01

    A Zika virus epidemic is currently ongoing in the Americas. This virus is linked to congenital infections with potential severe neurodevelopmental dysfunction. However, incidence of fetal infection and whether this virus is responsible of other fetal complications are still unknown. National and international public health authorities recommend caution and several prevention measures. Declaration of Zika virus infection is now mandatory in France. Given the available knowledge on Zika virus, we suggest here a review of the current recommendations for management of pregnancy in case of suspicious or infection by Zika virus in a pregnant woman. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  15. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

    International Nuclear Information System (INIS)

    Zhang, Xinsheng; Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J.; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A.; Parks, Christopher L.

    2015-01-01

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance

  16. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xinsheng, E-mail: xzhang@iavi.org [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States); Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Anzala, Omu [Kenya AIDS Vaccine Initiative (KAVI)-Institute of Clinical Research, Nairobi (Kenya); Sanders, Eduard J. [Centre for Geographic Medicine Research, Kenya Medical Research Institute (KEMRI), Kilifi, Kenya & Centre for Clinical Vaccinology and Tropical Medicine, University of Oxford, Headington (United Kingdom); Kamali, Anatoli [MRC/UVRI Uganda Virus Research Unit on AIDS, Masaka and Entebbe (Uganda); Karita, Etienne [Projet San Francisco, Kigali (Rwanda); Allen, Susan [Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Fast, Pat [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Gilmour, Jill [Human Immunology Laboratory, International AIDS Vaccine Initiative, London (United Kingdom); Price, Matt A. [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Department of Epidemiology and Biostatistics, University of California at San Francisco, San Francisco, CA (United States); Parks, Christopher L. [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States)

    2015-08-15

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.

  17. An outbreak of canine distemper virus in tigers (Panthera tigris): possible transmission from wild animals to zoo animals.

    Science.gov (United States)

    Nagao, Yumiko; Nishio, Yohei; Shiomoda, Hiroshi; Tamaru, Seiji; Shimojima, Masayuki; Goto, Megumi; Une, Yumi; Sato, Azusa; Ikebe, Yusuke; Maeda, Ken

    2012-06-01

    Canine distemper virus (CDV), a morbillivirus that causes one of the most contagious and lethal viral diseases known in canids, has an expanding host range, including wild animals. Since December 2009, several dead or dying wild raccoon dogs (Nyctereutes procyonoides) were found in and around one safari-style zoo in Japan, and CDV was isolated from four of these animals. In the subsequent months (January to February 2010), 12 tigers (Panthera tigris) in the zoo developed respiratory and gastrointestinal diseases, and CDV RNA was detected in fecal samples of the examined tigers. In March 2010, one of the tigers developed a neurological disorder and died; CDV was isolated from the lung of this animal. Sequence analysis of the complete hemagglutinin (H) gene and the signal peptide region of the fusion (F) gene showed high homology among these isolates (99.8-100%), indicating that CDV might have been transmitted from raccoon dog to tiger. In addition, these isolates belonged to genotype Asia-1 and had lower homology (<90%) to the vaccine strain (Onderstepoort). Seropositivity of lions (Panthera leo) in the zoo and wild bears (Ursus thibetanus) captured around this area supported the theory that a CDV epidemic had occurred in many mammal species in and around the zoo. These results indicate a risk of CDV transmission among many animal species, including large felids and endangered species.

  18. Use of hydrophilic extra-viral domain of canine distemper virus H protein for enzyme-linked immunosorbent assay development.

    Science.gov (United States)

    Cho, Ki-hyun; Kim, Jeongmi; Yoo, Hyun-ah; Kim, Dae-hee; Park, Seung-yong; Song, Chang-seon; Choi, In-soo; Lee, Joong-bok

    2014-12-01

    Simple methods for measuring the levels of serum antibody against canine distemper virus (CDV) would assist in the effective vaccination of dogs. To develop an enzyme-linked immunosorbent assay (ELISA) specific for CDV, we expressed hydrophilic extra-viral domain (HEVD) protein of the A75/17-CDV H gene in a pET 28a plasmid-based Escherichia (E.) coli vector system. Expression was confirmed by dot and Western blotting. We proposed that detection of E. coli-expressed H protein might be conformation- dependent because intensities of the reactions observed with these two methods varied. The H gene HEVD protein was further purified and used as an antigen for an ELISA. Samples from dogs with undetectable to high anti-CDV antibody titers were analyzed using this HEVD-specific ELISA and a commercial CDV antibody detection kit (ImmunoComb). Levels of HEVD antigenicity measured with the assays and immunochromatography correlated. These data indicated that the HEDV protein may be used as antigen to develop techniques for detecting antibodies against CDV.

  19. Identification of a novel canine distemper virus B-cell epitope using a monoclonal antibody against nucleocapsid protein.

    Science.gov (United States)

    Yi, Li; Cheng, Yuening; Zhang, Miao; Cao, Zhigang; Tong, Mingwei; Wang, Jianke; Zhao, Hang; Lin, Peng; Cheng, Shipeng

    2016-02-02

    Canine distemper virus (CDV) is a member of the genus Morbillivirus within the family Paramyxoviridae and has caused severe economic losses in China. Nucleocapsid protein (N) is the major structural viral protein and can be used to diagnose CDV and other morbilliviruses. In this study, a specific monoclonal antibody, 1N8, was produced against the CDV N protein (amino acids 277-471). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis. The results indicated that (350)LNFGRSYFDPA(360) was the minimal linear epitope that could be recognized by mAb 1N8. ELISA assays revealed that mouse anti-CDV sera could also recognize the minimal linear epitope. Alignment analysis of the amino acid sequences indicated that the epitope was highly conserved among CDV strains. Furthermore, the epitope was conserved among other morbilliviruses, which was confirmed with PRRV using western blotting. Taken together, the results of this study may have potential applications in the development of suitable diagnostic techniques for CDV or other morbilliviruses. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Zika virus infection

    DEFF Research Database (Denmark)

    Nazerai, Loulieta; Scholler, Amalie Skak; Buus, Soren

    2017-01-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus that has drawn worldwide attention due to its association to neurologic complications, particularly severe congenital malformations. While ZIKV can replicate efficiently and cause disease in human hosts, it fails to replicate to substantial titers...... mice by introducing the virus directly in the brain via intracerebral (i.c.) inoculation. In this way, the antigen is precisely placed at the site of interest, evading the first line of defense, and thus rendering the mice susceptible to infection. We found that, while intravenous (i.v.) inoculation...... of two different strains of WT mice with low doses of ZIKV does not result in viremia, it is nevertheless able to induce both cell-mediated and humoral immunity as well as clinical protection against subsequent i.c challenge with lethal doses of the virus. In order to determine the contribution of key...

  2. Zika virus infections.

    Science.gov (United States)

    de Laval, F; Leparc-Goffart, I; Meynard, J-B; Daubigny, H; Simon, F; Briolant, S

    2016-05-01

    Since its discovery in 1947 in Uganda, the Zika virus (ZIKV) remained in the shadows emerging in 2007 in Micronesia, where hundreds of dengue-like syndromes were reported. Then, in 2013-2014, it was rife in French Polynesia, where the first neurological effects were observed. More recently, its arrival in Brazil was accompanied by an unusually high number of children with microcephaly born to mothers infected with ZIKV during the first trimester of pregnancy. In 2016, the World Health Organization declared ZIKV infection to be a public health emergency and now talks about a ZIKV pandemic. This review aims to summarize the current knowledge about ZIKV infection, successively addressing its transmission, epidemiology, clinical aspects, diagnosis, treatment, and prevention before discussing some perspectives.

  3. Canine distemper in endangered Ethiopian wolves.

    Science.gov (United States)

    Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio

    2015-05-01

    The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore.

  4. Zika Virus Infection

    Directory of Open Access Journals (Sweden)

    I.B. Yershova

    2016-04-01

    Full Text Available Zika virus disease — an infectious disease caused by a virus of the same name from the Flaviviridae family. The main route of transmission of the virus is the infection through the blood during a bite by tropical mosquitoes of Aedes genus and sexual contact with a patient. Only in Brazil in 2015 Zika fever affected a half million people. There is a serious risk of further spread of the infection, for this reason, the disease has been given a status of pandemic. The incubation period is 3 to 12 days. In 75 % of cases, Zika fever is asymptomatic. Symptomatic form is usually occurs in a mild, rarely — in moderate-to-severe form. The symptoms — weakness, often low-grade fever, chills, heada­che, retro-orbital pain, myalgia and arthralgia, maculopapular rash on the face and body. Conjunctivitis, intolerance of bright light develop. Nausea, abdominal pain, diarrhea, cough, sore throat, lymphadenopathy occur less often. Cases of death in people with fever Zika are extremely rare. In areas, where Zika fever outbreak is detected, an increased number of children born with microcephaly is recorded. The disease is diagnosed by polymerase chain reaction. Drugs for the treatment and vaccines for the prevention of the disease do not exist. Conventional antiviral drugs are ineffective. The only way of medical exposure is symptomatic treatment. After recovery, lifelong immunity is formed. Protection against disease is only avoiding mosquito bites in areas where there is Zika fever.

  5. The recombinant EHV-1 vector producing CDV hemagglutinin as potential vaccine against canine distemper.

    Science.gov (United States)

    Pan, Zihao; Liu, Jin; Ma, Jiale; Jin, Qiuli; Yao, Huochun; Osterrieder, Nikolaus

    2017-10-01

    Canine distemper virus (CDV), is a pantropic agent of morbillivirus that causes fetal disease in dogs. Base on a broad host rang of CDV, the continued vaccines inoculation is unavoidable to pose gene recombination risk in vaccine virus and wild virus. The current study presents the construction of novel vectors, using equine herpesvirus type 1 (EHV-1) expressing the canine distemper virus (CDV). The recent field strain hemagglutinin protein and nucleoprotein were used for the construction of the viral vector vaccines. Based on the Bacterial artificial chromosome (BAC) genomes of EHV-1 RacH strain, the recombinant EHV-1 vaccine virus encoding CDV hemagglutinin protein (EHV-H) or CDV nucleoprotein (EHV-N) was constructed separately. The constructed BACs were rescued after 72 h post infection, and the expression of H or N in the recombinant viruses was confirmed by western-blotting. Furthermore, high levels of neutralizing antibodies were induced persistently following vaccination in the groups EHV-H&EHV-N and EHV-H, but the EHV-N group. The groups of vaccinated EHV-H and EHV-H&EHV-N pups were monitored for clinical signs, whereas the vaccinated EHV-N group developed moderate symptoms. The present study demonstrated that EHV-1 based recombinant virus carrying CDV H could be a promising vaccine candidate against canine distemper. Copyright © 2017. Published by Elsevier Ltd.

  6. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  7. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

    Science.gov (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

    2012-12-01

    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  8. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013.

    Science.gov (United States)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina

    2015-09-30

    During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be

  9. Emergence of canine distemper virus strains with two amino acid substitutions in the haemagglutinin protein, detected from vaccinated carnivores in North-Eastern China in 2012-2013.

    Science.gov (United States)

    Zhao, Jianjun; Zhang, Hailing; Bai, Xue; Martella, Vito; Hu, Bo; Sun, Yangang; Zhu, Chunsheng; Zhang, Lei; Liu, Hao; Xu, Shujuan; Shao, Xiqun; Wu, Wei; Yan, Xijun

    2014-04-01

    A total of 16 strains of canine distemper virus (CDV) were detected from vaccinated minks, foxes, and raccoon dogs in four provinces in North-Eastern China between the end of 2011 and 2013. Upon sequence analysis of the haemagglutinin gene and comparison with wild-type CDV from different species in the same geographical areas, two non-synonymous single nucleotide polymorphisms were identified in 10 CDV strains, which led to amino acid changes at positions 542 (isoleucine to asparagine) and 549 (tyrosine to histidine) of the haemagglutinin protein coding sequence. The change at residue 542 generated a potentially novel N-glycosylation site. Masking of antigenic epitopes by sugar moieties might represent a mechanism for evasion of virus neutralising antibodies and reduced protection by vaccination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain

    DEFF Research Database (Denmark)

    Martella, V.; Blixenkrone-Møller, Merete; Elia, G.

    2011-01-01

    to differ from the commonly used vaccine strain, Onderstepoort (93.0% nt and 91.7% aa), and to resemble more closely (99.6% nt and 99.3% aa) a CDV strain detected in China from a Lesser Panda (Ailurus fulgens). An additional four CDV strains matching (>99% nt identity) the Rockborn virus were identified...

  11. Distemper virus as a cause of central nervous disease and death in badgers (Meles meles) in Denmark

    DEFF Research Database (Denmark)

    Hammer, Anne Sofie; Dietz, H. H.; Andersen, T. H.

    2004-01-01

    During the summer of 2002 a distemper-like disease was observed in the free-ranging badger population in Denmark. It was characterised by grand seizures, abnormal behaviour and death; the badgers all had severe chronic pneumonia and some had non-suppurative encephalomyelitis. in this study, eight...

  12. Cross-species transmission of canine distemper virus—an update

    Directory of Open Access Journals (Sweden)

    Andreas Beineke

    2015-12-01

    Full Text Available Canine distemper virus (CDV is a pantropic morbillivirus with a worldwide distribution, which causes fatal disease in dogs. Affected animals develop dyspnea, diarrhea, neurological signs and profound immunosuppression. Systemic CDV infection, resembling distemper in domestic dogs, can be found also in wild canids (e.g. wolves, foxes, procyonids (e.g. raccoons, kinkajous, ailurids (e.g. red pandas, ursids (e.g. black bears, giant pandas, mustelids (e.g. ferrets, minks, viverrids (e.g. civets, genets, hyaenids (e.g. spotted hyenas, and large felids (e.g. lions, tigers. Furthermore, besides infection with the closely related phocine distemper virus, seals can become infected by CDV. In some CDV outbreaks including the mass mortalities among Baikal and Caspian seals and large felids in the Serengeti Park, terrestrial carnivores including dogs and wolves have been suspected as vectors for the infectious agent. In addition, lethal infections have been described in non-carnivore species such as peccaries and non-human primates demonstrating the remarkable ability of the pathogen to cross species barriers. Mutations affecting the CDV H protein required for virus attachment to host-cell receptors are associated with virulence and disease emergence in novel host species. The broad and expanding host range of CDV and its maintenance within wildlife reservoir hosts considerably hampers disease eradication.

  13. Evidence of endemic Hendra virus infection in flying-foxes (Pteropus conspicillatus)--implications for disease risk management.

    Science.gov (United States)

    Breed, Andrew C; Breed, Martin F; Meers, Joanne; Field, Hume E

    2011-01-01

    This study investigated the seroepidemiology of Hendra virus in a spectacled flying-fox (Pteropus conspicillatus) population in northern Australia, near the location of an equine and associated human Hendra virus infection in late 2004. The pattern of infection in the population was investigated using a serial cross-sectional serological study over a 25-month period, with blood sampled from 521 individuals over six sampling sessions. Antibody titres to the virus were determined by virus neutralisation test. In contrast to the expected episodic infection pattern, we observed that seroprevalence gradually increased over the two years suggesting infection was endemic in the population over the study period. Our results suggested age, pregnancy and lactation were significant risk factors for a detectable neutralizing antibody response. Antibody titres were significantly higher in females than males, with the highest titres occurring in pregnant animals. Temporal variation in antibody titres suggests that herd immunity to the virus may wax and wane on a seasonal basis. These findings support an endemic infection pattern of henipaviruses in bat populations suggesting their infection dynamics may differ significantly from the acute, self limiting episodic pattern observed with related viruses (e.g. measles virus, phocine distemper virus, rinderpest virus) hence requiring a much smaller critical host population size to sustain the virus. These findings help inform predictive modelling of henipavirus infection in bat populations, and indicate that the life cycle of the reservoir species should be taken into account when developing risk management strategies for henipaviruses.

  14. Evidence of endemic Hendra virus infection in flying-foxes (Pteropus conspicillatus--implications for disease risk management.

    Directory of Open Access Journals (Sweden)

    Andrew C Breed

    Full Text Available This study investigated the seroepidemiology of Hendra virus in a spectacled flying-fox (Pteropus conspicillatus population in northern Australia, near the location of an equine and associated human Hendra virus infection in late 2004. The pattern of infection in the population was investigated using a serial cross-sectional serological study over a 25-month period, with blood sampled from 521 individuals over six sampling sessions. Antibody titres to the virus were determined by virus neutralisation test. In contrast to the expected episodic infection pattern, we observed that seroprevalence gradually increased over the two years suggesting infection was endemic in the population over the study period. Our results suggested age, pregnancy and lactation were significant risk factors for a detectable neutralizing antibody response. Antibody titres were significantly higher in females than males, with the highest titres occurring in pregnant animals. Temporal variation in antibody titres suggests that herd immunity to the virus may wax and wane on a seasonal basis. These findings support an endemic infection pattern of henipaviruses in bat populations suggesting their infection dynamics may differ significantly from the acute, self limiting episodic pattern observed with related viruses (e.g. measles virus, phocine distemper virus, rinderpest virus hence requiring a much smaller critical host population size to sustain the virus. These findings help inform predictive modelling of henipavirus infection in bat populations, and indicate that the life cycle of the reservoir species should be taken into account when developing risk management strategies for henipaviruses.

  15. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Science.gov (United States)

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Immunohistochemical detection of metalloproteinase-9 (MMP-9, anti-oxidant like 1 protein (AOP-1 and synaptosomal-associated protein (SNAP-25 in the cerebella of dogs naturally infected with spontaneous canine distemper

    Directory of Open Access Journals (Sweden)

    Tereza C. Cardoso

    2011-04-01

    Full Text Available In most viral infections of the central nervous system (CNS, the integrity of brain extracelluar matrix (ECM, oxidative stress and dysfunction in neuronal transmission may contribute to the observed pathology. The purpose of this study was to investigate the role of these factors in demyelinating canine distemper virus (CDV infections. Regardless of ECM integrity, the expression of metalloproteinase-9 (MMP-9 was visualized in microglial-like cells, whereas the expression of anti-oxidant like-1 (AOP-1 and synaptosomal associated protein (SNAP-25 was frequently detected in Purkinje cells (r2 = 0.989; p < 0.05, regardless of whether the lesions were classified as acute or chronic. Increased numbers of immunolabeled microglia-like cells and reactive gliosis were observed in advanced cases of demyelinating CDV, suggesting that the expression of AOP-1 and SNAP-25 is correlated with the ultimate death of affected cells. Our findings bring a new perspective to understanding the role of the AOP-1, MMP-9 and SNAP-25 proteins in mediating chronic leukoencephalitis caused by CDV. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 1, pp. 41–48

  17. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein.

    Science.gov (United States)

    Zhang, Xinsheng; Wallace, Olivia L; Domi, Arban; Wright, Kevin J; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A; Parks, Christopher L

    2015-08-01

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Autophagy in Measles Virus Infection

    Directory of Open Access Journals (Sweden)

    Aurore Rozières

    2017-11-01

    Full Text Available Autophagy is a biological process that helps cells to recycle obsolete cellular components and which greatly contributes to maintaining cellular integrity in response to environmental stress factors. Autophagy is also among the first lines of cellular defense against invading microorganisms, including viruses. The autophagic destruction of invading pathogens, a process referred to as xenophagy, involves cytosolic autophagy receptors, such as p62/SQSTM1 (Sequestosome 1 or NDP52/CALCOCO2 (Nuclear Dot 52 KDa Protein/Calcium Binding And Coiled-Coil Domain 2, which bind to microbial components and target them towards growing autophagosomes for degradation. However, most, if not all, infectious viruses have evolved molecular tricks to escape from xenophagy. Many viruses even use autophagy, part of the autophagy pathway or some autophagy-associated proteins, to improve their infectious potential. In this regard, the measles virus, responsible for epidemic measles, has a unique interface with autophagy as the virus can induce multiple rounds of autophagy in the course of infection. These successive waves of autophagy result from distinct molecular pathways and seem associated with anti- and/or pro-measles virus consequences. In this review, we describe what the autophagy–measles virus interplay has taught us about both the biology of the virus and the mechanistic orchestration of autophagy.

  19. Membrane-bound SIV envelope trimers are immunogenic in ferrets after intranasal vaccination with a replication-competent canine distemper virus vector.

    Science.gov (United States)

    Zhang, Xinsheng; Wallace, Olivia; Wright, Kevin J; Backer, Martin; Coleman, John W; Koehnke, Rebecca; Frenk, Esther; Domi, Arban; Chiuchiolo, Maria J; DeStefano, Joanne; Narpala, Sandeep; Powell, Rebecca; Morrow, Gavin; Boggiano, Cesar; Zamb, Timothy J; Richter King, C; Parks, Christopher L

    2013-11-01

    We are investigating canine distemper virus (CDV) as a vaccine vector for the delivery of HIV envelope (Env) that closely resembles the native trimeric spike. We selected CDV because it will promote vaccine delivery to lymphoid tissues, and because human exposure is infrequent, reducing potential effects of pre-existing immunity. Using SIV Env as a model, we tested a number of vector and gene insert designs. Vectors containing a gene inserted between the CDV H and L genes, which encoded Env lacking most of its cytoplasmic tail, propagated efficiently in Vero cells, expressed the immunogen on the cell surface, and incorporated the SIV glycoprotein into progeny virus particles. When ferrets were vaccinated intranasally, there were no signs of distress, vector replication was observed in the gut-associated lymphoid tissues, and the animals produced anti-SIV Env antibodies. These data show that live CDV-SIV Env vectors can safely induce anti-Env immune responses following intranasal vaccination. © 2013 Elsevier Inc. All rights reserved.

  20. Dengue virus antibodies enhance Zika virus infection.

    Science.gov (United States)

    Paul, Lauren M; Carlin, Eric R; Jenkins, Meagan M; Tan, Amanda L; Barcellona, Carolyn M; Nicholson, Cindo O; Michael, Scott F; Isern, Sharon

    2016-12-01

    For decades, human infections with Zika virus (ZIKV), a mosquito-transmitted flavivirus, were sporadic, associated with mild disease, and went underreported since symptoms were similar to other acute febrile diseases. Recent reports of severe disease associated with ZIKV have greatly heightened awareness. It is anticipated that ZIKV will continue to spread in the Americas and globally where competent Aedes mosquito vectors are found. Dengue virus (DENV), the most common mosquito-transmitted human flavivirus, is both well-established and the source of outbreaks in areas of recent ZIKV introduction. DENV and ZIKV are closely related, resulting in substantial antigenic overlap. Through antibody-dependent enhancement (ADE), anti-DENV antibodies can enhance the infectivity of DENV for certain classes of immune cells, causing increased viral production that correlates with severe disease outcomes. Similarly, ZIKV has been shown to undergo ADE in response to antibodies generated by other flaviviruses. We tested the neutralizing and enhancing potential of well-characterized broadly neutralizing human anti-DENV monoclonal antibodies (HMAbs) and human DENV immune sera against ZIKV using neutralization and ADE assays. We show that anti-DENV HMAbs, cross-react, do not neutralize, and greatly enhance ZIKV infection in vitro . DENV immune sera had varying degrees of neutralization against ZIKV and similarly enhanced ZIKV infection. Our results suggest that pre-existing DENV immunity may enhance ZIKV infection in vivo and may lead to increased disease severity. Understanding the interplay between ZIKV and DENV will be critical in informing public health responses and will be particularly valuable for ZIKV and DENV vaccine design and implementation strategies.

  1. Chikungunya VIrUS infection

    African Journals Online (AJOL)

    A retrospective study of 107 cases of serologically proven chikungunya (CHIK) virus infection was undertaken. All respondents 'had contracted the. 'disease at least 3 years previously; 87,9% had fully .recovered, 3,7% experienced only occasional stiff- ness or mild discomfort, 2,8% had persistent resi- dual joint stiffness but ...

  2. Canine distemper, a re-emerging morbillivirus with complex neuropathogenic mechanisms.

    Science.gov (United States)

    Griot, Christian; Vandevelde, Marc; Schobesberger, Martina; Zurbriggen, Andreas

    2003-06-01

    Paramyxoviruses are responsible for a wide variety of diseases both in humans and in animals. Common to many paramyxoviruses is the fact that they can cause neurological symptoms in their final host. Newly discovered paramyxoviruses, such as the Hendra and Nipah viruses, show the same pattern of pathogenesis as that of the paramyxoviruses already known. Canine distemper virus (CDV) is a well-studied member of the genus Morbillivirus. Study of the neuropathogenesis of CDV might give insight into disease mechanisms and suggest approaches for the prevention of other recently discovered paramyxovirus infections.

  3. Neonatal Herpes Simplex Virus Infection.

    Science.gov (United States)

    James, Scott H; Kimberlin, David W

    2015-09-01

    Herpes simplex virus (HSV) 1 and HSV-2 infections are highly prevalent worldwide and are characterized by establishing lifelong infection with periods of latency interspersed with periodic episodes of reactivation. Acquisition of HSV by an infant during the peripartum or postpartum period results in neonatal HSV disease, a rare but significant infection that can be associated with severe morbidity and mortality, especially if there is dissemination or central nervous system involvement. Diagnostic and therapeutic advances have led to improvements in mortality and, to a lesser extent, neurodevelopmental outcomes, but room exists for further improvement. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-05-23

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

  5. The canine MHC class Ia allele DLA-88*508:01 presents diverse self- and canine distemper virus-origin peptides of varying length that have a conserved binding motif.

    Science.gov (United States)

    Ross, Peter; Nemec, Paige S; Kapatos, Alexander; Miller, Keith R; Holmes, Jennifer C; Suter, Steven E; Buntzman, Adam S; Soderblom, Erik J; Collins, Edward J; Hess, Paul R

    2018-03-01

    Ideally, CD8+ T-cell responses against virally infected or malignant cells are defined at the level of the specific peptide and restricting MHC class I element, a determination not yet made in the dog. To advance the discovery of canine CTL epitopes, we sought to determine whether a putative classical MHC class Ia gene, Dog Leukocyte Antigen (DLA)-88, presents peptides from a viral pathogen, canine distemper virus (CDV). To investigate this possibility, DLA-88*508:01, an allele prevalent in Golden Retrievers, was expressed as a FLAG-tagged construct in canine histiocytic cells to allow affinity purification of peptide-DLA-88 complexes and subsequent elution of bound peptides. Pattern analysis of self peptide sequences, which were determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS), permitted binding preferences to be inferred. DLA-88*508:01 binds peptides that are 9-to-12 amino acids in length, with a modest preference for 9- and 11-mers. Hydrophobic residues are favored at positions 2 and 3, as are K, R or F residues at the C-terminus. Testing motif-matched and -unmatched synthetic peptides via peptide-MHC surface stabilization assay using a DLA-88*508:01-transfected, TAP-deficient RMA-S line supported these conclusions. With CDV infection, 22 viral peptides ranging from 9-to-12 residues in length were identified in DLA-88*508:01 eluates by LC-MS/MS. Combined motif analysis and surface stabilization assay data suggested that 11 of these 22 peptides, derived from CDV hemagglutinin, large polymerase, matrix, nucleocapsid, and V proteins, were processed and presented, and thus, potential targets of anti-viral CTL in DLA-88*508:01-bearing dogs. The presentation of diverse self and viral peptides indicates that DLA-88 is a classical MHC class Ia gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Canine Distemper Virus Antigen Detection in External Epithelia of Recently Vaccinated, Sick Dogs by Fluorescence Microscopy Is a Valuable Prognostic Indicator

    Science.gov (United States)

    Neel, Tina

    2014-01-01

    Currently, there are no reliable predictors of the clinical outcomes of domesticated dogs that have been recently vaccinated against canine distemper virus (CDV) and develop respiratory disease. In this study, vaccinated dogs from Oklahoma City that were showing clinical signs of respiratory disease were evaluated for CDV antigen using a direct fluorescent antibody test (FAT). Clinical outcomes after standard symptomatic therapy for respiratory disease were recorded, and a statistical analysis of the results was performed. We present our study showing that CDV FAT results were predictive of clinical recovery (prognostic indicator, prospects of clinical recovery) among vaccinated dogs showing clinical signs of respiratory disease. Negative CDV FAT results equated to 80% chances of recovery after symptomatic therapy, compared to 55% chances of recovery when the CDV FAT results were positive. Based on the results of this study, we show that veterinarians can make better informed decisions about the clinical outcomes of suspected CDV cases, with 2-h turnaround times, by using the CDV FAT. Thus, antemortem examination with the CDV FAT on external epithelia of recently vaccinated, sick dogs is a clinically useful diagnostic test and valuable prognostic indicator for veterinarians. Application of the CDV FAT to these samples avoids unnecessary euthanasia of dogs with suspected CDV. PMID:25428156

  7. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Directory of Open Access Journals (Sweden)

    Nicolás Sarute

    Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  8. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Science.gov (United States)

    Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

    2013-01-01

    Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  9. Virus-host interaction in feline immunodeficiency virus (FIV) infection.

    Science.gov (United States)

    Taniwaki, Sueli Akemi; Figueiredo, Andreza Soriano; Araujo, João Pessoa

    2013-12-01

    Feline immunodeficiency virus (FIV) infection has been the focus of several studies because this virus exhibits genetic and pathogenic characteristics that are similar to those of the human immunodeficiency virus (HIV). FIV causes acquired immunodeficiency syndrome (AIDS) in cats, nevertheless, a large fraction of infected cats remain asymptomatic throughout life despite of persistent chronic infection. This slow disease progression may be due to the presence of factors that are involved in the natural resistance to infection and the immune response that is mounted by the animals, as well as due to the adaptation of the virus to the host. Therefore, the study of virus-host interaction is essential to the understanding of the different patterns of disease course and the virus persistence in the host, and to help with the development of effective vaccines and perhaps the cure of FIV and HIV infections. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Hepatitis C Virus and Human Immunodeficiency Virus Co-Infection ...

    African Journals Online (AJOL)

    Hepatitis C Virus and Human Immunodeficiency Virus Co-Infection among Pregnant Women in South-South, Nigeria. ... Concerted efforts need to be made towards reducing the seroprevalence through awareness campaigns, testing for the virus as well as development of vaccine among other preventive measures.

  11. Human Immunodeficiency Virus and Hepatitis C Virus Co-infection ...

    African Journals Online (AJOL)

    Human Immunodeficiency Virus and Hepatitis C Virus Co-infection in Cameroon: Investigation of the Genetic Diversity and Virulent Circulating Strains. ... A total of 36 HIV/HCV co-infected isolates (22 from volunteer blood donors and 14 from people living with HIV/AIDS not yet on antiretroviral treatment) were analyzed ...

  12. [Zika virus infection in pregnancy].

    Science.gov (United States)

    Varjasi, Gabriella; Póka, Róbert

    2017-04-01

    The Zika virus is a flavivirus spread by mosquitoes. Its primary vectors are the Aedes aegypti and the Aedes albopictus. Before 2007 it sporadically caused benign morbidity. Since 2015, it started spreading "explosively" in America, especially in Brazil. In August 2016 they reported cases from New York and Poland, too. Most of the infections don't produce any symptoms, but can cause grave complications. The most important lesion is microcephalia that forms in fetuses. Microcephalia's most serious consequence is mental retardation, which puts great burden on both the family and the society. The viral infection increases the incidence of Guillain-Barré syndrome. This is an acute autoimmune disease which causes demyelination and, in the worst cases, it can also be fatal. Yet we do not possess adequate and specific vaccination nor antiviral therapy, although, since July 2016, the effectiveness of a DNA based vaccine is being tested on humans. More than half of the world's population lives in areas contaminated by infected mosquitoes so there is a great need for the development of an effective method against the vector mosquitoes. Sadly, even the vector control strategies aren't effective enough to push back the epidemic. Pregnant or fertile women must take the highest precautions against mosquito bites, especially if they travel to regions ravaged by the epidemic. The safest solution would be to postpone both the trip and the childbearing. In Europe, the vectors aren't spread enough to cause major threat, except maybe the warmer regions bordered by the Mediterranean Sea. However, it is possible that in the near future other viruses spread by Aedes mosquitoes could appear. Naturally, the travellers and immigrants, who came from endemic regions can also contribute to the spread of the epidemic. Thanks to the changes in global weather, there were reported findings of mosquitoes of the Aedes albopictus species in Hungary, which are slowly invading the continent, although

  13. Co-infections with respiratory viruses in dogs with bacterial pneumonia.

    Science.gov (United States)

    Viitanen, S J; Lappalainen, A; Rajamäki, M M

    2015-01-01

    Bacterial pneumonia (BP) is an inflammation of the lower airways and lung parenchyma secondary to bacterial infection. The pathogenesis of BP in dogs is complex and the role of canine respiratory viruses has not been fully evaluated. The aim of this study was to investigate the occurrence of viral co-infections in dogs with BP and to assess demographic or clinical variables as well as disease severity associated with viral co-infections. Twenty household dogs with BP caused by opportunistic bacteria and 13 dogs with chronic (>30 days) tracheobronchitis caused by Bordetella bronchiseptica (BBTB). Prospective cross-sectional observational study. Diagnosis was confirmed by clinical and laboratory findings, diagnostic imaging, and cytologic and microbiologic analysis of bronchoalveolar lavage or transtracheal wash fluid. Canine parainfluenza virus (CPIV), canine adenovirus, canine herpes virus, canine influenzavirus, canine distemper virus, canine respiratory coronavirus (CRCoV) and canine pneumovirus, as well as B. bronchiseptica and Mycoplasma spp. were analyzed in respiratory samples using PCR assays. CPIV was detected in 7/20 and CRCoV in 1/20 dogs with BP. Respiratory viruses were not detected in dogs with BBTB. There were no significant differences in clinical variables between BP dogs with and without a viral co-infection. Respiratory viruses were found frequently in dogs with BP and may therefore play an important role in the etiology and pathogenesis of BP. Clinical variables and disease severity did not differ between BP dogs with and without viral co-infection. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  14. Distemper outbreak and its effect on African wild dog conservation.

    NARCIS (Netherlands)

    M.W.G. van de Bildt (Marco); T. Kuiken (Thijs); A.M. Visee; S. Lema; A.R. Fitzjohn; A.D.M.E. Osterhaus (Albert)

    2002-01-01

    textabstractIn December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus

  15. Combined distemper-adenoviral pneumonia in a dog

    Science.gov (United States)

    Rodriguez-Tovar, Luis E.; Ramírez-Romero, Rafael; Valdez-Nava, Yazel; Nevárez-Garza, Alicia M.; Zárate-Ramos, Juan J.; López, Alfonso

    2007-01-01

    A 3 1/2-month-old pug with oculonasal discharge and seizures was submitted for postmortem examination. Grossly, the lungs had cranioventral consolidation, and microscopically, 2 distinct types of inclusion bodies compatible with Canine distemper virus and Canine adenovirus type 2. Presence of both viruses was confirmed via immunohistochemical staining. PMID:17616064

  16. The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

    Science.gov (United States)

    Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige

    2009-01-01

    Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927

  17. Hepatitis E Virus Infects Neurons and Brains

    NARCIS (Netherlands)

    Zhou, Xinying; Huang, Fen; Xu, Lei; Lin, Zhanmin; de Vrij, Femke M. S.; Ayo-Martin, Ane C.; van der Kroeg, Mark; Zhao, Manzhi; Yin, Yuebang; Wang, Wenshi; Cao, Wanlu; Wang, Yijin; Kushner, Steven A.; Marie Peron, Jean; Alric, Laurent; de Man, Robert A.; Jacobs, Bart C.; van Eijk, Jeroen J.; Aronica, Eleonora M. A.; Sprengers, Dave; Metselaar, Herold J.; de Zeeuw, Chris I.; Dalton, Harry R.; Kamar, Nassim; Peppelenbosch, Maikel P.; Pan, Qiuwei

    2017-01-01

    Hepatitis E virus (HEV), as a hepatotropic virus, is supposed to exclusively infect the liver and only cause hepatitis. However, a broad range of extrahepatic manifestations (in particular, idiopathic neurological disorders) have been recently reported in association with its infection. In this

  18. Medicinal herbs for hepatitis C virus infection

    DEFF Research Database (Denmark)

    Liu, Jianping; Manheimer, Eric; Tsutani, Kiichiro

    2003-01-01

    The aim of this study was to assess beneficial and harmful effects of medicinal herbs for hepatitis C virus (HCV) infection.......The aim of this study was to assess beneficial and harmful effects of medicinal herbs for hepatitis C virus (HCV) infection....

  19. Persistent hepatitis virus infection and immune homeostasis

    OpenAIRE

    ZHOU Yun

    2014-01-01

    Homeostasis between the host and viruses is naturally maintained. On the one hand, the immune system activates the immune response to kill or eliminate viruses; on the other hand, the immune system controls the immune response to maintain immune homeostasis. The cause of persistent infections with hepatitis viruses such as HBV and HCV is that viral molecules damage the immune system of the host and their variants escape immune clearance. Long-term coexistence of the host and viruses is the pr...

  20. Interaction of a synthetic peptide corresponding to the N-terminus of canine distemper virus fusion protein with phospholipid vesicles: a biophysical study.

    Science.gov (United States)

    Aranda, Francisco J; Teruel, José A; Ortiz, Antonio

    2003-12-03

    The F protein of canine distemper virus (CDV) is a classic type I glycoprotein formed by two polypeptides, F1 and F2. The N-terminal regions of the F1 polypeptides of CDV, measles virus and other paramyxoviruses present moderate to high homology, supporting the existence of a high conservation within these structures, which emphasises its role in viral-host cell membrane fusion. This N-terminal polypeptide is usually termed the fusion peptide. The fusion peptides of most viral fusion-mediating glycoproteins contain a high proportion of hydrophobic amino acids, which facilitates its insertion into target membranes during fusion. In this work we report on the interaction of a 31-residue synthetic peptide (FP31) corresponding to the N terminus of CDV F1 protein with phospholipid membranes composed of various phospholipids, as studied by means of various biophysical techniques. FTIR investigation of FP31 secondary structure in aqueous medium and in membranes resulted in a major proportion of alpha-helical structure which increased upon membrane insertion. Differential scanning calorimetry (DSC) showed that the presence of concentrations of FP31 as low as 0.1 mol%, in mixtures with L-alpha-dimyristoylphosphatidylcholine (DMPC), L-alpha-dipalmitoylphosphatidylcholine (DPPC) and L-alpha-distearoylphosphatidylcholine (DSPC), already affected the thermotropic properties of the gel to liquid-crystalline phase transition. In mixtures with the three lipids, increasing the concentration of peptide made the pretransition to disappear, and lowered and broadened the main transition. This effect was slightly stronger as the acyl chain length of the phospholipid grew larger. In the corresponding partial phase diagrams, no immiscibilities or critical points were observed. FTIR showed that incorporation of 1 mol% of peptide in DPPC shifted the antisymmetric and symmetric CH2 stretching bands to higher values, indicating the existence of an additional disordering of the acyl chain

  1. [Intrauterine herpes simplex virus infection].

    Science.gov (United States)

    Hoppen, T; Eis-Hübinger, A M; Schild, R L; Enders, G; Hansmann, M; Rister, M; Bartmann, P

    2001-01-01

    Early fetal herpes simplex virus (HSV) infection is rarely documented. Only the minority of affected fetuses survive this condition. At 19 weeks of gestation the first episode of a genital HSV-infection of a pregnant woman was treated with local interferon beta. At 34 weeks of gestation hydrocephalus with secondary microcephaly and microphthalmia of both eyes was detected by ultrasonography. In the amniotic fluid HSV type 2 (HSV-2) was isolated and HSV-2-DNA was detected by PCR. The serum of the mother proved positive for HSV-2 (glycoprotein G2)-specific IgG-antibodies. No other infectious causes were apparent on further testing. At 35 + 4 weeks gestation a small-for-gestational-age neonate (2130 g) with microcephaly (29 cm head circumference) was born by spontaneous vaginal delivery. Scarce ulcerative skin lesions and vesicles, hepatosplenomegaly and microphthalmia were diagnosed. Furthermore, encephalomalacia with parenchymal destruction, cataract of both eyes and aplasia of the maculae and papillae were found. HSV-2-PCR was tested positive in chorionic cells and an umbilical segment of the placenta as well as in swabs from both eyes, throat, and a herpetic skin lesion collected during the first 5 days of life. HSV-IgM-antibodies were found in the umbilical cord blood. Local and intravenous treatment with aciclovir was started. The infant exhibited signs of a severely malfunctioning central nervous system. At the age of 4 months the boy suffered from generalised cerebral seizures. He died at the age of 9 months as a consequence of respiratory insufficiency with consecutive circulation failure. The case of an intrauterine HSV-2-infection is presented. The time of onset of fetal infection was most probably at the time of the maternal disease (19 weeks of gestation). Inspite of the very early infection the fetus did not die in utero. Especially, if a primary genital HSV-2-infection of a pregnant woman is suspected, which can be proven by serological means only

  2. Human immunodeficiency virus and hepatitus B virus co-infection ...

    African Journals Online (AJOL)

    Human immunodeficiency virus and hepatitus B virus co-infection amog patients in Kano Nigeria. EE Nwokedi, MA Emokpae, AI Dutse. Abstract. No Abstract. Nigerian Journal of Medicine Vol. 15(3) July-September 2006: 227-229. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD ...

  3. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis

    Science.gov (United States)

    Lempp, Charlotte; Spitzbarth, Ingo; Puff, Christina; Cana, Armend; Kegler, Kristel; Techangamsuwan, Somporn; Baumgärtner, Wolfgang; Seehusen, Frauke

    2014-01-01

    Canine distemper virus (CDV) is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL). In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR)-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature astrocytes

  4. New aspects of the pathogenesis of canine distemper leukoencephalitis.

    Science.gov (United States)

    Lempp, Charlotte; Spitzbarth, Ingo; Puff, Christina; Cana, Armend; Kegler, Kristel; Techangamsuwan, Somporn; Baumgärtner, Wolfgang; Seehusen, Frauke

    2014-07-02

    Canine distemper virus (CDV) is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL). In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR)-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature astrocytes

  5. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis

    Directory of Open Access Journals (Sweden)

    Charlotte Lempp

    2014-07-01

    Full Text Available Canine distemper virus (CDV is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL. In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature

  6. Hendra Virus Infection in Dog, Australia, 2013.

    Science.gov (United States)

    Kirkland, Peter D; Gabor, Melinda; Poe, Ian; Neale, Kristie; Chaffey, Kim; Finlaison, Deborah S; Gu, Xingnian; Hick, Paul M; Read, Andrew J; Wright, Therese; Middleton, Deborah

    2015-12-01

    Hendra virus occasionally causes severe disease in horses and humans. In Australia in 2013, infection was detected in a dog that had been in contact with an infected horse. Abnormalities and viral RNA were found in the dog's kidney, brain, lymph nodes, spleen, and liver. Dogs should be kept away from infected horses.

  7. Zika Virus: Mechanisms of Infection During Pregnancy.

    Science.gov (United States)

    King, Nicholas J C; Teixeira, Mauro M; Mahalingam, Suresh

    2017-09-01

    Immune status changes during pregnancy, with pro-inflammatory and anti-inflammatory contexts at different stages, making pregnant women potentially more susceptible to various infections. Infection by Zika virus during pregnancy can cause developmental damage to the fetus, and the altered immune response during pregnancy could contribute to disease during Zika infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Canine distemper virus and Toxoplasma gondii co-infection in dogs with neurological signs

    Directory of Open Access Journals (Sweden)

    D.M. Aguiar

    2012-02-01

    Full Text Available O presente estudo relata a ocorrência de co-infecção entre o vírus da cinomose canina (CDV e Toxoplama gondii em cães com sinais neurológicos. Amostras de soro e tecido nervoso (pos-mortem de 21 cães, suspeitos de cinomose canina foram analisadas pela Reação de Imunofluorecência indireta (RIFI para pesquisa de anticorpos contra T. gondii e N. caninum e por RT-PCR para CDV. Dezessete (80,9% cães foram positivos para o CDV pela RT-PCR e 8 (38,1% foram positivos para anticorpos contra T. gondii. Sete cães (41,1% apresentaram-se positivos para ambos agentes, caracterizando processo de co-infecção. Somente 1 (4,7% cão foi soropositivo para N. caninum (RIFI=100, entretanto este mesmo animal foi positivo para T. gondii (RIFI=4096 e para CDV (RT-PCR.

  9. Host response during acute canine distemper virus infections in naive and DNA immunized mink

    DEFF Research Database (Denmark)

    Nielsen, Line

    SAMMENDRAG (DANISH SUMMARY) Mink blev inokuleret med to forskellige vildtype hundesygevirus (CDV) stammer fra forskellige genotyper. DK91 stammen repræsenter de europæiske genotyper isoleret efter 1990, mens Snyder Hill stammen repræsenter de gamle amerikanske genotyper isoleret før 1960. De to C...

  10. Zika Virus Infection: Current Concerns and Perspectives.

    Science.gov (United States)

    Maharajan, Mari Kannan; Ranjan, Aruna; Chu, Jian Feng; Foo, Wei Lim; Chai, Zhi Xin; Lau, Eileen YinYien; Ye, Heuy Mien; Theam, Xi Jin; Lok, Yen Ling

    2016-12-01

    The Zika virus outbreaks highlight the growing importance need for a reliable, specific and rapid diagnostic device to detect Zika virus, as it is often recognized as a mild disease without being identified. Many Zika virus infection cases have been misdiagnosed or underreported because of the non-specific clinical presentation. The aim of this review was to provide a critical and comprehensive overview of the published peer-reviewed evidence related to clinical presentations, various diagnostic methods and modes of transmission of Zika virus infection, as well as potential therapeutic targets to combat microcephaly. Zika virus is mainly transmitted through bites from Aedes aegypti mosquito. It can also be transmitted through blood, perinatally and sexually. Pregnant women are advised to postpone or avoid travelling to areas where active Zika virus transmission is reported, as this infection is directly linked to foetal microcephaly. Due to the high prevalence of Guillain-Barre syndrome and microcephaly in the endemic area, it is vital to confirm the diagnosis of Zika virus. Zika virus infection had been declared as a public health emergency and of international concern by the World Health Organisation. Governments and agencies should play an important role in terms of investing time and resources to fundamentally understand this infection so that a vaccine can be developed besides raising awareness.

  11. Jaundice and bilirubinemia as manifestations of canine distemper in raccoons and ferrets

    Science.gov (United States)

    Kilham, L.; Habermann, R.T.; Herman, C.M.

    1956-01-01

    1) Two strains of distemper virus have been isolated from wild raccoons and one strain from ferrets. 2) All strains isolated have induced bilirubinemia in raccoons and ferrets. Many raccoons with bilirubinemia also had jaundice. 3) Identification of these strains as members of the canine distemper virus complex has been by clinical and pathological findings consistent with this diagnosis as well as by cross-immunity tests.

  12. Interferon-γ Inhibits Ebola Virus Infection.

    Directory of Open Access Journals (Sweden)

    Bethany A Rhein

    Full Text Available Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

  13. Ebola Virus Infection Modelling and Identifiability Problems

    Directory of Open Access Journals (Sweden)

    Van-Kinh eNguyen

    2015-04-01

    Full Text Available The recent outbreaks of Ebola virus (EBOV infections have underlined the impact of the virus as a major threat for human health. Due to the high biosafety classification of EBOV (level 4, basic research is very limited. Therefore, the development of new avenues of thinking to advance quantitative comprehension of the virus and its interaction with the host cells is urgently neededto tackle this lethal disease. Mathematical modelling of the EBOV dynamics can be instrumental to interpret Ebola infection kinetics on quantitative grounds. To the best of our knowledge, a mathematical modelling approach to unravel the interaction between EBOV and the host cells isstill missing. In this paper, a mathematical model based on differential equations is used to represent the basic interactions between EBOV and wild-type Vero cells in vitro. Parameter sets that represent infectivity of pathogens are estimated for EBOV infection and compared with influenza virus infection kinetics. The average infecting time of wild-type Vero cells in EBOV is slower than in influenza infection. Simulation results suggest that the slow infecting time of EBOV could be compensated by its efficient replication. This study reveals several identifiability problems and what kind of experiments are necessary to advance the quantification of EBOV infection. A first mathematical approach of EBOV dynamics and the estimation of standard parametersin viral infections kinetics is the key contribution of this work, paving the way for future modelling work on EBOV infection.

  14. Saffold virus infection associated with human myocarditis

    DEFF Research Database (Denmark)

    Nielsen, Trine Skov; Nielsen, Alex Yde; Banner, Jytte

    2016-01-01

    BACKGROUND: Saffold virus was described in 2007 as one of the first human viruses within the genus cardioviruses. Cardioviruses may cause severe infections of the myocardium in animals, and several studies have associated saffold virus with human disease. As a result, saffold virus has been...... isolated from different anatomical compartments, including the myocardium, but, until now, it has not been possible to demonstrate the accompanying histopathological signs of inflammation. OBJECTIVES: The aim of the study was to examine if saffold virus is capable of causing invasive infection in the human...... myocardium. STUDY DESIGN: Using real-time PCR, we retrospectively examined formalin-fixed paraffin embedded cardiac tissue specimens from 150 deceased individuals diagnosed with myocarditis at autopsy. The results were compared with histological findings. RESULTS AND CONCLUSIONS: Saffold virus was detected...

  15. Immune Response in Hepatitis B Virus Infection

    Science.gov (United States)

    Tan, Anthony; Koh, Sarene; Bertoletti, Antonio

    2015-01-01

    Hepatitis B virus (HBV) can replicate within hepatocytes without causing direct cell damage. The host immune response is, therefore, not only essential to control the spread of virus infection, but it is also responsible for the inflammatory events causing liver pathologies. In this review, we discuss how HBV deals with host immunity and how we can harness it to achieve virus control and suppress liver damage. PMID:26134480

  16. Functional RNA during Zika virus infection

    NARCIS (Netherlands)

    Göertz, Giel P.; Abbo, Sandra R.; Fros, Jelke J.; Pijlman, Gorben P.

    2017-01-01

    Zika virus (ZIKV; family Flaviviridae; genus Flavivirus) is a pathogenic mosquito-borne RNA virus that currently threatens human health in the Americas, large parts of Asia and occasionally elsewhere in the world. ZIKV infection is often asymptomatic but can cause severe symptoms including

  17. Virus infections of honeybees Apis Mellifera

    Directory of Open Access Journals (Sweden)

    Giuseppina Tantillo

    2015-09-01

    Full Text Available The health and vigour of honeybee colonies are threatened by numerous parasites (such as Varroa destructor and Nosema spp. and pathogens, including viruses, bacteria, protozoa. Among honeybee pathogens, viruses are one of the major threats to the health and wellbeing of honeybees and cause serious concern for researchers and beekeepers. To tone down the threats posed by these invasive organisms, a better understanding of bee viral infections will be of crucial importance in developing effective and environmentally benign disease control strategies. Here we summarize recent progress in the understanding of the morphology, genome organization, transmission, epidemiology and pathogenesis of eight honeybee viruses: Deformed wing virus (DWV and Kakugo virus (KV; Sacbrood virus (SBV; Black Queen cell virus (BQCV; Acute bee paralysis virus (ABPV; Kashmir bee virus (KBV; Israeli Acute Paralysis Virus (IAPV; Chronic bee paralysis virus (CBPV. The review has been designed to provide researchers in the field with updated information about honeybee viruses and to serve as a starting point for future research.

  18. Virus Infections of Honeybees Apis Mellifera

    Science.gov (United States)

    Tantillo, Giuseppina; Bottaro, Marilisa; Di Pinto, Angela; Martella, Vito; Di Pinto, Pietro

    2015-01-01

    The health and vigour of honeybee colonies are threatened by numerous parasites (such as Varroa destructor and Nosema spp.) and pathogens, including viruses, bacteria, protozoa. Among honeybee pathogens, viruses are one of the major threats to the health and well-being of honeybees and cause serious concern for researchers and beekeepers. To tone down the threats posed by these invasive organisms, a better understanding of bee viral infections will be of crucial importance in developing effective and environmentally benign disease control strategies. Here we summarize recent progress in the understanding of the morphology, genome organization, transmission, epidemiology and pathogenesis of eight honeybee viruses: Deformed wing virus (DWV) and Kakugo virus (KV); Sacbrood virus (SBV); Black Queen cell virus (BQCV); Acute bee paralysis virus (ABPV); Kashmir bee virus (KBV); Israeli Acute Paralysis Virus (IAPV); Chronic bee paralysis virus (CBPV). The review has been designed to provide researchers in the field with updated information about honeybee viruses and to serve as a starting point for future research. PMID:27800411

  19. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    that canine distemper virus was responsible for the outbreak canine disease in the areas. Sequencing of positive samples from ... United States and elsewhere in world, and are caused by many factors. These factors include the over population of .... Pet Overpopulation in the United States”. ASPCA. Retrieved 2015-04-09.

  20. Lectin Switching During Dengue Virus Infection

    Science.gov (United States)

    Dejnirattisai, Wanwisa; Webb, Andrew I.; Chan, Vera; Jumnainsong, Amonrat; Davidson, Andrew; Mongkolsapaya, Juthathip

    2011-01-01

    Dengue virus receptors are relatively poorly characterized, but there has been recent interest in 2 C-type lectin molecules, dendritic cell–specific intercellular adhesion molecule 3 (ICAM-3)–grabbing nonintegrin (DC-SIGN) and its close homologue liver/lymph node–specific ICAM-3–grabbing integrin (L-SIGN), which can both bind dengue and promote infection. In this report we have studied the interaction of dengue viruses produced in insect cells, tumor cell lines, and primary human dendritic cells (DCs) with DC-SIGN and L-SIGN. Virus produced in primary DCs is unable to interact with DC-SIGN but remains infectious for L-SIGN–expressing cells. Skin-resident DCs may thus be a site of initial infection by insect-produced virus, but DCs will likely not participate in large-scale virus replication during dengue infection. These results reveal that differential glycosylation of dengue virus envelope protein is highly dependent on cell state and suggest that studies of virus tropism using virus prepared in insect cells or tumor cell lines should be interpreted with caution. PMID:21606536

  1. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-07-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  2. Inhibition of Enveloped Viruses Infectivity by Curcumin

    Science.gov (United States)

    Wen, Hsiao-Wei; Ou, Jun-Lin; Chiou, Shyan-Song; Chen, Jo-Mei; Wong, Min-Liang; Hsu, Wei-Li

    2013-01-01

    Curcumin, a natural compound and ingredient in curry, has antiinflammatory, antioxidant, and anticarcinogenic properties. Previously, we reported that curcumin abrogated influenza virus infectivity by inhibiting hemagglutination (HA) activity. This study demonstrates a novel mechanism by which curcumin inhibits the infectivity of enveloped viruses. In all analyzed enveloped viruses, including the influenza virus, curcumin inhibited plaque formation. In contrast, the nonenveloped enterovirus 71 remained unaffected by curcumin treatment. We evaluated the effects of curcumin on the membrane structure using fluorescent dye (sulforhodamine B; SRB)-containing liposomes that mimic the viral envelope. Curcumin treatment induced the leakage of SRB from these liposomes and the addition of the influenza virus reduced the leakage, indicating that curcumin disrupts the integrity of the membranes of viral envelopes and of liposomes. When testing liposomes of various diameters, we detected higher levels of SRB leakage from the smaller-sized liposomes than from the larger liposomes. Interestingly, the curcumin concentration required to reduce plaque formation was lower for the influenza virus (approximately 100 nm in diameter) than for the pseudorabies virus (approximately 180 nm) and the vaccinia virus (roughly 335 × 200 × 200 nm). These data provide insights on the molecular antiviral mechanisms of curcumin and its potential use as an antiviral agent for enveloped viruses. PMID:23658730

  3. Inhibition of enveloped viruses infectivity by curcumin.

    Directory of Open Access Journals (Sweden)

    Tzu-Yen Chen

    Full Text Available Curcumin, a natural compound and ingredient in curry, has antiinflammatory, antioxidant, and anticarcinogenic properties. Previously, we reported that curcumin abrogated influenza virus infectivity by inhibiting hemagglutination (HA activity. This study demonstrates a novel mechanism by which curcumin inhibits the infectivity of enveloped viruses. In all analyzed enveloped viruses, including the influenza virus, curcumin inhibited plaque formation. In contrast, the nonenveloped enterovirus 71 remained unaffected by curcumin treatment. We evaluated the effects of curcumin on the membrane structure using fluorescent dye (sulforhodamine B; SRB-containing liposomes that mimic the viral envelope. Curcumin treatment induced the leakage of SRB from these liposomes and the addition of the influenza virus reduced the leakage, indicating that curcumin disrupts the integrity of the membranes of viral envelopes and of liposomes. When testing liposomes of various diameters, we detected higher levels of SRB leakage from the smaller-sized liposomes than from the larger liposomes. Interestingly, the curcumin concentration required to reduce plaque formation was lower for the influenza virus (approximately 100 nm in diameter than for the pseudorabies virus (approximately 180 nm and the vaccinia virus (roughly 335 × 200 × 200 nm. These data provide insights on the molecular antiviral mechanisms of curcumin and its potential use as an antiviral agent for enveloped viruses.

  4. Antiviral therapy in herpes- virus infections

    African Journals Online (AJOL)

    Repro

    Herpesviruses are large, enveloped DNA viruses.There are currently 8 known human herpesviruses and 1 primate species that is a rare human pathogen. Most people have been infected with sev- eral human herpesviruses. In immuno- competent individuals primary infections with herpesviruses are generally mild, self-.

  5. Detection of respiratory viruses and Bordetella bronchiseptica in dogs with acute respiratory tract infections.

    Science.gov (United States)

    Schulz, B S; Kurz, S; Weber, K; Balzer, H-J; Hartmann, K

    2014-09-01

    Canine infectious respiratory disease (CIRD) is an acute, highly contagious disease complex caused by a variety of infectious agents. At present, the role of viral and bacterial components as primary or secondary pathogens in CIRD is not fully understood. The aim of this study was to investigate the prevalence of canine parainfluenza virus (CPIV), canine adenovirus type 2 (CAV-2), canine influenza virus (CIV), canine respiratory coronavirus (CRCoV), canine herpes virus-1 (CHV-1), canine distemper virus (CDV) and Bordetella bronchiseptica in dogs with CIRD and to compare the data with findings in healthy dogs. Sixty-one dogs with CIRD and 90 clinically healthy dogs from Southern Germany were prospectively enrolled in this study. Nasal and pharyngeal swabs were collected from all dogs and were analysed for CPIV, CAV-2, CIV, CRCoV, CHV-1, CDV, and B. bronchiseptica by real-time PCR. In dogs with acute respiratory signs, 37.7% tested positive for CPIV, 9.8% for CRCoV and 78.7% for B. bronchiseptica. Co-infections with more than one agent were detected in 47.9% of B. bronchiseptica-positive, 82.6% of CPIV-positive, and 100% of CRCoV-positive dogs. In clinically healthy dogs, 1.1% tested positive for CAV-2, 7.8% for CPIV and 45.6% for B. bronchiseptica. CPIV and B. bronchiseptica were detected significantly more often in dogs with CIRD than in clinically healthy dogs (P infectious agents in dogs with CIRD in Southern Germany. Mixed infections with several pathogens were common. In conclusion, clinically healthy dogs can carry respiratory pathogens and could act as sources of infection for susceptible dogs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Clinical syndromes of nervous distemper in dogs initially presented without conventional evidences of CDV infectionSíndromes clínicas da apresentação neurológica da cinomose em cães admitidos inicialmente sem as evidencias convencionais da infecção pelo CDV

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2012-12-01

    Full Text Available Despite large vaccination practice, canine distemper virus (CDV is yet an important infectious agent that leads to nervous disease in canine populations worldwide. Unfortunately, the clinical diagnosis of distemper encephalomyelitis is often difficult in cases presented without conventional evidences of CDV infection such as systemic signs and myoclonus. Therefore, the aim of this study was to evaluate the neurological deficits and the clinical syndromes of nervous distemper in dogs suffering from neurological disease admitted in the absence of the conventional evidences of CDV infection. Dogs presented with central nervous disease in which toxic/traumatic or a CDV-free etiology could be excluded ante mortem were prospectively followed up and which that died (natural death or euthanasia, despite medical treatment and necropsy was carried out were included in this study. Ten out of 35 evaluated dogs were post mortem diagnosed with CDV encephalomyelitis by both CDV RNA detection through RT-PCR assay in nervous tissue and observation of distemper-compatible neuroparenchymal lesions. According to the nervous signs, clinical history, and the age of presentation, the distemper dogs were grouped in three clinical syndromes of CDV encephalomyelitis: i canine distemper encephalitis in immature dogs (CDEID (n=3; ii multifocal distemper encephalomyelitis in mature dogs (MDEMD (n=6; and iii old dog encephalitis (ODE-like syndrome (n=1. The respective nervous deficits expected from each one of the syndromes herein presented were discussed.Apesar da prática de vacinação, o vírus da cinomose canina (CDV ainda é um importante agente infeccioso que leva à doença neurológica na população canina em todo o mundo. Infelizmente, o diagnóstico clínico da encefalomielite pela cinomose é difícil nos casos apresentados sem evidências clínicas convencionais de infecção pelo CDV, tais como sinais sistêmicos e mioclonia. Portanto, o objetivo deste estudo

  7. Hepatitis C Virus Infection in Nigerians | Ejiofor | Nigerian Medical ...

    African Journals Online (AJOL)

    Background: Hepatitis C virus is a chronic life long infection in the majority of patients who are infected with the virus. Not much is known and written/published about this virus in Nigeria. Objective: To asses the status of hepatitis C virus infection in Nigeria. Materials and method: Sources of information were mainly from ...

  8. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection

    OpenAIRE

    Paquin-Proulx, Dominic; Avelino-Silva, Vivian I.; Santos, Bianca A. N.; Silveira Barsotti, Nathália; Siroma, Fabiana; Fernandes Ramos, Jessica; Coracini Tonacio, Adriana; Song, Alice; Maestri, Alvino; Barros Cerqueira, Natalia; Felix, Alvina Clara; Levi, José Eduardo; Greenspun, Benjamin C.; de Mulder Rougvie, Miguel; Rosenberg, Michael G.

    2018-01-01

    Dengue virus (DENV) and Zika virus (ZIKV) are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome). The...

  9. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection.

    OpenAIRE

    Dominic Paquin-Proulx; Vivian I Avelino-Silva; Bianca A N Santos; Nathália Silveira Barsotti; Fabiana Siroma; Jessica Fernandes Ramos; Adriana Coracini Tonacio; Alice Song; Alvino Maestri; Natalia Barros Cerqueira; Alvina Clara Felix; José Eduardo Levi; Benjamin C Greenspun; Miguel de Mulder Rougvie; Michael G Rosenberg

    2018-01-01

    Dengue virus (DENV) and Zika virus (ZIKV) are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome). The...

  10. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

    Science.gov (United States)

    Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

    2011-12-15

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted

    2015-01-01

    distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...... case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak...

  12. Hepatitis E Virus Infects Neurons and Brains.

    Science.gov (United States)

    Zhou, Xinying; Huang, Fen; Xu, Lei; Lin, Zhanmin; de Vrij, Femke M S; Ayo-Martin, Ane C; van der Kroeg, Mark; Zhao, Manzhi; Yin, Yuebang; Wang, Wenshi; Cao, Wanlu; Wang, Yijin; Kushner, Steven A; Marie Peron, Jean; Alric, Laurent; de Man, Robert A; Jacobs, Bart C; van Eijk, Jeroen J; Aronica, Eleonora M A; Sprengers, Dave; Metselaar, Herold J; de Zeeuw, Chris I; Dalton, Harry R; Kamar, Nassim; Peppelenbosch, Maikel P; Pan, Qiuwei

    2017-04-15

    Hepatitis E virus (HEV), as a hepatotropic virus, is supposed to exclusively infect the liver and only cause hepatitis. However, a broad range of extrahepatic manifestations (in particular, idiopathic neurological disorders) have been recently reported in association with its infection. In this study, we have demonstrated that various human neural cell lines (embryonic stem cell-derived neural lineage cells) induced pluripotent stem cell-derived human neurons and primary mouse neurons are highly susceptible to HEV infection. Treatment with interferon-α or ribavirin, the off-label antiviral drugs for chronic hepatitis E, exerted potent antiviral activities against HEV infection in neural cells. More importantly, in mice and monkey peripherally inoculated with HEV particles, viral RNA and protein were detected in brain tissues. Finally, patients with HEV-associated neurological disorders shed the virus into cerebrospinal fluid, indicating a direct infection of their nervous system. Thus, HEV is neurotropic in vitro, and in mice, monkeys, and possibly humans. These results challenge the dogma of HEV as a pure hepatotropic virus and suggest that HEV infection should be considered in the differential diagnosis of idiopathic neurological disorders. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  13. Varicella Zoster Virus (Chickenpox) Infection in Pregnancy

    OpenAIRE

    Lamont, Ronald F.; Sobel, Jack D; Carrington, D; Mazaki-Tovi, Shali; Kusanovic, Juan Pedro; Vaisbuch, Edi; Romero, Roberto

    2011-01-01

    Congenital varicella syndrome, maternal varicella zoster virus pneumonia and neonatal varicella infection are associated with serious feto-maternal morbidity and not infrequently with mortality. Vaccination against Varicella zoster virus can prevent the disease and outbreak control limits the exposure of pregnant women to the infectious agent. Maternal varicella zoster immune globulin (VZIG) administration before rash development, with or without antivirals medications can modify progression ...

  14. Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs

    OpenAIRE

    McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel

    1985-01-01

    Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

  15. The impact of hepatitis A virus infection on hepatitis C virus infection: a competitive exclusion hypothesis.

    Science.gov (United States)

    Amaku, Marcos; Coutinho, Francisco Antonio Bezerra; Chaib, Eleazar; Massad, Eduardo

    2013-01-01

    We address the observation that, in some cases, patients infected with the hepatitis C virus (HCV) are cleared of HCV when super-infected with the hepatitis A virus (HAV). We hypothesise that this phenomenon can be explained by the competitive exclusion principle, including the action of the immune system, and show that the inclusion of the immune system explains both the elimination of one virus and the co-existence of both infections for a certain range of parameters. We discuss the potential clinical implications of our findings.

  16. Activity of andrographolide against chikungunya virus infection.

    Science.gov (United States)

    Wintachai, Phitchayapak; Kaur, Parveen; Lee, Regina Ching Hua; Ramphan, Suwipa; Kuadkitkan, Atichat; Wikan, Nitwara; Ubol, Sukathida; Roytrakul, Sittiruk; Chu, Justin Jang Hann; Smith, Duncan R

    2015-09-18

    Chikungunya virus (CHIKV) is a re-emerging mosquito-borne alphavirus that has recently engendered large epidemics around the world. There is no specific antiviral for treatment of patients infected with CHIKV, and development of compounds with significant anti-CHIKV activity that can be further developed to a practical therapy is urgently required. Andrographolide is derived from Andrographis paniculata, a herb traditionally used to treat a number of conditions including infections. This study sought to determine the potential of andrographolide as an inhibitor of CHIKV infection. Andrographolide showed good inhibition of CHIKV infection and reduced virus production by approximately 3log10 with a 50% effective concentration (EC50) of 77 μM without cytotoxicity. Time-of-addition and RNA transfection studies showed that andrographolide affected CHIKV replication and the activity of andrographolide was shown to be cell type independent. This study suggests that andrographolide has the potential to be developed further as an anti-CHIKV therapeutic agent.

  17. Hepatitis C virus infection and risk of coronary artery disease

    DEFF Research Database (Denmark)

    Roed, Torsten; Lebech, Anne-Mette; Kjaer, Andreas

    2012-01-01

    Several chronic infections have been associated with cardiovascular diseases, including Chlamydia pneumoniae, human immunodeficiency virus and viral hepatitis. This review evaluates the literature on the association between chronic hepatitis C virus (HCV) infection and the risk of coronary artery...

  18. Activity of andrographolide against chikungunya virus infection

    OpenAIRE

    Phitchayapak Wintachai; Parveen Kaur; Regina Ching Hua Lee; Suwipa Ramphan; Atichat Kuadkitkan; Nitwara Wikan; Sukathida Ubol; Sittiruk Roytrakul; Justin Jang Hann Chu; Duncan R. Smith

    2015-01-01

    Chikungunya virus (CHIKV) is a re-emerging mosquito-borne alphavirus that has recently engendered large epidemics around the world. There is no specific antiviral for treatment of patients infected with CHIKV, and development of compounds with significant anti-CHIKV activity that can be further developed to a practical therapy is urgently required. Andrographolide is derived from Andrographis paniculata, a herb traditionally used to treat a number of conditions including infections. This stud...

  19. USEFULNESS OF THE GRAPEVINE VIRUS-INFECTED COLLECTION

    Directory of Open Access Journals (Sweden)

    Elena-Cocuţa Buciumeanu

    2012-04-01

    Full Text Available In order to use the virus-infected material as reference in various studies, a grapevine virus collection was established at NRDIBH Ştefănşti-Argeş. The vines are infected with 1-3 of the main specific viruses of this crop: fanleaf virus, leafroll associated virus serotypes 1+3, fleck virus and virus A. Different lots of plants belonging to the same cultivar are infected with different viruses. The own rooted or grafted potted plants are maintained in an insect-proof greenhouse. The main goals of the study of grapevine under the influence of virus infection had in view: symptoms, in vitro behaviour of virus infected grapevine, virus elimination, plant positive control in the diagnostic process. The symptoms produced by viral infection can affect the whole plant (systemic symptoms or they are visible on certain parts of the plant (local symptoms. In vitro studies of virus infected grapevines comparatively with the healthy material aimed with the quantitative and qualitative aspects of the culture: multiplication and rooting rates, shoots elongation, abnormal cuttings and vitrification phenomena. Infected grapevine cultivars and clones were subjected to virus elimination through thermotherapy, chemotherapy or electrotherapy, combined with in vitro culture. The diagnosis of leafroll, fleck, vein necrosis and corky bark diseases have been done by in vitro micrografting, as rapid biological method of virus detection. Samples collected from infected vines were used as material testing for virus detection by ELISA in inter-laboratory comparisons and Iaboratory-performed validation.

  20. Zika virus infection of Hofbauer cells.

    Science.gov (United States)

    Simoni, Michael K; Jurado, Kellie Ann; Abrahams, Vikki M; Fikrig, Erol; Guller, Seth

    2017-02-01

    Recent studies have linked antenatal infection with Zika virus (ZIKV) with major adverse fetal and neonatal outcomes, including microcephaly. There is a growing consensus for the existence of a congenital Zika syndrome (CZS). Previous studies have indicated that non-placental macrophages play a key role in the replication of dengue virus (DENV), a closely related flavivirus. As the placenta provides the conduit for vertical transmission of certain viruses, and placental Hofbauer cells (HBCs) are fetal-placental macrophages located adjacent to fetal capillaries, it is not surprising that several recent studies have examined infection of HBCs by ZIKV. In this review, we describe congenital abnormalities associated with ZIKV infection, the role of HBCs in the placental response to infection, and evidence for the susceptibility of HBCs to ZIKV infection. We conclude that HBCs may contribute to the spread of ZIKV in placenta and promote vertical transmission of ZIKV, ultimately compromising fetal and neonatal development and function. Current evidence strongly suggests that further studies are warranted to dissect the specific molecular mechanism through which ZIKV infects HBCs and its potential impact on the development of CZS. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    Directory of Open Access Journals (Sweden)

    C.M.S. Gebara

    2004-08-01

    Full Text Available A presença do vírus da cinomose canina (CDV foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR, em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1% das 87 amostras de urina provenientes de cães com sinais clínicos sugestivos de cinomose. Todas as amostras obtidas de animais assintomáticos foram negativas na RT-PCR. Amostras positivas foram encontradas nos três grupos de animais com sinais clínicos na proporção de 51,2% (24/41, 29% (11/37 e 100% (9/9 para os grupos A, B e C, respectivamente. A leucocitose foi a alteração hematológica mais freqüente nos três grupos de cães com sinais clínicos porém, não foi possível estabelecer correlação entre o resultado da RT-PCR e as alterações hematológicas. Os resultados demonstraram que, independente da forma de apresentação clínica, a técnica da RT-PCR realizada em urina pode ser utilizada no diagnóstico ante mortem da infecção pelo CDV.The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control included 20 assymptomatic dogs. A chi2

  2. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

    Directory of Open Access Journals (Sweden)

    Touihri Leila

    2012-12-01

    Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The

  3. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

    Science.gov (United States)

    2012-01-01

    Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES) domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient

  4. Chronic arthritis in chikungunya virus infection.

    Science.gov (United States)

    Mateo, Lourdes; Roure, Silvia

    2017-07-24

    Chikungunya virus infection causes arthralgia and arthritis in the acute phase of the disease but, in more than half of the cases, musculoskeletal manifestations can be prolonged over time and, in some cases, become chronic. Although polyarthralgia is the most frequent chronic manifestation, forms with polyarthritis, tenosynovitis and enthesopathy are also common. To analyze the clinical characteristics of patients with persistent articular manifestations after infection with the Chikungunya virus. Report of 3 cases of chronic arthritis after infection with chikungunya virus diagnosed at outpatient care in a university hospital of Catalonia, all of them imported after exposure in areas of epidemic infection between 2013-2015. All three patients had inflammatory joint pain for more than one year after acute disease (3, 2 and 1 years, respectively). In all cases, it appeared as polyarthritis with involvement of small joints of hands and feet (pseudorheumatoid arthritis-like). Laboratory tests showed a slight elevation of acute phase reactants, and analyses for immune markers were negative. Two of the patients required treatment with glucocorticoids and hydroxychloroquine. The course led to slow clinical improvement, but only one of them came to be completely asymptomatic. In the differential diagnosis of chronic polyarthritis, Chikungunya virus disease should also be considered in areas in which it is not endemic. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  5. Neopterin and human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Hofmann, B

    1993-01-01

    to predict the later development of AIDS. The increased neopterin concentrations show that the immune system is activated in HIV infection and demonstrate the presence of an interaction between the virus and the immune system. The most important future use of neopterin measurements may be in fast evaluation...

  6. Avian Influenza A Virus Infections in Humans

    Science.gov (United States)

    ... in People Spread of Bird Flu Viruses Between Animals and People Examples of Human Infections with Avian Influenza A ... Influenza A (H5N1) H5N1 in Birds and Other Animals H5N1 in People Public Health Threat of Highly Pathogenic Asian Avian ...

  7. Human immunodeficiency virus infection among migrant fishermen ...

    African Journals Online (AJOL)

    Background: People migrate from place to place for diverse reasons chief among which is economic. Migrant fishermen like other migrant population lead high risk sexual lifestyle and are therefore, predisposed to Human immunodeficiency virus (HIV) infection. Aim: To determine the prevalence of HIV among migrant ...

  8. Infection of Bergmann glia in the cerebellum of a skunk experimentally infected with street rabies virus.

    Science.gov (United States)

    Jackson, A C; Phelan, C C; Rossiter, J P

    2000-10-01

    Rabies virus is a highly neuronotropic virus and glial cell infection is not prominent in the central nervous system (CNS). Paraffin-embedded tissues from the cerebella of skunks experimentally infected with either a skunk salivary gland isolate of street rabies virus or the challenge virus standard (CVS) strain of fixed rabies virus were examined with immunoperoxidase staining for rabies virus antigen by using an anti-rabies virus nucleocapsid protein monoclonal antibody. A skunk infected with street rabies virus showed prominent infection of Bergmann glia. Although infected Purkinje cells were observed, they usually demonstrated a relatively small amount of antigen in their perikarya. A CVS-infected skunk showed many intensely labeled Purkinje cells and a relatively small number of infected Bergmann glia. These findings indicate that although rabies virus is a highly neuronotropic virus, street rabies virus strains do not always demonstrate strict neuronotropism in the central nervous system.

  9. Tickborne Powassan virus infections among Wisconsin residents.

    Science.gov (United States)

    Johnson, Diep K Hoang; Staples, J Erin; Sotir, Mark J; Warshauer, David M; Davis, Jeffrey P

    2010-04-01

    Powassan virus (POWV) is a tickborne Flavivirus that causes a rare but potentially life-threatening illness. The first reported case of POWV infection in a Wisconsin resident occurred in 2003. Enhanced surveillance and testing detected 2 additional cases. Patient specimens with a positive or equivocal immunoglobulin M (IgM) antibody to an arbovirus were sent from commercial laboratories to the Wisconsin State Laboratory of Hygiene and forwarded to the Centers for Disease Control and Prevention (CDC) for confirmatory testing. Patients with laboratory confirmed POWV infections were interviewed to obtain demographic, clinical, and epidemiologic information. POWV infections were confirmed in 3 adult Wisconsin residents in 2003, 2006, and 2007; illness onsets occurred during May and June. Two patients were hospitalized and all survived. One patient had a dual infection with POWV and Anaplasma phaghocytophilum. Specimens from all 3 patients were initially reported as positive for IgM antibody to either St Louis encephalitis or California serogroup viruses; POWV-specific antibody was detected during confirmatory testing at the CDC. Each patient had exposures to known or likely tick habitats in different counties within 30 days before illness onset. These are the first diagnosed human POWV infections in Wisconsin. Because all 3 patients were initially identified as having other arboviral infections using commercial screening kits, routine confirmatory testing is essential for proper diagnosis of most arboviral infections. Wisconsin residents should be educated regarding risks of acquiring and ways to prevent POWV infection and other tickborne diseases when spending time outdoors.

  10. Epidemiology of Hepatitis B and Hepatitis C Virus infections among ...

    African Journals Online (AJOL)

    Hepatitis B and hepatitis C virus infection are common in Nigeria; where they are a major cause of both acute and chronic liver disease, as well as hepatocellular cancer. Persons at risk of acquisition of Human Immunodeficiency Virus (HIV) infection are also at risk of acquisition of infection with Hepatitis B virus (HBV) and ...

  11. Immunodomination during peripheral vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Leon C W Lin

    Full Text Available Immunodominance is a fundamental property of CD8(+ T cell responses to viruses and vaccines. It had been observed that route of administration alters immunodominance after vaccinia virus (VACV infection, but only a few epitopes were examined and no mechanism was provided. We re-visited this issue, examining a panel of 15 VACV epitopes and four routes, namely intradermal (i.d., subcutaneous (s.c., intraperitoneal (i.p. and intravenous (i.v. injection. We found that immunodominance is sharpened following peripheral routes of infection (i.d. and s.c. compared with those that allow systemic virus dissemination (i.p. and i.v.. This increased immunodominance was demonstrated with native epitopes of VACV and with herpes simplex virus glycoprotein B when expressed from VACV. Responses to some subdominant epitopes were altered by as much as fourfold. Tracking of virus, examination of priming sites, and experiments restricting virus spread showed that priming of CD8(+ T cells in the spleen was necessary, but not sufficient to broaden responses. Further, we directly demonstrated that immunodomination occurs more readily when priming is mainly in lymph nodes. Finally, we were able to reduce immunodominance after i.d., but not i.p. infection, using a VACV expressing the costimulators CD80 (B7-1 and CD86 (B7-2, which is notable because VACV-based vaccines incorporating these molecules are in clinical trials. Taken together, our data indicate that resources for CD8(+ T cell priming are limiting in local draining lymph nodes, leading to greater immunodomination. Further, we provide evidence that costimulation can be a limiting factor that contributes to immunodomination. These results shed light on a possible mechanism of immunodomination and highlight the need to consider multiple epitopes across the spectrum of immunogenicities in studies aimed at understanding CD8(+ T cell immunity to viruses.

  12. Identification of a novel linear B-cell epitope using a monoclonal antibody against the carboxy terminus of the canine distemper virus nucleoprotein and sequence analysis of the identified epitope in different CDV isolates.

    Science.gov (United States)

    Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng

    2017-09-29

    The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.

  13. Influenza virus infection during pregnancy and in specific populations

    OpenAIRE

    Meijer, WJ

    2016-01-01

    Influenza virus infection causes approximately 1 billion infections worldwide each year. These infections are usually self-limiting, but serious complications may occur, in particular in adults aged 65 years or older, patients with cardiovascular disease, asthma or autoimmune disorders and pregnant women. In this thesis we studied several aspects of influenza virus infection. Pregnant women appear to be at an increased risk of complications of influenza virus infection, especially during the ...

  14. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  15. Dengue Virus-Specific Antibodies Enhance Brazilian Zika Virus Infection.

    Science.gov (United States)

    Castanha, Priscila M S; Nascimento, Eduardo J M; Braga, Cynthia; Cordeiro, Marli T; de Carvalho, Otávio V; de Mendonça, Leila R; Azevedo, Elisa A N; França, Rafael F O; Dhalia, Rafael; Marques, Ernesto T A

    2017-03-01

    Anti-Flavivirus antibodies are highly cross-reactive and may facilitate Zika virus (ZIKV) infection through the antibody-dependent enhancement (ADE) mechanism. We demonstrate that dengue-specific antibodies enhance the infection of a primary Brazilian ZIKV isolate in a FcγRII-expressing K562 cell line. In addition, we demonstrate that serum samples from dengue-immune pregnant women enhanced ZIKV infection. These findings highlight the need for epidemiological studies and animal models to further confirm the role of ADE in the development of congenital and neurological complications associated with ZIKV infections. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  16. Cells in Dengue Virus Infection In Vivo

    Directory of Open Access Journals (Sweden)

    Sansanee Noisakran

    2010-01-01

    Full Text Available Dengue has been recognized as one of the most important vector-borne emerging infectious diseases globally. Though dengue normally causes a self-limiting infection, some patients may develop a life-threatening illness, dengue hemorrhagic fever (DHF/dengue shock syndrome (DSS. The reason why DHF/DSS occurs in certain individuals is unclear. Studies in the endemic regions suggest that the preexisting antibodies are a risk factor for DHF/DSS. Viremia and thrombocytopenia are the key clinical features of dengue virus infection in patients. The amounts of virus circulating in patients are highly correlated with severe dengue disease, DHF/DSS. Also, the disturbance, mainly a transient depression, of hematological cells is a critical clinical finding in acute dengue patients. However, the cells responsible for the dengue viremia are unresolved in spite of the intensive efforts been made. Dengue virus appears to replicate and proliferate in many adapted cell lines, but these in vitro properties are extremely difficult to be reproduced in primary cells or in vivo. This paper summarizes reports on the permissive cells in vitro and in vivo and suggests a hematological cell lineage for dengue virus infection in vivo, with the hope that a new focus will shed light on further understanding of the complexities of dengue disease.

  17. Virus elimination in acute lymphocytic choriomeningitis virus infection. Correlation with virus-specific delayed-type hypersensitivity rather than cytotoxicity

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Volkert, M; Bro-Jørgensen, K

    1983-01-01

    The immunological effector mechanism responsible for the elimination of virus in murine acute non-fatal extracranial lymphocytic choriomeningitis virus infection was studied. In this infection virus clearance is generally regarded as the result of a direct action of virus-specific cytotoxic T cells...

  18. Hepatitis C virus infection and the brain.

    Science.gov (United States)

    Weissenborn, Karin; Tryc, Anita B; Heeren, Meike; Worthmann, Hans; Pflugrad, Henning; Berding, Georg; Bokemeyer, Martin; Tillmann, Hans L; Goldbecker, Annemarie

    2009-03-01

    There is growing evidence that hepatitis C virus (HCV)-infection may affect the brain. About half of the HCV-infected patients complain of chronic fatigue irrespective of their stage of liver disease or virus replication rate. Even after successful antiviral therapy fatigue persists in about one third of the patients. Many patients, in addition, report of deficits in attention, concentration and memory, some also of depression. Psychometric testing revealed deficits in attention and verbal learning ability as characteristic for HCV-afflicted patients with normal liver function. Magnetic resonance spectroscopic studies showed alterations of the cerebral choline, N-acetyl-aspartate, and creatine content in the basal ganglia, white matter and frontal cortex, respectively. Recently, pathologic cerebral serotonin and dopamine transporter binding and regional alterations of the cerebral glucose utilisation compatible with alterations of the dopaminergic attentional system were observed. Several studies detected HCV in brain samples or cerebro-spinal fluid. Interestingly, viral sequences in the brain often differed from those in the liver, but were closely related to those found in lymphoid tissue. Therefore, the Trojan horse hypothesis emerged: HCV-infected mononuclear blood cells enter the brain, enabling the virus to reside within the brain (probably in microglia) and to infect brain cells, especially astrocytes.

  19. Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

    Science.gov (United States)

    Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

    2015-07-01

    In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.

  20. Prevalence and prognostic significance of infection with TT virus in patients infected with human immunodeficiency virus

    DEFF Research Database (Denmark)

    Christensen, JK; Eugen-Olsen, Jesper; Sørensen, M

    2000-01-01

    No clear association between human disease and TT virus (TTV) has been documented. A possible pathogenic role of TTV was investigated in patients infected with human immunodeficiency virus (HIV). TTV serum concentrations were estimated in 185 HIV-infected patients by dilution polymerase chain...... reaction. Of these, 149 (76%) were TTV-positive, compared with 18 (7%) of 252 Danish blood donors (PHIV-infected patients who were TTV-positive, 72 (51%) had high TTV viremia (>/=5 times the highest concentration observed among blood donors, i.e., >/=3.5x105 TTV/mL of serum). High TTV...... viremia was associated with decreased survival (PHIV viral load (P

  1. Hepatitis C virus infection in the human immunodeficiency virus infected patient

    DEFF Research Database (Denmark)

    Clausen, Louise Nygaard; Lundbo, Lene Fogt; Benfield, Thomas

    2014-01-01

    for 15%-20% of chronically infected individuals. HCV treatment has rapidly changed with the development of new direct-acting antiviral agents; therefore, cure rates have greatly improved because the new treatment regimens target different parts of the HCV life cycle. In this review, we focus......Human immunodeficiency virus (HIV) and hepatitis C virus (HCV) share the same transmission routes; therefore, coinfection is frequent. An estimated 5-10 million individuals alone in the western world are infected with both viruses. The majority of people acquire HCV by injection drug use and...... HIV-HCV coinfected individuals. Morbidity and mortality rates from chronic HCV infection will increase because the infection incidence peaked in the mid-1980s and because liver disease progresses slowly and is clinically silent to cirrhosis and end-stage-liver disease over a 15-20 year time period...

  2. Post-vaccinal distemper encephalitis in two Border Collie cross littermates.

    Science.gov (United States)

    Fairley, R A; Knesl, O; Pesavento, P A; Elias, B C

    2015-03-01

    One 4.5-month-old male Border Collie cross presented with aggression and seizures in October 2006. A 16-month-old, female, spayed Border Collie cross presented with hypersalivation and a dropped jaw and rapidly became stuporous in September 2007. The dogs were littermates and developed acute neurological signs 5 and 27 days, respectively, after vaccination with different modified live vaccines containing canine distemper virus. Sections of brain in both dogs showed evidence of encephalitis mainly centred on the grey matter of brainstem nuclei, where there was extensive and intense parenchymal and perivascular infiltration of histiocytes and lymphocytes. Intra-nuclear and intra-cytoplasmic inclusions typical of distemper were plentiful and there was abundant labelling for canine distemper virus using immunohistochemistry. Post-vaccinal canine distemper. Post-vaccinal canine distemper has mainly been attributed to virulent vaccine virus, but it may also occur in dogs whose immunologic nature makes them susceptible to disease induced by a modified-live vaccine virus that is safe and protective for most dogs.

  3. [A NEW PANDEMIC: ZIKA VIRUS INFECTION].

    Science.gov (United States)

    Bourée, Patrice

    2016-06-01

    Zika virus is a flavivirus isolated in non human primates in 1647, then in humans 1954 (Uganda). It emerged on Micronesia (island af Yap) in 2007, then in French Polynesia in 2013-2014, in South America (mostly in Brazil and Colombia) in 2015 and in French West Indies in 2016. It is transmitted by the bite of Aedes mosquitoes. Zika virus infection is symptomatic in only 20% of cases and clinical presentation is associated with mild illness. But several neurological complications are reported (as Guillain-Barré syndrome: 48 cases in French Polynesia) and congenital malformations (microcephaly). Laboratory diagnosis is based on virus isolation by PCR. There is no specific treatment or vaccine available against the Zika virs. Prevention is based on measures of protection from mosquitoes bites.

  4. Myeloradiculopathy associated with chikungunya virus infection.

    Science.gov (United States)

    Bank, Anna M; Batra, Ayush; Colorado, Rene A; Lyons, Jennifer L

    2016-02-01

    Chikungunya virus (CHIKV) is a mosquito-borne alphavirus that is endemic to parts of Africa, South and Southeast Asia, and more recently the Caribbean. Patients typically present with fever, rash, and arthralgias, though neurologic symptoms, primarily encephalitis, have been described. We report the case of a 47-year-old woman who was clinically diagnosed with CHIKV while traveling in the Dominican Republic and presented 10 days later with left lower extremity weakness, a corresponding enhancing thoracic spinal cord lesion, and positive CHIKV serologies. She initially responded to corticosteroids, followed by relapsing symptoms and gradual clinical improvement. The time lapse between acute CHIKV infection and the onset of myelopathic sequelae suggests an immune-mediated phenomenon rather than direct activity of the virus itself. Chikungunya virus should be considered in the differential diagnosis of myelopathy in endemic areas. The progression of symptoms despite corticosteroid administration suggests more aggressive immunomodulatory therapies may be warranted at disease onset.

  5. Mechanisms of Zika Virus Infection and Neuropathogenesis.

    Science.gov (United States)

    Olagnier, David; Muscolini, Michela; Coyne, Carolyn B; Diamond, Michael S; Hiscott, John

    2016-08-01

    A spotlight has been focused on the mosquito-borne Zika virus (ZIKV) because of its epidemic outbreak in Brazil and Latin America, as well as the severe neurological manifestations of microcephaly and Guillain-Barré syndrome associated with infection. In this review, we discuss the recent literature on ZIKV-host interactions, including new mechanistic insight concerning the basis of ZIKV-induced neuropathogenesis.

  6. Clinical and biological differences between recurrent herpes simplex virus and varicella-zoster virus infections

    International Nuclear Information System (INIS)

    Straus, S.E.

    1989-01-01

    The major features that distinguish recurrent herpes simplex virus infections from zoster are illustrated in this article by two case histories. The clinical and epidemiologic features that characterize recurrent herpes simplex virus and varicella-zoster virus infections are reviewed. It is noted that herpesvirus infections are more common and severe in patients with cellular immune deficiency. Each virus evokes both humoral and cellular immune response in the course of primary infection. DNA hybridization studies with RNA probes labelled with sulfur-35 indicate that herpes simplex viruses persist within neurons, and that varicella-zoster virus is found in the satellite cells that encircle the neurons

  7. Mechanisms of immune evasion in Epstein-Barr virus infection

    OpenAIRE

    Gram., A.M.

    2016-01-01

    The human herpesvirus Epstein-Barr virus (EBV) is a large DNA virus that infects over 90% of the adult world population. EBV is the causative agent of infectious mononucleosis and EBV infection is associated with various malignancies. EBV establishes lifelong infections in immunocompetent hosts. To counteract the host’s immune defence, EBV acquired numerous immune evasion mechanisms. During latency of EBV, viral protein synthesis is limited or absent, making the virus-infected cells virtually...

  8. Pharmacological intervention for dengue virus infection.

    Science.gov (United States)

    Lai, Jenn-Haung; Lin, Yi-Ling; Hsieh, Shie-Liang

    2017-04-01

    Dengue virus (DENV) infection has a considerable health impact in tropical and subtropical countries worldwide. Escalation of infection rates greatly increases morbidity and mortality, most commonly from deaths due to dengue hemorrhagic fever and dengue shock syndrome. Although the development of an effective, long-lasting vaccine has been a major aim for control and prevention of DENV infection, the currently licensed vaccine has limitations and is less than satisfactory. Thus, there remains an important need to identify effective and tolerable medications for treatment of DENV-infected patients both in the early phase, to prevent progression to fatal outcomes, and to minimize deaths after patients develop severe complications. This review will address several specific points, including (1) approaches to identify anti-DENV medications, (2) recent advances in the development of potential compounds targeting DENV infection, (3) experience with clinical trials of regimens for DENV infection, (4) some available medications of potential for clinical trials against DENV infection, (5) reasons for unsuccessful outcomes and challenges of anti-DENV treatments, and (6) directions for developing or selecting better anti-DENV strategies. This review provides useful guidance for clinicians selecting drugs for DENV-infected patients with severe manifestations or potential fatal disease progression, and for basic researchers seeking to develop effective anti-DENV regimens. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Influenza A virus infections in swine: pathogenesis and diagnosis.

    Science.gov (United States)

    Janke, B H

    2014-03-01

    Influenza has been recognized as a respiratory disease in swine since its first appearance concurrent with the 1918 "Spanish flu" human pandemic. All influenza viruses of significance in swine are type A, subtype H1N1, H1N2, or H3N2 viruses. Influenza viruses infect epithelial cells lining the surface of the respiratory tract, inducing prominent necrotizing bronchitis and bronchiolitis and variable interstitial pneumonia. Cell death is due to direct virus infection and to insult directed by leukocytes and cytokines of the innate immune system. The most virulent viruses consistently express the following characteristics of infection: (1) higher or more prolonged virus replication, (2) excessive cytokine induction, and (3) replication in the lower respiratory tract. Nearly all the viral proteins contribute to virulence. Pigs are susceptible to infection with both human and avian viruses, which often results in gene reassortment between these viruses and endemic swine viruses. The receptors on the epithelial cells lining the respiratory tract are major determinants of infection by influenza viruses from other hosts. The polymerases, especially PB2, also influence cross-species infection. Methods of diagnosis and characterization of influenza viruses that infect swine have improved over the years, driven both by the availability of new technologies and by the necessity of keeping up with changes in the virus. Testing of oral fluids from pigs for virus and antibody is a recent development that allows efficient sampling of large numbers of animals.

  10. Outbreaks of Tilapia Lake Virus Infection, Thailand, 2015?2016

    OpenAIRE

    Surachetpong, Win; Janetanakit, Taveesak; Nonthabenjawan, Nutthawan; Tattiyapong, Puntanat; Sirikanchana, Kwanrawee; Amonsin, Alongkorn

    2017-01-01

    During 2015?2016, several outbreaks of tilapia lake virus infection occurred among tilapia in Thailand. Phylogenetic analysis showed that the virus from Thailand grouped with a tilapia virus (family Orthomyxoviridae) from Israel. This emerging virus is a threat to tilapia aquaculture in Asia and worldwide.

  11. Outbreaks of Tilapia Lake Virus Infection, Thailand, 2015-2016.

    Science.gov (United States)

    Surachetpong, Win; Janetanakit, Taveesak; Nonthabenjawan, Nutthawan; Tattiyapong, Puntanat; Sirikanchana, Kwanrawee; Amonsin, Alongkorn

    2017-06-01

    During 2015-2016, several outbreaks of tilapia lake virus infection occurred among tilapia in Thailand. Phylogenetic analysis showed that the virus from Thailand grouped with a tilapia virus (family Orthomyxoviridae) from Israel. This emerging virus is a threat to tilapia aquaculture in Asia and worldwide.

  12. Virus strategies for evasion of the host response to infection.

    Science.gov (United States)

    Smith, G L

    1994-03-01

    The attack on viruses and virus-infected cells by the mammalian immune system has provided considerable selective pressure for viruses that have evolved vigorous countermeasures to pre-empt, neutralize or evade this host attack. These countermeasures are astonishingly diverse, and their study imparts fundamental information about immunology and the mechanisms enabling viruses to survive and cause disease.

  13. Photodynamic treatment of Herpes simplex virus infection in vitro

    International Nuclear Information System (INIS)

    Lytle, C.D.; Hester, L.D.

    1976-01-01

    The effects of photodynamic action on in vitro herpes simplex virus infections of CV-1 monkey kidney fibroblasts or human skin fibroblasts were determined using proflavine sulfate and white fluorescent lamps. Photodynamic treatment of confluent cell monolayers prior to virus infection inactivated cell capacity, i.e. the capacity of the treated cells to support subsequent virus growth as measured by plaque formation. The capacity of human cells was more sensitive to inactivation than the capacity of monkey cells when 6 μM proflavine was used. Treated cell monolayers recovered the capacity to support virus plaque formation when virus infection was delayed four days after the treatment. Experiments in which the photodynamically treated monolayers were infected with UV-irradiated virus demonstrated that this treatment induced Weigle reactivation in both types of cells. This reactivation occurred for virus infection just after treatment or 4 days later. A Luria-Latarjet-type experiment was also performed in which cultures infected with unirradiated virus were photodynamically treated at different times after the start of infection. The results showed that for the first several hours of the virus infection the infected cultures were more sensitive to inactivation by photodynamic treatment than cell capacity. By the end of the eclipse period the infected cultures were less sensitive to inactivation than cell capacity. Results from extracellular inactivation of virus growth in monkey cells at 6 μM proflavine indicated that at physiological pH the virus has a sensitivity to photodynamic inactivation similar to that for inactivation of cell capacity. The combined data indicated that photodynamic treatment of the cell before or after virus infection could prevent virus growth. Thus, photodynamic inactivation of infected and uninfected cells may be as important as inactivation of virus particles when considering possible mechanisms in clinical photodynamic therapy for herpes

  14. Hepatitis A virus infection - shifting epidemiology

    International Nuclear Information System (INIS)

    Tariq, W.Z.; Hussain, A.B.; Hussain, T.; Anwar, M.; Ghani, E.; Asad-Ullah

    2006-01-01

    Objective of the Study: To determine the age distribution in HAV infection and seasonal variations in the prevalence of acute viral hepatitis caused by hepatitis A virus. Study Design: A descriptive study. Place and Duration: The study was carried out on the patients reporting at Virology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, for determination of hepatitis A virus (HAV) IgM antibody, from July 2003 to June 2004. Patients and Methods: Altogether 626 patients with clinical suspicion of hepatitis A virus infection were referred to AFIP Rawalpindi for this test. Blood samples were collected and sera were separated and transferred to plastic aliquots that were stored at -20 deg. C in a retrievable fashion until utilized in testing. The testing for ant-HAY IgM was carried out with the help of a commercial Enzyme Linked Immunosorbent Assay (ELISA) using reagent kits of Dias Orin (Germany) for HAV IgM antibodies. Results: The HAV IgM positive rate was 40.57% (252/626). Those tested included the sporadic cases as well as the patients from outbreak in two schools of Nowshera cantonment. The age of patients testing positive for HAV IgM, ranged from 03 to 27 years. There was a statistically significant seasonal difference in rate of positivity in different months of the calendar year. An outbreak of HAV infection was seen in the children of two neighboring schools of a cantonment, in which 44 children in different classes developed clinical jaundice. Conclusion: HAV infection occurs in a significant proportion of young people with a clinical suspicion of HAV infection. There is a changing trend of developing hepatitis a in the age beyond 18 years and in outbreaks, which was not there in our patients previously due to universal immunity found against HAV by the age of 18. It was because of chances of consumption of polluted food. (author)

  15. Laboratory Diagnosis of Zika Virus Infection.

    Science.gov (United States)

    Landry, Marie Louise; St George, Kirsten

    2017-01-01

    -The rapid and accurate diagnosis of Zika virus infection is an international priority. -To review current recommendations, methods, limitations, and priorities for Zika virus testing. -Sources include published literature, public health recommendations, laboratory procedures, and testing experience. -Until recently, the laboratory diagnosis of Zika infection was confined to public health or research laboratories that prepared their own reagents, and test capacity has been limited. Furthermore, Zika cross-reacts serologically with other flaviviruses, such as dengue, West Nile, and yellow fever. Current or past infection, or even vaccination with another flavivirus, will often cause false-positive or uninterpretable Zika serology results. Detection of viral RNA during acute infection using nucleic acid amplification tests provides more specific results, and a number of commercial nucleic acid amplification tests have received emergency use authorization. In addition to serum, testing of whole blood and urine is recommended because of the higher vial loads and longer duration of shedding. However, nucleic acid amplification testing has limited utility because many patients are asymptomatic or present for testing after the brief period of Zika shedding has passed. Thus, the greatest need and most difficult challenge is development of accurate antibody tests for the diagnosis of recent Zika infection. Research is urgently needed to identify Zika virus epitopes that do not cross-react with other flavivirus antigens. New information is emerging at a rapid pace and, with ongoing public-private and international collaborations and government support, it is hoped that rapid progress will be made in developing robust and widely applicable diagnostic tools.

  16. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  17. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection.

    Science.gov (United States)

    Paquin-Proulx, Dominic; Avelino-Silva, Vivian I; Santos, Bianca A N; Silveira Barsotti, Nathália; Siroma, Fabiana; Fernandes Ramos, Jessica; Coracini Tonacio, Adriana; Song, Alice; Maestri, Alvino; Barros Cerqueira, Natalia; Felix, Alvina Clara; Levi, José Eduardo; Greenspun, Benjamin C; de Mulder Rougvie, Miguel; Rosenberg, Michael G; Nixon, Douglas F; Kallas, Esper G

    2018-01-01

    Dengue virus (DENV) and Zika virus (ZIKV) are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome). The protective and pathogenic roles played by the immune response in these infections is unknown. Mucosal-associated invariant T (MAIT) cells are a population of innate T cells with potent anti-bacterial activity. MAIT cells have also been postulated to play a role in the immune response to viral infections. In this study, we evaluated MAIT cell frequency, phenotype, and function in samples from subjects with acute and convalescent DENV infection. We found that in acute DENV infection, MAIT cells had elevated co-expression of the activation markers CD38 and HLA-DR and had a poor IFNγ response following bacterial stimulation. Furthermore, we found that MAIT cells can produce IFNγ in response to in vitro infection with ZIKV. This MAIT cell response was independent of MR1, but dependent on IL-12 and IL-18. Our results suggest that MAIT cells may play an important role in the immune response to Flavivirus infections.

  18. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection.

    Directory of Open Access Journals (Sweden)

    Dominic Paquin-Proulx

    2018-01-01

    Full Text Available Dengue virus (DENV and Zika virus (ZIKV are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome. The protective and pathogenic roles played by the immune response in these infections is unknown. Mucosal-associated invariant T (MAIT cells are a population of innate T cells with potent anti-bacterial activity. MAIT cells have also been postulated to play a role in the immune response to viral infections. In this study, we evaluated MAIT cell frequency, phenotype, and function in samples from subjects with acute and convalescent DENV infection. We found that in acute DENV infection, MAIT cells had elevated co-expression of the activation markers CD38 and HLA-DR and had a poor IFNγ response following bacterial stimulation. Furthermore, we found that MAIT cells can produce IFNγ in response to in vitro infection with ZIKV. This MAIT cell response was independent of MR1, but dependent on IL-12 and IL-18. Our results suggest that MAIT cells may play an important role in the immune response to Flavivirus infections.

  19. Hepatitis E Virus (HEV) Infection in Ireland

    LENUS (Irish Health Repository)

    Hickey, C

    2016-09-01

    Hepatitis E virus (HEV) is a single stranded RNA virus causing infection worldwide. In developing countries HEV genotypes 1 and 2 spread faeco-orally via water. Recently, infections with HEV have been detected in Europe and North America in patients with no travel history. These are food-borne HEV genotypes 3 and 4, a pig-associated zoonosis. Most infections are asymptomatic but morbidity and chronic infection may occur with prior liver disease or immunosuppression. International seroprevalence rates vary and with improved diagnostics have increased. To determine the current prevalence in this region we studied anonymised serum samples submitted in 2015 for routine testing. We detected anti-HEV IgG in 16\\/198 (8%) individuals, highest rate in 40-59 year olds (43.8%). This is higher than reported for the same region in 1995 (0.4%) using a previous generation assay. This study provides evidence of HEV circulation in Ireland and reinforces the need for ongoing surveillance.

  20. Viral protein synthesis in cowpea mosaic virus infected protoplasts

    International Nuclear Information System (INIS)

    Rottier, P.

    1980-01-01

    Some aspects of cowpea mosaic virus (CPMV) multiplication in cowpea mesophyll protoplasts were studied. The detection and characterization of proteins whose synthesis is induced or is stimulated upon virus infection was performed with the aid of radioactive labelling. (Auth.)

  1. Clinical studies on hepatitis B, C, and E virus infection

    NARCIS (Netherlands)

    Willemse, S.B.

    2017-01-01

    Chronic viral hepatitis is a major cause of liver-related morbidity and mortality. This thesis describes clinical aspects of hepatitis B, C, and E virus infection. Part I focuses on hepatitis B virus (HBV) infection. This part describes immune responses of patients with acute HBV-infection,

  2. Mechanisms of immune evasion in Epstein-Barr virus infection

    NARCIS (Netherlands)

    Gram., A.M.

    2016-01-01

    The human herpesvirus Epstein-Barr virus (EBV) is a large DNA virus that infects over 90% of the adult world population. EBV is the causative agent of infectious mononucleosis and EBV infection is associated with various malignancies. EBV establishes lifelong infections in immunocompetent hosts. To

  3. Imunocompetent Mice Model for Dengue Virus Infection

    Directory of Open Access Journals (Sweden)

    Denise Gonçalves

    2012-01-01

    Full Text Available Dengue fever is a noncontagious infectious disease caused by dengue virus (DENV. DENV belongs to the family Flaviviridae, genus Flavivirus, and is classified into four antigenically distinct serotypes: DENV-1, DENV-2, DENV-3, and DENV-4. The number of nations and people affected has increased steadily and today is considered the most widely spread arbovirus (arthropod-borne viral disease in the world. The absence of an appropriate animal model for studying the disease has hindered the understanding of dengue pathogenesis. In our study, we have found that immunocompetent C57BL/6 mice infected intraperitoneally with DENV-1 presented some signs of dengue disease such as thrombocytopenia, spleen hemorrhage, liver damage, and increase in production of IFNγ and TNFα cytokines. Moreover, the animals became viremic and the virus was detected in several organs by real-time RT-PCR. Thus, this animal model could be used to study mechanism of dengue virus infection, to test antiviral drugs, as well as to evaluate candidate vaccines.

  4. Comparison of association of diabetes mellitus in hepatitis C virus infection and hepatitis B virus infection

    International Nuclear Information System (INIS)

    Khan, I.A.; Bukhari, M.H.; Khokhar, M.S.

    2013-01-01

    Background: While patients with liver disease are known to have a higher prevalence of glucose intolerance, preliminary studies suggest that hepatitis C virus (HCV) infection may be an additional risk factor for the development of diabetes mellitus (DM). Objective: The presented study was aimed to study and determine a relationship between the relative proportions of Diabetes Mellitus in patients suffering from HCV infection. Study Design: This cross sectional study. Study Settings: Patients were registered from outdoor as well as indoor departments of different teaching hospitals (Services hospital Lahore and medical departments in Jinnah hospital, Mayo hospital, Sir Ganga Ram hospital) in Lahore, Pakistan. Methods: This cross sectional study was comprised of age and sex matched 258 patients of viral hepatitis B infection and viral hepatitis C infection, conducted at Hepatitis Clinic Services Hospital, affiliated with Post Graduate Medical Institute, Lahore. Diagnosis of HBV was made with evidence of hepatitis B surface antigen, HCV infection was diagnosed if patient was sero positive for anti HCV (ELISA methods) and HCV - RNA (By PCR). Diabetes Mellitus was diagnosed after fulfilling the American Diabetic Association Criteria, from November, 2000 to September, 2002. Results: A total of 318 patients were registered, out of which 258 cases fulfilled the inclusion criteria, 164 hepatitis C infected and 94 hepatitis B infected cases, 16.46% hepatitis C infected cases were diagnosed as diabetics while 4.25% hepatitis B infected cases were diagnosed as diabetics. Conclusion: This study concludes that there is high Association and relationship of Diabetes Mellitus with Hepatitis C virus infection as compared with Hepatitis B virus infection. (author)

  5. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia.

    Science.gov (United States)

    Yob, J. M.; Field, H.; Rashdi, A. M.; Morrissy, C.; van der Heide, B.; Rota, P.; bin Adzhar, A.; White, J.; Daniels, P.; Jamaluddin, A.; Ksiazek, T.

    2001-01-01

    Nipah virus, family Paramyxoviridae, caused disease in pigs and humans in peninsular Malaysia in 1998-99. Because Nipah virus appears closely related to Hendra virus, wildlife surveillance focused primarily on pteropid bats (suborder Megachiroptera), a natural host of Hendra virus in Australia. We collected 324 bats from 14 species on peninsular Malaysia. Neutralizing antibodies to Nipah virus were demonstrated in five species, suggesting widespread infection in bat populations in peninsular Malaysia. PMID:11384522

  6. Association between urticaria and virus infections: A systematic review.

    Science.gov (United States)

    Imbalzano, Egidio; Casciaro, Marco; Quartuccio, Sebastiano; Minciullo, Paola L; Cascio, Antonio; Calapai, Gioacchino; Gangemi, Sebastiano

    2016-01-01

    The association between urticaria and virus infections has rarely been reported in the literature. The lack of reported cases is probably due to the difficulty in establishing a cause-and-effect relationship. It is not possible to challenge the patient with an etiologic agent. The purpose of this work was to perform a systematic review on the association between urticaria and virus infections. This systematic review was conducted according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. We searched for articles from January 1, 2008, through May 2015, by using two key terms related to urticaria and virus diseases, "urticaria" and one key term related to virus infections, "virus disease," then "urticaria" and the name of each virus family, and of the most representative virus serotypes. We reported cases of patients affected either by acute or chronic urticaria with a concurrent virus infection. Previous other causes of urticaria had to be excluded. Herpesviridae infections and urticaria were the most frequently reported associations in children. However, hepatitis virus infections would appear to be the most-frequent cause of urticaria in adults. Data obtained indicated viral infection as a potential trigger and sometimes as the main etiologic agent in causing acute or chronic urticaria. In every case, urticarial manifestation cleared up after either healing or controlling of the viral infection. However, prospective studies and well-structured research is needed to better clarify the role of viruses in the pathogenesis of urticaria and their relative prevalence.

  7. Congenital Zika Virus Infection: Beyond Neonatal Microcephaly.

    Science.gov (United States)

    Melo, Adriana Suely de Oliveira; Aguiar, Renato Santana; Amorim, Melania Maria Ramos; Arruda, Monica B; Melo, Fabiana de Oliveira; Ribeiro, Suelem Taís Clementino; Batista, Alba Gean Medeiros; Ferreira, Thales; Dos Santos, Mayra Pereira; Sampaio, Virgínia Vilar; Moura, Sarah Rogéria Martins; Rabello, Luciana Portela; Gonzaga, Clarissa Emanuelle; Malinger, Gustavo; Ximenes, Renato; de Oliveira-Szejnfeld, Patricia Soares; Tovar-Moll, Fernanda; Chimelli, Leila; Silveira, Paola Paz; Delvechio, Rodrigo; Higa, Luiza; Campanati, Loraine; Nogueira, Rita M R; Filippis, Ana Maria Bispo; Szejnfeld, Jacob; Voloch, Carolina Moreira; Ferreira, Orlando C; Brindeiro, Rodrigo M; Tanuri, Amilcar

    2016-12-01

    Recent studies have reported an increase in the number of fetuses and neonates with microcephaly whose mothers were infected with the Zika virus (ZIKV) during pregnancy. To our knowledge, most reports to date have focused on select aspects of the maternal or fetal infection and fetal effects. To describe the prenatal evolution and perinatal outcomes of 11 neonates who had developmental abnormalities and neurological damage associated with ZIKV infection in Brazil. We observed 11 infants with congenital ZIKV infection from gestation to 6 months in the state of Paraíba, Brazil. Ten of 11 women included in this study presented with symptoms of ZIKV infection during the first half of pregnancy, and all 11 had laboratory evidence of the infection in several tissues by serology or polymerase chain reaction. Brain damage was confirmed through intrauterine ultrasonography and was complemented by magnetic resonance imaging. Histopathological analysis was performed on the placenta and brain tissue from infants who died. The ZIKV genome was investigated in several tissues and sequenced for further phylogenetic analysis. Description of the major lesions caused by ZIKV congenital infection. Of the 11 infants, 7 (63.6%) were female, and the median (SD) maternal age at delivery was 25 (6) years. Three of 11 neonates died, giving a perinatal mortality rate of 27.3%. The median (SD) cephalic perimeter at birth was 31 (3) cm, a value lower than the limit to consider a microcephaly case. In all patients, neurological impairments were identified, including microcephaly, a reduction in cerebral volume, ventriculomegaly, cerebellar hypoplasia, lissencephaly with hydrocephalus, and fetal akinesia deformation sequence (ie, arthrogryposis). Results of limited testing for other causes of microcephaly, such as genetic disorders and viral and bacterial infections, were negative, and the ZIKV genome was found in both maternal and neonatal tissues (eg, amniotic fluid, cord blood, placenta, and

  8. Lack of Durable Cross-Neutralizing Antibodies Against Zika Virus from Dengue Virus Infection.

    Science.gov (United States)

    Collins, Matthew H; McGowan, Eileen; Jadi, Ramesh; Young, Ellen; Lopez, Cesar A; Baric, Ralph S; Lazear, Helen M; de Silva, Aravinda M

    2017-05-01

    Cross-reactive antibodies elicited by dengue virus (DENV) infection might affect Zika virus infection and confound serologic tests. Recent data demonstrate neutralization of Zika virus by monoclonal antibodies or human serum collected early after DENV infection. Whether this finding is true in late DENV convalescence (>6 months after infection) is unknown. We studied late convalescent serum samples from persons with prior DENV or Zika virus exposure. Despite extensive cross-reactivity in IgG binding, Zika virus neutralization was not observed among primary DENV infections. We observed low-frequency (23%) Zika virus cross-neutralization in repeat DENV infections. DENV-immune persons who had Zika virus as a secondary infection had distinct populations of antibodies that neutralized DENVs and Zika virus, as shown by DENV-reactive antibody depletion experiments. These data suggest that most DENV infections do not induce durable, high-level Zika virus cross-neutralizing antibodies. Zika virus-specific antibody populations develop after Zika virus infection irrespective of prior DENV immunity.

  9. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-07-15

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

  10. Neurological complications of Zika virus infection.

    Science.gov (United States)

    Carod-Artal, Francisco Javier

    2018-04-26

    Zika virus (ZIKV) disease is a vector-borne infectious disease transmitted by Aedes mosquitoes. Recently, ZIKV has caused outbreaks in most American countries. Areas covered: Publications about neurological complications of ZIKV infection retrieved from pubmed searchers were reviewed, and reference lists and relevant articles from review articles were also examined. Vertical/intrauterine transmission leads to congenital infection and causes microcephaly and congenital ZIKV syndrome. ZIKV preferentially infects human neural progenitor cells and triggers cell apoptosis. ZIKV RNA has been identified in foetal brain tissue and brains of microcephalic infants who died; amniotic fluid and placentas of pregnant mothers; and umbilical cord, cerebro-spinal fluid and meninges of newborns. The increase in the number of Guillain-Barre syndrome (GBS) cases during the ZIKV outbreak in the Americas provides epidemiological evidence for the link between ZIKV infection and GBS. Less frequently reported ZIKV neurological complications include encephalitis/meningoencephalitis, acute disseminated encephalomyelitis, myelitis, cerebrovascular complications (ischemic infarction; vasculopathy), seizures and encephalopathy, sensory polyneuropathy and sensory neuronopathy. Analysis of GBS incidence could serve as an epidemiological 'marker' or sentinel for ZIKV disease and other neurological complications associated to ZIKV. Expert commentary: An expanding spectrum of neurological complications associated with ZIKV infection is being recognised.

  11. Animal Models of Dengue Virus Infection

    Directory of Open Access Journals (Sweden)

    Eva Harris

    2012-01-01

    Full Text Available The development of animal models of dengue virus (DENV infection and disease has been challenging, as epidemic DENV does not naturally infect non-human species. Non-human primates (NHPs can sustain viral replication in relevant cell types and develop a robust immune response, but they do not develop overt disease. In contrast, certain immunodeficient mouse models infected with mouse-adapted DENV strains show signs of severe disease similar to the ‘vascular-leak’ syndrome seen in severe dengue in humans. Humanized mouse models can sustain DENV replication and show some signs of disease, but further development is needed to validate the immune response. Classically, immunocompetent mice infected with DENV do not manifest disease or else develop paralysis when inoculated intracranially; however, a new model using high doses of DENV has recently been shown to develop hemorrhagic signs after infection. Overall, each model has its advantages and disadvantages and is differentially suited for studies of dengue pathogenesis and immunopathogenesis and/or pre-clinical testing of antiviral drugs and vaccines.

  12. Zika virus infections in pregnancy: epidemics and case management

    Directory of Open Access Journals (Sweden)

    Fatih sahiner

    2016-03-01

    Full Text Available Zika virus is an RNA virus belonging to the Flaviviridae family, and is primarily transmitted by Aedes mosquitoes. Only a small number of cases had been described until 2007 when the first major Zika virus outbreak occurred on Yap Island, Micronesia. Approximately 80% of people infected with Zika virus do not exhibit any symptoms. Symptomatic infections are generally moderate and characterized by acute onset of fever, maculopapular rash, arthralgia, or conjunctivitis. The virus has recently attracted a broad interest due to the emerging cases of microcephaly that are possibly associated with mothers infected by the Zika virus during pregnancy, and the regional increases in the incidence of Guillain-Barre syndrome during the epidemic periods. Although the relationship between Zika virus infection and these abnormalities is not obviously understood yet, Zika virus testing is recommended for infants with microcephaly or intracranial calcifications whose mothers were potentially infected with the Zika virus during pregnancy. Every day, new reports are being published about the outbreaks associated with this virus; nevertheless, no new cases of this virus have been reported in Turkey. Despite this, we cannot currently exclude the possibility of the encounter with the virus because of the presence of Aedes mosquitoes, which are responsible for the spread of the virus, are prevalent in Turkey, and an increasing number of travel-related cases are being reported from different countries. In the light of the current knowledge on this virus, this review aims to discuss the course of Zika virus infections in detail, especially congenital infection, and presenting current information about the case management and preventive measures. [Cukurova Med J 2016; 41(1.000: 143-151

  13. Hepatitis B virus infection in Indonesia.

    Science.gov (United States)

    Yano, Yoshihiko; Utsumi, Takako; Lusida, Maria Inge; Hayashi, Yoshitake

    2015-10-14

    Approximately 240 million people are chronically infected with hepatitis B virus (HBV), 75% of whom reside in Asia. Approximately 600000 of infected patients die each year due to HBV-related diseases or hepatocellular carcinoma (HCC). The endemicity of hepatitis surface antigen in Indonesia is intermediate to high with a geographical difference. The risk of HBV infection is high in hemodialysis (HD) patients, men having sex with men, and health care workers. Occult HBV infection has been detected in various groups such as blood donors, HD patients, and HIV-infected individuals and children. The most common HBV subgenotype in Indonesia is B3 followed by C1. Various novel subgenotypes of HBV have been identified throughout Indonesia, with the novel HBV subgenotypes C6-C16 and D6 being successfully isolated. Although a number of HBV subgenotypes have been discovered in Indonesia, genotype-related pathogenicity has not yet been elucidated in detail. Therefore, genotype-related differences in the prognosis of liver disease and their effects on treatments need to be determined. A previous study conducted in Indonesia revealed that hepatic steatosis was associated with disease progression. Pre-S2 mutations and mutations at C1638T and T1753V in HBV/B3 have been associated with advanced liver diseases including HCC. However, drug resistance to lamivudine, which is prominent in Indonesia, remains obscure. Although the number of studies on HBV in Indonesia has been increasing, adequate databases on HBV infection are limited. We herein provided an overview of the epidemiology and clinical characteristics of HBV infection in Indonesia.

  14. Polysulfonate suramin inhibits Zika virus infection.

    Science.gov (United States)

    Tan, Chee Wah; Sam, I-Ching; Chong, Wei Lim; Lee, Vannajan Sanghiran; Chan, Yoke Fun

    2017-07-01

    Zika virus (ZIKV) is an arthropod-borne flavivirus that causes newborn microcephaly and Guillian-Barré syndrome in adults. No therapeutics are available to treat ZIKV infection or other flaviviruses. In this study, we explored the inhibitory effect of glycosaminoglycans and analogues against ZIKV infection. Highly sulfated heparin, dextran sulfate and suramin significantly inhibited ZIKV infection in Vero cells. De-sulfated heparin analogues lose inhibitory effect, implying that sulfonate groups are critical for viral inhibition. Suramin, an FDA-approved anti-parasitic drug, inhibits ZIKV infection with 3-5 log 10  PFU viral reduction with IC 50 value of ∼2.5-5 μg/ml (1.93 μM-3.85 μM). A time-of-drug-addition study revealed that suramin remains potent even when administrated at 1-24 hpi. Suramin inhibits ZIKV infection by preventing viral adsorption, entry and replication. Molecular dynamics simulation revealed stronger interaction of suramin with ZIKV NS3 helicase than with the envelope protein. Suramin warrants further investigation as a potential antiviral candidate for ZIKV infection. Heparan sulfate (HS) is a cellular attachment receptor for multiple flaviviruses. However, no direct ZIKV-heparin interaction was observed in heparin-binding analysis, and downregulate or removal of cellular HS with sodium chlorate or heparinase I/III did not inhibit ZIKV infection. This indicates that cell surface HS is not utilized by ZIKV as an attachment receptor. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Perinatal Chicken Pox (Varicella Zoster Virus Infection

    Directory of Open Access Journals (Sweden)

    Ali Annagur

    2013-04-01

    Full Text Available Chickenpox is due to infection with the varicella zoster virus (VZV, a human alphaherpervirus found worldwide. Classically, the cinical disease is a febrile illness with a pruritic vesicular rash. Maternal chickenpox between 5 days before delivery to 2 days after delivery (perinatal varicella can cause severe and even fatal illness in the newborn. A 7-day old girl baby presented on day 4 of postnatal with the complaints of widespread vesicular rash and non-suckling. Mother of the baby also had a similar eruption four day prior to delivery, which was clinically characteristic of varicella. Considering history and clinical presentation, a diagnosis of perinatal chickenpox was considered and the baby was treated with acyclovir which she responded and recovered. Herein, the clinical feasures and treatment of chickenpox infection in the perinatal period have been emphasized with this case report. [Cukurova Med J 2013; 38(2.000: 311-314

  16. Encephalomyocarditis virus infection in an Italian zoo

    Directory of Open Access Journals (Sweden)

    Pascotto Ernesto

    2010-03-01

    Full Text Available Abstract A fatal Encephalomyocarditis virus (EMCV infection epidemic involving fifteen primates occurred between October 2006 and February 2007 at the Natura Viva Zoo. This large open-field zoo park located near Lake Garda in Northern Italy hosts one thousand animals belonging to one hundred and fifty different species, including various lemur species. This lemur collection is the most relevant and rich in Italy. A second outbreak between September and November 2008 involved three lemurs. In all cases, the clinical signs were sudden deaths generally without any evident symptoms or only with mild unspecific clinical signs. Gross pathologic changes were characterized by myocarditis (diffuse or focal pallor of the myocardium, pulmonary congestion, emphysema, oedema and thoracic fluid. The EMCV was isolated and recognized as the causative agent of both outbreaks. The first outbreak in particular was associated with a rodent plague, confirming that rats are an important risk factor for the occurrence of the EMCV infection.

  17. Hepatitis C virus infection protein network.

    Science.gov (United States)

    de Chassey, B; Navratil, V; Tafforeau, L; Hiet, M S; Aublin-Gex, A; Agaugué, S; Meiffren, G; Pradezynski, F; Faria, B F; Chantier, T; Le Breton, M; Pellet, J; Davoust, N; Mangeot, P E; Chaboud, A; Penin, F; Jacob, Y; Vidalain, P O; Vidal, M; André, P; Rabourdin-Combe, C; Lotteau, V

    2008-01-01

    A proteome-wide mapping of interactions between hepatitis C virus (HCV) and human proteins was performed to provide a comprehensive view of the cellular infection. A total of 314 protein-protein interactions between HCV and human proteins was identified by yeast two-hybrid and 170 by literature mining. Integration of this data set into a reconstructed human interactome showed that cellular proteins interacting with HCV are enriched in highly central and interconnected proteins. A global analysis on the basis of functional annotation highlighted the enrichment of cellular pathways targeted by HCV. A network of proteins associated with frequent clinical disorders of chronically infected patients was constructed by connecting the insulin, Jak/STAT and TGFbeta pathways with cellular proteins targeted by HCV. CORE protein appeared as a major perturbator of this network. Focal adhesion was identified as a new function affected by HCV, mainly by NS3 and NS5A proteins.

  18. Encephalomyocarditis virus infection in an Italian zoo.

    Science.gov (United States)

    Canelli, Elena; Luppi, Andrea; Lavazza, Antonio; Lelli, Davide; Sozzi, Enrica; Martin, Ana M Moreno; Gelmetti, Daniela; Pascotto, Ernesto; Sandri, Camillo; Magnone, William; Cordioli, Paolo

    2010-03-18

    A fatal Encephalomyocarditis virus (EMCV) infection epidemic involving fifteen primates occurred between October 2006 and February 2007 at the Natura Viva Zoo. This large open-field zoo park located near Lake Garda in Northern Italy hosts one thousand animals belonging to one hundred and fifty different species, including various lemur species. This lemur collection is the most relevant and rich in Italy. A second outbreak between September and November 2008 involved three lemurs. In all cases, the clinical signs were sudden deaths generally without any evident symptoms or only with mild unspecific clinical signs. Gross pathologic changes were characterized by myocarditis (diffuse or focal pallor of the myocardium), pulmonary congestion, emphysema, oedema and thoracic fluid. The EMCV was isolated and recognized as the causative agent of both outbreaks. The first outbreak in particular was associated with a rodent plague, confirming that rats are an important risk factor for the occurrence of the EMCV infection.

  19. Honey Bee Infecting Lake Sinai Viruses

    Directory of Open Access Journals (Sweden)

    Katie F. Daughenbaugh

    2015-06-01

    Full Text Available Honey bees are critical pollinators of important agricultural crops. Recently, high annual losses of honey bee colonies have prompted further investigation of honey bee infecting viruses. To better characterize the recently discovered and very prevalent Lake Sinai virus (LSV group, we sequenced currently circulating LSVs, performed phylogenetic analysis, and obtained images of LSV2. Sequence analysis resulted in extension of the LSV1 and LSV2 genomes, the first detection of LSV4 in the US, and the discovery of LSV6 and LSV7. We detected LSV1 and LSV2 in the Varroa destructor mite, and determined that a large proportion of LSV2 is found in the honey bee gut, suggesting that vector-mediated, food-associated, and/or fecal-oral routes may be important for LSV dissemination. Pathogen-specific quantitative PCR data, obtained from samples collected during a small-scale monitoring project, revealed that LSV2, LSV1, Black queen cell virus (BQCV, and Nosema ceranae were more abundant in weak colonies than strong colonies within this sample cohort. Together, these results enhance our current understanding of LSVs and illustrate the importance of future studies aimed at investigating the role of LSVs and other pathogens on honey bee health at both the individual and colony levels.

  20. Efficacy of two canine distemper vaccines in wild Nearctic river otters (Lontra canadensis).

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2014-09-01

    Canine distemper virus (CDV), a contagious morbillivirus, infects families in the order Carnivora, including Nearctic river otters (Lontra canadensis). As a preventative measure, vaccinations against CDV are frequently given to mustelids in captive environments. The Pennsylvania River Otter Reintroduction Project (PRORP) used wild-caught river otters to evaluate the efficacy and need for vaccinations against CDV as part of any reintroduction project. The objectives of this study were to: 1) evaluate the prevalence of exposure to CDV in wild river otters, 2) determine the immunologic response of river otters (i.e., seroconversion) after vaccination with a single (primary) vaccine dose compared to a second (booster) dose of Galaxy-D, a modified live-virus canine distemper (CD) vaccine (MLV CDV), and 3) determine the immunologic response after being vaccinated with a primary vaccination compared to a booster dose of Fervac-D, an MLV CDV. River otters were injected subcutaneously in the nape of the neck with their designated vaccine. Timeframes for collection of blood samples and/or injection of booster vaccines varied depending on the parameters of PRORP. Ten of the 22 river otters had positive prevaccination titer levels to CD. Both vaccines, Galaxy-D and Fervac-D, produced sufficient seroconversion or rise of titer levels (86% and 57%, respectively) to recommend the use of vaccines in wild river otters. Future studies are recommended to evaluate currently produced CD vaccines. Future research should also focus on the number of days required between administration of primary and booster vaccines to achieve sufficient immune response. If only a primary dose is required, then hard-release reintroduction projects for river otters could be recommended. If primary and booster vaccines are required then soft-release reintroduction projects should be recommended. Soft-release projects should include captive management periods that allow for appropriate vaccination intervals

  1. Anticorpos neutralizantes contra os vírus da cinomose e da parainfluenza em cães de canis dos municípios de Novo Hamburgo e Porto Alegre, RS, Brasil Neutralizing antibodies to distemper and parainfluenza viruses in dogs in shelter kennels in the municipalities of Novo Hamburgo and Porto Alegre, RS, Brazil

    Directory of Open Access Journals (Sweden)

    Tamahine Larronda Schmidt Hartmann

    2007-08-01

    Full Text Available No presente estudo, foi realizada uma pesquisa em busca de anticorpos neutralizantes contra os vírus da cinomose (CDV e da parainfluenza (CPIV caninos em amostras de soro de 173 cães recolhidos a canis municipais em Novo Hamburgo (n=82 e Porto Alegre (n=91, RS. A pesquisa de anticorpos neutralizantes foi realizada pela técnica de soroneutralização frente a duas amostras vacinais de CDV (Rockborn e Snyder Hill e frente a uma amostra de CPIV (V660. Em relação ao CDV, 95,9% das amostras de soros foram negativas para anticorpos neutralizantes contra a amostra Snyder Hill e 90,7% soronegativas para a amostra Rockborn. Entre os soropositivos (n=20; 11,6%, somente três deles apresentaram anticorpos neutralizantes frente às duas amostras de CDV testadas, indicando pouca reatividade cruzada entre as mesmas. Quanto ao CPIV, a prevalência de anticorpos neutralizantes encontrada frente à amostra V660 foi de 51,4%. Esses achados indicam que a maioria dos cães examinados não teve contato prévio com o CDV, seja por infecção natural ou por imunização prévia. O CPIV, porém, parece estar amplamente difundido na população canina examinada, provavelmente por exposição natural ao vírus.In this report a serological survey was carried out in search for antibodies to canine distemper virus (CDV and canine parainfluenza virus (CPIV in 173 sera from dogs withdraw in kennels of the municipalities of Novo Hamburgo (n=82 and Porto Alegre (n=91, RS, Brazil. Neutralizing antibodies were evaluated against two CDV strains used for vaccine production (Rockborn and Snyder Hill as well as one strain of CPIV (V660. Search for anti-CDV neutralizing antibodies revealed that 95.9% of sera were negative for antibodies to CDV Snyder Hill and 90.7% were negative for antibodies to CDV Rockborn. Among the positive sera (n=20; 11.6 % only three of those had neutralizing antibodies to both CDV strains, indicating a low degree of cross reactivity between those. As

  2. Seroprevalence of Toscana virus infection in Tunisia.

    Science.gov (United States)

    Fezaa, Ons; Bahri, Olfa; Alaya Bouafif, Nissaf Ben; Triki, Henda; Bouattour, Ali

    2013-12-01

    The main objective of this study was to assess the prevalence of IgG antibodies against Toscana virus (TOSV) by an ELISA test and to determine the extent of its circulation in Tunisia. An indirect ELISA test was performed to detect anti-TOSV IgG. The results were compared to those of an indirect fluorescent antibody (IFA) test. The survey tested 494 healthy people from various regions of Tunisia by ELISA for anti-TOSV IgG; 47 people (9.5%) were found to be positive. Seroprevalence varied by bioclimatic region and gender. Two hundred and twelve samples, randomly chosen from the same selected population and tested with ELISA, were retested using an IFA for IgG antibodies. An 85% concordance between the IFA and ELISA was obtained (kappa=0.650). These serological data confirm the circulation of TOSV in different bioclimatic zones in Tunisia where the vector sand flies are found. The detection of IgG against TOSV suggests that the diagnosis of TOSV infection is often neglected, as this virus often causes asymptomatic infections, with only a few patients developing severe illnesses involving neurological manifestations. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. Viremia and Clinical Presentation in Nicaraguan Patients Infected With Zika Virus, Chikungunya Virus, and Dengue Virus.

    Science.gov (United States)

    Waggoner, Jesse J; Gresh, Lionel; Vargas, Maria Jose; Ballesteros, Gabriela; Tellez, Yolanda; Soda, K James; Sahoo, Malaya K; Nuñez, Andrea; Balmaseda, Angel; Harris, Eva; Pinsky, Benjamin A

    2016-12-15

     Zika virus (ZIKV), chikungunya virus (CHIKV), and dengue virus (DENV) cocirculate in Nicaragua. In this study, we sought to compare the quantified viremia and clinical presentation of patients infected with 1 or more of these viruses.  Acute-phase serum samples from 346 patients with a suspected arboviral illness were tested using a multiplex real-time reverse-transcription polymerase chain reaction for ZIKV, CHIKV, and DENV. Viremia was quantitated for each detected virus, and clinical information from request forms submitted with each sample was recorded.  A total of 263 patients tested positive for 1 or more viruses: 192 patients tested positive for a single virus (monoinfections) and 71 patients tested positive for 2 or all 3 viruses (coinfections). Quantifiable viremia was lower in ZIKV infections compared with CHIKV or DENV (mean 4.70 vs 6.42 and 5.84 log 10 copies/mL serum, respectively; P virus, mean viremia was significantly lower in coinfections than in monoinfections. Compared with patients with CHIKV or DENV, ZIKV patients were more likely to have a rash (P < .001) and less likely to be febrile (P < .05) or require hospitalization (P < .001). Among all patients, hospitalized cases had higher viremia than those who did not require hospitalization (7.1 vs 4.1 log10 copies/mL serum, respectively; P < .001).  ZIKV, CHIKV, and DENV result in similar clinical presentations, and coinfections may be relatively common. Our findings illustrate the need for accurate, multiplex diagnostics for patient care and epidemiologic surveillance. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  4. 78 FR 33848 - Draft Guidance for Industry on Human Immunodeficiency Virus-1 Infection: Developing...

    Science.gov (United States)

    2013-06-05

    ... No. FDA-2013-D-0589] Draft Guidance for Industry on Human Immunodeficiency Virus-1 Infection... guidance for industry entitled ``Human Immunodeficiency Virus-1 Infection: Developing Antiretroviral Drugs... guidance for industry entitled ``Human Immunodeficiency Virus-1 Infection: Developing Antiretroviral Drugs...

  5. First Imported Case of Zika Virus Infection into Korea.

    Science.gov (United States)

    Jang, Hee-Chang; Park, Wan Beom; Kim, Uh Jin; Chun, June Young; Choi, Su-Jin; Choe, Pyoeng Gyun; Jung, Sook-In; Jee, Youngmee; Kim, Nam-Joong; Choi, Eun Hwa; Oh, Myoung-Don

    2016-07-01

    Since Zika virus has been spreading rapidly in the Americas from 2015, the outbreak of Zika virus infection becomes a global health emergency because it can cause neurological complications and adverse fetal outcome including microcephaly. Here, we report clinical manifestations and virus isolation findings from a case of Zika virus infection imported from Brazil. The patient, 43-year-old Korean man, developed fever, myalgia, eyeball pain, and maculopapular rash, but not neurological manifestations. Zika virus was isolated from his semen, and reverse-transcriptase PCR was positive for the virus in the blood, urine, and saliva on the 7th day of the illness but was negative on the 21st day. He recovered spontaneously without any neurological complications. He is the first case of Zika virus infection in Korea imported from Brazil.

  6. Transfusion associated hepatitis B virus infection among sickle cell ...

    African Journals Online (AJOL)

    Background: Transfusion of blood products is a recognised way of transmitting infections particularly viruses. The extent to which blood transfusion contributes to hepatitis B virus (HBV) infections in transfused patients with sickle cell anaemia (SCA) has been found to be 20% in Lagos, Nigeria. Mamman in Zaria however ...

  7. Herpes Simplex Virus type 2 Infection among Females in Enugu ...

    African Journals Online (AJOL)

    BACKGROUND: Herpes simplex virus type 2 infection is life long with manifestation in a small proportion of those infected. It has presented public health concern because of its progressively increasing prevalence which some authorities say is of epidemic proportion in developing countries. Herpes simplex virus type 2 has ...

  8. Phyllanthus species for chronic hepatitis B virus infection

    DEFF Research Database (Denmark)

    Yun, Xia; Luo, Hui; Liu, Jian Ping

    2011-01-01

    Phyllanthus species for patients with chronic hepatitis B virus (HBV) infection have been assessed in clinical trials, but no consensus regarding their usefulness exists.......Phyllanthus species for patients with chronic hepatitis B virus (HBV) infection have been assessed in clinical trials, but no consensus regarding their usefulness exists....

  9. Diagnosis and Management of Paediatric Hepatitis C Virus Infection ...

    African Journals Online (AJOL)

    Background: HepatitisC virus is a chronic life-long infection in themajority of patientswho are infected with the virus.Without accurate diagnosis and follow up, these children cannot be offered optimal care, and are at risk of presenting in adult life with significant liver pathology and long-term sequelae. Objective: To explore ...

  10. Mayaro Virus Infection, Amazon Basin Region, Peru, 2010–2013

    Science.gov (United States)

    Siles, Crystyan; Guevara, Carolina; Vilcarromero, Stalin; Jhonston, Erik J.; Ramal, Cesar; Aguilar, Patricia V.; Ampuero, Julia S.

    2013-01-01

    During 2010–2013, we recruited 16 persons with confirmed Mayaro virus infection in the Peruvian Amazon to prospectively follow clinical symptoms and serologic response over a 12-month period. Mayaro virus infection caused long-term arthralgia in more than half, similar to reports of other arthritogenic alphaviruses. PMID:24210165

  11. Postmortem Findings for 7 Neonates with Congenital Zika Virus Infection.

    Science.gov (United States)

    Sousa, Anastácio Q; Cavalcante, Diane I M; Franco, Luciano M; Araújo, Fernanda M C; Sousa, Emília T; Valença-Junior, José Telmo; Rolim, Dionne B; Melo, Maria E L; Sindeaux, Pedro D T; Araújo, Marialva T F; Pearson, Richard D; Wilson, Mary E; Pompeu, Margarida M L

    2017-07-01

    Postmortem examination of 7 neonates with congenital Zika virus infection in Brazil revealed microcephaly, ventriculomegaly, dystrophic calcifications, and severe cortical neuronal depletion in all and arthrogryposis in 6. Other findings were leptomeningeal and brain parenchymal inflammation and pulmonary hypoplasia and lymphocytic infiltration in liver and lungs. Findings confirmed virus neurotropism and multiple organ infection.

  12. Quantitative Risk Assessment of Avian Influenza Virus Infection via Water

    NARCIS (Netherlands)

    Schijven FJ; Teunis PFM; Roda Husman AM de; MGB

    2006-01-01

    Using literature data, daily infection risks of chickens and humans with H5N1 avian influenza virus (AIV) by drinking water consumption were estimated for the Netherlands. A highly infectious virus and less than 4 log10 drinking water treatment (reasonably inefficient) may lead to a high infection

  13. Co-infections with Chikungunya and Dengue Viruses, Guatemala, 2015.

    Science.gov (United States)

    Edwards, Thomas; Signor, Leticia Del Carmen Castillo; Williams, Christopher; Donis, Evelin; Cuevas, Luis E; Adams, Emily R

    2016-11-01

    We screened serum samples referred to the national reference laboratory in Guatemala that were positive for chikungunya or dengue viruses in June 2015. Co-infection with both viruses was detected by reverse transcription PCR in 46 (32%) of 144 samples. Specimens should be tested for both arboviruses to detect co-infections.

  14. Hepatitis B Virus infection in Nigeria – a review | Emechebe ...

    African Journals Online (AJOL)

    ... virus in the general population also play role in Nigeria. Conclusion: Reduction in the of hepatitis B virus infection could be achieved by public enlightenment campaign, mass immunization of the children and adults at risk while antiviral drugs and immunostimulatory therapy should be provided for those already infected.

  15. Transverse myelitis associated with Zika virus infection: a Case Report

    OpenAIRE

    Beattriz Vaz Pereira Casagrande; Danielle Oliveira de Sousa; Adriana Kamilly Leitão Pitman Machado; Carolina Ribeiro Mainardi; Carolina Barros Kahwage

    2018-01-01

    Title: Transverse myelitis associated with Zika virus infection: a Case Report.: The zika virus belongs to the family flaviviridae, and is transmitted by the arthropod Aedes aegypt. Its major importance is related to the several debilitating neurological manifestations associated with it, such as transverse myelitis. Case: The authors report a case of transverse myelitis in a patient with a previous diagnosis of Zika virus infection. After the image exams and serology, the diagnosis was ...

  16. Tick-borne encephalitis virus infection in humans

    OpenAIRE

    Hrnjaković-Cvjetković Ivana; Cvjetković Dejan; Patić Aleksandra; Radovanov Jelena; Kovačević Gordana; Milošević Vesna

    2016-01-01

    Introduction. Tick-borne meningoencephalitis virus is a flavivirus that causes the most important vector-borne central nervous system infection in many countries of Europe and Asia. There are three subtypes of tick-borne encephalitis virus: European, Siberian and the Far-Eastern subtype. Transmission. In endemic areas, the virus remains in transmissive cycles between Ixodes ticks and small rodents. Clinical picture. In most cases (70−98%) infection goes asy...

  17. Susceptibility of different leukocyte cell types to Vaccinia virus infection

    Directory of Open Access Journals (Sweden)

    Sánchez-Puig Juana M

    2004-11-01

    Full Text Available Abstract Background Vaccinia virus, the prototype member of the family Poxviridae, was used extensively in the past as the Smallpox vaccine, and is currently considered as a candidate vector for new recombinant vaccines. Vaccinia virus has a wide host range, and is known to infect cultures of a variety of cell lines of mammalian origin. However, little is known about the virus tropism in human leukocyte populations. We report here that various cell types within leukocyte populations have widely different susceptibility to infection with vaccinia virus. Results We have investigated the ability of vaccinia virus to infect human PBLs by using virus recombinants expressing green fluorescent protein (GFP, and monoclonal antibodies specific for PBL subpopulations. Flow cytometry allowed the identification of infected cells within the PBL mixture 1–5 hours after infection. Antibody labeling revealed that different cell populations had very different infection rates. Monocytes showed the highest percentage of infected cells, followed by B lymphocytes and NK cells. In contrast to those cell types, the rate of infection of T lymphocytes was low. Comparison of vaccinia virus strains WR and MVA showed that both strains infected efficiently the monocyte population, although producing different expression levels. Our results suggest that MVA was less efficient than WR in infecting NK cells and B lymphocytes. Overall, both WR and MVA consistently showed a strong preference for the infection of non-T cells. Conclusions When infecting fresh human PBL preparations, vaccinia virus showed a strong bias towards the infection of monocytes, followed by B lymphocytes and NK cells. In contrast, very poor infection of T lymphocytes was detected. These finding may have important implications both in our understanding of poxvirus pathogenesis and in the development of improved smallpox vaccines.

  18. Pathogenesis of Hendra and Nipah virus infection in humans.

    Science.gov (United States)

    Escaffre, Olivier; Borisevich, Viktoriya; Rockx, Barry

    2013-04-17

    Hendra virus (HeV) and Nipah virus (NiV) are emerging zoonotic viruses that cause severe and often lethal respiratory illness and encephalitis in humans. Henipaviruses can infect a wide range of species and human-to-human transmission has been observed for NiV. While the exact route of transmission in humans is not known, experimental infection in different animal species suggests that infection can be efficiently initiated after respiratory challenge. The limited data on histopathological changes in fatal human cases of HeV and NiV suggest that endothelial cells are an important target during the terminal stage of infection; however, it is unknown where these viruses initially establish infection and how the virus disseminates from the respiratory tract to the central nervous system and other organs. Here we review the current concepts in henipavirus pathogenesis in humans.

  19. Equine Infectious Anemia Virus from Infected Horse Serum

    Science.gov (United States)

    Nakajima, Hideo; Yoshino, Tomoo; Ushimi, Chuzo

    1974-01-01

    Equine infectious anemia virus was purified from infected horse serum samples. Electron microscope observation on negatively stained preparations of purified virus showed roughly spherical particles sized between 100 and 200 nm in diameter. In disrupted particles, an envelope was visible but no internal structure could be resolved. Since the purified virus fraction had a strong antigenic activity to antiserum in immunodiffusion reaction, these particles are thought to be the causative virus of equine infectious anemia. Images PMID:4372175

  20. Microbiological diagnosis of human papilloma virus infection.

    Science.gov (United States)

    Mateos-Lindemann, Maria Luisa; Pérez-Castro, Sonia; Rodríguez-Iglesias, Manuel; Pérez-Gracia, Maria Teresa

    2017-11-01

    Infection with human papillomavirus (HPV) is the leading cause of sexually transmitted infection worldwide. This virus generally causes benign lesions, such as genital warts, but persistent infection may lead to cervical cancer, anal cancer, vaginal cancer, and oropharyngeal cancer, although less frequently. Cervical cancer is a severe disease with a high mortality in some countries. Screening with cytology has been very successful in the last few years, but nowadays there are numerous studies that confirm that cytology should be replaced with the detection of HPV as a first line test in population based screening. There are several commercially available FDA approved tests for screening of cervical cancer. A new strategy, based on individual detection of the high risk genotypes HPV16 and HPV18, present in 70% of cervical cancer biopsies, has been proposed by some experts, and is going to be implemented in most countries in the future. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  1. Hepatitis B virus infection in children.

    LENUS (Irish Health Repository)

    O'Gorman, C S

    2012-02-01

    Recent increases in Hepatitis B virus (HBV) infection prompted us to characterize HBV-infected children in Ireland and to audit management, by reviewing prospectively gathered data. Of 46 children (29 [63%] male), median age at presentation was 8.1 years (range 0.6-17.6), monitoring duration was 22.5 months (range 1-101), 23\\/46 (50%) were European (including 9 [19.6%] Irish), 15 (32.6%) African and 9 (19.6%) Asian. Acquisition was vertical (25\\/46 [54.3%]), horizontal (5\\/46 [10.9%]), unknown (16\\/46 [34.8%]). HBV-DNA was >100,000,000 cpm in 20\\/32 (62.5%) with chronic infection. Hepatitis B e antigen (HBeAg) was detected in 32\\/44 (72.7%). We estimate that universal neonatal vaccination (UNV-HBV) could have prevented 22% of cases, and could limit further horizontal HBV spread. This supports the recent introduction of UNV-HBV.

  2. Uncommon acute neurologic presentation of canine distemper in 4 adult dogs.

    Science.gov (United States)

    Galán, Alba; Gamito, Araceli; Carletti, Beatrice E; Guisado, Alicia; de las Mulas, Juana Martín; Pérez, José; Martín, Eva M

    2014-04-01

    Four uncommon cases of canine distemper (CD) were diagnosed in vaccinated adult dogs. All dogs had acute onset of neurologic signs, including seizures, abnormal mentation, ataxia, and proprioceptive deficits. Polymerase chain reaction for CD virus was positive on cerebrospinal fluid in 2 cases. Due to rapid deterioration the dogs were euthanized and CD was confirmed by postmortem examination.

  3. Absence of human metapneumovirus co-infection in cases of severe respiratory syncytial virus infection

    NARCIS (Netherlands)

    van Woensel, J. B. M.; Bos, A. P.; Lutter, R.; Rossen, J. W. A.; Schuurman, R.

    2006-01-01

    It has been suggested that co-infection of human metapneumovirus (hMPV) in severe respiratory syncytial (RSV) virus bronchiolitis is very common. To evaluate the epidemiology of hMPV co-infection in children with severe lower respiratory tract infection caused by RSV virus. This was an observational

  4. Absence of human metapneumovirus co-infection in cases of severe respiratory syncytial virus infection

    NARCIS (Netherlands)

    van Woensel, J B M; Bos, A P; Lutter, R; Rossen, J W A; Schuurman, R

    It has been suggested that co-infection of human metapneumovirus (hMPV) in severe respiratory syncytial (RSV) virus bronchiolitis is very common. To evaluate the epidemiology of hMPV co-infection in children with severe lower respiratory tract infection caused by RSV virus. This was an observational

  5. Antibody-induced generation of reactive oxygen radicals by brain macrophages in canine distemper encephalitis: a mechanism for bystander demyelination.

    Science.gov (United States)

    Griot, C; Bürge, T; Vandevelde, M; Peterhans, E

    1989-01-01

    The mechanism of inflammatory demyelination in canine distemper encephalitis (CDE) is uncertain but macrophages are thought to play an important effector role in this lesion. Serum and cerebrospinal fluid (CSF), containing anti-canine distemper virus and anti-myelin antibodies from dogs with CDE were tested for their ability to generate reactive oxygen species (ROS) in macrophages in primary dog brain cell cultures using a chemiluminescence (CL) assay. The majority of serum samples and several CSF samples from animals with inflammatory demyelination elicited a CL signal in infected dog brain cell cultures. In contrast, none of these samples induced a positive response in uninfected cultures which contained large numbers of myelin antigen-presenting cells, although defined anti-myelin antibodies lead to a marked secretion of ROS in this system. It was concluded that antiviral antibody-induced secretion of ROS, known to be highly toxic for brain tissue, may play an important role in white matter damage in inflammatory lesions supporting a previous hypothesis of bystander demyelination in CDE. No evidence was found for a similar antibody-dependent cellular cytotoxicity-like mechanism mediated by anti-myelin antibodies in CDE, which does not support the concept of autoimmunity in this disease.

  6. Transcriptional Profiling of the Immune Response to Marburg Virus Infection.

    Science.gov (United States)

    Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J

    2015-10-01

    Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells

  7. «I Am Legend»: comparison of the fictional virus infection and Rabies virus

    Directory of Open Access Journals (Sweden)

    José Francisco CAMACHO AGUILERA

    2016-04-01

    Full Text Available Using the movie I am legend (2007 by, the rabies virus infection is reviewed in this article, given its strong resemblance to the fictional disease created in this film caused by the virus Krippin. A review of history, virus characteristics, viral transmission, clinical manifestations, diagnostics, mortality, treatment and prevention, are presented and are contrasted with the film.

  8. West Nile virus meningitis in a patient with human immunodeficiency virus type 1 infection

    Directory of Open Access Journals (Sweden)

    D. Pilalas

    2017-09-01

    Full Text Available The emergence of West Nile virus lineage 2 in central Macedonia, Greece, in 2010 resulted in large outbreaks for 5 consecutive years. We report a case of viral meningitis in an individual infected with human immunodeficiency virus type 1, which preceded the recognition of the outbreak and was confirmed retrospectively as West Nile virus neuroinvasive disease.

  9. Unfolded protein response in hepatitis C virus infection

    Directory of Open Access Journals (Sweden)

    Shiu-Wan eChan

    2014-05-01

    Full Text Available Hepatitis C virus (HCV is a single-stranded, positive-sense RNA virus of clinical importance. The virus establishes a chronic infection and can progress from chronic hepatitis, steatosis to fibrosis, cirrhosis and hepatocellular carcinoma. The mechanisms of viral persistence and pathogenesis are poorly understood. Recently the unfolded protein response (UPR, a cellular homeostatic response to endoplasmic reticulum (ER stress, has emerged to be a major contributing factor in many human diseases. It is also evident that viruses interact with the host UPR in many different ways and the outcome could be pro-viral, anti-viral or pathogenic, depending on the particular type of infection. Here we present evidence for the elicitation of chronic ER stress in HCV infection. We analyze the UPR signaling pathways involved in HCV infection, the various levels of UPR regulation by different viral proteins and finally, we propose several mechanisms by which the virus provokes the UPR.

  10. Absence of Active Hepatitis C Virus Infection in Human Immunodeficiency Virus Clinics in Zambia and Mozambique.

    Science.gov (United States)

    Wandeler, Gilles; Mulenga, Lloyd; Hobbins, Michael; Joao, Candido; Sinkala, Edford; Hector, Jonas; Aly, Musa; Chi, Benjamin H; Egger, Matthias; Vinikoor, Michael J

    2016-03-01

    Few studies have evaluated the prevalence of replicating hepatitis C virus (HCV) infection in sub-Saharan Africa. Among 1812 individuals infected with human immunodeficiency virus, no patient in rural Mozambique and 4 patients in urban Zambia were positive for anti-HCV antibodies. Of these, none had confirmed HCV replication.

  11. Human Immunodeficiency Virus Infection in Pregnancy

    Directory of Open Access Journals (Sweden)

    Yasemin Arikan

    1998-01-01

    Full Text Available The incidence and prevalence of human immunodeficiency virus (HIV infection in women of child-bearing age continue to increase both internationally and in Canada. The care of HIV-infected pregnant women is complex, and multiple issues must be addressed, including the current and future health of the woman, minimization of the risk of maternal-infant HIV transmission, and maintenance of the well-being of the fetus and neonate. Vertical transmission of HIV can occur in utero, intrapartum and postpartum, but current evidence suggests that the majority of transmission occurs toward end of term, or during labour and delivery. Several maternal and obstetrical factors influence transmission rates, which can be reduced by optimal medical and obstetrical care. Zidovudine therapy has been demonstrated to reduce maternal-infant transmission significantly, but several issues, including the short and long term safety of antiretrovirals and the optimal use of combination antiretroviral therapy in pregnancy, remain to be defined. It is essential that health care workers providing care to these women fully understand the natural history of HIV disease in pregnancy, the factors that affect vertical transmission and the management issues during pregnancy. Close collaboration among a multidisciplinary team of knowledgeable health professionals and, most importantly, the woman herself can improve both maternal and infant outcomes.

  12. Hepatitis B virus and delta infection in male homosexuals.

    Science.gov (United States)

    Hess, G; Bienzle, U; Slusarczyk, J; Hansson, B G; Meyer zum Büschenfelde, K H

    1986-02-01

    Six hundred and sixty-six homosexuals were analysed in respect of hepatitis B virus and delta infections. Evidence of ongoing or recent hepatitis B virus infection was found in 450/666 (67.6%) homosexuals; 44 were HBsAg positive. Anti-delta was found in two HBsAg-positive homosexuals. Both individuals had a non-replicative form of HBV infection and biochemical evidence of liver disease. The study confirms that HBV infection is frequent in homosexuals and indicates that delta-infection is rare in male homosexuals.

  13. Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections

    Directory of Open Access Journals (Sweden)

    Müller Marcel A

    2005-02-01

    Full Text Available Abstract Ten potential reference genes were compared for their use in experiments investigating cellular mRNA expression of virus infected cells. Human cell lines were infected with Cytomegalovirus, Human Herpesvirus-6, Camelpox virus, SARS coronavirus or Yellow fever virus. The expression levels of these genes and the viral replication were determined by real-time PCR. Genes were ranked by the BestKeeper tool, the GeNorm tool and by criteria we reported previously. Ranking lists of the genes tested were tool dependent. However, over all, β-actin is an unsuitable as reference gene, whereas TATA-Box binding protein and peptidyl-prolyl-isomerase A are stable reference genes for expression studies in virus infected cells.

  14. Canine distemper outbreak in raccoons suggests pathogen interspecies transmission amongst alien and native carnivores in urban areas from Germany.

    Science.gov (United States)

    Rentería-Solís, Zaida; Förster, Christine; Aue, Angelika; Wittstatt, Ulrich; Wibbelt, Gudrun; König, Matthias

    2014-11-07

    From December 2012 to May 2013, an outbreak occurred among urban wild carnivores from Berlin. We collected 97 free-ranging raccoons from the city area. PCR assays, histopathology and immunohistochemistry confirmed canine distemper virus (CDV) infection in 74 raccoons. Phylogenetic analysis of haemagglutinin gene fragments (1767 nucleotides) of CDV isolated from four raccoons showed close relation to CDV isolates from foxes from Germany and a domestic dog from Hungary; all belonging to the "Europe" lineage of CDV. These study results suggest an inter-species transmission of CDV as the origin for the outbreak among the raccoon population. Implications for domestic pets and suggested interspecies transmission between urban wildlife and raccoons are discussed. This is the first major outbreak of CDV amongst free-ranging raccoons in Europe. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Prevalence of Hepatitis B virus infection amongst parturients in the ...

    African Journals Online (AJOL)

    Background: Hepatitis B virus (HBV) infection is endemic in Nigeria and indeed the whole of Sub-Saharan Africa. The Society of Gastroenterology and Hepatology in Nigeria (SOGHIN) recommends HBV screening for all Nigerians to pave way for early detection and treatment of the infection in those who are infected and ...

  16. Immunomodulatory therapy for chronic hepatitis B virus infection

    NARCIS (Netherlands)

    Sprengers, D.; Janssen, H. L. A.

    2005-01-01

    Hepatitis B virus (HBV) is one of the most prevalent viral pathogens of man with around 350 million chronically infected patients. It has been postulated that in persistently infected individuals the HBV-specific immune response is too weak to eliminate HBV from all infected hepatocytes, but

  17. Prevalence of viruses infecting cowpea in Uganda and their ...

    African Journals Online (AJOL)

    CMV and CABMV were later confirmed using reverse transcription polymerase chain reaction (RT-PCR). Of the viruses detected in leaf samples, 53.26% occurred as single infections, 24.46% dual and 22.28% multiple infections. Similarly, analysis of seed samples revealed infection of 40.6, 34.6 and 24.8% for single, dual ...

  18. Influenza virus infection during pregnancy and in specific populations

    NARCIS (Netherlands)

    Meijer, WJ

    2016-01-01

    Influenza virus infection causes approximately 1 billion infections worldwide each year. These infections are usually self-limiting, but serious complications may occur, in particular in adults aged 65 years or older, patients with cardiovascular disease, asthma or autoimmune disorders and pregnant

  19. Prenatal brain MRI of fetuses with Zika virus infection.

    Science.gov (United States)

    Guillemette-Artur, Prisca; Besnard, Marianne; Eyrolle-Guignot, Dominique; Jouannic, Jean-Marie; Garel, Catherine

    2016-06-01

    An outbreak of Zika virus was observed in French Polynesia in 2013-2014. Maternal Zika virus infection has been associated with fetal microcephaly and severe cerebral damage. To analyze the MRI cerebral findings in fetuses with intrauterine Zika virus infection. We retrospectively analyzed prospectively collected data. Inclusion criteria comprised cases with (1) estimated conception date between June 2013 and May 2014, (2) available US and MRI scans revealing severe fetal brain lesions and (3) positive polymerase chain reaction for Zika virus in the amniotic fluid. We recorded pregnancy history of Zika virus infection and analyzed US and MRI scans. Three out of 12 cases of severe cerebral lesions fulfilled all inclusion criteria. History of maternal Zika virus infection had been documented in two cases. Calcifications and ventriculomegaly were present at US in all cases. MRI showed micrencephaly (n = 3), low cerebellar biometry (n = 2), occipital subependymal pseudocysts (n = 2), polymicrogyria with laminar necrosis and opercular dysplasia (n = 3), absent (n = 1) or hypoplastic (n = 1) corpus callosum and hypoplastic brainstem (n = 1). Severe cerebral damage was observed in our series, with indirect findings suggesting that the germinal matrix is the principal target for Zika virus. The lesions are very similar to severe forms of congenital cytomegalovirus and lymphocytic choriomeningitis virus infections.

  20. Prenatal brain MRI of fetuses with Zika virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Guillemette-Artur, Prisca [Centre Hospitalier de Polynesie Francaise, Service de Radiologie, Pirae, Tahiti (Country Unknown); Besnard, Marianne [Centre Hospitalier de Polynesie Francaise, Service de Reanimation Neo-natale, Pirae, Tahiti (Country Unknown); Eyrolle-Guignot, Dominique [Centre Hospitalier de Polynesie Francaise, Service d' Obstetrique, Pirae, Tahiti (Country Unknown); Jouannic, Jean-Marie [Universite Pierre et Marie Curie, Service de Medecine Foetale, Hopital d' Enfants Armand-Trousseau, Paris (France); Garel, Catherine [Hopital d' Enfants Armand-Trousseau, Department of Radiology, Paris (France)

    2016-06-15

    An outbreak of Zika virus was observed in French Polynesia in 2013-2014. Maternal Zika virus infection has been associated with fetal microcephaly and severe cerebral damage. To analyze the MRI cerebral findings in fetuses with intrauterine Zika virus infection. We retrospectively analyzed prospectively collected data. Inclusion criteria comprised cases with (1) estimated conception date between June 2013 and May 2014, (2) available US and MRI scans revealing severe fetal brain lesions and (3) positive polymerase chain reaction for Zika virus in the amniotic fluid. We recorded pregnancy history of Zika virus infection and analyzed US and MRI scans. Three out of 12 cases of severe cerebral lesions fulfilled all inclusion criteria. History of maternal Zika virus infection had been documented in two cases. Calcifications and ventriculomegaly were present at US in all cases. MRI showed micrencephaly (n = 3), low cerebellar biometry (n = 2), occipital subependymal pseudocysts (n = 2), polymicrogyria with laminar necrosis and opercular dysplasia (n = 3), absent (n = 1) or hypoplastic (n = 1) corpus callosum and hypoplastic brainstem (n = 1). Severe cerebral damage was observed in our series, with indirect findings suggesting that the germinal matrix is the principal target for Zika virus. The lesions are very similar to severe forms of congenital cytomegalovirus and lymphocytic choriomeningitis virus infections. (orig.)

  1. Prenatal brain MRI of fetuses with Zika virus infection

    International Nuclear Information System (INIS)

    Guillemette-Artur, Prisca; Besnard, Marianne; Eyrolle-Guignot, Dominique; Jouannic, Jean-Marie; Garel, Catherine

    2016-01-01

    An outbreak of Zika virus was observed in French Polynesia in 2013-2014. Maternal Zika virus infection has been associated with fetal microcephaly and severe cerebral damage. To analyze the MRI cerebral findings in fetuses with intrauterine Zika virus infection. We retrospectively analyzed prospectively collected data. Inclusion criteria comprised cases with (1) estimated conception date between June 2013 and May 2014, (2) available US and MRI scans revealing severe fetal brain lesions and (3) positive polymerase chain reaction for Zika virus in the amniotic fluid. We recorded pregnancy history of Zika virus infection and analyzed US and MRI scans. Three out of 12 cases of severe cerebral lesions fulfilled all inclusion criteria. History of maternal Zika virus infection had been documented in two cases. Calcifications and ventriculomegaly were present at US in all cases. MRI showed micrencephaly (n = 3), low cerebellar biometry (n = 2), occipital subependymal pseudocysts (n = 2), polymicrogyria with laminar necrosis and opercular dysplasia (n = 3), absent (n = 1) or hypoplastic (n = 1) corpus callosum and hypoplastic brainstem (n = 1). Severe cerebral damage was observed in our series, with indirect findings suggesting that the germinal matrix is the principal target for Zika virus. The lesions are very similar to severe forms of congenital cytomegalovirus and lymphocytic choriomeningitis virus infections. (orig.)

  2. Seroprevalence of Ebola virus infection in Bombali District, Sierra Leone

    Directory of Open Access Journals (Sweden)

    Nadege Goumkwa Mafopa

    2017-12-01

    Full Text Available A serosurvey of anti-Ebola Zaire virus nucleoprotein IgG prevalence was carried out among Ebola virus disease survivors and their Community Contacts in Bombali District, Sierra Leone. Our data suggest that the specie of Ebola virus (Zaire responsible of the 2013-2016 epidemic in West Africa may cause mild or asymptomatic infection in a proportion of cases, possibly due to an efficient immune response.

  3. The Prevalence of Human Immunodeficiency Virus Infection among ...

    African Journals Online (AJOL)

    The Prevalence of Human Immunodeficiency Virus Infection among Pregnant Women in Labour with Unknown Status and those with Negative status early in the Index Pregnancy in a Tertiary Hospital in Nigeria.

  4. NNDSS - Table II. Cryptosporidiosis to Dengue virus infection

    Data.gov (United States)

    U.S. Department of Health & Human Services — NNDSS - Table II. Cryptosporidiosis to Dengue virus infection - 2018. In this Table, provisional cases of selected notifiable diseases (≥1,000 cases reported...

  5. Genus Phyllanthus for chronic hepatitis B virus infection

    DEFF Research Database (Denmark)

    Liu, J; Lin, Haili; McIntosh, H

    2001-01-01

    To evaluate the efficacy and safety of genus Phyllanthus for chronic hepatitis B virus (HBV) infection we performed a systematic review of randomized clinical trials. Randomized trials comparing genus Phyllanthus vs. placebo, no intervention, general nonspecific treatment, other herbal medicine...

  6. NNDSS - Table II. Cryptosporidiosis to Dengue virus infection

    Data.gov (United States)

    U.S. Department of Health & Human Services — NNDSS - Table II. Cryptosporidiosis to Dengue virus infection - 2018. In this Table, provisional cases of selected notifiable diseases (≥1,000 cases reported during...

  7. Schmallenberg virus infection of ruminants: challenges and opportunities for veterinarians

    Directory of Open Access Journals (Sweden)

    Claine F

    2015-06-01

    Full Text Available François Claine, Damien Coupeau, Laetitia Wiggers, Benoît Muylkens, Nathalie Kirschvink Veterinary Department, Faculty of Sciences, Namur Research Institute for Life Sciences (NARILIS, University of Namur (UNamur, Namur, Belgium Abstract: In 2011, European ruminant flocks were infected by Schmallenberg virus (SBV leading to transient disease in adult cattle but abortions and congenital deformities in calves, lambs, and goat kids. SBV belonging to the Simbu serogroup (family Bunyaviridae and genus Orthobunyavirus was first discovered in the same region where bluetongue virus serotype 8 (BTV-8 emerged 5 years before. Both viruses are transmitted by biting midges (Culicoides spp. and share several similarities. This paper describes the current knowledge of temporal and geographical spread, molecular virology, transmission and susceptible species, clinical signs, diagnosis, prevention and control, impact on ruminant health, and productivity of SBV infection in Europe, and compares SBV infection with BTV-8 infection in ruminants. Keywords: Schmallenberg virus, Europe, ruminants, review

  8. Easy and Rapid Detection of Mumps Virus by Live Fluorescent Visualization of Virus-Infected Cells.

    Directory of Open Access Journals (Sweden)

    Tadanobu Takahashi

    Full Text Available Mumps viruses show diverse cytopathic effects (CPEs of infected cells and viral plaque formation (no CPE or no plaque formation in some cases depending on the viral strain, highlighting the difficulty in mumps laboratory studies. In our previous study, a new sialidase substrate, 2-(benzothiazol-2-yl-4-bromophenyl 5-acetamido-3,5-dideoxy-α-D-glycero-D-galacto-2-nonulopyranosidonic acid (BTP3-Neu5Ac, was developed for visualization of sialidase activity. BTP3-Neu5Ac can easily and rapidly perform histochemical fluorescent visualization of influenza viruses and virus-infected cells without an antiviral antibody and cell fixation. In the present study, the potential utility of BTP3-Neu5Ac for rapid detection of mumps virus was demonstrated. BTP3-Neu5Ac could visualize dot-blotted mumps virus, virus-infected cells, and plaques (plaques should be called focuses due to staining of infected cells in this study, even if a CPE was not observed. Furthermore, virus cultivation was possible by direct pick-up from a fluorescent focus. In conventional methods, visible appearance of the CPE and focuses often requires more than 6 days after infection, but the new method with BTP3-Neu5Ac clearly visualized infected cells after 2 days and focuses after 4 days. The BTP3-Neu5Ac assay is a precise, easy, and rapid assay for confirmation and titration of mumps virus.

  9. Viral protein synthesis in cowpea mosaic virus infected protoplasts

    NARCIS (Netherlands)

    Rottier, P.

    1980-01-01

    In contrast to the situation concerning bacterial and, to a lesser extent, animal RNA viruses, little is known about the biochemical processes occurring in plant cells due to plant RNA virus infection. Such processes are difficult to study using intact plants or leaves. Great effort has

  10. Identification and distribution of viruses infecting sweet potato ...

    African Journals Online (AJOL)

    Reverse-transcription polymerase chain reaction of total plant RNA isolations confirmed the presence of SPFMV, SPVG, SPCSV and SPMMV as the most prevalent viruses infecting sweet potato in KZN. Keywords: reverse-transcription polymerase chain reaction, sweet potato, viruses. South African Journal of Plant and Soil ...

  11. Protection of melon plants against Cucumber mosaic virus infection ...

    African Journals Online (AJOL)

    Adhab

    serological means, nine species including, Portulaca oleraceae, Sisymbrium irio, Beta vulgaris, Chenopodium murale, Chenopodium album, Amaranthus retroflexus,. Solanum nigrum, Sonchus oleraceus, and Withania samnifera, were found to harbor the virus. Some of these hosts harbor the virus in asymptomatic infection ...

  12. Background review for diagnostic test development for Zika virus infection.

    Science.gov (United States)

    Charrel, Rémi N; Leparc-Goffart, Isabelle; Pas, Suzan; de Lamballerie, Xavier; Koopmans, Marion; Reusken, Chantal

    2016-08-01

    To review the state of knowledge about diagnostic testing for Zika virus infection and identify areas of research needed to address the current gaps in knowledge. We made a non-systematic review of the published literature about Zika virus and supplemented this with information from commercial diagnostic test kits and personal communications with researchers in European preparedness networks. The review covered current knowledge about the geographical spread, pathogen characteristics, life cycle and infection kinetics of the virus. The available molecular and serological tests and biosafety issues are described and discussed in the context of the current outbreak strain. We identified the following areas of research to address current knowledge gaps: (i) an urgent assessment of the laboratory capacity and capability of countries to detect Zika virus; (ii) rapid and extensive field validation of the available molecular and serological tests in areas with and without Zika virus transmission, with a focus on pregnant women; (iii) monitoring the genomic diversity of circulating Zika virus strains; (iv) prospective studies into the virus infection kinetics, focusing on diagnostic sampling (specimen types, combinations and timings); and (v) developing external quality assessments for molecular and serological testing, including differential diagnosis for similar viruses and symptom clusters. The availability of reagents for diagnostic development (virus strains and antigens, quantified viral ribonucleic acid) needs to be facilitated. An international laboratory response is needed, including preparation of protocols for prospective studies to address the most pressing information needs.

  13. Exposure of pampas fox (Pseudalopex gymnocercus and crab-eating fox (Cerdocyon thous from the Southern region of Brazil to Canine distemper virus (CDV, Canine parvovirus (CPV and Canine coronavirus (CCoV

    Directory of Open Access Journals (Sweden)

    Silvia de Oliveira Hübner

    2010-06-01

    Full Text Available The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous from Southern region of Brazil, to Canine distemper virus (CDV, canine parvovirus (CPV and Canine coronavirus (CCoV was investigated. Antibodies against CDV were detected in 38.5% (5/13 of the samples. There were anti-CDV antibodies in 60% (3/5 of P. gymnocercus and in 25% (2/8 of C. thous. The frequency was higher among the adults and males. Eleven canids (84.6% presented antibodies against CPV, 80% (4/5 were from P. gymnocercus and 87.5% (7/8 were from C. thous. There was no difference in positivity rate against CPV between gender and age. Antibodies against CCoV were detected in 38.5% (5/13 of the samples, with 60% (3/5 of positivity in P. gymnocercus and 25% (2/8 in C. thous. The frequency of antibodies against CCoV was higher among the adults and males. The study showed that these canids were exposed to CDV, CPV and CCoV.Foi investigada a ocorrência de exposição em 13 canídeos não domésticos de vida livre (cinco graxains-do-campo - Pseudalopex gymnocercus e oito graxains-do-mato - Cerdocyon thous da região sul do Brasil ao vírus da cinomose canina (CDV, parvovírus canino (CPV e coronavírus canino (CCoV. Anticorpos contra o CDV foram detectados em 38,5% (5/13 das amostras. Haviam anticorpos anti-CDV em 60% (3/5 dos P. gymnocercus e em 25% (2/8 dos C. thous. A freqüência foi maior entre machos e adultos. Para CPV, 11 canídeos (84,6% apresentaram anticorpos, 80% (4/5 eram da espécie P. gymnocercus e 87,5% (7/8 eram C. thous. Não houve diferença de positividade para o CPV entre sexos e idades. Anticorpos contra o CCoV foram detectados em 38,5% (5/13 das amostras, sendo 60% (3/5 de positividade entre os P. gymnocercus e 25% (2/8 entre os C. thous. A freqüência de anticorpos para CCoV foi maior entre os machos e adultos. O estudo revelou que estes canídeos foram expostos ao CDV, CPV

  14. The Effect of Human Immunodeficiency Virus on Hepatitis B Virus Serologic Status in Co-Infected Adults

    Science.gov (United States)

    2010-01-01

    The Effect of Human Immunodeficiency Virus on Hepatitis B Virus Serologic Status in Co-Infected Adults Michael L. Landrum1,2*, Ann M. Fieberg1,3...Portsmouth, Virginia, United States of America Abstract Background: Factors associated with serologic hepatitis B virus (HBV) outcomes in HIV-infected...HM, Crum-Cianflone NF, Marconi VC, et al. (2010) The Effect of Human Immunodeficiency Virus on Hepatitis B Virus Serologic Status in Co-Infected

  15. Mitigating Prenatal Zika Virus Infection in the Americas.

    Science.gov (United States)

    Ndeffo-Mbah, Martial L; Parpia, Alyssa S; Galvani, Alison P

    2016-10-18

    Because of the risk for Zika virus infection in the Americas and the links between infection and microcephaly, other serious neurologic conditions, and fetal death, health ministries across the region have advised women to delay pregnancy. However, the effectiveness of this policy in reducing prenatal Zika virus infection has yet to be quantified. To evaluate the effectiveness of pregnancy-delay policies on the incidence and prevalence of prenatal Zika virus infection. Vector-borne Zika virus transmission model fitted to epidemiologic data from 2015 to 2016 on Zika virus infection in Colombia. Colombia, August 2015 to July 2017. Population of Colombia, stratified by sex, age, and pregnancy status. Recommendations to delay pregnancy by 3, 6, 9, 12, or 24 months, at different levels of adherence. Weekly and cumulative incidence of prenatal infections and microcephaly cases. With 50% adherence to recommendations to delay pregnancy by 9 to 24 months, the cumulative incidence of prenatal Zika virus infections is likely to decrease by 17% to 44%, whereas recommendations to delay pregnancy by 6 or fewer months are likely to increase prenatal infections by 2% to 7%. This paradoxical exacerbation of prenatal Zika virus exposure is due to an elevated risk for pregnancies to shift toward the peak of the outbreak. Sexual transmission was not explicitly accounted for in the model because of limited data but was implicitly subsumed within the overall transmission rate, which was calibrated to observed incidence. Pregnancy delays can have a substantial effect on reducing cases of microcephaly but risks exacerbating the Zika virus outbreak if the duration is not sufficient. Duration of the delay, population adherence, and the timing of initiation of the intervention must be carefully considered. National Institutes of Health.

  16. Co-infection and disease severity of Ohio Maize dwarf mosaic virus and Maize chlorotic dwarf virus strains

    Science.gov (United States)

    Two major maize viruses have been reported in the United States: Maize dwarf mosaic virus (MDMV) and Maize chlorotic dwarf virus (MCDV). These viruses co-occur in regions where maize is grown such that co-infections are likely. Co-infection of different strains of MCDV is also observed frequently...

  17. Infection of Mosquito Cells (C6/36) by Dengue-2 Virus Interferes with Subsequent Infection by Yellow Fever Virus.

    Science.gov (United States)

    Abrao, Emiliana Pereira; da Fonseca, Benedito Antônio Lopes

    2016-02-01

    Dengue is one of the most important diseases caused by arboviruses in the world. Yellow fever is another arthropod-borne disease of great importance to public health that is endemic to tropical regions of Africa and the Americas. Both yellow fever and dengue viruses are flaviviruses transmitted by Aedes aegypti mosquitoes, and then, it is reasonable to consider that in a given moment, mosquito cells could be coinfected by both viruses. Therefore, we decided to evaluate if sequential infections of dengue and yellow fever viruses (and vice-versa) in mosquito cells could affect the virus replication patterns. Using immunofluorescence and real-time PCR-based replication assays in Aedes albopictus C6/36 cells with single or sequential infections with both viruses, we demonstrated the occurrence of viral interference, also called superinfection exclusion, between these two viruses. Our results show that this interference pattern is particularly evident when cells were first infected with dengue virus and subsequently with yellow fever virus (YFV). Reduction in dengue virus replication, although to a lower extent, was also observed when C6/36 cells were initially infected with YFV followed by dengue virus infection. Although the importance that these findings have on nature is unknown, this study provides evidence, at the cellular level, of the occurrence of replication interference between dengue and yellow fever viruses and raises the question if superinfection exclusion could be a possible explanation, at least partially, for the reported lack of urban yellow fever occurrence in regions where a high level of dengue transmission occurs.

  18. Chinese sacbrood virus infection in Asian honey bees (Apis cerana cerana) and host immune responses to the virus infection

    Science.gov (United States)

    Chinese Sacbrood virus (CSBV) is a common honey bee virus that infects both the European honey bee (A. mellifera) and the Asian honey bee (A. cerana). However, CSBV has much more devastating effects on Asian honey bees than on European honey bees, posing a serious threat to the agricultural and nat...

  19. Drosophila C virus systemic infection leads to intestinal obstruction.

    Science.gov (United States)

    Chtarbanova, Stanislava; Lamiable, Olivier; Lee, Kwang-Zin; Galiana, Delphine; Troxler, Laurent; Meignin, Carine; Hetru, Charles; Hoffmann, Jules A; Daeffler, Laurent; Imler, Jean-Luc

    2014-12-01

    Drosophila C virus (DCV) is a positive-sense RNA virus belonging to the Dicistroviridae family. This natural pathogen of the model organism Drosophila melanogaster is commonly used to investigate antiviral host defense in flies, which involves both RNA interference and inducible responses. Although lethality is used routinely as a readout for the efficiency of the antiviral immune response in these studies, virus-induced pathologies in flies still are poorly understood. Here, we characterize the pathogenesis associated with systemic DCV infection. Comparison of the transcriptome of flies infected with DCV or two other positive-sense RNA viruses, Flock House virus and Sindbis virus, reveals that DCV infection, unlike those of the other two viruses, represses the expression of a large number of genes. Several of these genes are expressed specifically in the midgut and also are repressed by starvation. We show that systemic DCV infection triggers a nutritional stress in Drosophila which results from intestinal obstruction with the accumulation of peritrophic matrix at the entry of the midgut and the accumulation of the food ingested in the crop, a blind muscular food storage organ. The related virus cricket paralysis virus (CrPV), which efficiently grows in Drosophila, does not trigger this pathology. We show that DCV, but not CrPV, infects the smooth muscles surrounding the crop, causing extensive cytopathology and strongly reducing the rate of contractions. We conclude that the pathogenesis associated with systemic DCV infection results from the tropism of the virus for an important organ within the foregut of dipteran insects, the crop. DCV is one of the few identified natural viral pathogens affecting the model organism Drosophila melanogaster. As such, it is an important virus for the deciphering of host-virus interactions in insects. We characterize here the pathogenesis associated with DCV infection in flies and show that it results from the tropism of the

  20. Cell-to-cell infection by HIV contributes over half of virus infection.

    Science.gov (United States)

    Iwami, Shingo; Takeuchi, Junko S; Nakaoka, Shinji; Mammano, Fabrizio; Clavel, François; Inaba, Hisashi; Kobayashi, Tomoko; Misawa, Naoko; Aihara, Kazuyuki; Koyanagi, Yoshio; Sato, Kei

    2015-10-06

    Cell-to-cell viral infection, in which viruses spread through contact of infected cell with surrounding uninfected cells, has been considered as a critical mode of virus infection. However, since it is technically difficult to experimentally discriminate the two modes of viral infection, namely cell-free infection and cell-to-cell infection, the quantitative information that underlies cell-to-cell infection has yet to be elucidated, and its impact on virus spread remains unclear. To address this fundamental question in virology, we quantitatively analyzed the dynamics of cell-to-cell and cell-free human immunodeficiency virus type 1 (HIV-1) infections through experimental-mathematical investigation. Our analyses demonstrated that the cell-to-cell infection mode accounts for approximately 60% of viral infection, and this infection mode shortens the generation time of viruses by 0.9 times and increases the viral fitness by 3.9 times. Our results suggest that even a complete block of the cell-free infection would provide only a limited impact on HIV-1 spread.

  1. Varicella-zoster virus (chickenpox) infection in pregnancy

    DEFF Research Database (Denmark)

    Lamont, Ronald F; Sobel, Jack D; Carrington, D

    2011-01-01

    Please cite this paper as: Lamont R, Sobel J, Carrington D, Mazaki-Tovi S, Kusanovic J, Vaisbuch E, Romero R. Varicella-zoster virus (chickenpox) infection in pregnancy. BJOG 2011; DOI: 10.1111/j.1471-0528.2011.02983.x. Congenital varicella syndrome, maternal varicella-zoster virus pneumonia...... and neonatal varicella infection are associated with serious fetomaternal morbidity and, not infrequently, mortality. Vaccination against varicella-zoster virus can prevent the disease, and outbreak control limits the exposure of pregnant women to the infectious agent. Maternal varicella-zoster immunoglobulin...

  2. The Aedes aegypti toll pathway controls dengue virus infection.

    Directory of Open Access Journals (Sweden)

    Zhiyong Xi

    2008-07-01

    Full Text Available Aedes aegypti, the mosquito vector of dengue viruses, utilizes its innate immune system to ward off a variety of pathogens, some of which can cause disease in humans. To date, the features of insects' innate immune defenses against viruses have mainly been studied in the fruit fly Drosophila melanogaster, which appears to utilize different immune pathways against different types of viruses, in addition to an RNA interference-based defense system. We have used the recently released whole-genome sequence of the Ae. aegypti mosquito, in combination with high-throughput gene expression and RNA interference (RNAi-based reverse genetic analyses, to characterize its response to dengue virus infection in different body compartments. We have further addressed the impact of the mosquito's endogenous microbial flora on virus infection. Our findings indicate a significant role for the Toll pathway in regulating resistance to dengue virus, as indicated by an infection-responsive regulation and functional assessment of several Toll pathway-associated genes. We have also shown that the mosquito's natural microbiota play a role in modulating the dengue virus infection, possibly through basal-level stimulation of the Toll immune pathway.

  3. Adverse outcomes of pregnancy-associated Zika virus infection.

    Science.gov (United States)

    Britt, William J

    2018-03-06

    The spread of Zika virus to the Americas was accompanied by surge in the number of infants with CNS abnormalities leading to a declaration of a health emergency by the WHO. This was accompanied by significant responses from governmental health agencies in the United States and Europe that resulted in significant new information described in the natural history of this perinatal infection in a very short period of time. Although much has been learned about Zika virus infection during pregnancy, limitations of current diagnostics and the challenges for accurate serologic diagnosis of acute Zika virus infection has restricted our understanding of the natural history of this perinatal infection to infants born to women with clinical disease during pregnancy and to Zika exposed infants with obvious clinical stigmata of disease. Thus, the spectrum of disease in infants exposed to Zika virus during pregnancy remains to be defined. In contrast, observations in informative animal models of Zika virus infections have provided rational pathways for vaccine development and existing antiviral drug development programs for other flaviviruses have resulted in accelerated development for potential antiviral therapies. This brief review will highlight some of the current concepts of the natural history of Zika virus during pregnancy. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Infection and Proliferation of Giant Viruses in Amoeba Cells.

    Science.gov (United States)

    Takemura, Masaharu

    2016-01-01

    Acanthamoeba polyphaga mimivirus, the first discovered giant virus with genome size and particle size much larger than previously discovered viruses, possesses several genes for translation and CRISPER Cas system-like defense mechanism against virophages, which co-infect amoeba cells with the giant virus and which inhibit giant virus proliferation. Mimiviruses infect amoeba cells by phagocytosis and release their DNA into amoeba cytoplasm through their stargate structure. After infection, giant virion factories (VFs) form in amoeba cytoplasm, followed by DNA replication and particle formation at peripheral regions of VF. Marseilleviruses, the smallest giant viruses, infect amoeba cells by phagocytosis or endocytosis, form larger VF than Mimivirus's VF in amoeba cytoplasm, and replicate their particles. Pandoraviruses found in 2013 have the largest genome size and particle size among all viruses ever found. Pandoraviruses infect amoeba cells by phagocytosis and release their DNA into amoeba cytoplasm through their mouth-like apical pores. The proliferation of Pandoraviruses occurs along with nucleus disruption. New virions form at the periphery of the region formerly occupied by the amoeba cell nucleus.

  5. Neuromuscular Manifestations of West Nile Virus Infection

    Directory of Open Access Journals (Sweden)

    A. Arturo eLeis

    2012-03-01

    Full Text Available The most common neuromuscular manifestation of West Nile virus (WNV infection is a poliomyelitis syndrome with asymmetric paralysis variably involving one (monoparesis to four limbs (quadriparesis, with or without brainstem involvement and respiratory failure. This syndrome of acute flaccid paralysis may occur without overt fever or meningoencephalitis. Although involvement of anterior horn cells in the spinal cord and motor neurons in the brainstem are the major sites of pathology responsible for neuromuscular signs, inflammation also may involve skeletal or cardiac muscle (myositis, myocarditis, motor axons (polyradiculitis, peripheral nerve (Guillain-Barré syndrome, brachial plexopathy. In addition, involvement of spinal sympathetic neurons and ganglia provides a plausible explanation for autonomic instability seen in some patients. Many patients also experience prolonged subjective generalized weakness and disabling fatigue. Despite recent evidence that WNV may persist long term in the central nervous system or periphery in animals, the evidence in humans is controversial. WNV persistence would be of great concern in immunosuppressed patients or in those with prolonged or recurrent symptoms. Support for the contention that WNV can lead to autoimmune disease arises from reports of patients presenting with various neuromuscular diseases that presumably involve autoimmune mechanisms (GBS, other demyelinating neu¬ropathies, myasthenia gravis, brachial plexopathies, stiff-person syndrome, and delayed or recurrent symptoms. Although there is no specific treatment or vaccine currently approved in humans, and the standard remains supportive care, drugs that can alter the cascade of immunobiochemical events leading to neuronal death may be potentially useful (high-dose corticosteroids, interferon preparations, and intravenous immune globulin containing WNV-specific antibodies. Human experience with these agents seems promising based on anecdotal

  6. Chronic hepatitis E virus infection in liver transplant recipients

    NARCIS (Netherlands)

    Haagsma, Elizabeth B.; van den Berg, Arie P.; Porte, Robert J.; Benne, Cornelis A.; Vennema, Harry; Reimerink, Johan H. J.; Koopmans, Marion P. G.

    Hepatitis E virus (HEV) infection is known to run a self-limiting course. Sporadic cases of acute hepatitis due to infection with HEV genotype 3, present in pig populations, are increasingly recognized. Zoonotic transmission seems infrequent. The entity of unexplained chronic hepatitis after liver

  7. Prevalence of hepatitis E virus infection in liver transplant recipients

    NARCIS (Netherlands)

    Haagsma, Elizabeth B; Niesters, Hubert G M; van den Berg, Arie P; Riezebos-Brilman, Annelies; Porte, Robert J; Vennema, Harry; Reimerink, Johan H J; Koopmans, Marion P G

    2009-01-01

    Hepatitis E virus (HEV) infection is known to run a self-limited course. Recently, chronic hepatitis E has been described in several immunosuppressed patients after solid organ transplantation. The prevalence of HEV infection after transplantation, however, is unknown. We studied HEV parameters [HEV

  8. Vaccination against acute respiratory virus infections and measles in man.

    NARCIS (Netherlands)

    A.D.M.E. Osterhaus (Albert); P. de Vries (Petra)

    1992-01-01

    textabstractSeveral viruses may cause more or less severe acute respiratory infections in man, some of which are followed by systemic infection. Only for influenza and measles are licensed vaccines available at present. The protection induced by influenza vaccines, which are based on inactivated

  9. Hepatitis C virus infection among transmission-prone medical personnel

    NARCIS (Netherlands)

    Zaaijer, H. L.; Appelman, P.; Frijstein, G.

    2012-01-01

    Hepatitis C virus (HCV)-infected physicians have been reported to infect some of their patients during exposure-prone procedures (EPPs). There is no European consensus on the policy for the prevention of this transmission. To help define an appropriate preventive policy, we determined the prevalence

  10. Distribution of hepatitis B virus infection in Namibia | Mhata | South ...

    African Journals Online (AJOL)

    Background. Namibia regards hepatitis B virus (HBV) infection as a public health problem and introduced hepatitis B vaccinations for infants during 2009. However, information on HBV infection in the country remains limited, and effective public health interventions may be compromised in the absence of adequate ...

  11. Prevalence of hepatitis B virus (HBV) infection among Makerere ...

    African Journals Online (AJOL)

    Background: Medical students in the course of their clinical work are at risk of acquiring hepatitis B virus (HBV) infection or transmitting it to their patients. HBV immunization for medical students in Uganda is recommended but not strictly enforced. It is important to assess the prevalence of HBV infection in medical students in ...

  12. Pitfalls in diagnosis of Hepatitis B Virus infection among adults ...

    African Journals Online (AJOL)

    Objective: Hepatitis B virus infection is common in Nigerians and its diagnosis is necessary for effective treatment and eradication. This study is aimed at highlighting the serological factors jeopardizing the diagnosis and treatment of the infection among Nigerians adults. Patients and Methods: Three studies were carried out.

  13. Hepatitis C Virus Infection in Nigerians | Ejiofor | Nigerian Medical ...

    African Journals Online (AJOL)

    Children and adults are all at risk of being infected especially sickle cell disease patients. Others include those who are exposed to the common risk factors like Blood transfusion, haemodialyisis, recycling of syringes and needles, sexual promiscuity. Conclusion: Reduction in the Hepatitis C virus infection could be achieved ...

  14. Hepatitis C virus infection in patients with oral lichen planus

    African Journals Online (AJOL)

    2011-02-20

    Feb 20, 2011 ... Background: Lichen planus (LP) is a chronic mucocutaneous disease of uncertain etiology. Recent reports suggest that LP is an extrahepatic manifestation of Hepatitis C infection. Objective: To determine the association of Hepatitis C virus (HCV) infection with oral LP and to study the tests of liver function in ...

  15. The prevalence of hepatitis B virus infection in Nigerian children ...

    African Journals Online (AJOL)

    Introduction: Hepatitis B virus infection is a major global health problem of public health importance. In a bid to control the infection, the Nigerian government in 2004 introduced hepatitis B vaccine into the National Program on Immunization. There are no studies on the prevalence of hepatitis B in adolescent prior to 2004.

  16. The Prevalence of Human Immunodeficiency Virus Infection among ...

    African Journals Online (AJOL)

    AJRH Managing Editor

    HIV Infection Diagnosed in Women in Labour. African Journal of Reproductive Health September 2015; 19 (3):137. ORIGINAL RESEARCH ARTICLE. The Prevalence of Human Immunodeficiency Virus Infection among. Pregnant Women in Labour with Unknown Status and those with. Negative status early in the Index ...

  17. Dengue virus life cycle : viral and host factors modulating infectivity

    NARCIS (Netherlands)

    Rodenhuis-Zybert, Izabela A.; Wilschut, Jan; Smit, Jolanda M.

    Dengue virus (DENV 1-4) represents a major emerging arthropod-borne pathogen. All four DENV serotypes are prevalent in the (sub) tropical regions of the world and infect 50-100 million individuals annually. Whereas the majority of DENV infections proceed asymptomatically or result in self-limited

  18. Outbreak of West Nile Virus Infection in Greece, 2010

    Science.gov (United States)

    Papa, Anna; Theocharopoulos, George; Dougas, Georgios; Athanasiou, Maria; Detsis, Marios; Baka, Agoritsa; Lytras, Theodoros; Mellou, Kassiani; Bonovas, Stefanos; Panagiotopoulos, Takis

    2011-01-01

    During 2010, an outbreak of West Nile virus infection occurred in Greece. A total of 197 patients with neuroinvasive disease were reported, of whom 33 (17%) died. Advanced age and a history of heart disease were independently associated with death, emphasizing the need for prevention of this infection in persons with these risk factors. PMID:22000357

  19. Pathogenesis of herpes simplex virus infections of the cornea

    NARCIS (Netherlands)

    J. Maertzdorf (Jeroen)

    2002-01-01

    textabstractThe identification of human herpes virus (HHV) infections can be traced back to ancient Greece where Herpes simplex vims (HSV) infections in humans were first documented. Hippocrates used the word "herpes", meaning to creep or crawl, to describe spreading skin lesions. Although the

  20. The Prevalence of Human Immunodeficiency Virus Infection among ...

    African Journals Online (AJOL)

    AJRH Managing Editor

    Agboghoroma et al. HIV Infection Diagnosed in Women in Labour. African Journal of Reproductive Health September 2015; 19 (3):137. ORIGINAL RESEARCH ARTICLE. The Prevalence of Human Immunodeficiency Virus Infection among. Pregnant Women in Labour with Unknown Status and those with. Negative status ...

  1. Hepatitis C virus infection in patients with oral lichen planus ...

    African Journals Online (AJOL)

    Background: Lichen planus (LP) is a chronic mucocutaneous disease of uncertain etiology. Recent reports suggest that LP is an extrahepatic manifestation of Hepatitis C infection. Objective: To determine the association of Hepatitis C virus (HCV) infection with oral LP and to study the tests of liver function in patients with ...

  2. [Neurological symptoms with a hepatitis E virus infection

    NARCIS (Netherlands)

    Wardt, J. van de; Dubbelink, T.B. Olde; Visee, H.F.; Schneeberger, P.M.; Lutgens, S.P.; Eijk, J.J.J. van

    2016-01-01

    BACKGROUND: Infection with hepatitis E virus genotype 3 (HEV3) is an emerging zoonosis in the industrialized world. The infection usually proceeds asymptomatically. Extrahepatic sequelae including neurological symptoms have been described. CASE DESCRIPTION: A 52-year-old man presented at the

  3. Early reverse transcription is essential for productive foamy virus infection.

    Science.gov (United States)

    Zamborlini, Alessia; Renault, Noémie; Saïb, Ali; Delelis, Olivier

    2010-06-11

    Although viral RNA constitutes the majority of nucleic acids packaged in virions, a late occurring step of reverse transcription leads to the presence of infectious viral cDNA in foamy virus particles. This peculiarity distinguishes them from the rest of the retroviral family. To evaluate the respective contribution of these viral nucleic acids in the replication of foamy viruses, their fate was studied by real-time PCR and RT-PCR early after infection, in the presence or in the absence of AZT. We found that an early reverse transcription step, which occurs during the first hours post-entry, is absolutely required for productive infection. Remarkably, sensitivity to AZT can be counteracted by increasing the multiplicity of infection (moi). We also show that 2-LTR circular viral DNA, which appears as soon as four hours post-infection, is transcriptionally competent. Taken together, our data demonstrate that an early reverse transcription process, which takes place soon after viral entry, is indispensable for infectivity of FVs at low moi, when the amount of DNA-containing particles is not sufficient to lead to a productive infection. This study demonstrates a key role of the packaged viral RNA in the foamy virus infection, suggesting that the replication of this virus can be achieved by involving either viral DNA or RNA genome, depending on the condition of infection.

  4. Characterization of Tomato Leaf Curl New Delhi Virus infecting ...

    African Journals Online (AJOL)

    Characterization of Tomato Leaf Curl New Delhi Virus infecting cucurbits: Evidence for sap transmission in a host specific manner. ... infected plants from different factors like buffer combinations, source of inoculum, age of inoculum, genotypes of test plants, and species of plants, temperature, seasons and organic materials.

  5. Human Hendra virus infection causes acute and relapsing encephalitis.

    Science.gov (United States)

    Wong, K T; Robertson, T; Ong, B B; Chong, J W; Yaiw, K C; Wang, L F; Ansford, A J; Tannenberg, A

    2009-06-01

    To study the pathology of two cases of human Hendra virus infection, one with no clinical encephalitis and one with relapsing encephalitis. Autopsy tissues were investigated by light microscopy, immunohistochemistry and in situ hybridization. In the patient with acute pulmonary syndrome but not clinical acute encephalitis, vasculitis was found in the brain, lung, heart and kidney. Occasionally, viral antigens were demonstrated in vascular walls but multinucleated endothelial syncytia were absent. In the lung, there was severe inflammation, necrosis and viral antigens in type II pneumocytes and macrophages. The rare kidney glomerulus showed inflammation and viral antigens in capillary walls and podocytes. Discrete necrotic/vacuolar plaques in the brain parenchyma were associated with antigens and viral RNA. Brain inflammation was mild although CD68(+) microglia/macrophages were significantly increased. Cytoplasmic viral inclusions and antigens and viral RNA in neurones and ependyma suggested viral replication. In the case of relapsing encephalitis, there was severe widespread meningoencephalitis characterized by neuronal loss, macrophages and other inflammatory cells, reactive blood vessels and perivascular cuffing. Antigens and viral RNA were mainly found in neurones. Vasculitis was absent in all the tissues examined. The case of acute Hendra virus infection demonstrated evidence of systemic infection and acute encephalitis. The case of relapsing Hendra virus encephalitis showed no signs of extraneural infection but in the brain, extensive inflammation and infected neurones were observed. Hendra virus can cause acute and relapsing encephalitis and the findings suggest that the pathology and pathogenesis are similar to Nipah virus infection.

  6. Jellyfish green fluorescent protein as a reporter for virus infections.

    Science.gov (United States)

    Baulcombe, D C; Chapman, S; Santa Cruz, S

    1995-06-01

    The gene encoding green fluorescent protein (GFP) of Aequorea victoria was introduced into the expression cassette of a virus vector based on potato virus X (PVX). Host plants of PVX inoculated with PVX.GFP became systemically infected. Production of GFP in these plants was detected initially between 1 and 2 days postinoculation by the presence of regions on the inoculated leaf that fluoresced bright green under UV light. Subsequently, this green fluorescence was evident in systemically infected tissue. The fluorescence could be detected by several methods. The simplest of these was by looking at the UV-illuminated plants in a darkened room. The PVX.GFP-infected tissue has been analysed either by epifluorescence or confocal laser scanning microscopy. These microscopical methods allow the presence of the virus to be localized to individual infected cells. It was also possible to detect the green fluorescence by spectroscopy or by electrophoresis of extracts from infected plants. To illustrate the potential application of this reporter gene in virological studies a derivative of PVX.GFP was constructed in which the coat protein gene of PVX was replaced by GFP. Confocal laser scanning microscopy of the inoculated tissue showed that the virus was restricted to the inoculated cells thereby confirming earlier speculation that the PVX coat protein is essential for cell-to-cell movement. It is likely that GFP will be useful as a reporter gene in transgenic plants as well as in virus-infected tissue.

  7. Hepatitis B Virus and Human Immunodeficiency Virus co-infection in ...

    African Journals Online (AJOL)

    Hepatitis B Virus(HBV) and Human Immunodeficiency Virus(HIV) share similar properties such as modes of transmission. This study was therefore designed to find out the prevalence of HBV/HIV co-infection in Zawan village. Three hundred subjects were recruited into the study through simple random sampling method ...

  8. Outbreak of Zika Virus Infections, Dominica, 2016.

    Science.gov (United States)

    Ryan, Sadie J; Carlson, Colin J; Stewart-Ibarra, Anna M; Borbor-Cordova, Mercy J; Romero, Moory M; Cox, Shelly-Ann; Mahon, Roché; Trotman, Adrian; St Ville, Sylvester; Ahmed, Shalauddin

    2017-11-01

    In February 2016, the World Health Organization declared the pandemic of Zika virus a public health emergency. On March 4, 2016, Dominica reported its first autochthonous Zika virus disease case; subsequently, 1,263 cases were reported. We describe the outbreak through November 2016, when the last known case was reported.

  9. Outbreak of Zika Virus Infections, Dominica, 2016

    OpenAIRE

    Ryan, Sadie J.; Carlson, Colin J.; Stewart-Ibarra, Anna M.; Borbor-Cordova, Mercy J.; Romero, Moory M.; Cox, Shelly-Ann; Mahon, Roché; Trotman, Adrian; St. Ville, Sylvester; Ahmed, Shalauddin

    2017-01-01

    In February 2016, the World Health Organization declared the pandemic of Zika virus a public health emergency. On March 4, 2016, Dominica reported its first autochthonous Zika virus disease case; subsequently, 1,263 cases were reported. We describe the outbreak through November 2016, when the last known case was reported.

  10. Níveis de anticorpos contra o vírus da cinomose canina e o parvovírus canino em cães não vacinados e vacinados Antibodies levels against canine distemper virus and canine parvovirus in vaccinated and unvaccinated dogs

    Directory of Open Access Journals (Sweden)

    R. Hass

    2008-02-01

    Full Text Available Antibody titres to canine distemper virus (CDV and canine parvovirus (CPV were measured in 132 dogs: 80 had been vaccinated at least once, 22 had not been vaccinated, and 30 had unknown vaccination history. Serum antibody titers were measured by means of serum neutralization (CDV or hemagglutination inhibition (CPV. Serum CDV titers >20 and serum CPV titers >80 were considered protective. Protective antibodies to CDV were present in 40.1% of the population: 39.8% of the vaccinated dogs, 31.8% unvaccinated, and in 46.6% of the dogs with unknown vaccination history. Protective antibodies to CPV were present in 90.9% of the dogs: 93.7% of the vaccinated dogs, 90.9% of the unvaccinated, and 83.3% of the dogs with unknown vaccination history.

  11. Experimental Hendra virus infection of dogs: virus replication, shedding and potential for transmission.

    Science.gov (United States)

    Middleton, D J; Riddell, S; Klein, R; Arkinstall, R; Haining, J; Frazer, L; Mottley, C; Evans, R; Johnson, D; Pallister, J

    2017-01-01

    Characterisation of experimental Hendra virus (HeV) infection in dogs and assessment of associated transmission risk. Beagle dogs were exposed oronasally to Hendra virus/Australia/Horse/2008/Redlands or to blood collected from HeV-infected ferrets. Ferrets were exposed to oral fluids collected from dogs after canine exposure to HeV. Observations made and samples tested post-exposure were used to assess the clinical course and replication sites of HeV in dogs, the infectivity for ferrets of canine oral fluids and features of HeV infection in dogs following contact with infective blood. Dogs were reliably infected with HeV and were generally asymptomatic. HeV was re-isolated from the oral cavity and virus clearance was associated with development of virus neutralising antibody. Major sites of HeV replication in dogs were the tonsils, lower respiratory tract and associated lymph nodes. Virus replication was documented in canine kidney and spleen, confirming a viraemic phase for canine HeV infection and suggesting that urine may be a source of infectious virus. Infection was transmitted to ferrets via canine oral secretions, with copy numbers for the HeV N gene in canine oral swabs comparable to those reported for nasal swabs of experimentally infected horses. HeV is not highly pathogenic for dogs, but their oral secretions pose a potential transmission risk to people. The time-window for transmission risk is circumscribed and corresponds to the period of acute infection before establishment of an adaptive immune response. The likelihood of central nervous system involvement in canine HeV infection is unclear, as is any long-term consequence. © 2017 Australian Veterinary Association.

  12. Korean infection control nurses' knowledge and awareness of infection control against Ebola virus disease.

    Science.gov (United States)

    Kim, Kyung M; Choi, Jeong S

    2017-07-01

    To assess the level of knowledge and awareness of Ebola virus disease infection control among infection control nurses and to identify a correlation between these factors. The data were collected from 125 infection control nurses by using a self-report questionnaire. The data were collected on sociodemographic and hospital characteristics, as well as the level of knowledge and awareness of Ebola virus disease infection control. The respondents' mean level of knowledge (correct-answer rate) was 87.7% and their mean level of awareness was 3.86 (1 = "not important at all" to 4 = "very important"). Knowledge of Ebola virus disease infection control was significantly higher among those nurses who had received some Ebola virus disease education. There was a significant positive correlation between the level of knowledge and the level of awareness. The development of effective education and training systems is necessary to improve infection control nurses' knowledge and awareness of Ebola virus disease infection control. Moreover, each hospital should build effective and systematic Ebola virus disease infection control strategies. © 2016 Japan Academy of Nursing Science.

  13. Enhanced infectivity of bluetongue virus in cell culture by centrifugation.

    OpenAIRE

    Sundin, D R; Mecham, J O

    1989-01-01

    The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...

  14. Wheeze after Hospitalization for Respiratory Syncytial Virus Infection in Children

    DEFF Research Database (Denmark)

    Stensballe, Lone Graff; Simonsen, Jacob; Breindahl, Morten

    2018-01-01

    Introduction Prior studies found associations between respiratory syncytial virus (RSV) infection, wheezing, and asthma. The present study aimed to examine the risk of wheezing after RSV, by the history of wheezing. Methods We included 39 children hospitalized for RSV infection (cases) and 23...... children hospitalized for nonrespiratory tract infection reasons (controls) and followed the children prospectively with regular standardized telephone interviews until 18 months, and again 5 years after inclusion. The risk of wheeze was estimated by odds ratios (OR), comparing children hospitalized...

  15. Multiple Epstein-Barr virus infections in healthy individuals

    Science.gov (United States)

    Walling, Dennis M.; Brown, Abigail L.; Etienne, Wiguins; Keitel, Wendy A.; Ling, Paul D.; Butel, J. S. (Principal Investigator)

    2003-01-01

    We employed a newly developed genotyping technique with direct representational detection of LMP-1 gene sequences to study the molecular epidemiology of Epstein-Barr virus (EBV) infection in healthy individuals. Infections with up to five different EBV genotypes were found in two of nine individuals studied. These results support the hypothesis that multiple EBV infections of healthy individuals are common. The implications for the development of an EBV vaccine are discussed.

  16. Antiviral activity of lanatoside C against dengue virus infection.

    Science.gov (United States)

    Cheung, Yan Yi; Chen, Karen Caiyun; Chen, Huixin; Seng, Eng Khuan; Chu, Justin Jang Hann

    2014-11-01

    Dengue infection poses a serious threat globally due to its recent rapid spread and rise in incidence. Currently, there is no approved vaccine or effective antiviral drug for dengue virus infection. In response to the urgent need for the development of an effective antiviral for dengue virus, the US Drug Collection library was screened in this study to identify compounds with anti-dengue activities. Lanatoside C, an FDA approved cardiac glycoside was identified as a candidate anti-dengue compound. Our data revealed that lanatoside C has an IC50 of 0.19μM for dengue virus infection in HuH-7 cells. Dose-dependent reduction in dengue viral RNA and viral proteins synthesis were also observed upon treatment with increasing concentrations of lanatoside C. Time of addition study indicated that lanatoside C inhibits the early processes of the dengue virus replication cycle. Furthermore, lanatoside C can effectively inhibit all four serotypes of dengue virus, flavivirus Kunjin, alphavirus Chikungunya and Sindbis virus as well as the human enterovirus 71. These findings suggest that lanatoside C possesses broad spectrum antiviral activity against several groups of positive-sense RNA viruses. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Zika virus infection and its emerging trends in Southeast Asia.

    Science.gov (United States)

    Salehuddin, Ahmad Ruzain; Haslan, Haszianaliza; Mamikutty, Norshalizah; Zaidun, Nurul Hannim; Azmi, Mohamad Fairuz; Senin, Mohamad Mu'izuddin; Syed Ahmad Fuad, Syed Baharom; Thent, Zar Chi

    2017-03-01

    Zika virus is a mosquito-borne flavivirus that represents a public health emergency at the ongoing epidemic. Previously, this rare virus was limited to sporadic cases in Africa and Asia until its emergence in Brazil, South America in 2015, where it rapidly spread throughout the world. Recently, a high number of cases were reported in Singapore and other Southeast Asia countries. A combination of factors explains the current Zika virus outbreak although it is highly likely that the changes in the climate and high frequency of travelling contribute to the spread of Aedes vector carrying the Zika virus mainly to the tropical climate countries such as the Southeast Asia. The Zika virus is known to cause mild clinical symptoms similar to those of dengue and chikungunya and transmitted by different species of Aedes mosquitoes. However, neurological complications such as Guillain-Barré syndrome in adults, and congenital anomalies, including microcephaly in babies born to infected mothers, raised a serious concern. Currently, there is no specific antiviral treatment or vaccine available for Zika virus infection. Therefore, international public health response is primarily focused on preventing infection, particularly in pregnant women, and on providing up-to-date recommendations to reduce the risk of non-vector transmission of Zika virus. Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  18. Undetectable hepatitis C virus RNA during syphilis infection in two HIV/HCV-co-infected patients

    DEFF Research Database (Denmark)

    Salado-Rasmussen, Kirsten; Knudsen, Andreas; Krarup, Henrik Bygum

    2014-01-01

    BACKGROUND: Treponema pallidum, the causative agent of syphilis, elicits a vigorous immune response in the infected host. This study sought to describe the impact of syphilis infection on hepatitis C virus (HCV) RNA levels in patients with HIV and chronic HCV infection. METHODS: Patients...

  19. Why Zika virus infection has become a public health concern?

    Directory of Open Access Journals (Sweden)

    Hui-Lan Chen

    2016-04-01

    Full Text Available Prior to 2015, Zika Virus (ZIKV outbreaks had occurred in areas of Africa, Southeast Asia, and the Pacific Islands. Although a causal relationship between Zika infection during pregnancy and microcephaly is strongly suspected, such a connection has not yet been scientifically proven. In May 2015, the outbreak of ZIKV infection in Brazil led to reports of syndrome and pregnant women giving birth to babies with birth defects and poor pregnancy outcomes; the Pan American Health Organization (PAHO issued an alert regarding the first confirmed ZIKV infection in Brazil. Currently, ZIKV outbreaks are ongoing and it will be difficult to predict how the virus will spread over time. ZIKV is transmitted to humans primarily through the bite of infected mosquitos, Aedes aegypti and Aedes albopictus. These mosquitoes are the principle vectors of dengue, and ZIKV disease generally is reported to include symptoms associated with acute febrile illnesses that clinically resembles dengue fever. The laboratory diagnosis can be performed by using reverse-transcriptase polymerase chain reaction (RT-PCR on serum, viral nucleic acid and virus-specific immunoglobulin M. There is currently no vaccine and antiviral treatment available for ZIKV infection, and the only way to prevent congenital ZIKV infection is to prevent maternal infection. In February 2016, the Taiwan Centers for Disease Control (Taiwan CDC activated ZIKV as a Category V Notifiable Infectious Disease similar to Ebola virus disease and MERS.

  20. Animal models for the study of hepatitis B virus infection

    Directory of Open Access Journals (Sweden)

    Wei-Na Guo

    2018-01-01

    Full Text Available Even with an effective vaccine, an estimated 240 million people are chronically infected with hepatitis B virus (HBV worldwide. Current antiviral therapies, including interferon and nucleot(side analogues, rarely cure chronic hepatitis B. Animal models are very crucial for understanding the pathogenesis of chronic hepatitis B and developing new therapeutic drugs or strategies. HBV can only infect humans and chimpanzees, with the use of chimpanzees in HBV research strongly restricted. Thus, most advances in HBV research have been gained using mouse models with HBV replication or infection or models with HBV-related hepadnaviral infection. This review summarizes the animal models currently available for the study of HBV infection.