WorldWideScience

Sample records for disk agar diffusion

  1. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  2. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  3. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  4. Proposal for agar disk diffusion interpretive criteria for susceptibility testing of bovine mastitis pathogens using cefoperazone 30μg disks.

    Science.gov (United States)

    Feßler, Andrea T; Kaspar, Heike; Lindeman, Cynthia J; Peters, Thomas; Watts, Jeffrey L; Schwarz, Stefan

    2017-02-01

    Cefoperazone is a third generation cephalosporin which is commonly used for bovine mastitis therapy. Bacterial pathogens involved in bovine mastitis are frequently tested for their susceptibility to cefoperazone. So far, the cefoperazone susceptibility testing using 30μg disks has been hampered by the lack of quality control (QC) ranges as well as the lack of interpretive criteria. In 2014, QC ranges for 30 μg cefoperazone disks have been established for Staphylococcus aureus ATCC ® 25923 and Escherichia coli ATCC ® 25922. As a next step, interpretive criteria for the susceptibility testing of bovine mastitis pathogens should be developed. For this, 637 bovine mastitis pathogens (including 112 S. aureus, 121 coagulase-negative staphylococci (CoNS), 103 E. coli, 101 Streptococcus agalactiae, 100 Streptococcus dysgalactiae and 100 Streptococcus uberis) were investigated by agar disk diffusion according to the document Vet01-A4 of the Clinical and Laboratory Standards Institute (CLSI) using 30μg cefoperazone disks and the results were compared to the corresponding MIC values as determined by broth microdilution also according to the aforementioned CLSI document. Based on the results obtained and taking into account the achievable milk concentration of cefoperazone after regular dosing, the following interpretive criteria were proposed as a guidance for mastitis diagnostic laboratories: for staphylococci and E. coli ≥23mm (susceptible), 18-22mm (intermediate) and ≤17mm (resistant) and for streptococci ≥18mm (susceptible), and ≤17mm (non-susceptible). These proposed interpretive criteria shall contribute to a harmonization of cefoperazone susceptibility testing of bovine mastitis pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza

    2010-12-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.

  6. Comparison of Two Different Disk Diffusion Agar Tests in Determination of Antibiotic Susceptibility for E-Coli Isolated from Urinary Tract Infection in Pediatrics

    Directory of Open Access Journals (Sweden)

    I. Sedighi

    2010-04-01

    Full Text Available Introduction & Objective: Urinary Tract Infection (UTI is one of the most common infections during childhood and E-Coli is the more predominant pathogen recovered in UTI. Disk Diffusion agar test is a method of choice because it is cost effective, simple, and now routinely used for detection of antibiotic susceptibility. A rapid increase in antibiotic resistance in our region made the authors to design a study to compare this traditional method with two different disk diffusion agar tests.Materials & Methods: Our study was conducted between 2009 and 2010 in Be’sat teaching hospital on 100 pediatric patients ranged 15 days to 13 years old with positive urine culture for E-coli. Antibiogram detection was performed by disk diffusion agar test with two different kits as Padtan-Teb (made in Iran and Mast (made in the U.K. for Co-trimoxazol, Amikacin, Ceftriaxone, Nalidixic Acid, Cefixime, and Nitrofurantoin. At last the data was analyzed by McNemar test.Results: Co-trimoxazol obtained the lowest (23% Padtan-Teb and 26% Mast and Nitrofurantoin had the highest (86% Padtan-Teb and 97% Mast sensitivity in the two methods which were used in our study. The results were statistically significant for Amikacin, Ceftriaxone, Cefixime, and Nitrofurantoin. The data was analyzed by Mc Memar test.Conclusion: According to our study the results of antibiotic susceptibility were more compatible with other non national Disk diffusion agar test and thus we recommend that our manufactures in Iran should increase the quality of their products.

  7. [Evaluation of in vitro antimicrobial activity of cefazolin alone and in combination with cefmetazole or flomoxef using agar dilution method and disk diffusion method].

    Science.gov (United States)

    Matsuo, K; Uete, T

    1992-10-01

    Antimicrobial activities of cefazolin (CEZ) against 251 strains of various clinical isolates obtained during 1989 and 1990 were determined using the Mueller-Hinton agar dilution method at an inoculum level 10(6) CFU/ml. The reliability of the disk susceptility test was also studied using Mueller-Hinton agar and various disks at inoculum levels of 10(3-4) CFU/cm2 in estimating approximate values of MICs. In addition, antimicrobial activities of CEZ and cefmetazole (CMZ) or flomoxef (FMOX) in combination were investigated against methicillin-sensitive and -resistant Staphylococcus aureus (MSSA and MRSA) using the checkerboard agar dilution MIC method and the disk diffusion test either with the disks contained CEZ, CMZ, and FMOX alone, or CEZ, and CMZ or FMOX in combination. In this study, the MICs of CEZ against S. aureus were distributed with the 3 peak values at 0.39 microgram/ml, 3.13 micrograms/ml and > 100 micrograms/ml. MICs against MSSA were 0.39 microgram/ml to 0.78 microgram/ml, whereas those against MRSA were greater than 0.78 microgram/ml. MICs against majority of strains of Enterococcus faecalis were 25 micrograms/ml. Over 90% of strains of Escherichia coli and Klebsiella pneumoniae were inhibited at the level of 3.13 micrograms/ml. About 60% of isolates of indole negative Proteus spp. were inhibited at the levels of less than 3.13 micrograms/ml and 100% at 6.25 micrograms/ml, but MICs against indole positive Proteus spp., Serratia spp. and Pseudomonas aeruginosa were over 100 micrograms/ml. The antimicrobial activities of CEZ against these clinical isolates were not significantly different compared to those reported about 15-20 years ago, except for S. aureus. Highly resistant strains of S. aureus to CEZ were more prevalent in this study. The inhibitory zones obtained with the disk test were compared with MICs. The results of CEZ disk susceptibility test with 30 micrograms disk (Showa) or 10 micrograms disk (prepared in this laboratory) were well

  8. Antimicrobial Susceptibility of Flavobacterium psychrophilum from Chilean Salmon Farms and Their Epidemiological Cut-Off Values Using Agar Dilution and Disk Diffusion Methods.

    Science.gov (United States)

    Miranda, Claudio D; Smith, Peter; Rojas, Rodrigo; Contreras-Lynch, Sergio; Vega, J M Alonso

    2016-01-01

    Flavobacterium psychrophilum is the most important bacterial pathogen for freshwater farmed salmonids in Chile. The aims of this study were to determine the susceptibility to antimicrobials used in fish farming of Chilean isolates and to calculate their epidemiological cut-off (CO WT ) values. A number of 125 Chilean isolates of F. psychrophilum were isolated from reared salmonids presenting clinical symptoms indicative of flavobacteriosis and their identities were confirmed by 16S rRNA polymerase chain reaction. Susceptibility to antibacterials was tested on diluted Mueller-Hinton by using an agar dilution MIC method and a disk diffusion method. The CO WT values calculated by Normalized Resistance Interpretation (NRI) analysis allow isolates to be categorized either as wild-type fully susceptible (WT) or as manifesting reduced susceptibility (NWT). When MIC data was used, NRI analysis calculated a CO WT of ≤0.125, ≤2, and ≤0.5 μg mL -1 for amoxicillin, florfenicol, and oxytetracycline, respectively. For the quinolones, the CO WT were ≤1, ≤0.5, and ≤0.125 μg mL -1 for oxolinic acid, flumequine, and enrofloxacin, respectively. The disk diffusion data sets obtained in this work were extremely diverse and were spread over a wide range. For the quinolones there was a close agreement between the frequencies of NWT isolates calculated using MIC and disk data. For oxolinic acid, flumequine, and enrofloxacin the frequencies were 45, 39, and 38% using MIC data, and 42, 41, and 44%, when disk data were used. There was less agreement with the other antimicrobials, because NWT frequencies obtained using MIC and disk data, respectively, were 24 and 10% for amoxicillin, 8 and 2% for florfenicol, and 70 and 64% for oxytetracycline. Considering that the MIC data was more precise than the disk diffusion data, MIC determination would be the preferred method for susceptibility testing for this species and the NWT frequencies derived from the MIC data sets should be

  9. Comparison of E.test and Disk Diffusion Agar in Detection of Antibiotic Susceptibility of E.coli Isolated from Patients with Urinary Tract Infection in Tehran Shariati Hospital

    Directory of Open Access Journals (Sweden)

    Y. Erfani

    2008-07-01

    Full Text Available Introduction & Objective: UTI is one of the most common bacterial infections and Ecoli is known as an important cause of UTIs. Since bacterial resistances of antibiotics are increasing, reliable methods of antimicrobial resistance detection are of paramount importance in treatment and management of UTIs. The objective of the present study is to compare and to evaluate the performance of disk diffusion agar (Iranian and Italian and E.test (Epsilometer test (Sweden for antimicrobial susceptibility testing of Ecoli isolated from UTI.Materials & Methods: This study was done on 250 Isolates of Ecoli from patients with UTI in Shariati Hospital, Tehran University of Medical Sciences during 2004. Antibiotic susceptibility testing was performed by disk diffusion method using Iranian and Italian disk for Trimetoprim sulfamethoxazole, Gentamysin, Ceftazidim, Nitrofurantoin and Ciprofluxacin and Minimum Inhibitory concentration (MIC determination was performed by E.test for the same set of antimicrobial. All tests were performed on muller hinton agar. Results: Comparison of E.test and Iranian disk diffusion agar showed that paramount differences in antibiotic agreement (Max 37.8 % those differences in case of Ceftazidim and Gentamysin were respectively 76.8% and 62.2% whereas comparison of E.test and Italian disk diffusion agar showed less difference of antibiotics agreement (Max 11.2%.Conclusion: The results of this study showed that Iranian disk diffusion agar may be used as a preliminary screen for antibiotic susceptibility testing of E.coli and is less sensitive than Italian disk diffusion and E.test. Comparison of 3 mentioned methods have showed that E.test is the most sensitive and shows the effective dose of antibiotic for treatment and prevention of antibiotic resistance.

  10. Antimicrobial Susceptibility of Flavobacterium psychrophilum from Chilean Salmon Farms and their Epidemiological Cut-off Values using Agar Dilution and Disk Diffusion Methods

    Directory of Open Access Journals (Sweden)

    Claudio D Miranda

    2016-11-01

    Full Text Available Flavobacterium psychrophilum is the most important bacterial pathogen for freshwater farmed salmonids in Chile. The aims of this study were to determine the susceptibility to antimicrobials used in fish farming of Chilean isolates and to calculate their epidemiological cut-off (COWT values. A number of 125 Chilean isolates of F. psychrophilum were isolated from reared salmonids presenting clinical symptoms indicative of flavobacteriosis and their identities were confirmed by 16S rRNA polymerase chain reaction. Susceptibility to antibacterials was tested on diluted Mueller-Hinton by using an agar dilution MIC method and a disk diffusion method. The COWT values calculated by Normalised Resistance Interpretation (NRI analysis allow isolates to be categorized either as wild-type fully susceptible (WT or as manifesting reduced susceptibility (NWT. When MIC data was used, NRI analysis calculated a COWT of ≤ 0.125 μg mL-1, ≤ 2 μg mL-1 and ≤ 0.5 μg mL-1 for amoxicillin, florfenicol and oxytetracycline, respectively. For the quinolones, the COWT were ≤1 μg mL-1, ≤ 0.5 μg mL-1 and ≤ 0.125 μg mL-1 for oxolinic acid, flumequine and enrofloxacin respectively. The disc diffusion data sets obtained in this work were extremely diverse and were spread over a wide range. For the quinolones there was a close agreement between the frequencies of NWT isolates calculated using MIC and disc data. For oxolinic acid, flumequine and enrofloxacin the frequencies were 45, 39 and 38% using MIC data, and 42, 41 and 44%, when disc data were used. There was less agreement with the other antimicrobials, because NWT frequencies obtained using MIC and disc data respectively, were 24% and 10% for amoxicillin, 8% and 2% for florfenicol and 70% and 64% for oxytetracycline. Considering that the MIC data was more precise than the disc diffusion data, MIC determination would be the preferred method for susceptibility testing for this species and the NWT frequencies

  11. Performance of the EUCAST disk diffusion method, the CLSI agar screen method, and the Vitek 2 automated antimicrobial susceptibility testing system for detection of clinical isolates of Enterococci with low- and medium-level VanB-type vancomycin resistance

    DEFF Research Database (Denmark)

    Hegstad, Kristin; Giske, Christian G; Haldorsen, Bjørg

    2014-01-01

    faecium (n=18) strains with and without nonsusceptibility to vancomycin was examined blindly in Danish (n=5), Norwegian (n=13), and Swedish (n=10) laboratories using the EUCAST disk diffusion method (n=28) and the CLSI agar screen (n=18) or the Vitek 2 system (bioMérieux) (n=5). The EUCAST disk diffusion...... method (very major error [VME] rate, 7.0%; sensitivity, 0.93; major error [ME] rate, 2.4%; specificity, 0.98) and CLSI agar screen (VME rate, 6.6%; sensitivity, 0.93; ME rate, 5.6%; specificity, 0.94) performed significantly better (P=0.02) than the Vitek 2 system (VME rate, 13%; sensitivity, 0.87; ME...... rate, 0%; specificity, 1). The performance of the EUCAST disk diffusion method was challenged by differences in vancomycin inhibition zone sizes as well as the experience of the personnel in interpreting fuzzy zone edges as an indication of vancomycin resistance. Laboratories using Oxoid agar (P

  12. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  13. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  14. Diffuse interstellar gas in disk galaxies

    International Nuclear Information System (INIS)

    Vladilo, G.

    1989-01-01

    The physical properties of the diffuse gas in our Galaxy are reviewed and considered as a starting point for interstellar (IS) studies of disk galaxies. Attention is focussed on the atomic and ionic component, detected through radio, optical, ultraviolet (UV) and X-ray observations. The cooling and heating processes in the IS gas are briefly recalled in order to introduce current models of disk and halo gas. Observations of nearby galaxies critical to test IS models are considered, including 21-cm surveys, optical and UV absorptions of bright, extragalactic sources, and X-ray emission from hot halos. Finally, further steps necessary to develop a global model for the structure and evolution of the interstellar medium are indicated. (author)

  15. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  16. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  17. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  18. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  19. MAGNETIC BRAKING AND PROTOSTELLAR DISK FORMATION: AMBIPOLAR DIFFUSION

    International Nuclear Information System (INIS)

    Mellon, Richard R.; Li Zhiyun

    2009-01-01

    It is established that the formation of rotationally supported disks during the main accretion phase of star formation is suppressed by a moderately strong magnetic field in the ideal MHD limit. Nonideal MHD effects are expected to weaken the magnetic braking, perhaps allowing the disk to reappear. We concentrate on one such effect, ambipolar diffusion, which enables the field lines to slip relative to the bulk neutral matter. We find that the slippage does not sufficiently weaken the braking to allow rotationally supported disks to form for realistic levels of cloud magnetization and cosmic ray ionization rate; in some cases, the magnetic braking is even enhanced. Only in dense cores with both exceptionally weak fields and unreasonably low ionization rate do such disks start to form in our simulations. We conclude that additional processes, such as Ohmic dissipation or Hall effect, are needed to enable disk formation. Alternatively, the disk may form at late times when the massive envelope that anchors the magnetic brake is dissipated, perhaps by a protostellar wind.

  20. SNOW LINES AS PROBES OF TURBULENT DIFFUSION IN PROTOPLANETARY DISKS

    International Nuclear Information System (INIS)

    Owen, James E.

    2014-01-01

    Sharp chemical discontinuities can occur in protoplanetary disks, particularly at ''snow lines'' where a gas-phase species freezes out to form ice grains. Such sharp discontinuities will diffuse out due to the turbulence suspected to drive angular momentum transport in accretion disks. We demonstrate that the concentration gradient—in the vicinity of the snow line—of a species present outside a snow line but destroyed inside is strongly sensitive to the level of turbulent diffusion (provided the chemical and transport timescales are decoupled) and provides a direct measurement of the radial ''Schmidt number'' (the ratio of the angular momentum transport to radial turbulent diffusion). Taking as an example the tracer species N 2 H + , which is expected to be destroyed inside the CO snow line (as recently observed in TW Hya) we show that ALMA observations possess significant angular resolution to constrain the Schmidt number. Since different turbulent driving mechanisms predict different Schmidt numbers, a direct measurement of the Schmidt number in accretion disks would allow inferences to be made about the nature of the turbulence

  1. Antibiogramj: A tool for analysing images from disk diffusion tests.

    Science.gov (United States)

    Alonso, C A; Domínguez, C; Heras, J; Mata, E; Pascual, V; Torres, C; Zarazaga, M

    2017-05-01

    Disk diffusion testing, known as antibiogram, is widely applied in microbiology to determine the antimicrobial susceptibility of microorganisms. The measurement of the diameter of the zone of growth inhibition of microorganisms around the antimicrobial disks in the antibiogram is frequently performed manually by specialists using a ruler. This is a time-consuming and error-prone task that might be simplified using automated or semi-automated inhibition zone readers. However, most readers are usually expensive instruments with embedded software that require significant changes in laboratory design and workflow. Based on the workflow employed by specialists to determine the antimicrobial susceptibility of microorganisms, we have designed a software tool that, from images of disk diffusion tests, semi-automatises the process. Standard computer vision techniques are employed to achieve such an automatisation. We present AntibiogramJ, a user-friendly and open-source software tool to semi-automatically determine, measure and categorise inhibition zones of images from disk diffusion tests. AntibiogramJ is implemented in Java and deals with images captured with any device that incorporates a camera, including digital cameras and mobile phones. The fully automatic procedure of AntibiogramJ for measuring inhibition zones achieves an overall agreement of 87% with an expert microbiologist; moreover, AntibiogramJ includes features to easily detect when the automatic reading is not correct and fix it manually to obtain the correct result. AntibiogramJ is a user-friendly, platform-independent, open-source, and free tool that, up to the best of our knowledge, is the most complete software tool for antibiogram analysis without requiring any investment in new equipment or changes in the laboratory. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  3. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  4. Development of EUCAST disk diffusion method for susceptibility testing of the Bacteroides fragilis group isolates

    DEFF Research Database (Denmark)

    Nagy, Elisabeth; Justesen, Ulrik Stenz; Eitel, Zsuzsa

    2015-01-01

    -clavulanic acid, cefoxitin, clindamycin, imipenem, metronidazole, moxifloxacin, piperacillin/tazobactam, tigecycline by agar dilution method previously. The inhibition zones of the same antibiotics including meropenem disc were determined by the disc diffusion on Brucella blood agar supplemented with haemin...

  5. Identification of Yeast Species In the Oral Cavity of Iranian Soldiers By Disk Diffusion Method

    Directory of Open Access Journals (Sweden)

    M. Imami

    2008-02-01

    Full Text Available Background:The disk diffusion method for identification of yeasts species was performed based on different but distinct susceptibilities of yeasts spp.to chemicals:janus green, ethidium bromide,2,3,5-triphenyltetrazolium chloride, brilliant green, cycloheximide and rhodamine 6G. Methods: Atotal of 568 Iranian soldiers went under study for isolation and identification of Yeast species from their oral cavity. Asterile swab was used for each individual and specimens were collected from the nasopharynx region, then inoculated to petri dishes containing Sabouraud Dextrose Agar and incubated for 48 hrs at 37 °C. All colonies were counted and stocked in distilled water and stored in a refrigerator for further analysis. The yeasts were identified by the “disk diffusion test” [6,8]. This is a simple, rapid, accurate, and inexpensive technique presented by Sobczak [8]. By this method we identified yeast species within 24-48 hrs. Results: 51.4% of petri dishes were positive for yeast species and 318 strains were identified. Candida albicans, Candida kefyr, Candida tropicalis and Candida guilliermondii were the most common yeast species isolated from the oral cavity of soldiers. Conclusion: We used this method because of its simplicity and other beneficial characteristics for rapid identification of large and numerous isolates and the results were compared with other morphological characters such as chlamydospore and germ tube production. In addition,we used some type strains (Candida parapsilosis: PTCC 5089,Candida tropicalis: PTCC 5028,Saccharomyces cerevisiae:PTCC 5052,Candida lipolytica: PTCC 5063,Candida lipolytica:PTCC 5064,and the results were acceptable.

  6. Disk

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractIn disk storage, data is recorded on planar, round and rotating surfaces (disks, discs, or platters). A disk drive is a peripheral device of a computer system, connected by some communication medium to a disk controller. The disk controller is a chip, typically connected to the CPU of

  7. Comparison of Excretory-Secretory and Somatic Antigens of Ornithobilharzia turkestanicum in Agar Gel Diffusion Test

    Directory of Open Access Journals (Sweden)

    H Miranzadeh

    2008-12-01

    Full Text Available Background: Ornithobilharziosis as one of the parasitic infections may give rise to serious economic problems in animal husbandry. The Aim of the study was to prepare and compare the somatic and excretory-secretory (ES antigens of O. tur­kestanicum in gel diffusion test. Methods: Excretory-secretory (ES and somatic antigens of Ornithobilharzia turkestanicum were prepared from collected worms from mesentric blood vessels of infected sheep. The laboratory bred rabbits were immunized with antigens and then antisera were prepared. The reaction of antigens and antisera was observed in gel diffusion test. Results: ES antigens of this species showed positive reaction with antisera raised against ES and also somatic antigens. Somatic antigens also showed positive reaction with antisera raised against somatic and also ES antigens. Conclusion: The antigenicity of O. turkestanicum ES and somatic antigens is the same in gel diffusion test.

  8. RESIDENCE TIMES OF PARTICLES IN DIFFUSIVE PROTOPLANETARY DISK ENVIRONMENTS. I. VERTICAL MOTIONS

    International Nuclear Information System (INIS)

    Ciesla, F. J.

    2010-01-01

    The chemical and physical evolution of primitive materials in protoplanetary disks are determined by the types of environments they are exposed to and their residence times within each environment. Here, a method for calculating representative paths of materials in diffusive protoplanetary disks is developed and applied to understanding how the vertical trajectories that particles take impact their overall evolution. The methods are general enough to be applied to disks with uniform diffusivity, the so-called constant-α cases, and disks with a spatially varying diffusivity, such as expected in 'layered-disks'. The average long-term dynamical evolution of small particles and gaseous molecules is independent of the specific form of the diffusivity in that they spend comparable fractions of their lifetimes at different heights in the disk. However, the paths that individual particles and molecules take depend strongly on the form of the diffusivity leading to a different range of behavior of particles in terms of deviations from the mean. As temperatures, gas densities, chemical abundances, and photon fluxes will vary with height in protoplanetary disks, the different paths taken by primitive materials will lead to differences in their chemical and physical evolution. Examples of differences in gas phase chemistry and photochemistry are explored here. The methods outlined here provide a powerful tool that can be integrated with chemical models to understand the formation and evolution of primitive materials in protoplanetary disks on timescales of 10 5 -10 6 years.

  9. Comparing in vitro activity of tigecycline by using the disk diffusion test, the manual microdilution method, and the VITEK 2 automated system.

    Science.gov (United States)

    Leal Castro, A L; Buitrago Gutierrez, G; Ovalle, V; Cortes, J A; Alvarez, C A

    2010-01-01

    Tigecycline is a broad spectrum antibiotic having activity against multiresistant isolates. In vitro susceptibility testing is difficult to perform with the use of traditional microbiological techniques. The aim of this study was to evaluate the disk diffusion test with three different Mueller-Hinton agar brands, and the Vitek 2 automated system in comparison with the standard broth microdilution method against 200 gram-negative isolates (Escherichia coil, Klebsiella pneumoniae, Enterobacter cloacae, Serratia marcescens and Acinetobacter baumannii). Among Enterobacteriaceae, the Becton Dickinson agar had the lowest rate of minor (32.5%) and major errors (3.8%). No very major errors were found. For A. baumanni, the rate of minor and major errors was lower. A high rate of agreement (94%) was found between the broth microdilution method and the Vitek 2 system. Our results show that there are important differences between agars used for the disk diffusion test, and that Vitek 2 is a valid tool for susceptibility testing in clinical laboratories.

  10. Evaluation of an Automated System for Reading and Interpreting Disk Diffusion Antimicrobial Susceptibility Testing of Fastidious Bacteria.

    Science.gov (United States)

    Idelevich, Evgeny A; Becker, Karsten; Schmitz, Janne; Knaack, Dennis; Peters, Georg; Köck, Robin

    2016-01-01

    Results of disk diffusion antimicrobial susceptibility testing depend on individual visual reading of inhibition zone diameters. Therefore, automated reading using camera systems might represent a useful tool for standardization. In this study, the ADAGIO automated system (Bio-Rad) was evaluated for reading disk diffusion tests of fastidious bacteria. 144 clinical isolates (68 β-haemolytic streptococci, 28 Streptococcus pneumoniae, 18 viridans group streptococci, 13 Haemophilus influenzae, 7 Moraxella catarrhalis, and 10 Campylobacter jejuni) were tested on Mueller-Hinton agar supplemented with 5% defibrinated horse blood and 20 mg/L β-NAD (MH-F, Oxoid) according to EUCAST. Plates were read manually with a ruler and automatically using the ADAGIO system. Inhibition zone diameters, indicated by the automated system, were visually controlled and adjusted, if necessary. Among 1548 isolate-antibiotic combinations, comparison of automated vs. manual reading yielded categorical agreement (CA) without visual adjustment of the automatically determined zone diameters in 81.4%. In 20% (309 of 1548) of tests it was deemed necessary to adjust the automatically determined zone diameter after visual control. After adjustment, CA was 94.8%; very major errors (false susceptible interpretation), major errors (false resistant interpretation) and minor errors (false categorization involving intermediate result), calculated according to the ISO 20776-2 guideline, accounted to 13.7% (13 of 95 resistant results), 3.3% (47 of 1424 susceptible results) and 1.4% (21 of 1548 total results), respectively, compared to manual reading. The ADAGIO system allowed for automated reading of disk diffusion testing in fastidious bacteria and, after visual validation of the automated results, yielded good categorical agreement with manual reading.

  11. Synergy of β-Lactams with Vancomycin against Methicillin-Resistant Staphylococcus aureus: Correlation of Disk Diffusion and Checkerboard Methods.

    Science.gov (United States)

    Sy, Cheng Len; Huang, Tsi-Shu; Chen, Chii Shiang; Chen, Yao-Shen; Tsai, Hung-Chin; Wann, Shue-Renn; Wu, Kuan-Sheng; Chen, Jui-Kuang; Lee, Susan Shin-Jung; Liu, Yung-Ching

    2016-03-01

    Modified disk diffusion (MDD) and checkerboard tests were employed to assess the synergy of combinations of vancomycin and β-lactam antibiotics for 59 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and Mu50 (ATCC 700699). Bacterial inocula equivalent to 0.5 and 2.0 McFarland standard were inoculated on agar plates containing 0, 0.5, 1, and 2 μg/ml of vancomycin. Oxacillin-, cefazolin-, and cefoxitin-impregnated disks were applied to the surface, and the zones of inhibition were measured at 24 h. The CLSI-recommended checkerboard method was used as a reference to detect synergy. The MICs for vancomycin were determined using the Etest method, broth microdilution, and the Vitek 2 automated system. Synergy was observed with the checkerboard method in 51% to 60% of the isolates when vancomycin was combined with any β-lactam. The fractional inhibitory concentration indices were significantly lower in MRSA isolates with higher vancomycin MIC combinations (P synergy in MRSA isolates with bacterial inocula equivalent to McFarland standard 0.5 were 33.0% and 62.5% for oxacillin, 45.1% and 52.4% for cefazolin, and 43.1% and 52.4% for cefoxitin when combined with 0.5 and 2 μg/ml of vancomycin, respectively. Based on our study, the simple MDD method is not recommended as a replacement for the checkerboard method to detect synergy. However, it may serve as an initial screening method for the detection of potential synergy when it is not feasible to perform other labor-intensive synergy tests. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Antibiotic susceptibility of methicillin-resistant staphylococci (MRS) of food origin: A comparison of agar disc diffusion method and a commercially available miniaturized test.

    Science.gov (United States)

    Buzón-Durán, Laura; Capita, Rosa; Alonso-Calleja, Carlos

    2018-06-01

    Methicillin-resistant staphylococci (MRS) are a major concern to public and animal health. Thirty MRS (Staphylococcus aureus, S. cohnii, S. epidermidis, S. haemolyticus, S. hominis, S. lentus, S. lugdunensis, S. sciuri, and S. xylosus) isolates from meat and poultry preparations were tested for antimicrobial susceptibility to 11 antimicrobials (belonging to seven different categories) of clinical significance using both the standard agar disc diffusion method and a commercially available miniaturized system (Sensi Test Gram-positive). It is worth stressing that 16 isolates (53.33%) exhibited an extensively drug-resistant phenotype (XDR). The average number of resistances per strain was 4.67. These results suggest that retail meat and poultry preparations are a likely vehicle for the transmission of multi-drug resistant MRS. Resistance to erythromycin was the commonest finding (76.67% of strains), followed by tobramycin, ceftazidime (66.67%), ciprofloxacin (56.67%) and fosfomycin (53.33%). An agreement (kappa coefficient) of 0.64 was found between the two testing methods. Using the agar disc diffusion as the reference method, the sensitivity, specificity and accuracy of the miniaturized test were 98.44%, 69.44% and 83.33%, respectively. Most discrepancies between the two methods were due to isolates that were susceptible according to the disc diffusion method but resistant according to the miniaturized test (false positives). Copyright © 2017. Published by Elsevier Ltd.

  13. Diffusion-weighted magnetic resonance imaging of symptomatic nerve root of patients with lumbar disk herniation

    International Nuclear Information System (INIS)

    Eguchi, Yawara; Ohtori, Seiji; Yamashita, Masaomi; Yamauchi, Kazuyo; Suzuki, Munetaka; Orita, Sumihisa; Kamoda, Hiroto; Arai, Gen; Ishikawa, Tetsuhiro; Miyagi, Masayuki; Ochiai, Nobuyasu; Kishida, Shunji; Inoue, Gen; Takahashi, Kazuhisa; Masuda, Yoshitada; Ochi, Shigehiro; Kikawa, Takashi; Toyone, Tomoaki; Takaso, Masashi; Aoki, Yasuchika

    2011-01-01

    Diffusion-weighted imaging (DWI) can provide valuable structural information that may be useful for evaluating pathological changes of the lumbar nerve root. Diffusion-weighted magnetic resonance (MR) neurography has recently been introduced as an alternative way to visualize nerves, but to date, quantitative DWI and MR neurography have not been applied to evaluate the pathology of lumbar nerve roots. Our purpose was to visualize lumbar nerve roots and to analyze their morphology by MR neurography, and to measure the apparent diffusion coefficient (ADC) of lumbar nerve roots compressed by herniated disks using 1.5-T MR imaging. Ten consecutive patients (median age, 48.0 and range, 20-72 years) with monoradicular symptoms caused by a lumbar herniated disk and 14 healthy volunteers were studied. Regions of interests were placed on the lumbar roots at dorsal root ganglia (DRG) and distal spinal nerves on DWI to quantify mean ADC values. The spinal nerve roots were also visualized by MR neurography. In the patients, mean ADC values were significantly greater in the compressed DRG and distal spinal nerves than in intact nerves. MR neurography also showed abnormalities such as nerve swelling at and below the compression in the symptomatic nerve root. Increased ADC values were considered to be because of edema and Wallerian degeneration of compressed nerve roots. DWI is a potential tool for analysis of the pathophysiology of lumbar nerve roots compressed by herniated disks. (orig.)

  14. Diffusion-weighted magnetic resonance imaging of symptomatic nerve root of patients with lumbar disk herniation

    Energy Technology Data Exchange (ETDEWEB)

    Eguchi, Yawara; Ohtori, Seiji; Yamashita, Masaomi; Yamauchi, Kazuyo; Suzuki, Munetaka; Orita, Sumihisa; Kamoda, Hiroto; Arai, Gen; Ishikawa, Tetsuhiro; Miyagi, Masayuki; Ochiai, Nobuyasu; Kishida, Shunji; Inoue, Gen; Takahashi, Kazuhisa [Chiba University, Department of Orthopaedic Surgery, Graduate School of Medicine, Chiba (Japan); Masuda, Yoshitada; Ochi, Shigehiro; Kikawa, Takashi [Chiba University Hospital, Department of Radiology, Chiba (Japan); Toyone, Tomoaki [Teikyo University Chiba Medical Center, Department of Orthopaedic Surgery, Chiba (Japan); Takaso, Masashi [Kitasato University, Department of Orthopaedic Surgery, School of Medicine, Sagamihara City, Kanagawa (Japan); Aoki, Yasuchika [Chiba Rosai Hospital, Department of Orthopedic Surgery, Ichihara, Chiba (Japan)

    2011-09-15

    Diffusion-weighted imaging (DWI) can provide valuable structural information that may be useful for evaluating pathological changes of the lumbar nerve root. Diffusion-weighted magnetic resonance (MR) neurography has recently been introduced as an alternative way to visualize nerves, but to date, quantitative DWI and MR neurography have not been applied to evaluate the pathology of lumbar nerve roots. Our purpose was to visualize lumbar nerve roots and to analyze their morphology by MR neurography, and to measure the apparent diffusion coefficient (ADC) of lumbar nerve roots compressed by herniated disks using 1.5-T MR imaging. Ten consecutive patients (median age, 48.0 and range, 20-72 years) with monoradicular symptoms caused by a lumbar herniated disk and 14 healthy volunteers were studied. Regions of interests were placed on the lumbar roots at dorsal root ganglia (DRG) and distal spinal nerves on DWI to quantify mean ADC values. The spinal nerve roots were also visualized by MR neurography. In the patients, mean ADC values were significantly greater in the compressed DRG and distal spinal nerves than in intact nerves. MR neurography also showed abnormalities such as nerve swelling at and below the compression in the symptomatic nerve root. Increased ADC values were considered to be because of edema and Wallerian degeneration of compressed nerve roots. DWI is a potential tool for analysis of the pathophysiology of lumbar nerve roots compressed by herniated disks. (orig.)

  15. RESIDENCE TIMES OF PARTICLES IN DIFFUSIVE PROTOPLANETARY DISK ENVIRONMENTS. II. RADIAL MOTIONS AND APPLICATIONS TO DUST ANNEALING

    International Nuclear Information System (INIS)

    Ciesla, F. J.

    2011-01-01

    The origin of crystalline grains in comets and the outer regions of protoplanetary disks remains a mystery. It has been suggested that such grains form via annealing of amorphous precursors in the hot, inner region of a protoplanetary disk, where the temperatures needed for such transformations were found, and were then transported outward by some dynamical means. Here we develop a means of tracking the paths that dust grains would have taken through a diffusive protoplanetary disk and examine the types and ranges of environments that particles would have seen over a 10 6 yr time period in the dynamic disk. We then combine this model with three annealing laws to examine how the dynamic evolution of amorphous grains would have led to their physical restructuring and their delivery to various regions of the disk. It is found that 'sibling particles' - those particles that reside at the same location at a given period of time-take a wide range of unique and independent paths through the disk to arrive there. While high temperatures can persist in the disk for very long time periods, we find that those grains that are delivered to the cold outer regions of the disk are largely annealed in the first few x10 5 yr of disk history. This suggests that the crystallinity of grains in the outer disk would be determined early and remain unchanged for much of disk history, in agreement with recent astronomical observations.

  16. Evaluation of the PREVI® Isola automated seeder system compared to reference manual inoculation for antibiotic susceptibility testing by the disk diffusion method.

    Science.gov (United States)

    Le Page, S; van Belkum, A; Fulchiron, C; Huguet, R; Raoult, D; Rolain, J-M

    2015-09-01

    The disk diffusion (DD) method remains the most popular manual technique for antibiotic susceptibility testing (AST) in clinical microbiology laboratories. This is because of its simplicity, reproducibility, and limited cost compared to (automated) microdilution systems, which are usually less sensitive at detecting certain important mechanisms of resistance. Here, we evaluate the PREVI® Isola automated seeder system using a new protocol for spreading bacterial suspensions (eight deposits of calibrated inocula of bacteria, followed by two rounds of rotation) in comparison with manual DD reference testing on a large series of clinical and reference strains. The average time required for seeding one agar plate for DD with this new protocol was 51 s per plate, i.e., 70 agar plates/h. Reproducibility and repeatability was assessed on three reference and three randomly chosen clinical strains, as usually requested by the European Committee on Antimicrobial Susceptibility Testing (EUCAST), and was excellent compared to the manual method. The standard deviations of zones of growth inhibition showed no statistical discrimination. The correlation between the two methods, assessed using 294 clinical isolates and a panel of six antibiotics (n = 3,528 zones of growth inhibition measured), was excellent, with a correlation coefficient of 0.977. The new PREVI® Isola protocol adapted for DD had a sensitivity of 99 % and a specificity of 100 % compared to the manual technique for interpreting DD as recommended by the EUCAST.

  17. Comparison of different agar diffusion methods for the detection of residues in the kidneys of pigs treated with antimicrobial drugs.

    Science.gov (United States)

    Korkeala, H; Sorvettula, O; Mäki-Petäys, O; Hirn, J

    1983-01-01

    Residue analyses of the kidneys of twenty-six pigs treated with various antimicrobial drugs 20 h before slaughter and of eleven untreated pigs were performed. The effects of storage temperature of the kidneys, and of sampling location, on the residue analysis were also studied. No method alone was sufficient for the detection of residues. Oxytetracycline residues could be detected at pH 6, dihydrostreptomycin residues at pH 8, and sulphonamide residues if trimethoprim was present in the medium. Chloramphenicol, penicillin G procaine, tylosin and lincomycin residues were not detectable with the methods used. The concentration of ampicillin decreased during the storage of samples at +4°C. Most methods also yielded zones of inhibition for the frozen kidneys from untreated pigs. It seems necessary to use agar media of two different pH values: the addition of trimethoprim to the medium is also needed. The use of fresh pig kidneys, and samples containing both kidney medulla and kidney cortex, is recommended in residue analysis. Copyright © 1983. Published by Elsevier Ltd.

  18. Assessing the antimicrobial activity of zinc oxide thin films using disk diffusion and biofilm reactor

    International Nuclear Information System (INIS)

    Gittard, Shaun D.; Perfect, John R.; Monteiro-Riviere, Nancy A.; Wei Wei; Jin Chunming; Narayan, Roger J.

    2009-01-01

    The electronic and chemical properties of semiconductor materials may be useful in preventing growth of microorganisms. In this article, in vitro methods for assessing microbial growth on semiconductor materials will be presented. The structural and biological properties of silicon wafers coated with zinc oxide thin films were evaluated using atomic force microscopy, X-ray photoelectron spectroscopy, and MTT viability assay. The antimicrobial properties of zinc oxide thin films were established using disk diffusion and CDC Biofilm Reactor studies. Our results suggest that zinc oxide and other semiconductor materials may play a leading role in providing antimicrobial functionality to the next-generation medical devices

  19. Accretion Disk Reverberation with Hubble Space Telescope Observations of NGC 4593: Evidence for Diffuse Continuum Lags

    Science.gov (United States)

    Cackett, Edward M.; Chiang, Chia-Ying; McHardy, Ian; Edelson, Rick; Goad, Michael R.; Horne, Keith; Korista, Kirk T.

    2018-04-01

    The Seyfert 1 galaxy NGC 4593 was monitored spectroscopically with the Hubble Space Telescope as part of a reverberation mapping campaign that also included Swift, Kepler, and ground-based photometric monitoring. During 2016 July 12–August 6, we obtained 26 spectra across a nearly continuous wavelength range of ∼1150–10000 Å. These were combined with Swift data to produce a UV/optical “lag spectrum,” which shows the interband lag relative to the Swift UVW2 band as a function of wavelength. The broad shape of the lag spectrum appears to follow the τ ∝ λ 4/3 relation seen previously in photometric interband lag measurements of other active galactic nuclei (AGNs). This shape is consistent with the standard thin disk model, but the magnitude of the lags implies a disk that is a factor of ∼3 larger than predicted, again consistent with what has been previously seen in other AGNs. In all cases these large disk sizes, which are also implied by independent gravitational microlensing of higher-mass AGNs, cannot be simply reconciled with the standard model. However, the most striking feature in this higher-resolution lag spectrum is a clear excess around the 3646 Å Balmer jump. This strongly suggests that diffuse emission from gas in the much larger broad-line region (BLR) must also contribute significantly to the interband lags. While the relative contributions of the disk and BLR cannot be uniquely determined in these initial measurements, it is clear that both will need to be considered to comprehensively model and understand AGN lag spectra.

  20. Comparison of antimicrobial susceptibilities of Corynebacterium species by broth microdilution and disk diffusion methods.

    Science.gov (United States)

    Weiss, K; Laverdière, M; Rivest, R

    1996-01-01

    Corynebacterium species are increasingly being implicated in foreign-body infections and in immunocompromised-host infections. However, there are no specific recommendations on the method or the criteria to use in order to determine the in vitro activities of the antibiotics commonly used to treat Corynebacterium infections. The first aim of our study was to compare the susceptibilities of various species of Corynebacterium to vancomycin, erythromycin, and penicillin by using a broth microdilution method and a disk diffusion method. Second, the activity of penicillin against our isolates was assessed by using the interpretative criteria recommended by the National Committee for Clinical Laboratory Standards for the determination of the susceptibility of streptococci and Listeria monocytogenes to penicillin. Overall, 100% of the isolates were susceptible to vancomycin, while considerable variations in the activities of erythromycin and penicillin were noted for the different species tested, including the non-Corynebacterium jeikeium species. A good correlation in the susceptibilities of vancomycin and erythromycin between the disk diffusion and the microdilution methods was observed. However, a 5% rate of major or very major errors was detected with the Listeria criteria, while a high rate of minor errors (18%) was noted when the streptococcus criteria were used. Our findings indicate considerable variations in the activities of erythromycin and penicillin against the various species of Corynebacterium. Because of the absence of definite recommendations, important discrepancies were observed between the methods and the interpretations of the penicillin activity. PMID:8849254

  1. Limiting diffusion current at rotating disk electrode with dense particle layer.

    Science.gov (United States)

    Weroński, P; Nosek, M; Batys, P

    2013-09-28

    Exploiting the concept of diffusion permeability of multilayer gel membrane and porous multilayer we have derived a simple analytical equation for the limiting diffusion current at rotating disk electrode (RDE) covered by a thin layer with variable tortuosity and porosity, under the assumption of negligible convection in the porous film. The variation of limiting diffusion current with the porosity and tortuosity of the film can be described in terms of the equivalent thickness of stagnant solution layer, i.e., the average ratio of squared tortuosity to porosity. In case of monolayer of monodisperse spherical particles, the equivalent layer thickness is an algebraic function of the surface coverage. Thus, by means of cyclic voltammetry of RDE with a deposited particle monolayer we can determine the monolayer surface coverage. The effect of particle layer adsorbed on the surface of RDE increases non-linearly with surface coverage. We have tested our theoretical results experimentally by means of cyclic voltammetry measurements of limiting diffusion current at the glassy carbon RDE covered with a monolayer of 3 μm silica particles. The theoretical and experimental results are in a good agreement at the surface coverage higher than 0.7. This result suggests that convection in a monolayer of 3 μm monodisperse spherical particles is negligibly small, in the context of the coverage determination, in the range of very dense particle layers.

  2. Investigation of susceptibility of Staphylococcus species to some antibacterial drugs by disk diffusion and broth microdilution

    Directory of Open Access Journals (Sweden)

    Ašanin Jelena

    2012-01-01

    Full Text Available The objective of this work was to identify isolated Staphylococcus species and to investigate their sensitivity to some antibacterial drugs. The material used for these investigations were Staphylococcus isolates originating from milk samples. A total of 25 strains of Staphylococcus isolates were examined, including 24 from milk samples from cows with mastitis, and one strain was isolated from a milk sample from a cow following treatment for mastitis. For primary identification, catalase and oxidase tests were used, as well as the free coagulase test. Following the preliminary tests, the isolated strains were identified using commercial systems ID32 STAPH (bioMérieux, France and the BBL Crystal Gram-Positive ID Kit (Becton Dickinson, USA according to the enclosed instructions. The Staphylococcus isolates were examined for sensitivity to the following: oxacillin, penicillin, cefoxitin, gentamicin, erythromycin, chloramphenicol, tetracycline, ciprofloxacin, sulfametoxazol/trimetoprim, and vacomycin using the disk diffusion method and the broth microdilution method as recommended by the Clinical and Laboratory Strandards Institute - CLSI(2003, and the results were interpreted according to CLSI recommendations from 2008 and 2010. Antibiogram disks manufactured by Becton Dickinson (USA were used, and the broth microdilution method was applied using pure antibiotic substances from different manufacturers: erythromycin, chloramphenicol, cefoxitin, gentamicin, oxacillin, tetracycline (Sigma Aldrich, USA, sulfametoxazol (Fluka, USA, penicillin (Calbiochem, Germany, vancomycin (Abbott laboratories, USA, ciprofloxacin and trimetoprim (Zdravlje A.D., Serbia. All 25 strains were catalase positive and oxidase negative. Of the 25 strains, 19 were coagulase positive and 6 were coagulase negative.With the implementation of the disk diffusion method on 19 strains of S. aureus, 17 were established to be resistant to penicillin (89.5%, and 2 strains to gentamicin

  3. Direct rotating ring-disk measurement of the sodium borohydride diffusion coefficient in sodium hydroxide solutions

    Energy Technology Data Exchange (ETDEWEB)

    Chatenet, M. [Laboratoire d' Electrochimie et de Physico-chimie des Materiaux et des Interfaces, LEPMI, UMR 5631 CNRS/Grenoble-INP/UJF, 1130 rue de la piscine, BP75, 38402 Saint Martin d' Heres Cedex (France)], E-mail: Marian.Chatenet@phelma.grenoble-inp.fr; Molina-Concha, M.B. [Laboratoire d' Electrochimie et de Physico-chimie des Materiaux et des Interfaces, LEPMI, UMR 5631 CNRS/Grenoble-INP/UJF, 1130 rue de la piscine, BP75, 38402 Saint Martin d' Heres Cedex (France); El-Kissi, N. [Laboratoire de Rheologie, UMR 5520 CNRS/Grenoble-INP/UJF, 1301 rue de la piscine, 38041 Grenoble Cedex 9 (France); Parrour, G.; Diard, J.-P. [Laboratoire d' Electrochimie et de Physico-chimie des Materiaux et des Interfaces, LEPMI, UMR 5631 CNRS/Grenoble-INP/UJF, 1130 rue de la piscine, BP75, 38402 Saint Martin d' Heres Cedex (France)

    2009-07-15

    This paper presents the experimental determination of the diffusion coefficient of borohydride anion and solution kinematic viscosity for a large panel of NaOH + NaBH{sub 4} electrolytic solutions relevant for use as anolyte in Direct Borohydride Fuel Cells (DBFC). The diffusion coefficients have been measured by the transit-time technique on gold rotating ring-disk electrodes, and verified using other classical techniques reported in the literature, namely the Levich method and Electrochemical Impedance Spectroscopy on a gold RDE, or chronoamperometry at a gold microdisk. The agreement between these methods is generally good. The diffusion coefficients measured from the RRDE technique are however ca. twice larger than those previously reported in the literature (e.g. ca. 3 x 10{sup -5} cm{sup 2} s{sup -1} in 1 M NaOH + 0.01 M NaBH{sub 4} at 25 deg. C in the present study vs. ca. 1.6 x 10{sup -5} cm{sup 2} s{sup -1} in 1 M NaOH + 0.02 M NaBH{sub 4} at 30 deg. C in the literature, as measured by chronoamperometry at a gold microsphere), which is thoroughly discussed. Our measurements using chronoamperometry at a gold microdisk showed that such technique can yield diffusion coefficient values below what expected. The origin of such finding is explained in the frame of the formation of both a film of boron-oxide(s) at the surface of the (static) gold microdisk and the generation of H{sub 2} bubbles at the electrode surface (as a result of the heterogeneous hydrolysis at Au), which alter the access to the electrode surface and thus prevents efficient measurements. Such film formation and H{sub 2} bubbles generation is not so much of an issue for rotating electrodes thanks to the convection of electrolyte which sweeps the electrode surface. In addition, should such film be present, the transit-time determination technique on a RRDE displays the advantage of not being very sensible to its presence: the parameter measured is the time taken by a perturbation generated the

  4. Direct rotating ring-disk measurement of the sodium borohydride diffusion coefficient in sodium hydroxide solutions

    International Nuclear Information System (INIS)

    Chatenet, M.; Molina-Concha, M.B.; El-Kissi, N.; Parrour, G.; Diard, J.-P.

    2009-01-01

    This paper presents the experimental determination of the diffusion coefficient of borohydride anion and solution kinematic viscosity for a large panel of NaOH + NaBH 4 electrolytic solutions relevant for use as anolyte in Direct Borohydride Fuel Cells (DBFC). The diffusion coefficients have been measured by the transit-time technique on gold rotating ring-disk electrodes, and verified using other classical techniques reported in the literature, namely the Levich method and Electrochemical Impedance Spectroscopy on a gold RDE, or chronoamperometry at a gold microdisk. The agreement between these methods is generally good. The diffusion coefficients measured from the RRDE technique are however ca. twice larger than those previously reported in the literature (e.g. ca. 3 x 10 -5 cm 2 s -1 in 1 M NaOH + 0.01 M NaBH 4 at 25 deg. C in the present study vs. ca. 1.6 x 10 -5 cm 2 s -1 in 1 M NaOH + 0.02 M NaBH 4 at 30 deg. C in the literature, as measured by chronoamperometry at a gold microsphere), which is thoroughly discussed. Our measurements using chronoamperometry at a gold microdisk showed that such technique can yield diffusion coefficient values below what expected. The origin of such finding is explained in the frame of the formation of both a film of boron-oxide(s) at the surface of the (static) gold microdisk and the generation of H 2 bubbles at the electrode surface (as a result of the heterogeneous hydrolysis at Au), which alter the access to the electrode surface and thus prevents efficient measurements. Such film formation and H 2 bubbles generation is not so much of an issue for rotating electrodes thanks to the convection of electrolyte which sweeps the electrode surface. In addition, should such film be present, the transit-time determination technique on a RRDE displays the advantage of not being very sensible to its presence: the parameter measured is the time taken by a perturbation generated the disk to reach the ring trough a distance several orders

  5. Design of a system to measure thermal diffusivity of metals in the form of miniature disks

    International Nuclear Information System (INIS)

    Zimmerschied, M.K.

    1986-03-01

    This report describes the design of a system to measure the thermal diffusivity of stainless steel alloy specimens in the form of 3-mm-diameter, 0.3-mm-thick disks. To measure these tiny specimens, the flash method devised by Parker et al. is employed; in this method, one surface of the specimen is exposed to a pulse of energy and the temperature response of the opposite surface is recorded. Derivations of the governing equations are included; these derivations differ from the work of Parker et al. bcause the heat pulse irradiating the specimen in this system is a square wave (in intensity vs time) rather than triangular, and the equation for estimating the maximum temperature of the irradiated surface of the specimen was simplified by the elimination of several variables. The design, selection, or modification of each of the components of the system to meet the criteria of the flash method is described. The capability of this system to perform in accordance with the assumptions of the flash method is discussed, and recommendations for improvement of the present system and extension of its capabilities are included

  6. [Comparison of microdilution and disk diffusion methods for the detection of fluconazole and voriconazole susceptibility against clinical Candida glabrata isolates and determination of changing susceptibility with new CLSI breakpoints].

    Science.gov (United States)

    Hazırolan, Gülşen; Sarıbaş, Zeynep; Arıkan Akdağlı, Sevtap

    2016-07-01

    Candida albicans is the most frequently isolated species as the causative agent of Candida infections. However, in recent years, the isolation rate of non-albicans Candida species have increased. In many centers, Candida glabrata is one of the commonly isolated non-albicans species of C.glabrata infections which are difficult-to-treat due to decreased susceptibility to fluconazole and cross-resistance to other azoles. The aims of this study were to determine the in vitro susceptibility profiles of clinical C.glabrata isolates against fluconazole and voriconazole by microdilution and disk diffusion methods and to evaluate the results with both the previous (CLSI) and current species-specific CLSI (Clinical and Laboratory Standards Institute) clinical breakpoints. A total of 70 C.glabrata strains isolated from clinical samples were included in the study. The identification of the isolates was performed by morphologic examination on cornmeal Tween 80 agar and assimilation profiles obtained by using ID32C (BioMérieux, France). Broth microdilution and disk diffusion methods were performed according to CLSI M27-A3 and CLSI M44-A2 documents, respectively. The results were evaluated according to CLSI M27-A3 and M44-A2 documents and new vs. species-specific CLSI breakpoints. By using both previous and new CLSI breakpoints, broth microdilution test results showed that voriconazole has greater in vitro activity than fluconazole against C.glabrata isolates. For the two drugs tested, very major error was not observed with disk diffusion method when microdilution method was considered as the reference method. Since "susceptible" category no more exists for fluconazole vs. C.glabrata, the isolates that were interpreted as susceptible by previous breakpoints were evaluated as susceptible-dose dependent by current CLSI breakpoints. Since species-specific breakpoints remain yet undetermined for voriconazole, comparative analysis was not possible for this agent. The results obtained

  7. Quality Control Guidelines for Disk Diffusion and Broth Microdilution Antimicrobial Susceptibility Tests with Seven Drugs for Veterinary Applications

    Science.gov (United States)

    Odland, Brant A.; Erwin, Meredith E.; Jones, Ronald N.

    2000-01-01

    This multicenter study proposes antimicrobial susceptibility (MIC and disk diffusion methods) quality control (QC) parameters for seven compounds utilized in veterinary health. Alexomycin, apramycin, tiamulin, tilmicosin, and tylosin were tested by broth microdilution against various National Committee for Clinical Laboratory Standards (NCCLS)-recommended QC organisms (Staphylococcus aureus ATCC 29213, Enterococcus faecalis ATCC 29212, Streptococcus pneumoniae ATCC 49619, Escherichia coli ATCC 25922, and Pseudomonas aeruginosa ATCC 27853). In addition, disk diffusion zone diameter QC limits were determined for apramycin, enrofloxacin, and premafloxacin by using E. coli ATCC 25922, P. aeruginosa ATCC 27853, and S. aureus ATCC 25923. The results from five or six participating laboratories produced ≥99.0% of MICs and ≥95.0% of the zone diameters within suggested guidelines. The NCCLS Subcommittee for Veterinary Antimicrobial Susceptibility Testing has recently approved these ranges for publication in the next M31 document. PMID:10618141

  8. Thermal-diffusion and diffusion-thermo effects on MHD flow of viscous fluid between expanding or contracting rotating porous disks with viscous dissipation

    Directory of Open Access Journals (Sweden)

    S. Srinivas

    2016-01-01

    Full Text Available The present work investigates the effects of thermal-diffusion and diffusion-thermo on MHD flow of viscous fluid between expanding or contracting rotating porous disks with viscous dissipation. The partial differential equations governing the flow problem under consideration have been transformed by a similarity transformation into a system of coupled nonlinear ordinary differential equations. An analytical approach, namely the homotopy analysis method is employed in order to obtain the solutions of the ordinary differential equations. The effects of various emerging parameters on flow variables have been discussed numerically and explained graphically. Comparison of the HAM solutions with the numerical solutions is performed.

  9. Exact calculations of survival probability for diffusion on growing lines, disks, and spheres: The role of dimension.

    Science.gov (United States)

    Simpson, Matthew J; Baker, Ruth E

    2015-09-07

    Unlike standard applications of transport theory, the transport of molecules and cells during embryonic development often takes place within growing multidimensional tissues. In this work, we consider a model of diffusion on uniformly growing lines, disks, and spheres. An exact solution of the partial differential equation governing the diffusion of a population of individuals on the growing domain is derived. Using this solution, we study the survival probability, S(t). For the standard non-growing case with an absorbing boundary, we observe that S(t) decays to zero in the long time limit. In contrast, when the domain grows linearly or exponentially with time, we show that S(t) decays to a constant, positive value, indicating that a proportion of the diffusing substance remains on the growing domain indefinitely. Comparing S(t) for diffusion on lines, disks, and spheres indicates that there are minimal differences in S(t) in the limit of zero growth and minimal differences in S(t) in the limit of fast growth. In contrast, for intermediate growth rates, we observe modest differences in S(t) between different geometries. These differences can be quantified by evaluating the exact expressions derived and presented here.

  10. Use of the National Committee for Clinical Laboratory Standards Guidelines for Disk Diffusion Susceptibility Testing in New York State Laboratories

    Science.gov (United States)

    Kiehlbauch, Julia A.; Hannett, George E.; Salfinger, Max; Archinal, Wendy; Monserrat, Catherine; Carlyn, Cynthia

    2000-01-01

    Accurate antimicrobial susceptibility testing is vital for patient care and surveillance of emerging antimicrobial resistance. The National Committee for Clinical Laboratory Standards (NCCLS) outlines generally agreed upon guidelines for reliable and reproducible results. In January 1997 we surveyed 320 laboratories participating in the New York State Clinical Evaluation Program for General Bacteriology proficiency testing. Our survey addressed compliance with NCCLS susceptibility testing guidelines for bacterial species designated a problem (Staphylococcus aureus and Enterococcus species) or fastidious (Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria gonorrhoeae) organism. Specifically, we assessed compliance with guidelines for inoculum preparation, medium choice, number of disks per plate, and incubation conditions for disk diffusion tests. We also included length of incubation for S. aureus and Enterococcus species. We found overall compliance with the five characteristics listed above in 80 of 153 responding laboratories (50.6%) for S. aureus and 72 of 151 (47.7%) laboratories for Enterococcus species. The most common problem was an incubation time shortened to less than 24 h. Overall compliance with the first four characteristics was reported by 92 of 221 (41.6%) laboratories for S. pneumoniae, 49 of 163 (30.1%) laboratories for H. influenzae, and 11 of 77 (14.3%) laboratories for N. gonorrhoeae. Laboratories varied from NCCLS guidelines by placing an excess number of disks per plate. Laboratories also reported using alternative media for Enterococcus species, N. gonorrhoeae, and H. influenzae. This study demonstrates a need for education among clinical laboratories to increase compliance with NCCLS guidelines. PMID:10970381

  11. Enhancement of oxygen diffusion process on a rotating disk electrode for the electro-Fenton degradation of tetracycline

    International Nuclear Information System (INIS)

    Zhang, Yan; Gao, Ming-Ming; Wang, Xin-Hua; Wang, Shu-Guang; Liu, Rui-Ting

    2015-01-01

    An electro-Fenton process was developed for wastewater treatment in which hydrogen peroxide was generated in situ with a rotating graphite disk electrode as cathode. The maximum H 2 O 2 generation rate for the RDE reached 0.90 mg/L/h/cm 2 under the rotation speed of 400 rpm at pH 3, and −0.8 V vs SCE. The performance of this electro-Fenton reactor was assessed by tetracycline degradation in an aqueous solution. Experimental results showed the rotation of disk cathode resulted in the efficient production of H 2 O 2 without oxygen aeration, and excellent ability for degrading organic pollutants compared to the electro-Fenton system with fixed cathode. Tetracycline of 50 mg/L was degraded completely within 2 h with the addition of ferrous ion (1.0 mM). The chronoamperometry analysis was employed to investigate the oxygen diffusion on the rotating cathode. The results demonstrated that the diffusion coefficients of dissolved oxygen is 19.45 × 10 −5 cm 2 /s, which is greater than that reported in the literature. Further calculation indicated that oxygen is able to diffuse through the film on the rotating cathode within the contact time in each circle. This study proves that enhancement of oxygen diffusion on RDE is benefit for H 2 O 2 generation, thus provides a promising method for organic pollutants degradation by the combination of RDE with electro-Fenton reactor and offers a new insight on the oxygen transform process in this new system.

  12. Comparing in vitro activity of tigecycline by using the disk diffusion test, the manual microdilution method, and the VITEK 2 automated system Comparación de la actividad in vitro de la tigeciclina mediante la prueba de difusión con disco, el método de microdilución manual y el sistema automatizado Vitek 2

    Directory of Open Access Journals (Sweden)

    A. L. Leal Castro

    2010-09-01

    Full Text Available Tigecycline is a broad spectrum antibiotic having activity against multiresistant isolates. In vitro susceptibility testing is difficult to perform with the use of traditional microbiological techniques. The aim of this study was to evaluate the disk diffusion test with three different Mueller-Hinton agar brands, and the Vitek 2 automated system in comparison with the standard broth microdilution method against 200 gram-negative isolates (Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae, Serratia marcescens and Acinetobacter baumannii. Among Enterobacteriaceae, the Becton Dickinson agar had the lowest rate of minor (32.5% and major errors (3.8%. No very major errors were found. For A. baumanni, the rate of minor and major errors was lower. A high rate of agreement (94% was found between the broth microdilution method and the Vitek 2 system. Our results show that there are important differences between agars used for the disk diffusion test, and that Vitek 2 is a valid tool for susceptibility testing in clinical laboratories.La tigeciclina es un antibiótico de amplio espectro con actividad frente a bacterias multirresistentes. Existen dificultades en la determinación de la actividad in vitro a través de las técnicas microbiológicas convencionales. El objetivo del estudio fue evaluar tres marcas diferentes de medio agar Mueller-Hinton para utilizar en el método de difusión con disco y el método automatizado Vitek 2, y compararlos con la prueba tradicional de microdilución manual (Paneles Trek frente a 200 aislamientos de microorganismos gram negativos (Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae, Serratia marcescens y Acinetobacter baumannii. Para el grupo de las enterobacterias, el medio con mejor desempeño fue el producido por Becton Dickinson, que tuvo 32,5% de errores menores y 3,8% de errores mayores. No se presentaron errores mayores con ningún medio. Se encontró una alta concordancia (94% entre el

  13. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  14. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  15. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  16. The interstellar medium and star formation of galactic disks. I. Interstellar medium and giant molecular cloud properties with diffuse far-ultraviolet and cosmic-ray backgrounds

    Science.gov (United States)

    Li, Qi; Tan, Jonathan C.; Christie, Duncan; Bisbas, Thomas G.; Wu, Benjamin

    2018-01-01

    We present a series of adaptive mesh refinement hydrodynamic simulations of flat rotation curve galactic gas disks, with a detailed treatment of the interstellar medium (ISM) physics of the atomic to molecular phase transition under the influence of diffuse far-ultraviolet (FUV) radiation fields and cosmic-ray backgrounds. We explore the effects of different FUV intensities, including a model with a radial gradient designed to mimic the Milky Way. The effects of cosmic rays, including radial gradients in their heating and ionization rates, are also explored. The final simulations in this series achieve 4 pc resolution across the ˜20 kpc global disk diameter, with heating and cooling followed down to temperatures of ˜10 K. The disks are evolved for 300 Myr, which is enough time for the ISM to achieve a quasi-statistical equilibrium. In particular, the mass fraction of molecular gas is stabilized by ˜200 Myr. Additional global ISM properties are analyzed. Giant molecular clouds (GMCs) are also identified and the statistical properties of their populations are examined. GMCs are tracked as the disks evolve. GMC collisions, which may be a means of triggering star cluster formation, are counted and their rates are compared with analytic models. Relatively frequent GMC collision rates are seen in these simulations, and their implications for understanding GMC properties, including the driving of internal turbulence, are discussed.

  17. The interstellar medium and star formation of galactic disks. I. Interstellar medium and giant molecular cloud properties with diffuse far-ultraviolet and cosmic-ray backgrounds

    Science.gov (United States)

    Li, Qi; Tan, Jonathan C.; Christie, Duncan; Bisbas, Thomas G.; Wu, Benjamin

    2018-05-01

    We present a series of adaptive mesh refinement hydrodynamic simulations of flat rotation curve galactic gas disks, with a detailed treatment of the interstellar medium (ISM) physics of the atomic to molecular phase transition under the influence of diffuse far-ultraviolet (FUV) radiation fields and cosmic-ray backgrounds. We explore the effects of different FUV intensities, including a model with a radial gradient designed to mimic the Milky Way. The effects of cosmic rays, including radial gradients in their heating and ionization rates, are also explored. The final simulations in this series achieve 4 pc resolution across the ˜20 kpc global disk diameter, with heating and cooling followed down to temperatures of ˜10 K. The disks are evolved for 300 Myr, which is enough time for the ISM to achieve a quasi-statistical equilibrium. In particular, the mass fraction of molecular gas is stabilized by ˜200 Myr. Additional global ISM properties are analyzed. Giant molecular clouds (GMCs) are also identified and the statistical properties of their populations are examined. GMCs are tracked as the disks evolve. GMC collisions, which may be a means of triggering star cluster formation, are counted and their rates are compared with analytic models. Relatively frequent GMC collision rates are seen in these simulations, and their implications for understanding GMC properties, including the driving of internal turbulence, are discussed.

  18. Antimicrobial susceptibility testing of Clostridium difficile using EUCAST epidemiological cut-off values and disk diffusion correlates

    DEFF Research Database (Denmark)

    Erikstrup, L T; Hall, Vanessa Jane; Kahlmeter, G

    2012-01-01

    towards metronidazole, vancomycin and moxifloxacin on Brucella Blood Agar supplemented with hemin and vitamin K. We found an excellent agreement between inhibition zone diameter and MICs. For each MIC value, the inhibition zones varied from 0 to 8 mm, with 93% of values within 6 mm for metronidazole, 95...

  19. Evaluation of Brazilian medical devices using agar diffusion cytotoxicity assay Avaliação de dispositivos médicos brasileiros utilizando o ensaio de citotoxicidade pela difusão em ágar

    Directory of Open Access Journals (Sweden)

    Mirian N. P. Vidal

    2009-04-01

    Full Text Available Over the last decades, governmental actions and mechanisms created to protect consumer rights have been linked to a growing effort to guarantee the quality and reliability of products. Samples of condoms (latex, medical devices and blood bags (PVC - polyvinyl chloride have been tested using the agar diffusion assay. This assay evaluates the cytotoxicity induced by biomaterials by measuring the biological reactivity of mammalian cell cultures in contact with these materials. PVC is used in the production of medical devices because of its specific properties, such as flexibility, obtained after the addition of plasticizers (phthalates, which can cause toxicity even at low doses. Latex is a natural elastomer used for surgical gloves and condoms with a formulation that includes dispersion of liquid latex and chemicals, such as antioxidants and a vulcanizing accelerator, both of which are able to induce cytotoxicity. Samples were analyzed by the National Institute of Quality Control in Health - INCQS of the Oswaldo Cruz Foundation (Fiocruz in accordance with the governmental sanitary surveillance actions on respect to the quality control. We observed an increase in the quality of the products in relation to the results of the agar diffusion assay during the period between 2000 and 2007. This situation, together with other actions, reflects in an improvement in the quality of products that can be translated in the health of the population.Durante as últimas décadas, a disseminação de ações governamentais e os mecanismos criados para proteger os direitos dos consumidores se associaram em crescentes esforços para garantir a qualidade e confiabilidade dos produtos. As amostras de preservativos (látex, dispositivos médicos e bolsas de sangue (PVC - cloreto polivinílico foram testadas utilizando o ensaio de difusão em ágar. O teste avalia a citotoxicidade induzida por biomateriais, medindo a reatividade biológica de culturas de células de mam

  20. In vitro susceptibility of bovine mastitis pathogens to a combination of penicillin and framycetin: development of interpretive criteria for testing by broth microdilution and disk diffusion.

    Science.gov (United States)

    Pillar, C M; Stoneburner, A; Shinabarger, D L; Abbeloos, E; Goby, L; Bradley, Andrew J

    2014-10-01

    Dry cow therapy is an important part of mastitis control. This therapy typically consists of an antibiotic or antibiotics administered at a single dose by intramammary infusion at dry off to treat or prevent infection by prevalent mastitis pathogens. A combination dry cow therapy consisting of the active components penicillin and framycetin is currently used in several countries. Despite its use, standardized methods for the susceptibility testing of this combination against mastitis pathogens have not been established. In this study, which used Clinical and Laboratory Standards Institute methodology, preliminary interpretive criteria for the broth microdilution minimum inhibitory concentration (MIC) testing of mastitis pathogens to penicillin combined with framycetin (2:1 wt/wt) were established based on the amount of drug achieved and maintained postadministration in the udder. Based on resulting MIC distributions of recent veterinary field isolates and a subset of isolates preselected for resistance to β-lactams or aminoglycosides and concentrations achieved postadministration, criteria for broth microdilution testing of the combination (susceptible, intermediate, resistant in micrograms per milliliter) were set as follows: Escherichia coli ≤8/4, 16/8, ≥32/16; Staphylococcus spp. ≤2/1, 4/2-8/4, >16/8; Streptococcus uberis and Streptococcus dysgalactiae 4/2. A disk diffusion test using disks containing 100 μg of framycetin and 10 IU of penicillin was also developed, and preliminary interpretive criteria (susceptible, intermediate, resistant in millimeters) were set based on correlation to broth MIC values and the minimization of interpretive errors between isolates tested concurrently by broth microdilution and disk diffusion as follows: E. coli ≥18, 16-17, ≤15; Staphylococcus spp. ≥21, 18-20, ≤17; Strep. uberis and Strep. dysgalactiae ≥21, 19-20, ≤18. In addition, ranges for the quality control of the testing of this combination by both broth

  1. Marangoni convection in Casson liquid flow due to an infinite disk with exponential space dependent heat source and cross-diffusion effects

    Science.gov (United States)

    Mahanthesh, B.; Gireesha, B. J.; Shashikumar, N. S.; Hayat, T.; Alsaedi, A.

    2018-06-01

    Present work aims to investigate the features of the exponential space dependent heat source (ESHS) and cross-diffusion effects in Marangoni convective heat mass transfer flow due to an infinite disk. Flow analysis is comprised with magnetohydrodynamics (MHD). The effects of Joule heating, viscous dissipation and solar radiation are also utilized. The thermal and solute field on the disk surface varies in a quadratic manner. The ordinary differential equations have been obtained by utilizing Von Kármán transformations. The resulting problem under consideration is solved numerically via Runge-Kutta-Fehlberg based shooting scheme. The effects of involved pertinent flow parameters are explored by graphical illustrations. Results point out that the ESHS effect dominates thermal dependent heat source effect on thermal boundary layer growth. The concentration and temperature distributions and their associated layer thicknesses are enhanced by Marangoni effect.

  2. Friction and diffusion of a nano-colloidal disk in a two-dimensional solvent with a liquid-liquid transition.

    Science.gov (United States)

    Torres-Carbajal, Alexis; Castañeda-Priego, Ramón

    2018-03-07

    We report on the friction and diffusion of a single mobile nano-colloidal disk, whose size and mass are one and two orders of magnitude, respectively, greater than the molecules of the host solvent; all particles are restricted to move in a two-dimensional space. Using molecular dynamics simulations, the variation of the transport coefficients as a function of the thermodynamic state of the supporting fluid, in particular, around those states in the neighbourhood of the liquid-liquid phase coexistence, is investigated. The diffusion coefficient is determined through the fit of the mean-square displacement at long times and with the Green-Kubo relationship for the velocity autocorrelation function, whereas the friction coefficient is computed from the correlation of the fluctuating force. From the determination of the transport properties, the applicability of the Stokes-Einstein relation in two dimensions around the second critical point is discussed.

  3. Evaluation of CLSI M44-A2 Disk Diffusion and Associated Breakpoint Testing of Caspofungin and Micafungin Using a Well-Characterized Panel of Wild-Type and fks Hot Spot Mutant Candida Isolates▿

    Science.gov (United States)

    Arendrup, Maiken Cavling; Park, Steven; Brown, Steven; Pfaller, Michael; Perlin, David S.

    2011-01-01

    Disk diffusion testing has recently been standardized by the CLSI, and susceptibility breakpoints have been established for several antifungal compounds. For caspofungin, 5-μg disks are approved, and for micafungin, 10-μg disks are under evaluation. We evaluated the performances of caspofungin and micafungin disk testing using a panel of Candida isolates with and without known FKS echinocandin resistance mechanisms. Disk diffusion and microdilution assays were performed strictly according to CLSI documents M44-A2 and M27-A3. Eighty-nine clinical Candida isolates were included: Candida albicans (20 isolates/10 mutants), C. glabrata (19 isolates/10 mutants), C. dubliniensis (2 isolates/1 mutant), C. krusei (16 isolates/3 mutants), C. parapsilosis (14 isolates/0 mutants), and C. tropicalis (18 isolates/4 mutants). Quality control strains were C. parapsilosis ATCC 22019 and C. krusei ATCC 6258. The correlations between zone diameters and MIC results were good for both compounds, with identical susceptibility classifications for 93.3% of the isolates by applying the current CLSI breakpoints. However, the numbers of fks hot spot mutant isolates misclassified as being susceptible (S) (very major errors [VMEs]) were high (61% for caspofungin [S, ≥11 mm] and 93% for micafungin [S, ≥14 mm]). Changing the disk diffusion breakpoint to S at ≥22 mm significantly improved the discrimination. For caspofungin, 1 VME was detected (a C. tropicalis isolate with an F76S substitution) (3.5%), and for micafungin, 10 VMEs were detected, the majority of which were for C. glabrata (8/10). The broadest separation between zone diameter ranges for wild-type (WT) and mutant isolates was seen for caspofungin (6 to 12 mm versus −4 to 7 mm). In conclusion, caspofungin disk diffusion testing with a modified breakpoint led to excellent separation between WT and mutant isolates for all Candida species. PMID:21357293

  4. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  6. Comparison of Disk Diffusion and E-Test Methods for Doripenem Susceptibility of Nosocomial Acinetobacter Baumannii Strains

    Directory of Open Access Journals (Sweden)

    Yesim Cekin

    2014-03-01

    Full Text Available Aim: Acinetobacter species are amoung the most common two cause of infections isolated from patients of intensive care unit in our hospital. Doripenem which acts by inhibiting cell wall synthesis is resently introduced for use in our country is broad spectrum antibiotic belonging to carbapenems. There are many studies investigating the susceptibility of doripenem of Acinetobacter baumannii which is isolated as a cause of ventilatory associated pneumonia in the literature. We aimed to compare e-test and disc diffusion methods for doripenem susceptibility of acinetobacter baumannii strains as nosocomial infections Acinetobacter baumanni isolates detected as nosocomial infection. Material and Method:. Between January to December, 2009 a total of 94 Acinetobacter baumanni strains isolated from different clinical specimens from intensive care units have been studied for doripenem susceptibility by disc diffusion and E-test methods. Minimal inhibitory consantrations (MIC were accepted as; sensitive %u22641 %u03BCg/ml, intermadiate 2-4 %u03BCg/ml, resistant >4 %u03BCg/ml and diameters of inhibition zone with 10 µg disc; sensitive

  7. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  8. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  9. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  10. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  11. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  12. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  13. Application of Enrofloxacin and Orbifloxacin Disks Approved in Japan for Susceptibility Testing of Representative Veterinary Respiratory Pathogens

    Science.gov (United States)

    HARADA, Kazuki; USUI, Masaru; ASAI, Tetsuo

    2014-01-01

    ABSTRACT In this study, susceptibilities of Pasteurella multocida, Mannheimia haemolytica and Actinobacillus pleuropneumoniae to enrofloxacin and orbifloxacin were tested using an agar diffusion method with the commercial disks and a broth microdilution method. Good correlation between the 2 methods for enrofloxacin and orbifloxacin was observed for P. multocida (r = −0.743 and −0.818, respectively), M. haemolytica (r = −0.739 and −0.800, respectively) and A. pleuropneumoniae (r = −0.785 and −0.809, respectively). Based on the Clinical and Laboratory Standards Institute interpretive criteria for enrofloxacin, high-level categorical agreement between the 2 methods was found for P. multocida (97.9%), M. haemolytica (93.8%) and A. pleuropneumoniae (92.0%). Our findings indicate that the tested commercial disks can be applied for susceptibility testing of veterinary respiratory pathogens. PMID:25008965

  14. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  15. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  16. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  17. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  18. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  20. Grain surface chemistry in protoplanetary disks

    International Nuclear Information System (INIS)

    Reboussin, Laura

    2015-01-01

    Planetary formation occurs in the protoplanetary disks of gas and dust. Although dust represents only 1% of the total disk mass, it plays a fundamental role in disk chemical evolution since it acts as a catalyst for the formation of molecules. Understanding this chemistry is therefore essential to determine the initial conditions from which planets form. During my thesis, I studied grain-surface chemistry and its impact on the chemical evolution of molecular cloud, initial condition for disk formation, and protoplanetary disk. Thanks to numerical simulations, using the gas-grain code Nautilus, I showed the importance of diffusion reactions and gas-grain interactions for the abundances of gas-phase species. Model results combined with observations also showed the effects of the physical structure (in temperature, density, AV) on the molecular distribution in disks. (author)

  1. Método de difusión con discos para la determinación de sensibilidad a fluconazol en aislamientos de Candida spp Disk diffusion method for fluconazole susceptibility testing of Candida spp. isolates

    Directory of Open Access Journals (Sweden)

    L. Rodero

    2006-09-01

    Full Text Available Se estudiaron 1193 aislamientos clínicos para estandarizar y evaluar un método de difusión con discos de fluconazol de lectura visual, que permita detectar levaduras sensibles al antifúngico. Las especies analizadas fueron: Candida albicans (n=584, Candida parapsilosis (n=196, Candida tropicalis (n=200, Candida glabrata (n=113, Candida krusei (n=50, Candida spp. y otras levaduras oportunistas (n=50. Los discos fueron manufacturados en el INEI-ANLIS "Dr. Carlos G. Malbrán". Se midieron los halos de inhibición del crecimiento producidos por fluconazol y la concentración inhibitoria mínima (CIM por el método de referencia M27-A2 modificado por EUCAST. Se establecieron los valores de corte del método de difusión en: ≥16 mm para levaduras sensibles a fluconazol (CIM ≤ 8 µg/ml, entre 9 y 15 mm para sensibles dependientes de la dosis (CIM = 16-32 mg/ml y ≤ 8 mm para resistentes (CIM ≥ 64 µg/ml. El método de difusión tuvo 94,7% de concordancia con el de referencia, con 0,2% de errores very major y 0,3% de errores major. La reproducibilidad inter e intralaboratorio fue muy buena. Para detectar aislamientos sensibles a fluconazol, este método resulta confiable y de bajo costo; sin embargo, es conveniente que los aislamientos con halos ≤ 15 mm sean reevaluados por el método de referencia.In order to standardize and evaluate a disk diffusion method with visual reading to detect in vitro fluconazole susceptibility of yeast, 1193 clinical isolates were tested. These included 584 Candida albicans, 196 Candida parapsilosis, 200 Candida tropicalis, 113 Candida glabrata, 50 Candida krusei and 50 Candida spp. and other opportunistic yeasts. The disks were manufactured in the INEI-ANLIS "Dr. Carlos G. Malbrán". The disk diffusion method results were compared to MIC results obtained by the reference CLSI M27-A2 broth microdilution method modified by EUCAST. The interpretative breakpoints for in vitro susceptibility testing of fluconazole

  2. Avaliação da qualidade dos discos com antimicrobianos para testes de disco-difusão disponíveis comercialmente no Brasil Evaluation of the quality of the antimicrobial agents disks used in disk-diffusion tests comercially available in Brazil

    Directory of Open Access Journals (Sweden)

    Lilian M. Sejas

    2003-01-01

    the microbiology laboratory. Due to the great number of antimicrobial agents and the complexity of resistance mechanisms evolved, it has become very difficult to detect problems in these tests by simply evaluating the results obtained. Consequently, a quality control program must be performed continuously. Objective: The objective of the present study was to evaluate the quality of the antimicrobial susceptibility disks used in Brazil. Methods: Eighteen antimicrobial susceptibility disks manufactured from five commercial trade marks were evaluated. These antimicrobial disks were tested against four ATCCs and following the National Committee for Clinical Laboratory Standards (NCCLS procedures for disk-diffusion. Each test was repeated 20 times. Results: None of the trade marks presented a satisfactory performance for routine use in a microbiology laboratory. The best performance was presented by Cecon®, with 89,6% of overall agreement. Sensifar® disks showed a similar overall concordance of 90,8%. The trade mark with the least adequate performance was Pimenta Abreu®, with only 58,6% overall agreement. Conclusion: The results from this study indicate that the disks commercialized in Brazil are inappropriate to be used in clinical microbiology laboratories showing lack of quality control during the process of production and/or storage. They also show the importance of the implementation of both external and internal quality control programs.

  3. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  4. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  5. Co-trimoxazole susceptibility tests improved with separate trimethoprim and sulfamethoxazole disks.

    OpenAIRE

    Amyes, S G

    1981-01-01

    It is impossible to test accurately bacterial susceptibility to the trimethoprim-sulfamethoxazole combination co-trimoxazole with a single combined susceptibility disk. However, a variety of factors still affect the result even when separate trimethoprim and sulfamethoxazole disks are used. Experiments with separate disks showed that the optimum conditions for testing the susceptibilities of enterobacteria to these drugs were to flood-seed an agar plate with an inoculum of 10(4) to 10(5) orga...

  6. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  7. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  8. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  9. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  10. Oscillations of disks

    CERN Document Server

    Kato, Shoji

    2016-01-01

    This book presents the current state of research on disk oscillation theory, focusing on relativistic disks and tidally deformed disks. Since the launch of the Rossi X-ray Timing Explorer (RXTE) in 1996, many high-frequency quasiperiodic oscillations (HFQPOs) have been observed in X-ray binaries. Subsequently, similar quasi-periodic oscillations have been found in such relativistic objects as microquasars, ultra-luminous X-ray sources, and galactic nuclei. One of the most promising explanations of their origin is based on oscillations in relativistic disks, and a new field called discoseismology is currently developing. After reviewing observational aspects, the book presents the basic characteristics of disk oscillations, especially focusing on those in relativistic disks. Relativistic disks are essentially different from Newtonian disks in terms of several basic characteristics of their disk oscillations, including the radial distributions of epicyclic frequencies. In order to understand the basic processes...

  11. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  12. Disk Storage Server

    CERN Multimedia

    This model was a disk storage server used in the Data Centre up until 2012. Each tray contains a hard disk drive (see the 5TB hard disk drive on the main disk display section - this actually fits into one of the trays). There are 16 trays in all per server. There are hundreds of these servers mounted on racks in the Data Centre, as can be seen.

  13. Dust in Proto-Planetary Disks: Properties and Evolution

    OpenAIRE

    Natta, A.; Testi, L.; Calvet, N.; Henning, Th.; Waters, R.; Wilner, D.

    2006-01-01

    We review the properties of dust in protoplanetary disks around optically visible pre-main sequence stars obtained with a variety of observational techniques, from measurements of scattered light at visual and infrared wavelengths to mid-infrared spectroscopy and millimeter interferometry. A general result is that grains in disks are on average much larger than in the diffuse interstellar medium (ISM). In many disks, there is evidence that a large mass of dust is in grains with millimeter and...

  14. Understanding Floppy Disks.

    Science.gov (United States)

    Valentine, Pamela

    1980-01-01

    The author describes the floppy disk with an analogy to the phonograph record, and discusses the advantages, disadvantages, and capabilities of hard-sectored and soft-sectored floppy disks. She concludes that, at present, the floppy disk will continue to be the primary choice of personal computer manufacturers and their customers. (KC)

  15. Orbital Evolution of Moons in Weakly Accreting Circumplanetary Disks

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Yuri I.; Gressel, Oliver [Niels Bohr International Academy, The Niels Bohr Institute, Blegdamsvej 17, DK-2100, Copenhagen Ø (Denmark); Kobayashi, Hiroshi [Department of Physics, Nagoya University, Furo-cho, Showa-ku, Nagoya, Aichi, 464-8602 (Japan); Takahashi, Sanemichi Z., E-mail: yuri.fujii@nbi.ku.dk [Astronomical Institute, Tohoku University, 6-3 Aramaki, Aoba-ku, Sendai, 980-8578 (Japan)

    2017-04-01

    We investigate the formation of hot and massive circumplanetary disks (CPDs) and the orbital evolution of satellites formed in these disks. Because of the comparatively small size-scale of the sub-disk, quick magnetic diffusion prevents the magnetorotational instability (MRI) from being well developed at ionization levels that would allow MRI in the parent protoplanetary disk. In the absence of significant angular momentum transport, continuous mass supply from the parental protoplanetary disk leads to the formation of a massive CPD. We have developed an evolutionary model for this scenario and have estimated the orbital evolution of satellites within the disk. We find, in a certain temperature range, that inward migration of a satellite can be stopped by a change in the structure due to the opacity transitions. Moreover, by capturing second and third migrating satellites in mean motion resonances, a compact system in Laplace resonance can be formed in our disk models.

  16. Multicenter assessment of the linezolid spectrum and activity using the disk diffusion and Etest methods: report of the Zyvox® Antimicrobial Potency Study in Latin America (LA-ZAPS

    Directory of Open Access Journals (Sweden)

    Ballow Charles H.

    2002-01-01

    Full Text Available Linezolid was the first clinically applied member of the new antimicrobial class called the "oxazolidinones". These agents have a powerful spectrum of activity focussed against Gram-positive organisms including strains with documented resistances to other antimicrobial classes. We conducted a multicenter surveillance (Zyvox Antimicrobial Potency Study; ZAPS trial of qualifying Gram-positive isolates from 24 medical centers in eight countries in Latin America. The activity and spectrum of linezolid was compared to numerous agents including glycopeptides, quinupristin/dalfopristin, b-lactams and fluoroquinolones when testing 2,640 strains by the standardized disk diffusion method or Etest (AB BIODISK, Solna, Sweden. The linezolid spectrum was complete against staphylococci (median zone diameter, 29 - 32 mm, as was the spectrum of vancomycin and quinupristin/dalfopristin. Among the enterococci, no linezolid resistance was detected, and the susceptibility rate was 93.1 - 96.4%. Only the vancomycin-susceptible Enterococcus faecium strains remained susceptible (92.8% to quinupristin/dalfopristin. Marked differences in the glycopeptide resistance patterns (van A versus van B were noted for the 22 isolates of VRE, thus requiring local susceptibility testing to direct therapy. Streptococcus pneumoniae and other species were very susceptible (100.0% to linezolid, MIC90 at 0.75 mug/ml. Penicillin non-susceptible rate was 27.7% and erythromycin resistance was at 17.4%. Other streptococci were also completely susceptible to linezolid (MIC90, 1 mug/ml. These results provide the initial benchmark of potency and spectrum for linezolid in Latin American medical centers. Future comparisons should recognize that the oxazolidinones possess essentially a complete spectrum coverage of the monitored staphylococci, enterococci and streptococcal isolates in 2000-2001. This positions linezolid as the widest spectrum empiric choice against multi-resistant Gram

  17. Multicenter assessment of the linezolid spectrum and activity using the disk diffusion and Etest methods: report of the Zyvox® Antimicrobial Potency Study in Latin America (LA-ZAPS

    Directory of Open Access Journals (Sweden)

    Charles H. Ballow

    Full Text Available Linezolid was the first clinically applied member of the new antimicrobial class called the "oxazolidinones". These agents have a powerful spectrum of activity focussed against Gram-positive organisms including strains with documented resistances to other antimicrobial classes. We conducted a multicenter surveillance (Zyvox Antimicrobial Potency Study; ZAPS trial of qualifying Gram-positive isolates from 24 medical centers in eight countries in Latin America. The activity and spectrum of linezolid was compared to numerous agents including glycopeptides, quinupristin/dalfopristin, b-lactams and fluoroquinolones when testing 2,640 strains by the standardized disk diffusion method or Etest (AB BIODISK, Solna, Sweden. The linezolid spectrum was complete against staphylococci (median zone diameter, 29 - 32 mm, as was the spectrum of vancomycin and quinupristin/dalfopristin. Among the enterococci, no linezolid resistance was detected, and the susceptibility rate was 93.1 - 96.4%. Only the vancomycin-susceptible Enterococcus faecium strains remained susceptible (92.8% to quinupristin/dalfopristin. Marked differences in the glycopeptide resistance patterns (van A versus van B were noted for the 22 isolates of VRE, thus requiring local susceptibility testing to direct therapy. Streptococcus pneumoniae and other species were very susceptible (100.0% to linezolid, MIC90 at 0.75 mug/ml. Penicillin non-susceptible rate was 27.7% and erythromycin resistance was at 17.4%. Other streptococci were also completely susceptible to linezolid (MIC90, 1 mug/ml. These results provide the initial benchmark of potency and spectrum for linezolid in Latin American medical centers. Future comparisons should recognize that the oxazolidinones possess essentially a complete spectrum coverage of the monitored staphylococci, enterococci and streptococcal isolates in 2000-2001. This positions linezolid as the widest spectrum empiric choice against multi-resistant Gram

  18. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  19. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  20. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  1. HNC IN PROTOPLANETARY DISKS

    International Nuclear Information System (INIS)

    Graninger, Dawn; Öberg, Karin I.; Qi, Chunhua; Kastner, Joel

    2015-01-01

    The distributions and abundances of small organics in protoplanetary disks are potentially powerful probes of disk physics and chemistry. HNC is a common probe of dense interstellar regions and the target of this study. We use the Submillimeter Array (SMA) to observe HNC 3–2 toward the protoplanetary disks around the T Tauri star TW Hya and the Herbig Ae star HD 163296. HNC is detected toward both disks, constituting the first spatially resolved observations of HNC in disks. We also present SMA observations of HCN 3–2 and IRAM 30 m observations of HCN and HNC 1–0 toward HD 163296. The disk-averaged HNC/HCN emission ratio is 0.1–0.2 toward both disks. Toward TW Hya, the HNC emission is confined to a ring. The varying HNC abundance in the TW Hya disk demonstrates that HNC chemistry is strongly linked to the disk physical structure. In particular, the inner rim of the HNC ring can be explained by efficient destruction of HNC at elevated temperatures, similar to what is observed in the ISM. However, to realize the full potential of HNC as a disk tracer requires a combination of high SNR spatially resolved observations of HNC and HCN and disk-specific HNC chemical modeling

  2. HNC IN PROTOPLANETARY DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Graninger, Dawn; Öberg, Karin I.; Qi, Chunhua [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Kastner, Joel, E-mail: dgraninger@cfa.harvard.edu [Center for Imaging Science, School of Physics and Astronomy, and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States)

    2015-07-01

    The distributions and abundances of small organics in protoplanetary disks are potentially powerful probes of disk physics and chemistry. HNC is a common probe of dense interstellar regions and the target of this study. We use the Submillimeter Array (SMA) to observe HNC 3–2 toward the protoplanetary disks around the T Tauri star TW Hya and the Herbig Ae star HD 163296. HNC is detected toward both disks, constituting the first spatially resolved observations of HNC in disks. We also present SMA observations of HCN 3–2 and IRAM 30 m observations of HCN and HNC 1–0 toward HD 163296. The disk-averaged HNC/HCN emission ratio is 0.1–0.2 toward both disks. Toward TW Hya, the HNC emission is confined to a ring. The varying HNC abundance in the TW Hya disk demonstrates that HNC chemistry is strongly linked to the disk physical structure. In particular, the inner rim of the HNC ring can be explained by efficient destruction of HNC at elevated temperatures, similar to what is observed in the ISM. However, to realize the full potential of HNC as a disk tracer requires a combination of high SNR spatially resolved observations of HNC and HCN and disk-specific HNC chemical modeling.

  3. Exploring Disks Around Planets

    Science.gov (United States)

    Kohler, Susanna

    2017-07-01

    Giant planets are thought to form in circumstellar disks surrounding young stars, but material may also accrete into a smaller disk around the planet. Weve never detected one of these circumplanetary disks before but thanks to new simulations, we now have a better idea of what to look for.Image from previous work simulating a Jupiter-mass planet forming inside a circumstellar disk. The planet has its own circumplanetary disk of accreted material. [Frdric Masset]Elusive DisksIn the formation of giant planets, we think the final phase consists of accretion onto the planet from a disk that surrounds it. This circumplanetary disk is important to understand, since it both regulates the late gas accretion and forms the birthplace of future satellites of the planet.Weve yet to detect a circumplanetary disk thus far, because the resolution needed to spot one has been out of reach. Now, however, were entering an era where the disk and its kinematics may be observable with high-powered telescopes (like the Atacama Large Millimeter Array).To prepare for such observations, we need models that predict the basic characteristics of these disks like the mass, temperature, and kinematic properties. Now a researcher at the ETH Zrich Institute for Astronomy in Switzerland, Judit Szulgyi, has worked toward this goal.Simulating CoolingSzulgyi performs a series of 3D global radiative hydrodynamic simulations of 1, 3, 5, and 10 Jupiter-mass (MJ) giant planets and their surrounding circumplanetary disks, embedded within the larger circumstellar disk around the central star.Density (left column), temperature (center), and normalized angular momentum (right) for a 1 MJ planet over temperatures cooling from 10,000 K (top) to 1,000 K (bottom). At high temperatures, a spherical circumplanetary envelope surrounds the planet, but as the planet cools, the envelope transitions around 64,000 K to a flattened disk. [Szulgyi 2017]This work explores the effects of different planet temperatures and

  4. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  5. Stability of a chemically active floating disk

    Science.gov (United States)

    Vandadi, Vahid; Jafari Kang, Saeed; Rothstein, Jonathan; Masoud, Hassan

    2017-11-01

    We theoretically study the translational stability of a chemically active disk located at a flat liquid-gas interface. The initially immobile circular disk uniformly releases an interface-active agent that locally changes the surface tension and is insoluble in the bulk. If left unperturbed, the stationary disk remains motionless as the agent is discharged. Neglecting the inertial effects, we numerically test whether a perturbation in the translational velocity of the disk can lead to its spontaneous and self-sustained motion. Such a perturbation gives rise to an asymmetric distribution of the released factor that could trigger and sustain the Marangoni propulsion of the disk. An implicit Fourier-Chebyshev spectral method is employed to solve the advection-diffusion equation for the concentration of the active agent. The solution, given a linear equation of state for the surface tension, provides the shear stress distribution at the interface. This and the no-slip condition on the wetted surface of the disk are then used at each time step to semi-analytically determine the Stokes flow in the semi-infinite liquid layer. Overall, the findings of our investigation pave the way for pinpointing the conditions under which interface-bound active particles become dynamically unstable.

  6. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  7. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  8. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  9. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  10. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  11. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  12. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  13. Magnetohydrodynamics of accretion disks

    International Nuclear Information System (INIS)

    Torkelsson, U.

    1994-04-01

    The thesis consists of an introduction and summary, and five research papers. The introduction and summary provides the background in accretion disk physics and magnetohydrodynamics. The research papers describe numerical studies of magnetohydrodynamical processes in accretion disks. Paper 1 is a one-dimensional study of the effect of magnetic buoyancy on a flux tube in an accretion disk. The stabilizing influence of an accretion disk corona on the flux tube is demonstrated. Paper 2-4 present numerical simulations of mean-field dynamos in accretion disks. Paper 11 verifies the correctness of the numerical code by comparing linear models to previous work by other groups. The results are also extended to somewhat modified disk models. A transition from an oscillatory mode of negative parity for thick disks to a steady mode of even parity for thin disks is found. Preliminary results for nonlinear dynamos at very high dynamo numbers are also presented. Paper 3 describes the bifurcation behaviour of the nonlinear dynamos. For positive dynamo numbers it is found that the initial steady solution is replaced by an oscillatory solution of odd parity. For negative dynamo numbers the solution becomes chaotic at sufficiently high dynamo numbers. Paper 4 continues the studies of nonlinear dynamos, and it is demonstrated that a chaotic solution appears even for positive dynamo numbers, but that it returns to a steady solution of mixed parity at very high dynamo numbers. Paper 5 describes a first attempt at simulating the small-scale turbulence of an accretion disk in three dimensions. There is only find cases of decaying turbulence, but this is rather due to limitations of the simulations than that turbulence is really absent in accretion disks

  14. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  15. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  16. Global Simulations of the Inner Regions of Protoplanetary Disks with Comprehensive Disk Microphysics

    Science.gov (United States)

    Bai, Xue-Ning

    2017-08-01

    The gas dynamics of weakly ionized protoplanetary disks (PPDs) are largely governed by the coupling between gas and magnetic fields, described by three non-ideal magnetohydrodynamical (MHD) effects (Ohmic, Hall, ambipolar). Previous local simulations incorporating these processes have revealed that the inner regions of PPDs are largely laminar and accompanied by wind-driven accretion. We conduct 2D axisymmetric, fully global MHD simulations of these regions (˜1-20 au), taking into account all non-ideal MHD effects, with tabulated diffusion coefficients and approximate treatment of external ionization and heating. With the net vertical field aligned with disk rotation, the Hall-shear instability strongly amplifies horizontal magnetic field, making the overall dynamics dependent on initial field configuration. Following disk formation, the disk likely relaxes into an inner zone characterized by asymmetric field configuration across the midplane, which smoothly transitions to a more symmetric outer zone. Angular momentum transport is driven by both MHD winds and laminar Maxwell stress, with both accretion and decretion flows present at different heights, and modestly asymmetric winds from the two disk sides. With anti-aligned field polarity, weakly magnetized disks settle into an asymmetric field configuration with supersonic accretion flow concentrated at one side of the disk surface, and highly asymmetric winds between the two disk sides. In all cases, the wind is magneto-thermal in nature, characterized by a mass loss rate exceeding the accretion rate. More strongly magnetized disks give more symmetric field configuration and flow structures. Deeper far-UV penetration leads to stronger and less stable outflows. Implications for observations and planet formation are also discussed.

  17. Global Simulations of the Inner Regions of Protoplanetary Disks with Comprehensive Disk Microphysics

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Xue-Ning, E-mail: xbai@cfa.harvard.edu [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden St., MS-51, Cambridge, MA 02138 (United States)

    2017-08-10

    The gas dynamics of weakly ionized protoplanetary disks (PPDs) are largely governed by the coupling between gas and magnetic fields, described by three non-ideal magnetohydrodynamical (MHD) effects (Ohmic, Hall, ambipolar). Previous local simulations incorporating these processes have revealed that the inner regions of PPDs are largely laminar and accompanied by wind-driven accretion. We conduct 2D axisymmetric, fully global MHD simulations of these regions (∼1–20 au), taking into account all non-ideal MHD effects, with tabulated diffusion coefficients and approximate treatment of external ionization and heating. With the net vertical field aligned with disk rotation, the Hall-shear instability strongly amplifies horizontal magnetic field, making the overall dynamics dependent on initial field configuration. Following disk formation, the disk likely relaxes into an inner zone characterized by asymmetric field configuration across the midplane, which smoothly transitions to a more symmetric outer zone. Angular momentum transport is driven by both MHD winds and laminar Maxwell stress, with both accretion and decretion flows present at different heights, and modestly asymmetric winds from the two disk sides. With anti-aligned field polarity, weakly magnetized disks settle into an asymmetric field configuration with supersonic accretion flow concentrated at one side of the disk surface, and highly asymmetric winds between the two disk sides. In all cases, the wind is magneto-thermal in nature, characterized by a mass loss rate exceeding the accretion rate. More strongly magnetized disks give more symmetric field configuration and flow structures. Deeper far-UV penetration leads to stronger and less stable outflows. Implications for observations and planet formation are also discussed.

  18. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  19. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  20. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  1. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  2. PLANETESIMAL AND PROTOPLANET DYNAMICS IN A TURBULENT PROTOPLANETARY DISK: IDEAL UNSTRATIFIED DISKS

    International Nuclear Information System (INIS)

    Yang, Chao-Chin; Mac Low, Mordecai-Mark; Menou, Kristen

    2009-01-01

    The dynamics of planetesimals and planetary cores may be strongly influenced by density perturbations driven by magneto-rotational turbulence in their natal protoplanetary gas disks. Using the local shearing box approximation, we perform numerical simulations of planetesimals moving as massless particles in a turbulent, magnetized, unstratified gas disk. Our fiducial disk model shows turbulent accretion characterized by a Shakura-Sunyaev viscosity parameter of α ∼ 10 -2 , with rms density perturbations of ∼10%. We measure the statistical evolution of particle orbital properties in our simulations including mean radius, eccentricity, and velocity dispersion. We confirm random walk growth in time of all three properties, the first time that this has been done with direct orbital integration in a local model. We find that the growth rate increases with the box size used at least up to boxes of eight scale heights in horizontal size. However, even our largest boxes show velocity dispersions sufficiently low that collisional destruction of planetesimals should be unimportant in the inner disk throughout its lifetime. Our direct integrations agree with earlier torque measurements showing that type I migration dominates over diffusive migration by stochastic torques for most objects in the planetary core and terrestrial planet mass range. Diffusive migration remains important for objects in the mass range of kilometer-sized planetesimals. Discrepancies in the derived magnitude of turbulence between local and global simulations of magneto-rotationally unstable disks remains an open issue, with important consequences for planet formation scenarios.

  3. LUNAR ACCRETION FROM A ROCHE-INTERIOR FLUID DISK

    Energy Technology Data Exchange (ETDEWEB)

    Salmon, Julien; Canup, Robin M., E-mail: julien@boulder.swri.edu, E-mail: robin@boulder.swri.edu [Department of Space Studies, Southwest Research Institute, 1050 Walnut Street, Suite 300, Boulder, CO 80302 (United States)

    2012-11-20

    We use a hybrid numerical approach to simulate the formation of the Moon from an impact-generated disk, consisting of a fluid model for the disk inside the Roche limit and an N-body code to describe accretion outside the Roche limit. As the inner disk spreads due to a thermally regulated viscosity, material is delivered across the Roche limit and accretes into moonlets that are added to the N-body simulation. Contrary to an accretion timescale of a few months obtained with prior pure N-body codes, here the final stage of the Moon's growth is controlled by the slow spreading of the inner disk, resulting in a total lunar accretion timescale of {approx}10{sup 2} years. It has been proposed that the inner disk may compositionally equilibrate with the Earth through diffusive mixing, which offers a potential explanation for the identical oxygen isotope compositions of the Earth and Moon. However, the mass fraction of the final Moon that is derived from the inner disk is limited by resonant torques between the disk and exterior growing moons. For initial disks containing <2.5 lunar masses (M{sub Last-Quarter-Moon }), we find that a final Moon with mass > 0.8 M{sub Last-Quarter-Moon} contains {<=}60% material derived from the inner disk, with this material preferentially delivered to the Moon at the end of its accretion.

  4. Disk Defect Data

    Data.gov (United States)

    National Aeronautics and Space Administration — How Data Was Acquired: The data presented is from a physical simulator that simulated engine disks. Sample Rates and Parameter Description: All parameters are...

  5. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  6. Verbatim Floppy Disk

    CERN Multimedia

    1976-01-01

    Introduced under the name "Verbatim", Latin for "literally", these disks that sized more than 5¼ inches have become almost universal on dedicated word processing systems and personal computers. This format was replaced more slowly by the 3½-inch format, introduced for the first time in 1982. Compared to today, these large format disks stored very little data. In reality, they could only contain a few pages of text.

  7. Mass distributions in disk galaxies

    NARCIS (Netherlands)

    Martinsson, Thomas; Verheijen, Marc; Bershady, Matthew; Westfall, Kyle; Andersen, David; Swaters, Rob

    We present results on luminous and dark matter mass distributions in disk galaxies from the DiskMass Survey. As expected for normal disk galaxies, stars dominate the baryonic mass budget in the inner region of the disk; however, at about four optical scale lengths (hR ) the atomic gas starts to

  8. Dusty disks around young stars

    NARCIS (Netherlands)

    Verhoeff, A.

    2009-01-01

    Stars are formed through the collapse of giant molecular clouds. During this contraction the matter spins up and naturally forms a circumstellar disk. Once accretion comes to a halt, these disks are relatively stable. Some disks are known to last up to 10 Myrs. Most disks however, dissipate on

  9. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  10. 2TB hard disk drive

    CERN Multimedia

    This particular object was used up until 2012 in the Data Centre. It slots into one of the Disk Server trays. Hard disks were invented in the 1950s. They started as large disks up to 20 inches in diameter holding just a few megabytes (link is external). They were originally called "fixed disks" or "Winchesters" (a code name used for a popular IBM product). They later became known as "hard disks" to distinguish them from "floppy disks (link is external)." Hard disks have a hard platter that holds the magnetic medium, as opposed to the flexible plastic film found in tapes and floppies.

  11. Molecular Diffusion Coefficients: Experimental Determination and Demonstration.

    Science.gov (United States)

    Fate, Gwendolyn; Lynn, David G.

    1990-01-01

    Presented are laboratory methods which allow the demonstration and determination of the diffusion coefficients of compounds ranging in size from water to small proteins. Included are the procedures involving the use of a spectrometer, UV cell, triterated agar, and oxygen diffusion. Results including quantification are described. (CW)

  12. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  13. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  14. Debris Disks: Probing Planet Formation

    OpenAIRE

    Wyatt, Mark C.

    2018-01-01

    Debris disks are the dust disks found around ~20% of nearby main sequence stars in far-IR surveys. They can be considered as descendants of protoplanetary disks or components of planetary systems, providing valuable information on circumstellar disk evolution and the outcome of planet formation. The debris disk population can be explained by the steady collisional erosion of planetesimal belts; population models constrain where (10-100au) and in what quantity (>1Mearth) planetesimals (>10km i...

  15. Fast, Capacious Disk Memory Device

    Science.gov (United States)

    Muller, Ronald M.

    1990-01-01

    Device for recording digital data on, and playing back data from, memory disks has high recording or playback rate and utilizes available recording area more fully. Two disks, each with own reading/writing head, used to record data at same time. Head on disk A operates on one of tracks numbered from outside in; head on disk B operates on track of same number in sequence from inside out. Underlying concept of device applicable to magnetic or optical disks.

  16. Source to Accretion Disk Tilt

    OpenAIRE

    Montgomery, M. M.; Martin, E. L.

    2010-01-01

    Many different system types retrogradely precess, and retrograde precession could be from a tidal torque by the secondary on a misaligned accretion disk. However, a source to cause and maintain disk tilt is unknown. In this work, we show that accretion disks can tilt due to a force called lift. Lift results from differing gas stream supersonic speeds over and under an accretion disk. Because lift acts at the disk's center of pressure, a torque is applied around a rotation axis passing through...

  17. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  18. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  19. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  20. ACCRETION DISKS WITH A LARGE SCALE MAGNETIC FIELD AROUND BLACK HOLES

    Directory of Open Access Journals (Sweden)

    Gennady Bisnovatyi-Kogan

    2013-12-01

    Full Text Available We consider accretion disks around black holes at high luminosity, and the problem of the formation of a large-scale magnetic field in such disks, taking into account the non-uniform vertical structure of the disk. The structure of advective accretion disks is investigated, and conditions for the formation of optically thin regions in central parts of the accretion disk are found. The high electrical conductivity of the outer layers of the disk prevents outward diffusion of the magnetic field. This implies a stationary state with a strong magnetic field in the inner parts of the accretion disk close to the black hole, and zero radial velocity at the surface of the disk. The problem of jet collimation by magneto-torsion oscillations is investigated.

  1. PLANETESIMAL DISK MICROLENSING

    International Nuclear Information System (INIS)

    Heng, Kevin; Keeton, Charles R.

    2009-01-01

    Motivated by debris disk studies, we investigate the gravitational microlensing of background starlight by a planetesimal disk around a foreground star. We use dynamical survival models to construct a plausible example of a planetesimal disk and study its microlensing properties using established ideas of microlensing by small bodies. When a solar-type source star passes behind a planetesimal disk, the microlensing light curve may exhibit short-term, low-amplitude residuals caused by planetesimals several orders of magnitude below Earth mass. The minimum planetesimal mass probed depends on the photometric sensitivity and the size of the source star, and is lower when the planetesimal lens is located closer to us. Planetesimal lenses may be found more nearby than stellar lenses because the steepness of the planetesimal mass distribution changes how the microlensing signal depends on the lens/source distance ratio. Microlensing searches for planetesimals require essentially continuous monitoring programs that are already feasible and can potentially set constraints on models of debris disks, the progeny of the supposed extrasolar analogues of Kuiper Belts.

  2. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  3. Premixed direct injection disk

    Science.gov (United States)

    York, William David; Ziminsky, Willy Steve; Johnson, Thomas Edward; Lacy, Benjamin; Zuo, Baifang; Uhm, Jong Ho

    2013-04-23

    A fuel/air mixing disk for use in a fuel/air mixing combustor assembly is provided. The disk includes a first face, a second face, and at least one fuel plenum disposed therebetween. A plurality of fuel/air mixing tubes extend through the pre-mixing disk, each mixing tube including an outer tube wall extending axially along a tube axis and in fluid communication with the at least one fuel plenum. At least a portion of the plurality of fuel/air mixing tubes further includes at least one fuel injection hole have a fuel injection hole diameter extending through said outer tube wall, the fuel injection hole having an injection angle relative to the tube axis. The invention provides good fuel air mixing with low combustion generated NOx and low flow pressure loss translating to a high gas turbine efficiency, that is durable, and resistant to flame holding and flash back.

  4. Herniated lumbar intervertebral disk

    International Nuclear Information System (INIS)

    Hochhauser, L.; Cacayorin, E.D.; Karcnik, T.J.; McGowan, D.P.; Clark, K.G.; Storrs, D.; Kieffer, S.A.

    1988-01-01

    From a series of 25 patients with low-back pain and sciatica who subsequently underwent surgical exploration, 24 lumbar herniated disks and one asymmetrically bulging disk were correctly diagnosed with use of a 0.5-T MR imaging unit. The radiologic findings on saggital images included a polypoid protrusion beyond the posterior margin of the vertebral bodies more clearly displayed with T1-weighted than with T-2 weighted sequences and a focal extension into the extradural space on axial views. In most, the signal intensity of HNP was isointense to the disk of origin. The study suggests that MR imaging is currently capable of accurately predicting an HNP. The diagnosis is based primarily on morphologic characteristics rather than signal intensity alterations

  5. Relativistic, accreting disks

    International Nuclear Information System (INIS)

    Abramowicz, M.A; Jaroszynski, M.; Sikora, M.

    1978-01-01

    An analytic theory of the hydrodynamical structure of accreting disks (without self-gravitation but with pressure) orbiting around and axially symmetric, stationary, compact body (e.g. black hole) is presented. The inner edge of the marginally stable accreting disk (i.e. disk with constant angular momentum density) has a sharp cusp located on the equatorial plane between rsub(ms) and rsub(mb). The existence of the cusp is also typical for any angular momentum distribution. The physical importance of the cusp follows from the close analogy with the case of a close binary system (L 1 Lagrange point on the Roche lobe). The existence of the cusp is thus a crucial phenomenon in such problems as boundary condition for the viscous stresses, accretion rate etc. (orig.) [de

  6. Relativistic, accreting disks

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, M A; Jaroszynski, M; Sikora, M [Polska Akademia Nauk, Warsaw

    1978-02-01

    An analytic theory of the hydrodynamical structure of accreting disks (without self-gravitation but with pressure) orbiting around an axially symmetric, stationary, compact body (e.g. black hole) is presented. The inner edge of the marginally stable accreting disk (i.e. disk with constant angular momentum density) has a sharp cusp located on the equatorial plane between r/sub ms/ and r/sub mb/. The existence of the cusp is also typical for any angular momentum distribution. The physical importance of the cusp follows from the close analogy with the case of a close binary system (L/sub 1/ Lagrange point on the Roche lobe). The existence of the cusp is thus a crucial phenomenon in such problems as boundary condition for the viscous stresses, accretion rate, etc.

  7. Chemistry in protoplanetary disks

    Science.gov (United States)

    Semenov, D. A.

    2012-01-01

    In this lecture I discuss recent progress in the understanding of the chemical evolution of protoplanetary disks that resemble our Solar system during the first ten million years. At the verge of planet formation, strong variations of temperature, density, and radiation intensities in these disks lead to a layered chemical structure. In hot, dilute and heavily irradiated atmosphere only simple radicals, atoms, and atomic ions can survive, formed and destroyed by gas-phase processes. Beneath the atmosphere a partly UV-shielded, warm molecular layer is located, where high-energy radiation drives rich chemistry, both in the gas phase and on dust surfaces. In a cold, dense, dark disk midplane many molecules are frozen out, forming thick icy mantles where surface chemistry is active and where complex (organic) species are synthesized.

  8. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  9. Circumstellar and circumplanetary disks

    Science.gov (United States)

    Chiang, Eugene

    2000-11-01

    This thesis studies disks in three astrophysical contexts: (1)protoplanetary disks; (2)the Edgeworth-Kuiper Belt; and (3)planetary rings. We derive hydrostatic, radiative equilibrium models of passive protoplanetary disks surrounding T Tauri and Herbig Ae/Be stars. Each disk is encased by an optically thin layer of superheated dust grains. This layer is responsible for up to ~70% of the disk luminosity at wavelengths between ~5 and 60 μm. The heated disk flares and absorbs more stellar radiation at a given stellocentric distance than a flat disk would. Spectral energy distributions are computed and found to compare favorably with the observed flattish infrared excesses of several young stellar objects. Spectral features from dust grains in the superheated layer appear in emission if the disk is viewed nearly face-on. We present the results of a pencil-beam survey of the Kuiper Belt using the Keck 10-m telescope. Two new objects are discovered. Data from all surveys are pooled to construct the luminosity function from mR = 20 to 27. The cumulative number of objects per square degree, Σ(surface area but the largest bodies contain most of the mass. To order-of-magnitude, 0.2 M⊕ and 1 × 1010 comet progenitors lie between 30 and 50 AU. The classical Kuiper Belt appears truncated at a distance of 50 AU. We propose that rigid precession of narrow eccentric planetary rings surrounding Uranus and Saturn is maintained by a balance of forces due to ring self- gravity, planetary oblateness, and interparticle collisions. Collisional impulses play an especially dramatic role near ring edges. Pressure-induced accelerations are maximal near edges because there (1)velocity dispersions are enhanced by resonant satellite perturbations, and (2)the surface density declines steeply. Remarkably, collisional forces felt by material in the last ~100 m of a ~10 km wide ring can increase equilibrium masses up to a factor of ~100. New ring surface densities are derived which accord with

  10. Computing Temperatures in Optically Thick Protoplanetary Disks

    Science.gov (United States)

    Capuder, Lawrence F.. Jr.

    2011-01-01

    We worked with a Monte Carlo radiative transfer code to simulate the transfer of energy through protoplanetary disks, where planet formation occurs. The code tracks photons from the star into the disk, through scattering, absorption and re-emission, until they escape to infinity. High optical depths in the disk interior dominate the computation time because it takes the photon packet many interactions to get out of the region. High optical depths also receive few photons and therefore do not have well-estimated temperatures. We applied a modified random walk (MRW) approximation for treating high optical depths and to speed up the Monte Carlo calculations. The MRW is implemented by calculating the average number of interactions the photon packet will undergo in diffusing within a single cell of the spatial grid and then updating the packet position, packet frequencies, and local radiation absorption rate appropriately. The MRW approximation was then tested for accuracy and speed compared to the original code. We determined that MRW provides accurate answers to Monte Carlo Radiative transfer simulations. The speed gained from using MRW is shown to be proportional to the disk mass.

  11. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  12. PLANETESIMAL AND PROTOPLANET DYNAMICS IN A TURBULENT PROTOPLANETARY DISK: IDEAL STRATIFIED DISKS

    International Nuclear Information System (INIS)

    Yang, Chao-Chin; Mac Low, Mordecai-Mark; Menou, Kristen

    2012-01-01

    Due to the gravitational influence of density fluctuations driven by magneto-rotational instability in the gas disk, planetesimals and protoplanets undergo diffusive radial migration as well as changes in other orbital properties. The magnitude of the effect on particle orbits can have important consequences for planet formation scenarios. We use the local-shearing-box approximation to simulate an ideal, isothermal, magnetized gas disk with vertical density stratification and simultaneously evolve numerous massless particles moving under the gravitational field of the gas and the host star. We measure the evolution of the particle orbital properties, including mean radius, eccentricity, inclination, and velocity dispersion, and its dependence on the disk properties and the particle initial conditions. Although the results converge with resolution for fixed box dimensions, we find the response of the particles to the gravity of the turbulent gas correlates with the horizontal box size, up to 16 disk scale heights. This correlation indicates that caution should be exercised when interpreting local-shearing-box models involving gravitational physics of magneto-rotational turbulence. Based on heuristic arguments, nevertheless, the criterion L h /R ∼ O(1), where L h is the horizontal box size and R is the distance to the host star, is proposed to possibly circumvent this conundrum. If this criterion holds, we can still conclude that magneto-rotational turbulence seems likely to be ineffective at driving either diffusive migration or collisional erosion under most circumstances.

  13. Modeling Protoplanetary Disks

    Science.gov (United States)

    Holman, Megan; Tubbs, Drake; Keller, L. D.

    2018-01-01

    Using spectra models with known parameters and comparing them to spectra gathered from real systems is often the only ways to find out what is going on in those real systems. This project uses the modeling programs of RADMC-3D to generate model spectra for systems containing protoplanetary disks. The parameters can be changed to simulate protoplanetary disks in different stages of planet formation, with different sized gaps in different areas of the disks, as well as protoplanetary disks that contain different types of dust. We are working on producing a grid of models that all have different variations in the parameters in order to generate a miniature database to use for comparisons to gathered spectra. The spectra produced from these simulations will be compared to spectra that have been gathered from systems in the Small Magellanic cloud in order to find out the contents and stage of development of that system. This allows us to see if and how planets are forming in the Small Magellanic cloud, a region which has much less metallicity than our own galaxy. The data we gather from comparisons between the model spectra and the spectra of systems in the Small Magellanic Cloud can then be applied to how planets may have formed in the early universe.

  14. The Disk Mass Project

    NARCIS (Netherlands)

    Verheijen, Marc A. W.; Bershady, Matthew A.; Swaters, Rob A.; Andersen, David R.; Westfall, Kyle B.; de Jong, Roelof Sybe

    2007-01-01

    Little is known about the content and distribution of dark matter in spiral galaxies. To break the degeneracy in galaxy rotation curve decompositions, which allows a wide range of dark matter halo density profiles, an independent measure of the mass surface density of stellar disks is needed. Here,

  15. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  17. DISK FORMATION IN MAGNETIZED CLOUDS ENABLED BY THE HALL EFFECT

    International Nuclear Information System (INIS)

    Krasnopolsky, Ruben; Shang, Hsien; Li Zhiyun

    2011-01-01

    Stars form in dense cores of molecular clouds that are observed to be significantly magnetized. A dynamically important magnetic field presents a significant obstacle to the formation of protostellar disks. Recent studies have shown that magnetic braking is strong enough to suppress the formation of rotationally supported disks in the ideal MHD limit. Whether non-ideal MHD effects can enable disk formation remains unsettled. We carry out a first study on how disk formation in magnetic clouds is modified by the Hall effect, the least explored of the three non-ideal MHD effects in star formation (the other two being ambipolar diffusion and Ohmic dissipation). For illustrative purposes, we consider a simplified problem of a non-self-gravitating, magnetized envelope collapsing onto a central protostar of fixed mass. We find that the Hall effect can spin up the inner part of the collapsing flow to Keplerian speed, producing a rotationally supported disk. The disk is generated through a Hall-induced magnetic torque. Disk formation occurs even when the envelope is initially non-rotating, provided that the Hall coefficient is large enough. When the magnetic field orientation is flipped, the direction of disk rotation is reversed as well. The implication is that the Hall effect can in principle produce both regularly rotating and counter-rotating disks around protostars. The Hall coefficient expected in dense cores is about one order of magnitude smaller than that needed for efficient spin-up in these models. We conclude that the Hall effect is an important factor to consider in studying the angular momentum evolution of magnetized star formation in general and disk formation in particular.

  18. Identifying Likely Disk-hosting M dwarfs with Disk Detective

    Science.gov (United States)

    Silverberg, Steven; Wisniewski, John; Kuchner, Marc J.; Disk Detective Collaboration

    2018-01-01

    M dwarfs are critical targets for exoplanet searches. Debris disks often provide key information as to the formation and evolution of planetary systems around higher-mass stars, alongside the planet themselves. However, less than 300 M dwarf debris disks are known, despite M dwarfs making up 70% of the local neighborhood. The Disk Detective citizen science project has identified over 6000 new potential disk host stars from the AllWISE catalog over the past three years. Here, we present preliminary results of our search for new disk-hosting M dwarfs in the survey. Based on near-infrared color cuts and fitting stellar models to photometry, we have identified over 500 potential new M dwarf disk hosts, nearly doubling the known number of such systems. In this talk, we present our methodology, and outline our ongoing work to confirm systems as M dwarf disks.

  19. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  20. ALMA Survey of Lupus Protoplanetary Disks. II. Gas Disk Radii

    Science.gov (United States)

    Ansdell, M.; Williams, J. P.; Trapman, L.; van Terwisga, S. E.; Facchini, S.; Manara, C. F.; van der Marel, N.; Miotello, A.; Tazzari, M.; Hogerheijde, M.; Guidi, G.; Testi, L.; van Dishoeck, E. F.

    2018-05-01

    We present Atacama Large Millimeter/Sub-Millimeter Array (ALMA) Band 6 observations of a complete sample of protoplanetary disks in the young (∼1–3 Myr) Lupus star-forming region, covering the 1.33 mm continuum and the 12CO, 13CO, and C18O J = 2–1 lines. The spatial resolution is ∼0.″25 with a medium 3σ continuum sensitivity of 0.30 mJy, corresponding to M dust ∼ 0.2 M ⊕. We apply Keplerian masking to enhance the signal-to-noise ratios of our 12CO zero-moment maps, enabling measurements of gas disk radii for 22 Lupus disks; we find that gas disks are universally larger than millimeter dust disks by a factor of two on average, likely due to a combination of the optically thick gas emission and the growth and inward drift of the dust. Using the gas disk radii, we calculate the dimensionless viscosity parameter, α visc, finding a broad distribution and no correlations with other disk or stellar parameters, suggesting that viscous processes have not yet established quasi-steady states in Lupus disks. By combining our 1.33 mm continuum fluxes with our previous 890 μm continuum observations, we also calculate the millimeter spectral index, α mm, for 70 Lupus disks; we find an anticorrelation between α mm and millimeter flux for low-mass disks (M dust ≲ 5), followed by a flattening as disks approach α mm ≈ 2, which could indicate faster grain growth in higher-mass disks, but may also reflect their larger optically thick components. In sum, this work demonstrates the continuous stream of new insights into disk evolution and planet formation that can be gleaned from unbiased ALMA disk surveys.

  1. Self-gravity in Magnetized Neutrino-dominated Accretion Disks

    Energy Technology Data Exchange (ETDEWEB)

    Shahamat, Narjes; Abbassi, Shahram, E-mail: abbassi@um.ac.ir [Department of Physics, School of Science, Ferdowsi University of Mashhad, Mashhad, P.O. Box 91775-1436 (Iran, Islamic Republic of)

    2017-08-10

    In the present work we study self-gravity effects on the vertical structure of a magnetized neutrino-dominated accretion disk as a central engine for gamma-ray bursts (GRBs). Some of the disk physical timescales that are supposed to play a pivotal role in the late-time evolutions of the disk, such as viscous, cooling, and diffusion timescales, have been studied. We are interested in investigating the possibility of the occurrence of X-ray flares, observed in late-time GRBs’ extended emission through the “magnetic barrier” and “fragmentation” processes in our model. The results lead us to interpret self-gravity as an amplifier for Blandford–Payne luminosity (BP power) and the generated magnetic field, but a suppressor for neutrino luminosity and magnetic barrier processes via highlighting the fragmentation mechanism in the outer disk, especially for the higher mass accretion rates.

  2. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  3. Brown dwarf disks with ALMA

    Energy Technology Data Exchange (ETDEWEB)

    Ricci, L.; Isella, A. [Department of Astronomy, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Testi, L.; De Gregorio-Monsalvo, I. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Natta, A. [INAF-Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125 Firenze (Italy); Scholz, A., E-mail: lricci@astro.caltech.edu [School of Cosmic Physics, Dublin Institute for Advanced Studies, 31 Fitzwilliam Place, Dublin 2 (Ireland)

    2014-08-10

    We present Atacama Large Millimeter/submillimeter Array continuum and spectral line data at 0.89 mm and 3.2 mm for three disks surrounding young brown dwarfs and very low mass stars in the Taurus star forming region. Dust thermal emission is detected and spatially resolved for all the three disks, while CO(J = 3-2) emission is seen in two disks. We analyze the continuum visibilities and constrain the disks' physical structure in dust. The results of our analysis show that the disks are relatively large; the smallest one has an outer radius of about 70 AU. The inferred disk radii, radial profiles of the dust surface density, and disk to central object mass ratios lie within the ranges found for disks around more massive young stars. We derive from our observations the wavelength dependence of the millimeter dust opacity. In all the three disks, data are consistent with the presence of grains with at least millimeter sizes, as also found for disks around young stars, and confirm that the early stages of the solid growth toward planetesimals occur also around very low-mass objects. We discuss the implications of our findings on models of solids evolution in protoplanetary disks, the main mechanisms proposed for the formation of brown dwarfs and very low-mass stars, as well as the potential of finding rocky and giant planets around very low-mass objects.

  4. Interpretive criteria of antimicrobial disk susceptibility tests with flomoxef.

    Science.gov (United States)

    Grimm, H

    1991-01-01

    320 recently isolated pathogens, 20 strains from each of 16 species, were investigated using Mueller-Hinton agar and DIN as well as NCCLS standards. The geometric mean of the agar dilution MICs of flomoxef were 0.44 mg/l for Staphylococcus aureus, 0.05 mg/l (Klebsiella oxytoca) to 12.6 mg/l (Enterobacter spp.) for enterobacteriaceae, 33.1 mg/l for Acinetobacter anitratus, 64 mg/l for Enterococcus faecalis, and more than 256 mg/l for Pseudomonas aeruginosa. For disk susceptibility testing of flomoxef a 30 micrograms disk loading and the following interpretation of inhibition zones using the DIN method were recommended: resistant-up to 22 mm (corresponding to MICs of 8 mg/l or more), moderately susceptible-23 to 29 mm (corresponding to MICs from 1 to 4 mg/l), and susceptible-30 mm or more (corresponding to MICs of 0.5 mg/l or less). The respective values for the NCCLS method using the American high MIC breakpoints are: resistant--up to 14 mm (corresponding to MICs of 32 mg/l or more), moderately susceptible--15 to 17 mm (corresponding to MICs of 16 mg/l), and susceptible--18 mm or more (corresponding to MICs of 8 mg/l or less).

  5. Vibration of imperfect rotating disk

    Directory of Open Access Journals (Sweden)

    Půst L.

    2011-12-01

    Full Text Available This study is concerned with the theoretical and numerical calculations of the flexural vibrations of a bladed disk. The main focus of this study is to elaborate the basic background for diagnostic and identification methods for ascertaining the main properties of the real structure or an experimental model of turbine disks. The reduction of undesirable vibrations of blades is proposed by using damping heads, which on the experimental model of turbine disk are applied only on a limited number of blades. This partial setting of damping heads introduces imperfection in mass, stiffness and damping distribution on the periphery and leads to more complicated dynamic properties than those of a perfect disk. Calculation of FEM model and analytic—numerical solution of disk behaviour in the limited (two modes frequency range shows the splitting of resonance with an increasing speed of disk rotation. The spectrum of resonance is twice denser than that of a perfect disk.

  6. Evolution of magnetic disk subsystems

    Science.gov (United States)

    Kaneko, Satoru

    1994-06-01

    The higher recording density of magnetic disk realized today has brought larger storage capacity per unit and smaller form factors. If the required access performance per MB is constant, the performance of large subsystems has to be several times better. This article describes mainly the technology for improving the performance of the magnetic disk subsystems and the prospects of their future evolution. Also considered are 'crosscall pathing' which makes the data transfer channel more effective, 'disk cache' which improves performance coupling with solid state memory technology, and 'RAID' which improves the availability and integrity of disk subsystems by organizing multiple disk drives in a subsystem. As a result, it is concluded that since the performance of the subsystem is dominated by that of the disk cache, maximation of the performance of the disk cache subsystems is very important.

  7. HIGH-TEMPERATURE IONIZATION IN PROTOPLANETARY DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Desch, Steven J. [School of Earth and Space Exploration, Arizona State University, P.O. Box 871404, Tempe, AZ 85287-1404 (United States); Turner, Neal J. [Jet Propulsion Laboratory, Mail Stop 169-506, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States)

    2015-10-01

    We calculate the abundances of electrons and ions in the hot (≳500 K), dusty parts of protoplanetary disks, treating for the first time the effects of thermionic and ion emission from the dust grains. High-temperature ionization modeling has involved simply assuming that alkali elements such as potassium occur as gas-phase atoms and are collisionally ionized following the Saha equation. We show that the Saha equation often does not hold, because free charges are produced by thermionic and ion emission and destroyed when they stick to grain surfaces. This means the ionization state depends not on the first ionization potential of the alkali atoms, but rather on the grains’ work functions. The charged species’ abundances typically rise abruptly above about 800 K, with little qualitative dependence on the work function, gas density, or dust-to-gas mass ratio. Applying our results, we find that protoplanetary disks’ dead zone, where high diffusivities stifle magnetorotational turbulence, has its inner edge located where the temperature exceeds a threshold value ≈1000 K. The threshold is set by ambipolar diffusion except at the highest densities, where it is set by Ohmic resistivity. We find that the disk gas can be diffusively loaded onto the stellar magnetosphere at temperatures below a similar threshold. We investigate whether the “short-circuit” instability of current sheets can operate in disks and find that it cannot, or works only in a narrow range of conditions; it appears not to be the chondrule formation mechanism. We also suggest that thermionic emission is important for determining the rate of Ohmic heating in hot Jupiters.

  8. HIGH-TEMPERATURE IONIZATION IN PROTOPLANETARY DISKS

    International Nuclear Information System (INIS)

    Desch, Steven J.; Turner, Neal J.

    2015-01-01

    We calculate the abundances of electrons and ions in the hot (≳500 K), dusty parts of protoplanetary disks, treating for the first time the effects of thermionic and ion emission from the dust grains. High-temperature ionization modeling has involved simply assuming that alkali elements such as potassium occur as gas-phase atoms and are collisionally ionized following the Saha equation. We show that the Saha equation often does not hold, because free charges are produced by thermionic and ion emission and destroyed when they stick to grain surfaces. This means the ionization state depends not on the first ionization potential of the alkali atoms, but rather on the grains’ work functions. The charged species’ abundances typically rise abruptly above about 800 K, with little qualitative dependence on the work function, gas density, or dust-to-gas mass ratio. Applying our results, we find that protoplanetary disks’ dead zone, where high diffusivities stifle magnetorotational turbulence, has its inner edge located where the temperature exceeds a threshold value ≈1000 K. The threshold is set by ambipolar diffusion except at the highest densities, where it is set by Ohmic resistivity. We find that the disk gas can be diffusively loaded onto the stellar magnetosphere at temperatures below a similar threshold. We investigate whether the “short-circuit” instability of current sheets can operate in disks and find that it cannot, or works only in a narrow range of conditions; it appears not to be the chondrule formation mechanism. We also suggest that thermionic emission is important for determining the rate of Ohmic heating in hot Jupiters

  9. Herniated disk disease

    International Nuclear Information System (INIS)

    Ross, J.S.; Masaryk, T.J.; Modic, M.T.; Bohlman, H.; Wilber, G.; Carter, J.

    1988-01-01

    Thirty patients with symptoms of disk herniation and no previous surgery were examined with Gd-DTPA-enhanced MR imaging. Studies obtained before and after administration of Gd-DTPA included the following sequences: sagittal and axial spin echo (SE) 500/17 (repetition time, msec/echo time, msec), sagittal SE 2,000/60, sagittal FLASH 200/13/60. Studies were interpreted separately for presence of extradural disease (EDD) characterized by morphology, mass effect, and enhancement. Post Gd-DTPA diagnoses were: normal, n = 1; herniation, n = 28; neoplasm, n = 1. Tissue diagnosis was obtained in 13. The Gd-DTPA examination correctly changed the diagnosis in one case, provided increased confidence in the diagnosis in four, and was equivalent to the precontrast study in eight. Increased conspicuity of EDD with Gd-DTPA was related to the enhancement of epidural space analogous to IV CT and enhancement of scar surrounding disk herniation. Histologically, this scar was identical to that seen in postoperative spines, Gd-DTPA appears to be a useful adjunct in cervical and thoracic degenerative disk disease

  10. Transport coefficients for dense hard-disk systems

    NARCIS (Netherlands)

    García-Rojo, R.; Luding, S.; Brey, J.J.

    2006-01-01

    A study of the transport coefficients of a system of elastic hard disks based on the use of Helfand-Einstein expressions is reported. The self-diffusion, the viscosity, and the heat conductivity are examined with averaging techniques especially appropriate for event-driven molecular dynamics

  11. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  12. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  13. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  14. Non-immunological precipitation by the neutral detergent triton X-100 in agar gel diffusion.

    OpenAIRE

    Mansheim, B J; Stenstrom, M L

    1980-01-01

    Triton X-100 can be used to clarify vague immunoprecipitin lines from bacterial antigens; however, non-immunological precipitation can lead to mistaken interpretation of immunodiffusion results. If Triton X-100 is added directly to the gel during preparation rather than to the antigen well, this detergent artifact can be eliminated.

  15. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  16. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  17. Josephson current in ballistic graphene Corbino disk

    Science.gov (United States)

    Abdollahipour, Babak; Mohammadkhani, Ramin; Khalilzadeh, Mina

    2018-06-01

    We solve Dirac-Bogoliubov-De-Gennes (DBdG) equation in a superconductor-normal graphene-superconductor (SGS) junction with Corbino disk structure to investigate the Josephson current through this junction. We find that the critical current Ic has a nonzero value at Dirac point in which the concentration of the carriers is zero. We show this nonzero critical current depends on the system geometry and it decreases monotonically to zero by decreasing the ratio of the inner to outer radii of the Corbino disk (R1 /R2), while in the limit of R1 /R2 → 1 it scales like a diffusive Corbino disk. The product of the critical current and the normal-state resistance IcRN increases by increasing R1 /R2 and attains the same value for the wide and short rectangular structure at the limit of R1 /R2 → 1 at zero doping. These results reveals the pseudodiffusive behavior of the graphene Corbino Josephson junction similar to the rectangular structure at the zero doping.

  18. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  19. STEADY STATE DUST DISTRIBUTIONS IN DISK VORTICES: OBSERVATIONAL PREDICTIONS AND APPLICATIONS TO TRANSITIONAL DISKS

    International Nuclear Information System (INIS)

    Lyra, Wladimir; Lin, Min-Kai

    2013-01-01

    The Atacama Large Millimeter Array has returned images of transitional disks in which large asymmetries are seen in the distribution of millimeter sized dust in the outer disk. The explanation in vogue borrows from the vortex literature and suggests that these asymmetries are the result of dust trapping in giant vortices, excited via Rossby wave instabilities at planetary gap edges. Due to the drag force, dust trapped in vortices will accumulate in the center and diffusion is needed to maintain a steady state over the lifetime of the disk. While previous work derived semi-analytical models of the process, in this paper we provide analytical steady-steady solutions. Exact solutions exist for certain vortex models. The solution is determined by the vortex rotation profile, the gas scale height, the vortex aspect ratio, and the ratio of dust diffusion to gas-dust friction. In principle, all of these quantities can be derived from observations, which would validate the model and also provide constrains on the strength of the turbulence inside the vortex core. Based on our solution, we derive quantities such as the gas-dust contrast, the trapped dust mass, and the dust contrast at the same orbital location. We apply our model to the recently imaged Oph IRS 48 system, finding values within the range of the observational uncertainties

  20. RINGED ACCRETION DISKS: INSTABILITIES

    Energy Technology Data Exchange (ETDEWEB)

    Pugliese, D.; Stuchlík, Z., E-mail: d.pugliese.physics@gmail.com, E-mail: zdenek.stuchlik@physics.cz [Institute of Physics and Research Centre of Theoretical Physics and Astrophysics, Faculty of Philosophy and Science, Silesian University in Opava, Bezručovo náměstí 13, CZ-74601 Opava (Czech Republic)

    2016-04-01

    We analyze the possibility that several instability points may be formed, due to the Paczyński mechanism of violation of mechanical equilibrium, in the orbiting matter around a supermassive Kerr black hole. We consider a recently proposed model of a ringed accretion disk, made up by several tori (rings) that can be corotating or counter-rotating relative to the Kerr attractor due to the history of the accretion process. Each torus is governed by the general relativistic hydrodynamic Boyer condition of equilibrium configurations of rotating perfect fluids. We prove that the number of the instability points is generally limited and depends on the dimensionless spin of the rotating attractor.

  1. Audit: Automated Disk Investigation Toolkit

    Directory of Open Access Journals (Sweden)

    Umit Karabiyik

    2014-09-01

    Full Text Available Software tools designed for disk analysis play a critical role today in forensics investigations. However, these digital forensics tools are often difficult to use, usually task specific, and generally require professionally trained users with IT backgrounds. The relevant tools are also often open source requiring additional technical knowledge and proper configuration. This makes it difficult for investigators without some computer science background to easily conduct the needed disk analysis. In this paper, we present AUDIT, a novel automated disk investigation toolkit that supports investigations conducted by non-expert (in IT and disk technology and expert investigators. Our proof of concept design and implementation of AUDIT intelligently integrates open source tools and guides non-IT professionals while requiring minimal technical knowledge about the disk structures and file systems of the target disk image.

  2. Dust evolution in protoplanetary disks

    OpenAIRE

    Gonzalez , Jean-François; Fouchet , Laure; T. Maddison , Sarah; Laibe , Guillaume

    2007-01-01

    6 pages, 5 figures, to appear in the Proceedings of IAU Symp. 249: Exoplanets: Detection, Formation and Dynamics (Suzhou, China); International audience; We investigate the behaviour of dust in protoplanetary disks under the action of gas drag using our 3D, two-fluid (gas+dust) SPH code. We present the evolution of the dust spatial distribution in global simulations of planetless disks as well as of disks containing an already formed planet. The resulting dust structures vary strongly with pa...

  3. Fallback disks & magnetars: prospects & possibilities

    Science.gov (United States)

    Alpar, M. A.

    Some bound matter in the form of a fallback disk may be an initial parameter of isolated neutron stars at birth which along with the initial rotation rate and dipole and higher multipole magnetic moments determines the evolution of neutron stars and the categories into which they fall This talk reviews the strengths and difficulties of fallback disk models in explaining properties of isolated neutron stars of different categories Evidence for and observational limits on fallback disks will also be discussed

  4. IBM 3390 Hard Disk Platter

    CERN Multimedia

    1991-01-01

    The 3390 disks rotated faster than those in the previous model 3380. Faster disk rotation reduced rotational delay (ie. the time required for the correct area of the disk surface to move to the point where data could be read or written). In the 3390's initial models, the average rotational delay was reduced to 7.1 milliseconds from 8.3 milliseconds for the 3380 family.

  5. STELLAR MASS DEPENDENT DISK DISPERSAL

    International Nuclear Information System (INIS)

    Kennedy, Grant M.; Kenyon, Scott J.

    2009-01-01

    We use published optical spectral and infrared (IR) excess data from nine young clusters and associations to study the stellar mass dependent dispersal of circumstellar disks. All clusters older than ∼3 Myr show a decrease in disk fraction with increasing stellar mass for solar to higher mass stars. This result is significant at about the 1σ level in each cluster. For the complete set of clusters we reject the null hypothesis-that solar and intermediate-mass stars lose their disks at the same rate-with 95%-99.9% confidence. To interpret this behavior, we investigate the impact of grain growth, binary companions, and photoevaporation on the evolution of disk signatures. Changes in grain growth timescales at fixed disk temperature may explain why early-type stars with IR excesses appear to evolve faster than their later-type counterparts. Little evidence that binary companions affect disk evolution suggests that photoevaporation is the more likely mechanism for disk dispersal. A simple photoevaporation model provides a good fit to the observed disk fractions for solar and intermediate-mass stars. Although the current mass-dependent disk dispersal signal is not strong, larger and more complete samples of clusters with ages of 3-5 Myr can improve the significance and provide better tests of theoretical models. In addition, the orbits of extra-solar planets can constrain models of disk dispersal and migration. We suggest that the signature of stellar mass dependent disk dispersal due to photoevaporation may be present in the orbits of observed extra-solar planets. Planets orbiting hosts more massive than ∼1.6 M sun may have larger orbits because the disks in which they formed were dispersed before they could migrate.

  6. [Disk calcifications in children].

    Science.gov (United States)

    Schmit, P; Fauré, C; Denarnaud, L

    1985-05-01

    It is not unusual for intervertebral disk calcifications to be detected in pediatric practice, the 150 or so cases reported in the literature probably representing only a small proportion of lesions actually diagnosed. Case reports of 33 children with intervertebral disk calcifications were analyzed. In the majority of these patients (31 of 33) a diagnosis of "idiopathic" calcifications had been made, the cervical localization of the lesions being related to repeated ORL infections and/or trauma. A pre-existing pathologic factor was found in two cases (one child with juvenile rheumatoid arthritis treated by corticoids and one child with Williams and Van Beuren's syndrome). An uncomplicated course was noted in 31 cases, the symptomatology (pain, spinal stiffness and febricula) improving after several days. Complications developed in two cases: one child had very disabling dysphagia due to an anteriorly protruding cervical herniated disc and surgery was necessary; the other child developed cervicobrachial neuralgia due to herniated disc protrusion into the cervical spinal canal, but symptoms regressed within several days although calcifications persisted unaltered. These findings and the course of the rare complications documented in the literature suggest the need for the most conservative treatment possible in cases of disc calcifications in children.

  7. Disk storage at CERN

    CERN Document Server

    Mascetti, L; Chan, B; Espinal, X; Fiorot, A; Labrador, H Gonz; Iven, J; Lamanna, M; Presti, G Lo; Mościcki, JT; Peters, AJ; Ponce, S; Rousseau, H; van der Ster, D

    2015-01-01

    CERN IT DSS operates the main storage resources for data taking and physics analysis mainly via three system: AFS, CASTOR and EOS. The total usable space available on disk for users is about 100 PB (with relative ratios 1:20:120). EOS actively uses the two CERN Tier0 centres (Meyrin and Wigner) with 50:50 ratio. IT DSS also provide sizeable on-demand resources for IT services most notably OpenStack and NFS-based clients: this is provided by a Ceph infrastructure (3 PB) and few proprietary servers (NetApp). We will describe our operational experience and recent changes to these systems with special emphasis to the present usages for LHC data taking, the convergence to commodity hardware (nodes with 200-TB each with optional SSD) shared across all services. We also describe our experience in coupling commodity and home-grown solution (e.g. CERNBox integration in EOS, Ceph disk pools for AFS, CASTOR and NFS) and finally the future evolution of these systems for WLCG and beyond.

  8. Disk storage at CERN

    Science.gov (United States)

    Mascetti, L.; Cano, E.; Chan, B.; Espinal, X.; Fiorot, A.; González Labrador, H.; Iven, J.; Lamanna, M.; Lo Presti, G.; Mościcki, JT; Peters, AJ; Ponce, S.; Rousseau, H.; van der Ster, D.

    2015-12-01

    CERN IT DSS operates the main storage resources for data taking and physics analysis mainly via three system: AFS, CASTOR and EOS. The total usable space available on disk for users is about 100 PB (with relative ratios 1:20:120). EOS actively uses the two CERN Tier0 centres (Meyrin and Wigner) with 50:50 ratio. IT DSS also provide sizeable on-demand resources for IT services most notably OpenStack and NFS-based clients: this is provided by a Ceph infrastructure (3 PB) and few proprietary servers (NetApp). We will describe our operational experience and recent changes to these systems with special emphasis to the present usages for LHC data taking, the convergence to commodity hardware (nodes with 200-TB each with optional SSD) shared across all services. We also describe our experience in coupling commodity and home-grown solution (e.g. CERNBox integration in EOS, Ceph disk pools for AFS, CASTOR and NFS) and finally the future evolution of these systems for WLCG and beyond.

  9. EXor OUTBURSTS FROM DISK AMPLIFICATION OF STELLAR MAGNETIC CYCLES

    Energy Technology Data Exchange (ETDEWEB)

    Armitage, Philip J., E-mail: pja@jilau1.colorado.edu [JILA, University of Colorado and NIST, 440 UCB, Boulder, CO 80309-0440 (United States)

    2016-12-20

    EXor outbursts—moderate-amplitude disk accretion events observed in Class I and Class II protostellar sources—have timescales and amplitudes that are consistent with the viscous accumulation and release of gas in the inner disk near the dead zone boundary. We suggest that outbursts are indirectly triggered by stellar dynamo cycles, via poloidal magnetic flux that diffuses radially outward through the disk. Interior to the dead zone the strength of the net field modulates the efficiency of angular momentum transport by the magnetorotational instability. In the dead zone changes in the polarity of the net field may lead to stronger outbursts because of the dominant role of the Hall effect in this region of the disk. At the level of simple estimates we show that changes to kG-strength stellar fields could stimulate disk outbursts on 0.1 au scales, though this optimistic conclusion depends upon the uncertain efficiency of net flux transport through the inner disk. The model predicts a close association between observational tracers of stellar magnetic activity and EXor events.

  10. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  11. Gravitational Instabilities in a Young Protoplanetary Disk with Embedded Objects

    Science.gov (United States)

    Desai, Karna M.; Steiman-Cameron, Thomas Y.; Durisen, Richard H.

    2018-01-01

    Gravitational Instabilities (GIs), a mechanism for angular momentum transport, are more prominent during the early phases of protoplanetary disk evolution when the disk is relatively massive. In my dissertation work, I performed radiative 3D hydrodynamics simulations (by employing the code, CHYMERA) and extensively studied GIs by inserting different objects in the ‘control disk’ (a 0.14 M⊙ protoplanetary disk around a 1 M⊙ star).Studying planetary migration helps us better constrain planet formation models. To study the migration of Jovian planets, in 9 separate simulations, each of the 0.3 MJ, 1 MJ, and 3 MJ planets was inserted near the Inner and Outer Lindblad Resonances and the Corotation Radius (CR) of the dominant GI-induced two-armed spiral density wave in the disk. I found the migration timescales to be longer in a GI-active disk when compared to laminar disks. The 3 MJ planet controls its own orbital evolution, while the migration of a 0.3 MJ planet is stochastic in nature. I defined a ‘critical mass’ as the mass of an arm of the dominant two-armed spiral density wave within the planet’s Hill diameter. Planets above this mass control their own destiny, and planets below this mass are scattered by the disk. This critical mass could provide a recipe for predicting the migration behavior of planets in GI-active disks.To understand the stochastic migration of low-mass planets, I performed a simulation of 240 zero-mass planet-tracers (hereafter, planets) by inserting these at a range of locations in the control disk (an equivalent of 240 simulations of Saturn-mass or lower-mass objects). I calculated a Diffusion Coefficient (3.6 AU2/ 1000 yr) to characterize the stochastic migration of planets. I analyzed the increase in the eccentricity dispersion and compared it with the observed exoplanet eccentricities. The diffusion of planets can be a slow process, resulting in the survival of small planetary cores. Stochastic migration of planets is

  12. Multiple Paths of Deuterium Fractionation in Protoplanetary Disks

    Science.gov (United States)

    Aikawa, Yuri; Furuya, Kenji; Hincelin, Ugo; Herbst, Eric

    2018-03-01

    We investigate deuterium chemistry coupled with the nuclear spin-state chemistry of H2 and {{{H}}}3+ in protoplanetary disks. Multiple paths of deuterium fractionation are found; exchange reactions with D atoms, such as HCO+ + D, are effective in addition to those with HD. In a disk model with grain sizes appropriate for dark clouds, the freeze-out of molecules is severe in the outer midplane, while the disk surface is shielded from UV radiation. Gaseous molecules, including DCO+, thus become abundant at the disk surface, which tends to make their column density distribution relatively flat. If the dust grains have grown to millimeter size, the freeze-out rate of neutral species is reduced and the abundances of gaseous molecules, including DCO+ and N2D+, are enhanced in the cold midplane. Turbulent diffusion transports D atoms and radicals at the disk surface to the midplane, and stable ice species in the midplane to the disk surface. The effects of turbulence on chemistry are thus multifold; while DCO+ and N2D+ abundances increase or decrease depending on the regions, HCN and DCN in the gas and ice are greatly reduced at the innermost radii, compared to the model without turbulence. When cosmic rays penetrate the disk, the ortho-to-para ratio (OPR) of H2 is found to be thermal in the disk, except in the cold (≲10 K) midplane. We also analyze the OPR of {{{H}}}3+ and H2D+, as well as the main reactions of H2D+, DCO+, and N2D+, in order to analytically derive their abundances in the cold midplane.

  13. Melting of polydisperse hard disks

    NARCIS (Netherlands)

    Pronk, S.; Frenkel, D.

    2004-01-01

    The melting of a polydisperse hard-disk system is investigated by Monte Carlo simulations in the semigrand canonical ensemble. This is done in the context of possible continuous melting by a dislocation-unbinding mechanism, as an extension of the two-dimensional hard-disk melting problem. We find

  14. The Stability of Galaxy Disks

    NARCIS (Netherlands)

    Westfall, K. B.; Andersen, D. R.; Bershady, M. A.; Martinsson, T. P. K.; Swaters, R. A.; Verheijen, M. A. W.; Seigar, M.S.; Treuthardt, P.

    2014-01-01

    We calculate the stellar surface mass density (Σ*) and two-component (gas+stars) disk stability (QRW) for 25 late-type galaxies from the DiskMass Survey. These calculations are based on fits of a dynamical model to our ionized-gas and stellar kinematic data performed using a Markov Chain Monte Carlo

  15. Vibration of imperfect rotating disk

    Czech Academy of Sciences Publication Activity Database

    Půst, Ladislav; Pešek, Luděk

    2011-01-01

    Roč. 5, č. 2 (2011), s. 205-216 ISSN 1802-680X R&D Projects: GA ČR GA101/09/1166 Institutional research plan: CEZ:AV0Z20760514 Keywords : bladed disk * imperfect disk * travelling waves Subject RIV: BI - Acoustics http://www.kme.zcu.cz/acm/index.php/acm/article/view/86

  16. RINGED ACCRETION DISKS: EQUILIBRIUM CONFIGURATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Pugliese, D.; Stuchlík, Z., E-mail: d.pugliese.physics@gmail.com, E-mail: zdenek.stuchlik@physics.cz [Institute of Physics and Research Centre of Theoretical Physics and Astrophysics, Faculty of Philosophy and Science, Silesian University in Opava, Bezručovo náměstí 13, CZ-74601 Opava (Czech Republic)

    2015-12-15

    We investigate a model of a ringed accretion disk, made up by several rings rotating around a supermassive Kerr black hole attractor. Each toroid of the ringed disk is governed by the general relativity hydrodynamic Boyer condition of equilibrium configurations of rotating perfect fluids. Properties of the tori can then be determined by an appropriately defined effective potential reflecting the background Kerr geometry and the centrifugal effects. The ringed disks could be created in various regimes during the evolution of matter configurations around supermassive black holes. Therefore, both corotating and counterrotating rings have to be considered as being a constituent of the ringed disk. We provide constraints on the model parameters for the existence and stability of various ringed configurations and discuss occurrence of accretion onto the Kerr black hole and possible launching of jets from the ringed disk. We demonstrate that various ringed disks can be characterized by a maximum number of rings. We present also a perturbation analysis based on evolution of the oscillating components of the ringed disk. The dynamics of the unstable phases of the ringed disk evolution seems to be promising in relation to high-energy phenomena demonstrated in active galactic nuclei.

  17. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  18. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  19. Evaluation of oxacillin and cefoxitin disks for detection of resistance in coagulase negative staphylococci.

    Science.gov (United States)

    Souza Antunes, Ana Lúcia; Secchi, Carina; Reiter, Keli Cristine; Rodrigues Perez, Leandro Reus; Peixoto de Freitas, Ana Lúcia; Alves d'Azevedo, Pedro

    2007-09-01

    Coagulase-negative Staphylococcus spp. was considered nonpathogenic until the emergence of multiresistance and the demonstration of their participation as infectious agents. In Brazil, oxacillin resistance may be present in over 80% of isolates, and the Clinical and Laboratory Standards Institute standardized a disk-diffusion method to predict this resistance in Staphylococcus. The aim of this study was to evaluate the variability among commercial disks of oxacillin (1 microg) and cefoxitin (30 microg) widely used in clinical laboratories of microbiology, compared with mecA gene and minimum inhibitory concentration (MIC) of oxacillin. The use of oxacillin and cefoxitin disks simultaneously allowed the detection of important differences, particularly, in less frequent species such as S. cohnii, S. haemolyticus, S. saprophyticus, and S. sciuri. Disks of cefoxitin of the brand 2 displayed good correlation with the mecA gene (98.7%) and oxacillin MIC (97.8%), while major discrepancies were observed using disks of brand 1. One of the critical points in the diffusion disk test is the quality of the disks: the use of better quality disks associated with molecular methods lead to better results to define the best antibiotic therapy.

  20. Evaluation of oxacillin and cefoxitin disks for detection of resistance in coagulase negative staphylococci

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Souza Antunes

    2007-09-01

    Full Text Available Coagulase-negative Staphylococcus spp. was considered nonpathogenic until the emergence of multiresistance and the demonstration of their participation as infectious agents. In Brazil, oxacillin resistance may be present in over 80% of isolates, and the Clinical and Laboratory Standards Institute standardized a disk-diffusion method to predict this resistance in Staphylococcus. The aim of this study was to evaluate the variability among commercial disks of oxacillin (1 µg and cefoxitin (30 µg widely used in clinical laboratories of microbiology, compared with mecA gene and minimum inhibitory concentration (MIC of oxacillin. The use of oxacillin and cefoxitin disks simultaneously allowed the detection of important differences, particularly, in less frequent species such as S. cohnii, S. haemolyticus, S. saprophyticus, and S. sciuri. Disks of cefoxitin of the brand 2 displayed good correlation with the mecA gene (98.7% and oxacillin MIC (97.8%, while major discrepancies were observed using disks of brand 1. One of the critical points in the diffusion disk test is the quality of the disks: the use of better quality disks associated with molecular methods lead to better results to define the best antibiotic therapy.

  1. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  2. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  3. Hydrogen Cyanide In Protoplanetary Disks

    Science.gov (United States)

    Walker, Ashley L.; Oberg, Karin; Cleeves, L. Ilsedore

    2018-01-01

    The chemistry behind star and planet formation is extremely complex and important in the formation of habitable planets. Life requires molecules containing carbon, oxygen, and importantly, nitrogen. Hydrogen cyanide, or HCN, one of the main interstellar nitrogen carriers, is extremely dangerous here on Earth. However, it could be used as a vital tool for tracking the chemistry of potentially habitable planets. As we get closer to identifying other habitable planets, we must understand the beginnings of how those planets are formed in the early protoplanetary disk. This project investigates HCN chemistry in different locations in the disk, and what this might mean for forming planets at different distances from the star. HCN is a chemically diverse molecule. It is connected to the formation for other more complex molecules and is commonly used as a nitrogen tracer. Using computational chemical models we look at how the HCN abundance changes at different locations. We use realistic and physically motivated conditions for the gas in the protoplanetary disk: temperature, density, and radiation (UV flux). We analyze the reaction network, formation, and destruction of HCN molecules in the disk environment. The disk environment informs us about stability of habitable planets that are created based on HCN molecules. We reviewed and compared the difference in the molecules with a variety of locations in the disk and ultimately giving us a better understanding on how we view protoplanetary disks.

  4. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  5. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  6. Disk tides and accretion runaway

    Science.gov (United States)

    Ward, William R.; Hahn, Joseph M.

    1995-01-01

    It is suggested that tidal interaction of an accreting planetary embryo with the gaseous preplanetary disk may provide a mechanism to breach the so-called runaway limit during the formation of the giant planet cores. The disk tidal torque converts a would-be shepherding object into a 'predator,' which can continue to cannibalize the planetesimal disk. This is more likely to occur in the giant planet region than in the terrestrial zone, providing a natural cause for Jupiter to predate the inner planets and form within the O(10(exp 7) yr) lifetime of the nebula.

  7. 8-inch IBM floppy disk

    CERN Multimedia

    1971-01-01

    The 8-inch floppy disk was a magnetic storage disk for the data introduced commercially by IBM in 1971. It was designed by an IBM team as an inexpensive way to load data into the IBM System / 370. Plus it was a read-only bare disk containing 80 KB of data. The first read-write version was introduced in 1972 by Memorex and could contain 175 KB on 50 tracks (with 8 sectors per track). Other improvements have led to various coatings and increased capacities. Finally, it was surpassed by the mini diskette of 5.25 inches introduced in 1976.

  8. The Evolution of Spiral Disks

    Science.gov (United States)

    Bershady, Matthew A.; Andersen, David R.

    We report on aspects of an observational study to probe the mass assembly of large galaxy disks. In this contribution we focus on a new survey of integral-field Hα velocity-maps of nearby, face on disks. Preliminary results yield disk asymmetry amplitudes consistent with estimates based on the scatter in the local Tully-Fisher relation. We also show how the high quality of integral-field echelle spectroscopy enables determinations of kinematic inclinations to i ~20 °. This holds the promise that nearly-face-on galaxies can be included in the Tully-Fisher relation. Finally, we discuss the prospects for measuring dynamical asymmetries of distant galaxies.

  9. The Fortios disks revisited

    Directory of Open Access Journals (Sweden)

    António M. Monge Soares

    2017-07-01

    Full Text Available We have used EDXRF, Micro-PIXE and optical microscopy (metallographic analysis, complemented with SEM-EDS, to first determine the elemental content, and second, to identify the process used to join the components (disk, peripheral rod and tab of several Iron Age gold buttons. These have a very similar typology and were found at three archaeological sites in the South-Western part of the Iberian Peninsula. A set of 35 buttons from Castro dos Ratinhos (7, Outeiro da Cabeça (23 and Fortios (5 were analyzed and the results published in Trabajos de Prehistoria (Soares et al. 2010. Recently Perea et al. (2016 have published analyses of other 4 gold buttons from Fortios with the same purpose, but only using one technique, SEM-EDS. As they only analysed the rough surface layer, the results are neither effective nor reliable, taking into account the constraints associated with the technique, namely the small depth reached (< 2 ?m by the incident beam and, consequently, its sensitivity to the topography of the analyzed surface. Despite these constraints, they have accepted uncritically their results and, at the same time, question our own analyses and results and the interpretation we have made. Here we discuss the approach of Perea et al. in order to determine not only the elemental content of the Fortios gold buttons, but also to identify the joining process used in their manufacture.

  10. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  11. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  12. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  13. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  15. Hall-effect-controlled gas dynamics in protoplanetary disks. I. Wind solutions at the inner disk

    International Nuclear Information System (INIS)

    Bai, Xue-Ning

    2014-01-01

    The gas dynamics of protoplanetary disks (PPDs) is largely controlled by non-ideal magnetohydrodynamic (MHD) effects including Ohmic resistivity, the Hall effect, and ambipolar diffusion. Among these the role of the Hall effect is the least explored and most poorly understood. In this series, we have included, for the first time, all three non-ideal MHD effects in a self-consistent manner to investigate the role of the Hall effect on PPD gas dynamics using local shearing-box simulations. In this first paper, we focus on the inner region of PPDs, where previous studies (Bai and Stone 2013; Bai 2013) excluding the Hall effect have revealed that the inner disk up to ∼10 AU is largely laminar, with accretion driven by a magnetocentrifugal wind. We confirm this basic picture and show that the Hall effect modifies the wind solutions depending on the polarity of the large-scale poloidal magnetic field B 0 threading the disk. When B 0 ⋅Ω>0, the horizontal magnetic field is strongly amplified toward the disk interior, leading to a stronger disk wind (by ∼50% or less in terms of the wind-driven accretion rate). The enhanced horizontal field also leads to much stronger large-scale Maxwell stress (magnetic braking) that contributes to a considerable fraction of the wind-driven accretion rate. When B 0 ⋅Ω<0, the horizontal magnetic field is reduced, leading to a weaker disk wind (by ≲ 20%) and negligible magnetic braking. Under fiducial parameters, we find that when B 0 ⋅Ω>0, the laminar region extends farther to ∼10-15 AU before the magnetorotational instability sets in, while for B 0 ⋅Ω<0, the laminar region extends only to ∼3-5 AU for a typical accretion rate of ∼10 –8 to10 –7 M ☉ yr –1 . Scaling relations for the wind properties, especially the wind-driven accretion rate, are provided for aligned and anti-aligned field geometries.

  16. Hall-effect-controlled gas dynamics in protoplanetary disks. I. Wind solutions at the inner disk

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Xue-Ning, E-mail: xbai@cfa.harvard.edu [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, MS-51, Cambridge, MA 02138 (United States)

    2014-08-20

    The gas dynamics of protoplanetary disks (PPDs) is largely controlled by non-ideal magnetohydrodynamic (MHD) effects including Ohmic resistivity, the Hall effect, and ambipolar diffusion. Among these the role of the Hall effect is the least explored and most poorly understood. In this series, we have included, for the first time, all three non-ideal MHD effects in a self-consistent manner to investigate the role of the Hall effect on PPD gas dynamics using local shearing-box simulations. In this first paper, we focus on the inner region of PPDs, where previous studies (Bai and Stone 2013; Bai 2013) excluding the Hall effect have revealed that the inner disk up to ∼10 AU is largely laminar, with accretion driven by a magnetocentrifugal wind. We confirm this basic picture and show that the Hall effect modifies the wind solutions depending on the polarity of the large-scale poloidal magnetic field B{sub 0} threading the disk. When B{sub 0}⋅Ω>0, the horizontal magnetic field is strongly amplified toward the disk interior, leading to a stronger disk wind (by ∼50% or less in terms of the wind-driven accretion rate). The enhanced horizontal field also leads to much stronger large-scale Maxwell stress (magnetic braking) that contributes to a considerable fraction of the wind-driven accretion rate. When B{sub 0}⋅Ω<0, the horizontal magnetic field is reduced, leading to a weaker disk wind (by ≲ 20%) and negligible magnetic braking. Under fiducial parameters, we find that when B{sub 0}⋅Ω>0, the laminar region extends farther to ∼10-15 AU before the magnetorotational instability sets in, while for B{sub 0}⋅Ω<0, the laminar region extends only to ∼3-5 AU for a typical accretion rate of ∼10{sup –8} to10{sup –7} M {sub ☉} yr{sup –1}. Scaling relations for the wind properties, especially the wind-driven accretion rate, are provided for aligned and anti-aligned field geometries.

  17. Gravitational Instabilities in Circumstellar Disks

    Science.gov (United States)

    Kratter, Kaitlin; Lodato, Giuseppe

    2016-09-01

    Star and planet formation are the complex outcomes of gravitational collapse and angular momentum transport mediated by protostellar and protoplanetary disks. In this review, we focus on the role of gravitational instability in this process. We begin with a brief overview of the observational evidence for massive disks that might be subject to gravitational instability and then highlight the diverse ways in which the instability manifests itself in protostellar and protoplanetary disks: the generation of spiral arms, small-scale turbulence-like density fluctuations, and fragmentation of the disk itself. We present the analytic theory that describes the linear growth phase of the instability supplemented with a survey of numerical simulations that aim to capture the nonlinear evolution. We emphasize the role of thermodynamics and large-scale infall in controlling the outcome of the instability. Despite apparent controversies in the literature, we show a remarkable level of agreement between analytic predictions and numerical results. In the next part of our review, we focus on the astrophysical consequences of the instability. We show that the disks most likely to be gravitationally unstable are young and relatively massive compared with their host star, Md/M*≥0.1. They will develop quasi-stable spiral arms that process infall from the background cloud. Although instability is less likely at later times, once infall becomes less important, the manifestations of the instability are more varied. In this regime, the disk thermodynamics, often regulated by stellar irradiation, dictates the development and evolution of the instability. In some cases the instability may lead to fragmentation into bound companions. These companions are more likely to be brown dwarfs or stars than planetary mass objects. Finally, we highlight open questions related to the development of a turbulent cascade in thin disks and the role of mode-mode coupling in setting the maximum angular

  18. Bend testing for miniature disks

    International Nuclear Information System (INIS)

    Huang, F.H.; Hamilton, M.L.; Wire, G.L.

    1982-01-01

    A bend test was developed to obtain ductility measurements on a large number of alloy variants being irradiated in the form of miniature disks. Experimental results were shown to be in agreement with a theoretical analysis of the bend configuration. Disk specimens fabricated from the unstrained grip ends of previously tested tensile specimens were used for calibration purposes; bend ductilities and tensile ductilities were in good agreement. The criterion for estimating ductility was judged acceptable for screening purposes

  19. The Fabulous Four Debris Disks

    Science.gov (United States)

    Werner, Michael; Stapelfeldt, Karl

    2004-09-01

    This program is a comprehensive study of the four bright debris disks that were spatially resolved by IRAS: Beta Pictoris, Epsilon Eridani, Fomalhaut, and Vega. All SIRTF instruments and observing modes will be used. The program has three major objectives: (1) Study of the disk spatial structure from MIPS and IRAC imaging; (2) Study of the dust grain composition using the IRS and MIPS SED mode; and (3) companion searches using IRAC. The data from this program should lead to a detailed understanding of these four systems, and will provide a foundation for understanding all of the debris disks to be studied with SIRTF. Images and spectra will be compared with models for disk structure and dust properties. Dynamical features indicative of substellar companions' effects on the disks will be searched for. This program will require supporting observations of PSF stars, some of which have been included explicitly. In the majority of cases, the spectral observations require a preferred orientation to align the slits along the disk position angles. Detector saturation issues are still being worked for this program, and will lead to AOR modifications in subsequent submissions. The results from this program will be analyzed collaboratively by the IRAC, IRS, and MIPS teams and by general GTOs Jura and Werner.

  20. Static structure of active Brownian hard disks

    Science.gov (United States)

    de Macedo Biniossek, N.; Löwen, H.; Voigtmann, Th; Smallenburg, F.

    2018-02-01

    We explore the changes in static structure of a two-dimensional system of active Brownian particles (ABP) with hard-disk interactions, using event-driven Brownian dynamics simulations. In particular, the effect of the self-propulsion velocity and the rotational diffusivity on the orientationally-averaged fluid structure factor is discussed. Typically activity increases structural ordering and generates a structure factor peak at zero wave vector which is a precursor of motility-induced phase separation. Our results provide reference data to test future statistical theories for the fluid structure of active Brownian systems. This manuscript was submitted for the special issue of the Journal of Physics: Condensed Matter associated with the Liquid Matter Conference 2017.

  1. Vertical Structure of Radiation-pressure-dominated Thin Disks: Link between Vertical Advection and Convective Stability

    International Nuclear Information System (INIS)

    Gong, Hong-Yu; Gu, Wei-Min

    2017-01-01

    In the classic picture of standard thin accretion disks, viscous heating is balanced by radiative cooling through the diffusion process, and the radiation-pressure-dominated inner disk suffers convective instability. However, recent simulations have shown that, owing to the magnetic buoyancy, the vertical advection process can significantly contribute to energy transport. In addition, in comparing the simulation results with the local convective stability criterion, no convective instability has been found. In this work, following on from simulations, we revisit the vertical structure of radiation-pressure-dominated thin disks and include the vertical advection process. Our study indicates a link between the additional energy transport and the convectively stable property. Thus, the vertical advection not only significantly contributes to the energy transport, but it also plays an important role in making the disk convectively stable. Our analyses may help to explain the discrepancy between classic theory and simulations on standard thin disks.

  2. THE ROLE OF TURBULENT MAGNETIC RECONNECTION IN THE FORMATION OF ROTATIONALLY SUPPORTED PROTOSTELLAR DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Santos-Lima, R.; De Gouveia Dal Pino, E. M. [Instituto de Astronomia, Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, R. do Matao, 1226, Sao Paulo, SP 05508-090 (Brazil); Lazarian, A. [Department of Astronomy, University of Wisconsin, Madison, WI 53706 (United States)

    2012-03-01

    The formation of protostellar disks out of molecular cloud cores is still not fully understood. Under ideal MHD conditions, the removal of angular momentum from the disk progenitor by the typically embedded magnetic field may prevent the formation of a rotationally supported disk during the main protostellar accretion phase of low-mass stars. This has been known as the magnetic braking problem and the most investigated mechanism to alleviate this problem and help remove the excess of magnetic flux during the star formation process, the so-called ambipolar diffusion (AD), has been shown to be not sufficient to weaken the magnetic braking at least at this stage of the disk formation. In this work, motivated by recent progress in the understanding of magnetic reconnection in turbulent environments, we appeal to the diffusion of magnetic field mediated by magnetic reconnection as an alternative mechanism for removing magnetic flux. We investigate numerically this mechanism during the later phases of the protostellar disk formation and show its high efficiency. By means of fully three-dimensional MHD simulations, we show that the diffusivity arising from turbulent magnetic reconnection is able to transport magnetic flux to the outskirts of the disk progenitor at timescales compatible with the collapse, allowing the formation of a rotationally supported disk around the protostar of dimensions {approx}100 AU, with a nearly Keplerian profile in the early accretion phase. Since MHD turbulence is expected to be present in protostellar disks, this is a natural mechanism for removing magnetic flux excess and allowing the formation of these disks. This mechanism dismisses the necessity of postulating a hypothetical increase of the ohmic resistivity as discussed in the literature. Together with our earlier work which showed that magnetic flux removal from molecular cloud cores is very efficient, this work calls for reconsidering the relative role of AD in the processes of star

  3. Covering and piercing disks with two centers

    KAUST Repository

    Ahn, Heekap; Kim, Sangsub; Knauer, Christian; Schlipf, Lena; Shin, Chansu; Vigneron, Antoine E.

    2013-01-01

    We give exact and approximation algorithms for two-center problems when the input is a set D of disks in the plane. We first study the problem of finding two smallest congruent disks such that each disk in D intersects one of these two disks. Then we study the problem of covering the set D by two smallest congruent disks. © 2012 Elsevier B.V.

  4. Covering and piercing disks with two centers

    KAUST Repository

    Ahn, Heekap

    2013-04-01

    We give exact and approximation algorithms for two-center problems when the input is a set D of disks in the plane. We first study the problem of finding two smallest congruent disks such that each disk in D intersects one of these two disks. Then we study the problem of covering the set D by two smallest congruent disks. © 2012 Elsevier B.V.

  5. Covering and piercing disks with two centers

    KAUST Repository

    Ahn, Heekap; Kim, Sangsub; Knauer, Christian; Schlipf, Lena; Shin, Chansu; Vigneron, Antoine E.

    2011-01-01

    We consider new versions of the two-center problem where the input consists of a set D of disks in the plane. We first study the problem of finding two smallest congruent disks such that each disk in intersects one of these two disks. Then we study the problem of covering the set D by two smallest congruent disks. We give exact and approximation algorithms for these versions. © 2011 Springer-Verlag.

  6. Surface treatment of disk made by ultra-precision diamond turning

    International Nuclear Information System (INIS)

    Higashi, Norio; Higashi, Yasuo; Kudo, Noboru; Higo, Toshiyasu; Besyo, Koutarou; Funahashi, Yoshisato; Nagai, Minoru

    2005-01-01

    The etching treatment is applied to disk surface of X-band accelerator structures before bonding processes such as diffusion bonding and brazing. The KEK etching process was developed by modifying the process given by SLAC, where KEK-made disks are assembled and bonded as one of the collaborating activities between SLAC and KEK. The surface evaluation of the treated disks was performed by SEM (scanning electron microscope) with its magnification of about X500, in addition to the inspection by eye. The information and treatment process specification are described here. (author)

  7. MAGNETOROTATIONAL-INSTABILITY-DRIVEN ACCRETION IN PROTOPLANETARY DISKS

    International Nuclear Information System (INIS)

    Bai Xuening

    2011-01-01

    Non-ideal MHD effects play an important role in the gas dynamics in protoplanetary disks (PPDs). This paper addresses the influence of non-ideal MHD effects on the magnetorotational instability (MRI) and angular momentum transport in PPDs using the most up-to-date results from numerical simulations. We perform chemistry calculations using a complex reaction network with standard prescriptions for X-ray and cosmic-ray ionizations. We first show that whether or not grains are included, the recombination time is at least one order of magnitude less than the orbital time within five disk scale heights, justifying the validity of local ionization equilibrium and strong coupling limit in PPDs. The full conductivity tensor at different disk radii and heights is evaluated, with the MRI active region determined by requiring that (1) the Ohmic Elsasser number Λ be greater than 1 and (2) the ratio of gas to magnetic pressure β be greater than β min (Am) as identified in the recent study by Bai and Stone, where Am is the Elsasser number for ambipolar diffusion. With full flexibility as to the magnetic field strength, we provide a general framework for estimating the MRI-driven accretion rate M-dot and the magnetic field strength in the MRI active layer. We find that the MRI active layer always exists at any disk radius as long as the magnetic field in PPDs is sufficiently weak. However, the optimistically predicted M-dot in the inner disk (r = 1-10 AU) appears insufficient to account for the observed range of accretion rates in PPDs (around 10 -8 M sun yr -1 ) even in the grain-free calculation, and the presence of solar abundance sub-micron grains further reduces M-dot by one to two orders of magnitude. Moreover, we find that the predicted M-dot increases with radius in the inner disk where accretion is layered, which would lead to runaway mass accumulation if disk accretion is solely driven by the MRI. Our results suggest that stronger sources of ionization and

  8. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  9. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  10. Ultrafast disk lasers and amplifiers

    Science.gov (United States)

    Sutter, Dirk H.; Kleinbauer, Jochen; Bauer, Dominik; Wolf, Martin; Tan, Chuong; Gebs, Raphael; Budnicki, Aleksander; Wagenblast, Philipp; Weiler, Sascha

    2012-03-01

    Disk lasers with multi-kW continuous wave (CW) output power are widely used in manufacturing, primarily for cutting and welding applications, notably in the automotive industry. The ytterbium disk technology combines high power (average and/or peak power), excellent beam quality, high efficiency, and high reliability with low investment and operating costs. Fundamental mode picosecond disk lasers are well established in micro machining at high throughput and perfect precision. Following the world's first market introduction of industrial grade 50 W picosecond lasers (TruMicro 5050) at the Photonics West 2008, the second generation of the TruMicro series 5000 now provides twice the average power (100 W at 1030 nm, or 60 W frequency doubled, green output) at a significantly reduced footprint. Mode-locked disk oscillators achieve by far the highest average power of any unamplified lasers, significantly exceeding the 100 W level in laboratory set-ups. With robust long resonators their multi-microjoule pulse energies begin to compete with typical ultrafast amplifiers. In addition, significant interest in disk technology has recently come from the extreme light laser community, aiming for ultra-high peak powers of petawatts and beyond.

  11. CHEMISTRY IN A FORMING PROTOPLANETARY DISK: MAIN ACCRETION PHASE

    Energy Technology Data Exchange (ETDEWEB)

    Yoneda, Haruaki [Department of Planetology, Kobe University, Kobe 657-8501 (Japan); Tsukamoto, Yusuke [Riken, 2-1 Hirosawa, Wako, Saitama (Japan); Furuya, Kenji; Aikawa, Yuri, E-mail: aikawa@ccs.tsukuba.ac.jp [Center for Computational Sciences, University of Tsukuba (Japan)

    2016-12-10

    We investigate the chemistry in a radiation-hydrodynamics model of a star-forming core that evolves from a cold (∼10 K) prestellar core to the main accretion phase in ∼10{sup 5} years. A rotationally supported gravitationally unstable disk is formed around a protostar. We extract the temporal variation of physical parameters in ∼1.5 × 10{sup 3} SPH particles that end up in the disk, and perform post-processing calculations of the gas-grain chemistry adopting a three-phase model. Inside the disk, the SPH particles migrate both inward and outward. Since a significant fraction of volatiles such as CO can be trapped in the water-dominant ice in the three-phase model, the ice mantle composition depends not only on the current position in the disk, but also on whether the dust grain has ever experienced higher temperatures than the water sublimation temperature. Stable molecules such as H{sub 2}O, CH{sub 4}, NH{sub 3}, and CH{sub 3}OH are already abundant at the onset of gravitational collapse and are simply sublimated as the fluid parcels migrate inside the water snow line. On the other hand, various molecules such as carbon chains and complex organic molecules (COMs) are formed in the disk. The COMs abundance sensitively depends on the outcomes of photodissociation and diffusion rates of photofragments in bulk ice mantle. As for S-bearing species, H{sub 2}S ice is abundant in the collapse phase. In the warm regions in the disk, H{sub 2}S is sublimated to be destroyed, while SO, H{sub 2}CS, OCS, and SO{sub 2} become abundant.

  12. CHEMISTRY IN A FORMING PROTOPLANETARY DISK: MAIN ACCRETION PHASE

    International Nuclear Information System (INIS)

    Yoneda, Haruaki; Tsukamoto, Yusuke; Furuya, Kenji; Aikawa, Yuri

    2016-01-01

    We investigate the chemistry in a radiation-hydrodynamics model of a star-forming core that evolves from a cold (∼10 K) prestellar core to the main accretion phase in ∼10 5 years. A rotationally supported gravitationally unstable disk is formed around a protostar. We extract the temporal variation of physical parameters in ∼1.5 × 10 3 SPH particles that end up in the disk, and perform post-processing calculations of the gas-grain chemistry adopting a three-phase model. Inside the disk, the SPH particles migrate both inward and outward. Since a significant fraction of volatiles such as CO can be trapped in the water-dominant ice in the three-phase model, the ice mantle composition depends not only on the current position in the disk, but also on whether the dust grain has ever experienced higher temperatures than the water sublimation temperature. Stable molecules such as H 2 O, CH 4 , NH 3 , and CH 3 OH are already abundant at the onset of gravitational collapse and are simply sublimated as the fluid parcels migrate inside the water snow line. On the other hand, various molecules such as carbon chains and complex organic molecules (COMs) are formed in the disk. The COMs abundance sensitively depends on the outcomes of photodissociation and diffusion rates of photofragments in bulk ice mantle. As for S-bearing species, H 2 S ice is abundant in the collapse phase. In the warm regions in the disk, H 2 S is sublimated to be destroyed, while SO, H 2 CS, OCS, and SO 2 become abundant.

  13. CT recognition of lateral lumbar disk herniation

    International Nuclear Information System (INIS)

    Williams, A.L.; Haughton, V.M.; Daniels, D.L.; Thornton, R.S.

    1982-01-01

    Although computed tomography (CT) has been shown to be useful in diagnosing posterolateral and central lumbar disk herniations, its effectiveness in demonstrating lateral herniated disks has not been emphasized. The myelographic recognition of those herniations may be difficult because root sheaths or dural sacs may not be deformed. A total of 274 CT scans interpreted as showing lumbar disk herniation was reviewed. Fourteen (5%) showed a lateral disk herniation. The CT features of a lateral herniated disk included: (1) focal protrusion of the disk margin within or lateral to the intervertebral foramen: (2) displacement of epidural fat within the intervertebral foramen; (3) absence of dural sac deformity; and (4) soft-tissue mass within or lateral to the intervertebral foramen. Because it can image the disk margin and free disk fragments irrespective of dural sac or root sheath deformity, CT may be more effective than myelography for demonstrating the presence and extent of lateral disk herniation

  14. Dust in protoplanetary disks: observations*

    Directory of Open Access Journals (Sweden)

    Waters L.B.F.M.

    2015-01-01

    Full Text Available Solid particles, usually referred to as dust, are a crucial component of interstellar matter and of planet forming disks surrounding young stars. Despite the relatively small mass fraction of ≈1% (in the solar neighborhood of our galaxy; this number may differ substantially in other galaxies that interstellar grains represent of the total mass budget of interstellar matter, dust grains play an important role in the physics and chemistry of interstellar matter. This is because of the opacity dust grains at short (optical, UV wavelengths, and the surface they provide for chemical reactions. In addition, dust grains play a pivotal role in the planet formation process: in the core accretion model of planet formation, the growth of dust grains from the microscopic size range to large, cm-sized or larger grains is the first step in planet formation. Not only the grain size distribution is affected by planet formation. Chemical and physical processes alter the structure and chemical composition of dust grains as they enter the protoplanetary disk and move closer to the forming star. Therefore, a lot can be learned about the way stars and planets are formed by observations of dust in protoplanetary disks. Ideally, one would like to measure the dust mass, the grain size distribution, grain structure (porosity, fluffiness, the chemical composition, and all of these as a function of position in the disk. Fortunately, several observational diagnostics are available to derive constrains on these quantities. In combination with rapidly increasing quality of the data (spatial and spectral resolution, a lot of progress has been made in our understanding of dust evolution in protoplanetary disks. An excellent review of dust evolution in protoplanetary disks can be found in Testi et al. (2014.

  15. Dust trapping by vortices in transitional disks: evidence for non-ideal magnetohydrodynamic effects in protoplanetary disks

    International Nuclear Information System (INIS)

    Zhu, Zhaohuan; Stone, James M.

    2014-01-01

    We study particle trapping at the edge of a gap opened by a planet in a protoplanetary disk. In particular, we explore the effects of turbulence driven by the magnetorotational instability on particle trapping, using global three-dimensional magnetohydrodynamic (MHD) simulations including Lagrangian dust particles. We study disks either in the ideal MHD limit or dominated by ambipolar diffusion (AD) which plays an essential role at the outer regions of a protoplanetary disk. With ideal MHD, strong turbulence (the equivalent viscosity parameter α ∼ 10 –2 ) in disks prevents vortex formation at the edge of the gap opened by a 9 M J planet, and most particles (except the particles that drift fastest) pile up at the outer gap edge almost axisymmetrically. When AD is considered, turbulence is significantly suppressed (α ≲ 10 –3 ), and a large vortex forms at the edge of the planet induced gap, which survives ∼1000 orbits. The vortex can efficiently trap dust particles that span 3 orders of magnitude in size within 100 planetary orbits. We have also carried out two-dimensional hydrodynamical (HD) simulations using viscosity as an approximation to MHD turbulence. These HD simulations can reproduce vortex generation at the gap edge as seen in MHD simulations. Finally, we use our simulation results to generate synthetic images for ALMA dust continuum observations on Oph IRS 48 and HD 142527, which show good agreement with existing observations. Predictions for future ALMA cycle 2 observations have been made. We conclude that the asymmetry in ALMA observations can be explained by dust trapping vortices and the existence of vortices could be the evidence that the outer protoplanetary disks are dominated by AD with α < 10 –3 at the disk midplane.

  16. Forging Long Shafts On Disks

    Science.gov (United States)

    Tilghman, Chris; Askey, William; Hopkins, Steven

    1989-01-01

    Isothermal-forging apparatus produces long shafts integral with disks. Equipment based on modification of conventional isothermal-forging equipment, required stroke cut by more than half. Enables forging of shafts as long as 48 in. (122 cm) on typical modified conventional forging press, otherwise limited to making shafts no longer than 18 in. (46cm). Removable punch, in which forged material cools after plastic deformation, essential novel feature of forging apparatus. Technology used to improve such products as components of gas turbines and turbopumps and of other shaft/disk parts for powerplants, drive trains, or static structures.

  17. Parallel Readout of Optical Disks

    Science.gov (United States)

    1992-08-01

    r(x,y) is the apparent reflectance function of the disk surface including the phase error. The illuminat - ing optics should be chosen so that Er(x,y...of the light uniformly illuminat - ing the chip, Ap = 474\\im 2 is the area of photodiode, and rs is the time required to switch the synapses. Figure...reference beam that is incident from the right. Once the hologram is recorded the input is blocked and the disk is illuminat - ed. Lens LI takes the

  18. The Disk Mass Project: breaking the disk-halo degeneracy

    NARCIS (Netherlands)

    Verheijen, Marc A. W.; Bershady, Matthew A.; Swaters, Rob A.; Andersen, David R.; Westfall, Kyle B.; DE JONG, R. S.

    2007-01-01

    Little is known about the content and distribution of dark matter in spiral galaxies. To break the degeneracy in galaxy rotation curve decompositions, which allows a wide range of dark matter halo density profiles, an independent measure of the mass surface density of stellar disks is needed. Here,

  19. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  20. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  1. Coevolution of Binaries and Circumbinary Gaseous Disks

    Science.gov (United States)

    Fleming, David; Quinn, Thomas R.

    2018-04-01

    The recent discoveries of circumbinary planets by Kepler raise questions for contemporary planet formation models. Understanding how these planets form requires characterizing their formation environment, the circumbinary protoplanetary disk, and how the disk and binary interact. The central binary excites resonances in the surrounding protoplanetary disk that drive evolution in both the binary orbital elements and in the disk. To probe how these interactions impact both binary eccentricity and disk structure evolution, we ran N-body smooth particle hydrodynamics (SPH) simulations of gaseous protoplanetary disks surrounding binaries based on Kepler 38 for 10^4 binary orbital periods for several initial binary eccentricities. We find that nearly circular binaries weakly couple to the disk via a parametric instability and excite disk eccentricity growth. Eccentric binaries strongly couple to the disk causing eccentricity growth for both the disk and binary. Disks around sufficiently eccentric binaries strongly couple to the disk and develop an m = 1 spiral wave launched from the 1:3 eccentric outer Lindblad resonance (EOLR). This wave corresponds to an alignment of gas particle longitude of periastrons. We find that in all simulations, the binary semi-major axis decays due to dissipation from the viscous disk.

  2. THICK-DISK EVOLUTION INDUCED BY THE GROWTH OF AN EMBEDDED THIN DISK

    International Nuclear Information System (INIS)

    Villalobos, Alvaro; Helmi, Amina; Kazantzidis, Stelios

    2010-01-01

    We perform collisionless N-body simulations to investigate the evolution of the structural and kinematical properties of simulated thick disks induced by the growth of an embedded thin disk. The thick disks used in the present study originate from cosmologically common 5:1 encounters between initially thin primary disk galaxies and infalling satellites. The growing thin disks are modeled as static gravitational potentials and we explore a variety of growing-disk parameters that are likely to influence the response of thick disks. We find that the final thick-disk properties depend strongly on the total mass and radial scale length of the growing thin disk, and much less sensitively on its growth timescale and vertical scale height as well as the initial sense of thick-disk rotation. Overall, the growth of an embedded thin disk can cause a substantial contraction in both the radial and vertical direction, resulting in a significant decrease in the scale lengths and scale heights of thick disks. Kinematically, a growing thin disk can induce a notable increase in the mean rotation and velocity dispersions of thick-disk stars. We conclude that the reformation of a thin disk via gas accretion may play a significant role in setting the structure and kinematics of thick disks, and thus it is an important ingredient in models of thick-disk formation.

  3. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  4. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  5. A Simple Experiment for Visualizing Diffusion

    Science.gov (United States)

    Helseth, L. E.

    2011-01-01

    We propose a simple and fascinating experiment for studying diffusion in gels using a pH-sensitive dye. By doping agar with methyl red, we obtain a gel which rapidly reacts to changes in pH by changing its absorption spectrum. The pH gradients can be followed using a digital camera, and we demonstrate here that the pH-sensitive colour changes can…

  6. Compact objects and accretion disks

    NARCIS (Netherlands)

    Blandford, Roger; Agol, Eric; Broderick, Avery; Heyl, Jeremy; Koopmans, Leon; Lee, Hee-Won

    2002-01-01

    Recent developments in the spectropolarimetric study of compact objects, specifically black holes (stellar and massive) and neutron stars are reviewed. The lectures are organized around five topics: disks, jets, outflows, neutron stars and black holes. They emphasize physical mechanisms and are

  7. Disk Operating System User's Guide

    Science.gov (United States)

    1972-05-01

    This document serves the purpose of bringing together in one place most of the information a user needs to use the DDP-516 Disk Operating System, (DOS). DOS is a core resident, one user, console-oriented operating system which allows the user to cont...

  8. Gas Evolution in Protoplanetary Disks

    NARCIS (Netherlands)

    Woitke, Peter; Dent, Bill; Thi, Wing-Fai; Sibthorpe, Bruce; Rice, Ken; Williams, Jonathan; Sicilia-Aguilar, Aurora; Brown, Joanna; Kamp, Inga; Pascucci, Ilaria; Alexander, Richard; Roberge, Aki

    2009-01-01

    This article summarizes a Splinter Session at the Cool Stars XV conference in St. Andrews with 3 review and 4 contributed talks. The speakers have discussed various approaches to understand the structure and evolution of the gas component in protoplanetary disks. These ranged from observational

  9. On Fallback Disks around Young Neutron Stars

    Science.gov (United States)

    Alpar, M. Ali; Ertan, Ü.; Erkut, M. H.

    2006-08-01

    Some bound matter in the form of a fallback disk may be an initial parameter of isolated neutron stars at birth, which, along with the initial rotation rate and dipole (and higher multipole) magnetic moments, determines the evolution of neutron stars and the categories into which they fall. This talk reviews the possibilities of fallback disk models in explaining properties of isolated neutron stars of different categories. Recent observations of a fallback disk and observational limits on fallback disks will also be discussed.

  10. ANALYTICAL SOLUTIONS FOR RADIATIVE TRANSFER: IMPLICATIONS FOR GIANT PLANET FORMATION BY DISK INSTABILITY

    International Nuclear Information System (INIS)

    Boss, Alan P.

    2009-01-01

    The disk instability mechanism for giant planet formation is based on the formation of clumps in a marginally gravitationally unstable protoplanetary disk, which must lose thermal energy through a combination of convection and radiative cooling if they are to survive and contract to become giant protoplanets. While there is good observational support for forming at least some giant planets by disk instability, the mechanism has become theoretically contentious, with different three-dimensional radiative hydrodynamics codes often yielding different results. Rigorous code testing is required to make further progress. Here we present two new analytical solutions for radiative transfer in spherical coordinates, suitable for testing the code employed in all of the Boss disk instability calculations. The testing shows that the Boss code radiative transfer routines do an excellent job of relaxing to and maintaining the analytical results for the radial temperature and radiative flux profiles for a spherical cloud with high or moderate optical depths, including the transition from optically thick to optically thin regions. These radial test results are independent of whether the Eddington approximation, diffusion approximation, or flux-limited diffusion approximation routines are employed. The Boss code does an equally excellent job of relaxing to and maintaining the analytical results for the vertical (θ) temperature and radiative flux profiles for a disk with a height proportional to the radial distance. These tests strongly support the disk instability mechanism for forming giant planets.

  11. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  12. CIRCUMSTELLAR DEBRIS DISKS: DIAGNOSING THE UNSEEN PERTURBER

    Energy Technology Data Exchange (ETDEWEB)

    Nesvold, Erika R. [Department of Terrestrial Magnetism, Carnegie Institution for Science, 5241 Broad Branch Rd., Washington, DC 20015 (United States); Naoz, Smadar; Vican, Laura [Department of Physics and Astronomy, UCLA, 475 Portola Plaza, Los Angeles, CA 90095 (United States); Farr, Will M. [School of Physics and Astronomy, University of Birmingham, Birmingham, B15 2TT (United Kingdom)

    2016-07-20

    The first indication of the presence of a circumstellar debris disk is usually the detection of excess infrared emission from the population of small dust grains orbiting the star. This dust is short-lived, requiring continual replenishment, and indicating that the disk must be excited by an unseen perturber. Previous theoretical studies have demonstrated that an eccentric planet orbiting interior to the disk will stir the larger bodies in the belt and produce dust via interparticle collisions. However, motivated by recent observations, we explore another possible mechanism for heating a debris disk: a stellar-mass perturber orbiting exterior to and inclined to the disk and exciting the disk particles’ eccentricities and inclinations via the Kozai–Lidov mechanism. We explore the consequences of an exterior perturber on the evolution of a debris disk using secular analysis and collisional N -body simulations. We demonstrate that a Kozai–Lidov excited disk can generate a dust disk via collisions and we compare the results of the Kozai–Lidov excited disk with a simulated disk perturbed by an interior eccentric planet. Finally, we propose two observational tests of a dust disk that can distinguish whether the dust was produced by an exterior brown dwarf or stellar companion or an interior eccentric planet.

  13. NASA Lunar and Meteorite Sample Disk Program

    Science.gov (United States)

    Foxworth, Suzanne

    2017-01-01

    The Lunar and Meteorite Sample Disk Program is designed for K-12 classroom educators who work in K-12 schools, museums, libraries, or planetariums. Educators have to be certified to borrow the Lunar and Meteorite Sample Disks by attending a NASA Certification Workshop provided by a NASA Authorized Sample Disk Certifier.

  14. PROTOPLANETARY DISK RESONANCES AND TYPE I MIGRATION

    International Nuclear Information System (INIS)

    Tsang, David

    2011-01-01

    Waves reflected by the inner edge of a protoplanetary disk are shown to significantly modify Type I migration, even allowing the trapping of planets near the inner disk edge for small planets in a range of disk parameters. This may inform the distribution of planets close to their central stars, as observed recently by the Kepler mission.

  15. A COMMON SOURCE OF ACCRETION DISK TILT

    International Nuclear Information System (INIS)

    Montgomery, M. M.; Martin, E. L.

    2010-01-01

    Many different system types retrogradely precess, and retrograde precession could be from a tidal torque by the secondary on a misaligned accretion disk. However, a source that causes and maintains disk tilt is unknown. In this work, we show that accretion disks can tilt due to a force called lift. Lift results from differing gas stream supersonic speeds over and under an accretion disk. Because lift acts at the disk's center of pressure, a torque is applied around a rotation axis passing through the disk's center of mass. The disk responds to lift by pitching around the disk's line of nodes. If the gas stream flow ebbs, then lift also ebbs and the disk attempts to return to its original orientation. To first approximation, lift does not depend on magnetic fields or radiation sources but does depend on the mass and the surface area of the disk. Also, for disk tilt to be initiated, a minimum mass transfer rate must be exceeded. For example, a 10 -11 M sun disk around a 0.8 M sun compact central object requires a mass transfer rate greater than ∼ 8 x 10 -11 M sun yr -1 , a value well below the known mass transfer rates in cataclysmic variable dwarf novae systems that retrogradely precess and exhibit negative superhumps in their light curves and a value well below mass transfer rates in protostellar-forming systems.

  16. Equilibrium and kinetic modelling of Cd(II) biosorption by algae Gelidium and agar extraction algal waste.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2006-01-01

    In this study an industrial algal waste from agar extraction has been used as an inexpensive and effective biosorbent for cadmium (II) removal from aqueous solutions. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction. Equilibrium data follow both Langmuir and Redlich-Peterson models. The parameters of Langmuir equilibrium model are q(max)=18.0 mgg(-1), b=0.19 mgl(-1) and q(max)=9.7 mgg(-1), b=0.16 mgl(-1), respectively for Gelidium and the algal waste. Kinetic experiments were conducted at initial Cd(II) concentrations in the range 6-91 mgl(-1). Data were fitted to pseudo-first- and second-order Lagergren models. For an initial Cd(II) concentration of 91 mgl(-1) the parameters of the pseudo-first-order Lagergren model are k(1,ads)=0.17 and 0.87 min(-1); q(eq)=16.3 and 8.7 mgg(-1), respectively, for Gelidium and algal waste. Kinetic constants vary with the initial metal concentration. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model. The model successfully predicts Cd(II) concentration profiles and provides significant insights on the biosorbents performance. The homogeneous diffusivity, D(h), is in the range 0.5-2.2 x10(-8) and 2.1-10.4 x10(-8)cm(2)s(-1), respectively, for Gelidium and algal waste.

  17. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  18. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  19. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  20. Disk Heating, Galactoseismology, and the Formation of Stellar Halos

    Directory of Open Access Journals (Sweden)

    Kathryn V. Johnston

    2017-08-01

    Full Text Available Deep photometric surveys of the Milky Way have revealed diffuse structures encircling our Galaxy far beyond the “classical” limits of the stellar disk. This paper reviews results from our own and other observational programs, which together suggest that, despite their extreme positions, the stars in these structures were formed in our Galactic disk. Mounting evidence from recent observations and simulations implies kinematic connections between several of these distinct structures. This suggests the existence of collective disk oscillations that can plausibly be traced all the way to asymmetries seen in the stellar velocity distribution around the Sun. There are multiple interesting implications of these findings: they promise new perspectives on the process of disk heating; they provide direct evidence for a stellar halo formation mechanism in addition to the accretion and disruption of satellite galaxies; and, they motivate searches of current and near-future surveys to trace these oscillations across the Galaxy. Such maps could be used as dynamical diagnostics in the emerging field of “Galactoseismology”, which promises to model the history of interactions between the Milky Way and its entourage of satellites, as well examine the density of our dark matter halo. As sensitivity to very low surface brightness features around external galaxies increases, many more examples of such disk oscillations will likely be identified. Statistical samples of such features not only encode detailed information about interaction rates and mergers, but also about long sought-after dark matter halo densities and shapes. Models for the Milky Way’s own Galactoseismic history will therefore serve as a critical foundation for studying the weak dynamical interactions of galaxies across the universe.

  1. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  2. Leber congenital amaurosis associated with optic disk neovascularization and vitreous hemorrhage.

    Science.gov (United States)

    Kurz, Daryl; Ciulla, Thomas A

    2003-05-01

    To report an unusual case of optic disk neovascularization and vitreous hemorrhage associated with Leber congenital amaurosis (LCA). Interventional case report. A 16-year-old Caucasian girl with a history of LCA presented with decreased vision in her left eye, diffuse retinal pigmentary abnormalities characteristic of LCA, and hemorrhage over the left optic disk and macula. Six months of follow-up revealed optic disk neovascularization. A small amount of neovascularization was noted in the right eye at 6 months. An extensive systemic evaluation indicated no other cause for the neovascularization. Panretinal photocoagulation was performed in both eyes, and subsequently the neovascularization regressed. Leber congenital amaurosis like retinitis pigmentosa, can rarely be associated with neovascularization of the disk, which is amenable to treatment with peripheral photocoagulation if it does not spontaneously regress.

  3. Angular momentum transfer in steady disk accretion

    International Nuclear Information System (INIS)

    Gorbatskij, V.G.

    1977-01-01

    The conditions of steady disk accretion have been investigated. The disk axisymmetric model is considered. It is shown that the gas is let at the outer boundary of the disk with the azimuthal velocity which is slightly less than the Kepler circular one. Gas possesses the motion quality moment which is transferred from the outer layers of the disk to the surface of the star. The steady state of the disk preserved until the inflow of the moment to the star increases its rotation velocity up to magnitudes close to the critical one

  4. Warm Debris Disks from WISE

    Science.gov (United States)

    Padgett, Deborah L.

    2011-01-01

    "The Wide Field Infrared Survey Explorer (WISE) has just completed a sensitive all-sky survey in photometric bands at 3.4, 4.6, 12, and 22 microns. We report on a preliminary investigation of main sequence Hipparcos and Tycho catalog stars with 22 micron emission in excess of photospheric levels. This warm excess emission traces material in the circumstellar region likely to host terrestrial planets and is preferentially found in young systems with ages warm debris disk candidates are detected among FGK stars and a similar number of A stars within 120 pc. We are in the process of obtaining spectra to determine spectral types and activity level of these stars and are using HST, Herschel and Keck to characterize the dust, multiplicity, and substellar companions of these systems. In this contribution, we will discuss source selection methods and individual examples from among the WISE debris disk candidates. "

  5. MIT miniaturized disk bend test

    International Nuclear Information System (INIS)

    Harling, O.K.; Lee, M.; Sohn, D.S.; Kohse, G.; Lau, C.W.

    1983-01-01

    A miniaturized disk bend test (MDBT) using transmission electron microscopy specimens for the determination of various mechanical properties is being developed at MIT. Recent progress in obtaining strengths and ductilities of highly irradiated metal alloys is reviewed. Other mechanical properties can also be obtained using the MDBT approach. Progress in fatigue testing and in determination of the ductile-to-brittle transition temperature is reviewed briefly. 11 figures

  6. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  7. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  10. Fullerenes and disk-fullerenes

    International Nuclear Information System (INIS)

    Deza, M; Dutour Sikirić, M; Shtogrin, M I

    2013-01-01

    A geometric fullerene, or simply a fullerene, is the surface of a simple closed convex 3-dimensional polyhedron with only 5- and 6-gonal faces. Fullerenes are geometric models for chemical fullerenes, which form an important class of organic molecules. These molecules have been studied intensively in chemistry, physics, crystallography, and so on, and their study has led to the appearance of a vast literature on fullerenes in mathematical chemistry and combinatorial and applied geometry. In particular, several generalizations of the notion of a fullerene have been given, aiming at various applications. Here a new generalization of this notion is proposed: an n-disk-fullerene. It is obtained from the surface of a closed convex 3-dimensional polyhedron which has one n-gonal face and all other faces 5- and 6-gonal, by removing the n-gonal face. Only 5- and 6-disk-fullerenes correspond to geometric fullerenes. The notion of a geometric fullerene is therefore generalized from spheres to compact simply connected two-dimensional manifolds with boundary. A two-dimensional surface is said to be unshrinkable if it does not contain belts, that is, simple cycles consisting of 6-gons each of which has two neighbours adjacent at a pair of opposite edges. Shrinkability of fullerenes and n-disk-fullerenes is investigated. Bibliography: 87 titles

  11. A Pulsar and a Disk

    Science.gov (United States)

    Kohler, Susanna

    2016-07-01

    Recent, unusual X-ray observations from our galactic neighbor, the Small Magellanic Cloud, have led to an interesting model for SXP 214, a pulsar in a binary star system.Artists illustration of the magnetic field lines of a pulsar, a highly magnetized, rotating neutron star. [NASA]An Intriguing BinaryAn X-ray pulsar is a magnetized, rotating neutron star in a binary system with a stellar companion. Material is fed from the companion onto the neutron star, channeled by the objects magnetic fields onto a hotspot thats millions of degrees. This hotspot rotating past our line of sight is what produces the pulsations that we observe from X-ray pulsars.Located in the Small Magellanic Cloud, SXP 214 is a transient X-ray pulsar in a binary with a Be-type star. This star is spinning so quickly that material is thrown off of it to form a circumstellar disk.Recently, a team of authors led by JaeSub Hong (Harvard-Smithsonian Center for Astrophysics) have presented new Chandra X-ray observations of SXP 214, tracking it for 50 ks (~14 hours) in January 2013. These observations reveal some very unexpected behavior for this pulsar.X-ray PuzzleThe energy distribution of the X-ray emission from SXP 214 over time. Dark shades or blue colors indicate high counts, and light shades or yellow colors indicate low counts. Lower-energy X-ray emission appeared only later, after about 20 ks. [Hong et al. 2016]Three interesting pieces of information came from the Chandra observations:SXP 214s rotation period was measured to be 211.5 s an increase in the spin rate since the discovery measurement of a 214-second period. Pulsars usually spin down as they lose angular momentum over time so what caused this one to spin up?Its overall X-ray luminosity steadily increased over the 50 ks of observations.Its spectrum became gradually softer (lower energy) over time; in the first 20 ks, the spectrum only consisted of hard X-ray photons above 3 keV, but after 20 ks, softer X-ray photons below 2 ke

  12. Fullerenes and disk-fullerenes

    Science.gov (United States)

    Deza, M.; Dutour Sikirić, M.; Shtogrin, M. I.

    2013-08-01

    A geometric fullerene, or simply a fullerene, is the surface of a simple closed convex 3-dimensional polyhedron with only 5- and 6-gonal faces. Fullerenes are geometric models for chemical fullerenes, which form an important class of organic molecules. These molecules have been studied intensively in chemistry, physics, crystallography, and so on, and their study has led to the appearance of a vast literature on fullerenes in mathematical chemistry and combinatorial and applied geometry. In particular, several generalizations of the notion of a fullerene have been given, aiming at various applications. Here a new generalization of this notion is proposed: an n-disk-fullerene. It is obtained from the surface of a closed convex 3-dimensional polyhedron which has one n-gonal face and all other faces 5- and 6-gonal, by removing the n-gonal face. Only 5- and 6-disk-fullerenes correspond to geometric fullerenes. The notion of a geometric fullerene is therefore generalized from spheres to compact simply connected two-dimensional manifolds with boundary. A two-dimensional surface is said to be unshrinkable if it does not contain belts, that is, simple cycles consisting of 6-gons each of which has two neighbours adjacent at a pair of opposite edges. Shrinkability of fullerenes and n-disk-fullerenes is investigated. Bibliography: 87 titles.

  13. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  14. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  15. A novel DTI-QA tool: Automated metric extraction exploiting the sphericity of an agar filled phantom.

    Science.gov (United States)

    Chavez, Sofia; Viviano, Joseph; Zamyadi, Mojdeh; Kingsley, Peter B; Kochunov, Peter; Strother, Stephen; Voineskos, Aristotle

    2018-02-01

    To develop a quality assurance (QA) tool (acquisition guidelines and automated processing) for diffusion tensor imaging (DTI) data using a common agar-based phantom used for fMRI QA. The goal is to produce a comprehensive set of automated, sensitive and robust QA metrics. A readily available agar phantom was scanned with and without parallel imaging reconstruction. Other scanning parameters were matched to the human scans. A central slab made up of either a thick slice or an average of a few slices, was extracted and all processing was performed on that image. The proposed QA relies on the creation of two ROIs for processing: (i) a preset central circular region of interest (ccROI) and (ii) a signal mask for all images in the dataset. The ccROI enables computation of average signal for SNR calculations as well as average FA values. The production of the signal masks enables automated measurements of eddy current and B0 inhomogeneity induced distortions by exploiting the sphericity of the phantom. Also, the signal masks allow automated background localization to assess levels of Nyquist ghosting. The proposed DTI-QA was shown to produce eleven metrics which are robust yet sensitive to image quality changes within site and differences across sites. It can be performed in a reasonable amount of scan time (~15min) and the code for automated processing has been made publicly available. A novel DTI-QA tool has been proposed. It has been applied successfully on data from several scanners/platforms. The novelty lies in the exploitation of the sphericity of the phantom for distortion measurements. Other novel contributions are: the computation of an SNR value per gradient direction for the diffusion weighted images (DWIs) and an SNR value per non-DWI, an automated background detection for the Nyquist ghosting measurement and an error metric reflecting the contribution of EPI instability to the eddy current induced shape changes observed for DWIs. Copyright © 2017 Elsevier

  16. THE EDGE OF THE YOUNG GALACTIC DISK

    International Nuclear Information System (INIS)

    Carraro, Giovanni; Vazquez, Ruben A.; Costa, Edgardo; Perren, Gabriel; Moitinho, Andre

    2010-01-01

    In this work, we report and discuss the detection of two distant diffuse stellar groups in the third Galactic quadrant. They are composed of young stars, with spectral types ranging from late O to late B, and lie at galactocentric distances between 15 and 20 kpc. These groups are located in the area of two cataloged open clusters (VdB-Hagen 04 and Ruprecht 30), projected toward the Vela-Puppis constellations, and within the core of the Canis Major overdensity. Their reddening and distances have been estimated by analyzing their color-color and color-magnitude diagrams, derived from deep UBV photometry. The existence of young star aggregates at such extreme distances from the Galactic center challenges the commonly accepted scenario in which the Galactic disk has a sharp cutoff at about 14 kpc from the Galactic center and indicates that it extends to much greater distances (as also supported by the recent detection of CO molecular complexes well beyond this distance). While the groups we find in the area of Ruprecht 30 are compatible with the Orion and Norma-Cygnus spiral arms, respectively, the distant group we identify in the region of VdB-Hagen 04 lies in the external regions of the Norma-Cygnus arm, at a galactocentric distance (∼20 kpc) where no young stars have been detected so far in the optical.

  17. OT1_ipascucc_1: Understanding the Origin of Transition Disks via Disk Mass Measurements

    Science.gov (United States)

    Pascucci, I.

    2010-07-01

    Transition disks are a distinguished group of few Myr-old systems caught in the phase of dispersing their inner dust disk. Three different processes have been proposed to explain this inside-out clearing: grain growth, photoevaporation driven by the central star, and dynamical clearing by a forming giant planet. Which of these processes lead to a transition disk? Distinguishing between them requires the combined knowledge of stellar accretion rates and disk masses. We propose here to use 43.8 hours of PACS spectroscopy to detect the [OI] 63 micron emission line from a sample of 21 well-known transition disks with measured mass accretion rates. We will use this line, in combination with ancillary CO millimeter lines, to measure their gas disk mass. Because gas dominates the mass of protoplanetary disks our approach and choice of lines will enable us to trace the bulk of the disk mass that resides beyond tens of AU from young stars. Our program will quadruple the number of transition disks currently observed with Herschel in this setting and for which disk masses can be measured. We will then place the transition and the ~100 classical/non-transition disks of similar age (from the Herschel KP "Gas in Protoplanetary Systems") in the mass accretion rate-disk mass diagram with two main goals: 1) reveal which gaps have been created by grain growth, photoevaporation, or giant planet formation and 2) from the statistics, determine the main disk dispersal mechanism leading to a transition disk.

  18. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  19. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  20. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  1. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  2. Foundations of Black Hole Accretion Disk Theory.

    Science.gov (United States)

    Abramowicz, Marek A; Fragile, P Chris

    2013-01-01

    This review covers the main aspects of black hole accretion disk theory. We begin with the view that one of the main goals of the theory is to better understand the nature of black holes themselves. In this light we discuss how accretion disks might reveal some of the unique signatures of strong gravity: the event horizon, the innermost stable circular orbit, and the ergosphere. We then review, from a first-principles perspective, the physical processes at play in accretion disks. This leads us to the four primary accretion disk models that we review: Polish doughnuts (thick disks), Shakura-Sunyaev (thin) disks, slim disks, and advection-dominated accretion flows (ADAFs). After presenting the models we discuss issues of stability, oscillations, and jets. Following our review of the analytic work, we take a parallel approach in reviewing numerical studies of black hole accretion disks. We finish with a few select applications that highlight particular astrophysical applications: measurements of black hole mass and spin, black hole vs. neutron star accretion disks, black hole accretion disk spectral states, and quasi-periodic oscillations (QPOs).

  3. Foundations of Black Hole Accretion Disk Theory

    Directory of Open Access Journals (Sweden)

    Marek A. Abramowicz

    2013-01-01

    Full Text Available This review covers the main aspects of black hole accretion disk theory. We begin with the view that one of the main goals of the theory is to better understand the nature of black holes themselves. In this light we discuss how accretion disks might reveal some of the unique signatures of strong gravity: the event horizon, the innermost stable circular orbit, and the ergosphere. We then review, from a first-principles perspective, the physical processes at play in accretion disks. This leads us to the four primary accretion disk models that we review: Polish doughnuts (thick disks, Shakura-Sunyaev (thin disks, slim disks, and advection-dominated accretion flows (ADAFs. After presenting the models we discuss issues of stability, oscillations, and jets. Following our review of the analytic work, we take a parallel approach in reviewing numerical studies of black hole accretion disks. We finish with a few select applications that highlight particular astrophysical applications: measurements of black hole mass and spin, black hole vs. neutron star accretion disks, black hole accretion disk spectral states, and quasi-periodic oscillations (QPOs.

  4. Fast disk array for image storage

    Science.gov (United States)

    Feng, Dan; Zhu, Zhichun; Jin, Hai; Zhang, Jiangling

    1997-01-01

    A fast disk array is designed for the large continuous image storage. It includes a high speed data architecture and the technology of data striping and organization on the disk array. The high speed data path which is constructed by two dual port RAM and some control circuit is configured to transfer data between a host system and a plurality of disk drives. The bandwidth can be more than 100 MB/s if the data path based on PCI (peripheral component interconnect). The organization of data stored on the disk array is similar to RAID 4. Data are striped on a plurality of disk, and each striping unit is equal to a track. I/O instructions are performed in parallel on the disk drives. An independent disk is used to store the parity information in the fast disk array architecture. By placing the parity generation circuit directly on the SCSI (or SCSI 2) bus, the parity information can be generated on the fly. It will affect little on the data writing in parallel on the other disks. The fast disk array architecture designed in the paper can meet the demands of the image storage.

  5. Secular Evolution in Disk Galaxies

    Science.gov (United States)

    Kormendy, John

    2013-10-01

    Self-gravitating systems evolve toward the most tightly bound configuration that is reachable via the evolution processes that are available to them. They do this by spreading -- the inner parts shrink while the outer parts expand -- provided that some physical process efficiently transports energy or angular momentum outward. The reason is that self-gravitating systems have negative specific heats. As a result, the evolution of stars, star clusters, protostellar and protoplanetary disks, black hole accretion disks and galaxy disks are fundamentally similar. How evolution proceeds then depends on the evolution processes that are available to each kind of self-gravitating system. These processes and their consequences for galaxy disks are the subjects of my lectures and of this Canary Islands Winter School. I begin with a review of the formation, growth and death of bars. Then I review the slow (`secular') rearrangement of energy, angular momentum, and mass that results from interactions between stars or gas clouds and collective phenomena such as bars, oval disks, spiral structure and triaxial dark haloes. The `existence-proof' phase of this work is largely over: we have a good heuristic understanding of how nonaxisymmetric structures rearrange disk gas into outer rings, inner rings and stuff dumped onto the centre. The results of simulations correspond closely to the morphology of barred and oval galaxies. Gas that is transported to small radii reaches high densities. Observations confirm that many barred and oval galaxies have dense central concentrations of gas and star formation. The result is to grow, on timescales of a few Gyr, dense central components that are frequently mistaken for classical (elliptical-galaxy-like) bulges but that were grown slowly out of the disk (not made rapidly by major mergers). The resulting picture of secular galaxy evolution accounts for the richness observed in galaxy structure. We can distinguish between classical and pseudo

  6. Anchoring Polar Magnetic Field in a Stationary Thick Accretion Disk

    Energy Technology Data Exchange (ETDEWEB)

    Samadi, Maryam; Abbassi, Shahram, E-mail: samadimojarad@um.ac.ir [Department of Physics, School of Sciences, Ferdowsi University of Mashhad, Mashhad, 91775-1436 (Iran, Islamic Republic of)

    2017-08-20

    We investigate the properties of a hot accretion flow bathed in a poloidal magnetic field. We consider an axisymmetric viscous-resistive flow in the steady-state configuration. We assume that the dominant mechanism of energy dissipation is due to turbulence viscosity and magnetic diffusivity. A certain fraction of that energy can be advected toward the central compact object. We employ the self-similar method in the radial direction to find a system of ODEs with just one varible, θ in the spherical coordinates. For the existence and maintenance of a purely poloidal magnetic field in a rotating thick disk, we find that the necessary condition is a constant value of angular velocity along a magnetic field line. We obtain an analytical solution for the poloidal magnetic flux. We explore possible changes in the vertical structure of the disk under the influences of symmetric and asymmetric magnetic fields. Our results reveal that a polar magnetic field with even symmetry about the equatorial plane makes the disk vertically thin. Moreover, the accretion rate decreases when we consider a strong magnetic field. Finally, we notice that hot magnetized accretion flows can be fully advected even in a slim shape.

  7. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  8. Inefficient volatile loss from the Moon-forming disk: Reconciling the giant impact hypothesis and a wet Moon

    Science.gov (United States)

    Nakajima, Miki; Stevenson, David J.

    2018-04-01

    The Earth's Moon is thought to have formed from a circumterrestrial disk generated by a giant impact between the proto-Earth and an impactor approximately 4.5 billion years ago. Since this impact was energetic, the disk would have been hot (4000-6000 K) and partially vaporized (20-100% by mass). This formation process is thought to be responsible for the geochemical observation that the Moon is depleted in volatiles (e.g., K and Na). To explain this volatile depletion, some studies suggest the Moon-forming disk was rich in hydrogen, which was dissociated from water, and it escaped from the disk as a hydrodynamic wind accompanying heavier volatiles (hydrodynamic escape). This model predicts that the Moon should be significantly depleted in water, but this appears to contradict some of the recently measured lunar water abundances and D/H ratios that suggest that the Moon is more water-rich than previously thought. Alternatively, the Moon could have retained its water if the upper parts (low pressure regions) of the disk were dominated by heavier species because hydrogen would have had to diffuse out from the heavy-element rich disk, and therefore the escape rate would have been limited by this slow diffusion process (diffusion-limited escape). To identify which escape the disk would have experienced and to quantify volatiles loss from the disk, we compute the thermal structure of the Moon-forming disk considering various bulk water abundances (100-1000 ppm) and mid-plane disk temperatures (2500-4000 K). Assuming that the disk consists of silicate (SiO2 or Mg2SiO4) and water and that the disk is in the chemical equilibrium, our calculations show that the upper parts of the Moon-forming disk are dominated by heavy atoms or molecules (SiO and O at Tmid > 2500- 2800 K and H2O at Tmid lost water and hydrogen would have been small compared to the initial abundance assumed. This result indicates that the giant impact hypothesis can be consistent with the water-rich Moon

  9. Dynamics of dense particle disks

    International Nuclear Information System (INIS)

    Araki, S.; Tremaine, S.; Toronto Univ., Canada)

    1986-01-01

    The present investigation of mechanical equilibrium and collisional transport processes in dense, differentially rotating particle disks is based on the Enskog (1922) theory of dense, hard sphere gases, with the single exception that the spheres are inelastic. The viscous instability suggested as a source of Saturn B ring structure does not arise in the models presented, although the ring may be subject to a phase transition analogous to the liquid-solid transition observed in molecular dynamics simulations of elastic hard spheres. In such a case, the ring would alternately exhibit zero-shear, or solid, and high shear, or liquid, zones. 29 references

  10. Astrophysical disks Collective and Stochastic Phenomena

    CERN Document Server

    Fridman, Alexei M; Kovalenko, Ilya G

    2006-01-01

    The book deals with collective and stochastic processes in astrophysical discs involving theory, observations, and the results of modelling. Among others, it examines the spiral-vortex structure in galactic and accretion disks , stochastic and ordered structures in the developed turbulence. It also describes sources of turbulence in the accretion disks, internal structure of disk in the vicinity of a black hole, numerical modelling of Be envelopes in binaries, gaseous disks in spiral galaxies with shock waves formation, observation of accretion disks in a binary system and mass distribution of luminous matter in disk galaxies. The editors adaptly brought together collective and stochastic phenomena in the modern field of astrophysical discs, their formation, structure, and evolution involving the methodology to deal with, the results of observation and modelling, thereby advancing the study in this important branch of astrophysics and benefiting Professional Researchers, Lecturers, and Graduate Students.

  11. Rotation of gas above the galactic disk

    International Nuclear Information System (INIS)

    Gvaramadze, V.V.; Lominadze, D.G.

    1988-01-01

    The galactic disk is modeled by an oblate spheroid with confocal spherodial isodensity surfaces. An explicit analytic expression is found for the angular velocity of the gas outside the disk. The parameters of a three-component model of a spiral galaxy (oblate spheroid with central hole, bulge, and massive corona) are chosen in such a way as to obtain in the disk a two-hump rotation curve (as in the Galaxy, M 31, and M 81). It is shown that at heights absolute value z ≤ 2 kpc the gas rotates in the same manner as the disk. However, at greater heights the rotation curve ceases to have two humps. Allowance for the pressure gradient of the gas slightly changes the rotation curve directly above the disk (r r/sub disk/)

  12. [Management of disk displacement with condylar fracture].

    Science.gov (United States)

    Yu, Shi-bin; Li, Zu-bing; Yang, Xue-wen; Zhao, Ji-hong; Dong, Yao-jun

    2003-07-01

    To investigate clinical features of disk displacement during the course of condylar fracture and to explore the techniques of disk reposition and suturation. 32 patients (10 females and 22 males) who had disk displacements with condylar fractures were followed up. Reduction and reposition of the dislocated disks simultaneously with fixation of fractures were performed. 7 patients underwent intermaxillary fixation with elastic bands for 1 to 2 weeks. The occlusions were satisfactory in all cases but one for the reason of ramus height loss. No TMJ symptom was found when examined 3 months post operation. Anterior disk displacements were most occurred with high condylar process fractures. Surgical reposition and suturation of disk play an important role for the later TMJ-function.

  13. Circumstellar Gas in Young Planetary Debris Disks

    Science.gov (United States)

    Roberge, A.

    Circumstellar (CS) disks orbiting young stars fall into two categories: primordial disks, composed of unprocessed interstellar dust and gas, and debris disks, produced by the destruction of solid planetary bodies. In the first class, the most abundant gas is H_2; in the second, it appears that the H_2 gas has disappeared, possibly through incorporation into gas giant planets. The lifetime of H_2 gas in a CS disk is therefore of great importance, as it dictates the timescale for the formation of giant planets. FUSE observations of H_2 in CS disk systems have shown that FUV absorption spectroscopy may sensitively probe for small amounts of gas along the line of sight to the star. Most importantly, the FUSE non-detection of H_2 gas in the Beta Pictoris disk suggests that the primordial gas lifetime is less than about 12 Myr, and that gas giant planets must form very quickly. However, this suggestion is based on one system, and needs to be tested in additional systems with a range of ages, especially since there are indications that age is not the only factor in the evolution of a CS disk. We propose for FUSE observations of 3 additional debris disk systems, Fomalhaut, HD3003, and HD2884. Fomalhaut is an intermediate age debris disk, one of the Fabulous Four CS disks first discovered in 1984. The other two disks are younger, with ages similar to that of Beta Pic. All three stars are brighter in the FUV than Beta Pic, permitting us to sensitively probe for traces of H_2 gas. We will also measure the amount of secondary atomic gas produced from planetary bodies in these disks, in an effort to understand the entire evolution of CS gas in young planetary systems.

  14. MOLECULAR GAS IN YOUNG DEBRIS DISKS

    International Nuclear Information System (INIS)

    Moor, A.; Abraham, P.; Kiss, Cs.; Juhasz, A.; Kospal, A.; Pascucci, I.; Apai, D.; Henning, Th.; Csengeri, T.; Grady, C.

    2011-01-01

    Gas-rich primordial disks and tenuous gas-poor debris disks are usually considered as two distinct evolutionary phases of the circumstellar matter. Interestingly, the debris disk around the young main-sequence star 49 Ceti possesses a substantial amount of molecular gas and possibly represents the missing link between the two phases. Motivated to understand the evolution of the gas component in circumstellar disks via finding more 49 Ceti-like systems, we carried out a CO J = 3-2 survey with the Atacama Pathfinder EXperiment, targeting 20 infrared-luminous debris disks. These systems fill the gap between primordial and old tenuous debris disks in terms of fractional luminosity. Here we report on the discovery of a second 49 Ceti-like disk around the 30 Myr old A3-type star HD21997, a member of the Columba Association. This system was also detected in the CO(2-1) transition, and the reliable age determination makes it an even clearer example of an old gas-bearing disk than 49 Ceti. While the fractional luminosities of HD21997 and 49 Ceti are not particularly high, these objects seem to harbor the most extended disks within our sample. The double-peaked profiles of HD21997 were reproduced by a Keplerian disk model combined with the LIME radiative transfer code. Based on their similarities, 49 Ceti and HD21997 may be the first representatives of a so far undefined new class of relatively old (∼>8 Myr), gaseous dust disks. From our results, neither primordial origin nor steady secondary production from icy planetesimals can unequivocally explain the presence of CO gas in the disk of HD21997.

  15. Theory of Disk Accretion onto Magnetic Stars

    Directory of Open Access Journals (Sweden)

    Lai Dong

    2014-01-01

    Full Text Available Disk accretion onto magnetic stars occurs in a variety of systems, including accreting neutron stars (with both high and low magnetic fields, white dwarfs, and protostars. We review some of the key physical processes in magnetosphere-disk interaction, highlighting the theoretical uncertainties. We also discuss some applications to the observations of accreting neutron star and protostellar systems, as well as possible connections to protoplanetary disks and exoplanets.

  16. Disk access controller for Multi 8 computer

    International Nuclear Information System (INIS)

    Segalard, Jean

    1970-01-01

    After having presented the initial characteristics and weaknesses of the software provided for the control of a memory disk coupled with a Multi 8 computer, the author reports the development and improvement of this controller software. He presents the different constitutive parts of the computer and the operation of the disk coupling and of the direct access to memory. He reports the development of the disk access controller: software organisation, loader, subprograms and statements

  17. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  18. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  19. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  1. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  2. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  3. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  4. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  5. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  6. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  7. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  8. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  9. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  10. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  11. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  12. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  13. Evaluation of powder metallurgy superalloy disk materials

    Science.gov (United States)

    Evans, D. J.

    1975-01-01

    A program was conducted to develop nickel-base superalloy disk material using prealloyed powder metallurgy techniques. The program included fabrication of test specimens and subscale turbine disks from four different prealloyed powders (NASA-TRW-VIA, AF2-1DA, Mar-M-432 and MERL 80). Based on evaluation of these specimens and disks, two alloys (AF2-1DA and Mar-M-432) were selected for scale-up evaluation. Using fabricating experience gained in the subscale turbine disk effort, test specimens and full scale turbine disks were formed from the selected alloys. These specimens and disks were then subjected to a rigorous test program to evaluate their physical properties and determine their suitability for use in advanced performance turbine engines. A major objective of the program was to develop processes which would yield alloy properties that would be repeatable in producing jet engine disks from the same powder metallurgy alloys. The feasibility of manufacturing full scale gas turbine engine disks by thermomechanical processing of pre-alloyed metal powders was demonstrated. AF2-1DA was shown to possess tensile and creep-rupture properties in excess of those of Astroloy, one of the highest temperature capability disk alloys now in production. It was determined that metallographic evaluation after post-HIP elevated temperature exposure should be used to verify the effectiveness of consolidation of hot isostatically pressed billets.

  14. Thermal Comptonization in standard accretion disks

    International Nuclear Information System (INIS)

    Maraschi, L.; Molendi, S.

    1990-01-01

    Using the theory of geometrically thin accretion disks (where the effects of viscosity are parametrized in terms of the total pressure, viscosity parameter, α) equations are presented for the innermost region of the disk (where the pressure is due to radiation, and the main source of opacity is Thompson scattering). It is important to stress that the four equations can be solved without making use of an equation for the temperature. This is not true for the other regions of the disk. An equation given is used to determine the temperature, assuming that the disk is homogeneous and isothermal in the vertical direction. (author)

  15. Kinetics and equilibrium modelling of lead uptake by algae Gelidium and algal waste from agar extraction industry.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-05-08

    Pb(II) biosorption onto algae Gelidium, algal waste from agar extraction industry and a composite material was studied. Discrete and continuous site distribution models were used to describe the biosorption equilibrium at different pH (5.3, 4 and 3), considering competition among Pb(II) ions and protons. The affinity distribution function of Pb(II) on the active sites was calculated by the Sips distribution. The Langmuir equilibrium constant was compared with the apparent affinity calculated by the discrete model, showing higher affinity for lead ions at higher pH values. Kinetic experiments were conducted at initial Pb(II) concentrations of 29-104 mgl(-1) and data fitted to pseudo-first Lagergren and second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch mass transfer kinetic model, which successfully predicts Pb(II) concentration profiles at different initial lead concentration and pH, and provides significant insights on the biosorbents performance. Average values of homogeneous diffusivity, D(h), are 3.6 x 10(-8); 6.1 x 10(-8) and 2.4 x 10(-8)cm(2)s(-1), respectively, for Gelidium, algal waste and composite material. The concentration of lead inside biosorbent particles follows a parabolic profile that becomes linear near equilibrium.

  16. Kinetics and equilibrium modelling of lead uptake by algae Gelidium and algal waste from agar extraction industry

    International Nuclear Information System (INIS)

    Vilar, Vitor J.P.; Botelho, Cidalia M.S.; Boaventura, Rui A.R.

    2007-01-01

    Pb(II) biosorption onto algae Gelidium, algal waste from agar extraction industry and a composite material was studied. Discrete and continuous site distribution models were used to describe the biosorption equilibrium at different pH (5.3, 4 and 3), considering competition among Pb(II) ions and protons. The affinity distribution function of Pb(II) on the active sites was calculated by the Sips distribution. The Langmuir equilibrium constant was compared with the apparent affinity calculated by the discrete model, showing higher affinity for lead ions at higher pH values. Kinetic experiments were conducted at initial Pb(II) concentrations of 29-104 mg l -1 and data fitted to pseudo-first Lagergren and second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch mass transfer kinetic model, which successfully predicts Pb(II) concentration profiles at different initial lead concentration and pH, and provides significant insights on the biosorbents performance. Average values of homogeneous diffusivity, D h , are 3.6 x 10 -8 ; 6.1 x 10 -8 and 2.4 x 10 -8 cm 2 s -1 , respectively, for Gelidium, algal waste and composite material. The concentration of lead inside biosorbent particles follows a parabolic profile that becomes linear near equilibrium

  17. Kinetics and equilibrium modelling of lead uptake by algae Gelidium and algal waste from agar extraction industry

    Energy Technology Data Exchange (ETDEWEB)

    Vilar, Vitor J.P. [Laboratory of Separation and Reaction Engineering (LSRE), Departamento de Engenharia Quimica, Faculdade de Engenharia da Universidade do Porto, Rua Dr. Roberto Frias, 4200-465 Porto (Portugal); Botelho, Cidalia M.S. [Laboratory of Separation and Reaction Engineering (LSRE), Departamento de Engenharia Quimica, Faculdade de Engenharia da Universidade do Porto, Rua Dr. Roberto Frias, 4200-465 Porto (Portugal); Boaventura, Rui A.R. [Laboratory of Separation and Reaction Engineering (LSRE), Departamento de Engenharia Quimica, Faculdade de Engenharia da Universidade do Porto, Rua Dr. Roberto Frias, 4200-465 Porto (Portugal)]. E-mail: bventura@fe.up.pt

    2007-05-08

    Pb(II) biosorption onto algae Gelidium, algal waste from agar extraction industry and a composite material was studied. Discrete and continuous site distribution models were used to describe the biosorption equilibrium at different pH (5.3, 4 and 3), considering competition among Pb(II) ions and protons. The affinity distribution function of Pb(II) on the active sites was calculated by the Sips distribution. The Langmuir equilibrium constant was compared with the apparent affinity calculated by the discrete model, showing higher affinity for lead ions at higher pH values. Kinetic experiments were conducted at initial Pb(II) concentrations of 29-104 mg l{sup -1} and data fitted to pseudo-first Lagergren and second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch mass transfer kinetic model, which successfully predicts Pb(II) concentration profiles at different initial lead concentration and pH, and provides significant insights on the biosorbents performance. Average values of homogeneous diffusivity, D {sub h}, are 3.6 x 10{sup -8}; 6.1 x 10{sup -8} and 2.4 x 10{sup -8} cm{sup 2} s{sup -1}, respectively, for Gelidium, algal waste and composite material. The concentration of lead inside biosorbent particles follows a parabolic profile that becomes linear near equilibrium.

  18. Hard disks with SCSI interface

    CERN Document Server

    Denisov, O Yu

    1999-01-01

    The testing of 20 models of hard SCSI-disks is carried out: the Fujitsu MAE3091LP; the IBM DDRS-39130, DGHS-318220, DNES-318350, DRHS-36V and DRVS-18V; the Quantum Atlas VI 18.2; the Viking 11 9.1; the Seagate ST118202LW, ST118273LW, ST118273W, ST318203LW, ST318275LW, ST34520W, ST39140LW and ST39173W; and the Western Digital WDE9100-0007, WDE9100-AV0016, WDE9100-AV0030 and WDE9180-0048. All tests ran under the Windows NT 4.0 workstation operating system with Service Pack 4, under video mode with 1024*768 pixel resolution, 32- bit colour depth and V-frequency equal to 85 Hz. The detailed description and characteristics of SCSI stores are presented. Test results (ZD Winstone 99 and ZD WinBench 99 tests) are given in both table and diagram (disk transfer rate) forms. (0 refs).

  19. The Stability of Galaxy Disks

    Science.gov (United States)

    Westfall, K. B.; Andersen, D. R.; Bershady, M. A.; Martinsson, T. P. K.; Swaters, R. A.; Verheijen, M. A. W.

    2014-03-01

    We calculate the stellar surface mass density (Σ*) and two-component (gas+stars) disk stability (QRW) for 25 late-type galaxies from the DiskMass Survey. These calculations are based on fits of a dynamical model to our ionized-gas and stellar kinematic data performed using a Markov Chain Monte Carlo sampling of the Bayesian posterior. Marginalizing over all galaxies, we find a median value of QRW = 2.0±0.9 at 1.5 scale lengths. We also find that QRW is anti-correlated with the star-formation rate surface density (Σ*), which can be predicted using a closed set of empirical scaling relations. Finally, we find that the star-formation efficiency (Σ*/Σg) is correlated with Σ* and weakly anti-correlated with QRW. The former is consistent with an equilibrium prediction of Σ*/Σg ∝ Σ*1/2. Despite its order-of-magnitude range, we find no correlation of Σ*/ΣgΣ*1/2 with any other physical quantity derived by our study.

  20. Disk and circumsolar radiances in the presence of ice clouds

    Directory of Open Access Journals (Sweden)

    P. Haapanala

    2017-06-01

    Full Text Available The impact of ice clouds on solar disk and circumsolar radiances is investigated using a Monte Carlo radiative transfer model. The monochromatic direct and diffuse radiances are simulated at angles of 0 to 8° from the center of the sun. Input data for the model are derived from measurements conducted during the 2010 Small Particles in Cirrus (SPARTICUS campaign together with state-of-the-art databases of optical properties of ice crystals and aerosols. For selected cases, the simulated radiances are compared with ground-based radiance measurements obtained by the Sun and Aureole Measurements (SAM instrument. First, the sensitivity of the radiances to the ice cloud properties and aerosol optical thickness is addressed. The angular dependence of the disk and circumsolar radiances is found to be most sensitive to assumptions about ice crystal roughness (or, more generally, non-ideal features of ice crystals and size distribution, with ice crystal habit playing a somewhat smaller role. Second, in comparisons with SAM data, the ice cloud optical thickness is adjusted for each case so that the simulated radiances agree closely (i.e., within 3 % with the measured disk radiances. Circumsolar radiances at angles larger than ≈ 3° are systematically underestimated when assuming smooth ice crystals, whereas the agreement with the measurements is better when rough ice crystals are assumed. Our results suggest that it may well be possible to infer the particle roughness directly from ground-based SAM measurements. In addition, the results show the necessity of correcting the ground-based measurements of direct radiation for the presence of diffuse radiation in the instrument's field of view, in particular in the presence of ice clouds.

  1. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  2. Conservative diffusions

    International Nuclear Information System (INIS)

    Carlen, E.A.

    1984-01-01

    In Nelson's stochastic mechanics, quantum phenomena are described in terms of diffusions instead of wave functions. These diffusions are formally given by stochastic differential equations with extremely singular coefficients. Using PDE methods, we prove the existence of solutions. This reult provides a rigorous basis for stochastic mechanics. (orig.)

  3. ON THE TRANSITIONAL DISK CLASS: LINKING OBSERVATIONS OF T TAURI STARS AND PHYSICAL DISK MODELS

    International Nuclear Information System (INIS)

    Espaillat, C.; Andrews, S.; Qi, C.; Wilner, D.; Ingleby, L.; Calvet, N.; Hernández, J.; Furlan, E.; D'Alessio, P.; Muzerolle, J.

    2012-01-01

    Two decades ago 'transitional disks' (TDs) described spectral energy distributions (SEDs) of T Tauri stars with small near-IR excesses, but significant mid- and far-IR excesses. Many inferred this indicated dust-free holes in disks possibly cleared by planets. Recently, this term has been applied disparately to objects whose Spitzer SEDs diverge from the expectations for a typical full disk (FD). Here, we use irradiated accretion disk models to fit the SEDs of 15 such disks in NGC 2068 and IC 348. One group has a 'dip' in infrared emission while the others' continuum emission decreases steadily at all wavelengths. We find that the former have an inner disk hole or gap at intermediate radii in the disk and we call these objects 'transitional disks' and 'pre-transitional disks' (PTDs), respectively. For the latter group, we can fit these SEDs with FD models and find that millimeter data are necessary to break the degeneracy between dust settling and disk mass. We suggest that the term 'transitional' only be applied to objects that display evidence for a radical change in the disk's radial structure. Using this definition, we find that TDs and PTDs tend to have lower mass accretion rates than FDs and that TDs have lower accretion rates than PTDs. These reduced accretion rates onto the star could be linked to forming planets. Future observations of TDs and PTDs will allow us to better quantify the signatures of planet formation in young disks.

  4. [The possibilities for diagnostics of prescription of death coming based on the changes in the lumbar intervertebral disks (the comparison of the morphological, immunohistochemical and topographical findings)].

    Science.gov (United States)

    Byval'tsev, V A; Stepanov, I A; Semenov, A V; Perfil'ev, D V; Belykh, E G; Bardonova, L A; Nikiforov, S B; Sudakov, N P; Bespyatykh, I V; Antipina, S L

    The objective of the present study was the comprehensive analysis of the postmortem changes in the lumbar intervertebral disks within different periods after death. A total of seven vertebromotor segments were distinguished in the lumbosacral region of the vertebral column based on the examination of 7 corpses. All these segments were divided into three groups in accordance with the prescription of death coming as follows: up to 12 hours (group 1), between 12 and 24 hours (group 2), and between 24 and 36 hours (group 3) after death. The models of the segments thus obtained were subjected to the study by means of diffusion weighted MRI. The removed intervertebral disks were used for morphological and immunohistochemical investigations. The comparison of the diffusion coefficients (DI) revealed the significant difference between the intervertebral disks assigned to groups 1 and 2 (p<0.01). The number of the cells in the pulpal core, the vertebral end plate, and the fibrous ring in all the above groups of the intervertebral disks was significantly reduced (p<0.01). The analysis of the correlation dependence between cell density and diffusion coefficients has demonstrated the well apparent relationship between these characteristics of the intervertebral disks comprising groups 1 and 2. It is concluded that diffusion weighted MRI in the combination with the calculation of diffusion coefficients for the intervertebral disks provides a tool for diagnostics of prescription of death coming as confirmed by the results of the morphometric studies and immunohistochemical analysis.

  5. WIND-DRIVEN ACCRETION IN PROTOPLANETARY DISKS. II. RADIAL DEPENDENCE AND GLOBAL PICTURE

    Energy Technology Data Exchange (ETDEWEB)

    Bai Xuening, E-mail: xbai@cfa.harvard.edu [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, MS-51, Cambridge, MA 02138 (United States)

    2013-08-01

    Non-ideal magnetohydrodynamical effects play a crucial role in determining the mechanism and efficiency of angular momentum transport as well as the level of turbulence in protoplanetary disks (PPDs), which are the key to understanding PPD evolution and planet formation. It was shown in our previous work that at 1 AU, the magnetorotational instability (MRI) is completely suppressed when both ohmic resistivity and ambipolar diffusion (AD) are taken into account, resulting in a laminar flow with accretion driven by magnetocentrifugal wind. In this work, we study the radial dependence of the laminar wind solution using local shearing-box simulations. The scaling relation on the angular momentum transport for the laminar wind is obtained, and we find that the wind-driven accretion rate can be approximated as M-dot approx. 0.91 x 10{sup -8}R{sub AU}{sup 1.21}(B{sub p}/10 mG){sup 0.93} M{sub Sun} yr{sup -1}, where B{sub p} is the strength of the large-scale poloidal magnetic field threading the disk. The result is independent of disk surface density. Four criteria are outlined for the existence of the laminar wind solution: (1) ohmic resistivity dominated the midplane region, (2) the AD-dominated disk upper layer, (3) the presence of a (not too weak) net vertical magnetic flux, and (4) sufficiently well-ionized gas beyond the disk surface. All these criteria are likely to be met in the inner region of the disk from {approx}0.3 AU to about 5-10 AU for typical PPD accretion rates. Beyond this radius, the angular momentum transport is likely to proceed due to a combination of the MRI and disk wind, and eventually completely dominated by the MRI (in the presence of strong AD) in the outer disk. Our simulation results provide key ingredients for a new paradigm on the accretion processes in PPDs.

  6. SIMULATING THE FORMATION OF MASSIVE PROTOSTARS. I. RADIATIVE FEEDBACK AND ACCRETION DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Klassen, Mikhail; Pudritz, Ralph E. [Department of Physics and Astronomy, McMaster University, 1280 Main Street W, Hamilton, ON L8S 4M1 (Canada); Kuiper, Rolf [Institute of Astronomy and Astrophysics, University of Tübingen, Auf der Morgenstelle 10, D-72076 Tübingen (Germany); Peters, Thomas [Max-Planck-Institut für Astrophysik, Karl-Schwarzschild-Strasse 1, D-85748 Garching (Germany); Banerjee, Robi, E-mail: klassm@mcmaster.ca [Hamburger Sternwarte, Universität Hamburg, Gojenbergsweg 112, D-21029 Hamburg (Germany)

    2016-05-20

    We present radiation hydrodynamic simulations of collapsing protostellar cores with initial masses of 30, 100, and 200 M {sub ⊙}. We follow their gravitational collapse and the formation of a massive protostar and protostellar accretion disk. We employ a new hybrid radiative feedback method blending raytracing techniques with flux-limited diffusion for a more accurate treatment of the temperature and radiative force. In each case, the disk that forms becomes Toomre-unstable and develops spiral arms. This occurs between 0.35 and 0.55 freefall times and is accompanied by an increase in the accretion rate by a factor of 2–10. Although the disk becomes unstable, no other stars are formed. In the case of our 100 and 200 M {sub ⊙} simulations, the star becomes highly super-Eddington and begins to drive bipolar outflow cavities that expand outwards. These radiatively driven bubbles appear stable, and appear to be channeling gas back onto the protostellar accretion disk. Accretion proceeds strongly through the disk. After 81.4 kyr of evolution, our 30 M {sub ⊙} simulation shows a star with a mass of 5.48 M {sub ⊙} and a disk of mass 3.3 M {sub ⊙}, while our 100 M {sub ⊙} simulation forms a 28.8 M {sub ⊙} mass star with a 15.8 M {sub ⊙} disk over the course of 41.6 kyr, and our 200 M {sub ⊙} simulation forms a 43.7 M {sub ⊙} star with an 18 M {sub ⊙} disk in 21.9 kyr. In the absence of magnetic fields or other forms of feedback, the masses of the stars in our simulation do not appear to be limited by their own luminosities.

  7. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  8. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  9. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  11. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  12. Scaling Ratios and Triangles in Siegel Disks

    DEFF Research Database (Denmark)

    Buff, Xavier; Henriksen, Christian

    1999-01-01

    Let f(z)=e^{2i\\pi \\theta} + z^2, where \\theta is a quadratic irrational. McMullen proved that the Siegel disk for f is self-similar about the critical point, and we show that if \\theta = (\\sqrt{5}-1)/2 is the golden mean, then there exists a triangle contained in the Siegel disk, and with one...

  13. Attention Novices: Friendly Intro to Shiny Disks.

    Science.gov (United States)

    Bardes, D'Ellen

    1986-01-01

    Provides an overview of how optical storage technologies--videodisk, Write-Once disks, and CD-ROM CD-I disks are built into and controlled via DEC, Apple, Atari, Amiga, and IBM PC compatible microcomputers. Several available products are noted and a list of producers is included. (EM)

  14. Circumstellar disks around binary stars in Taurus

    International Nuclear Information System (INIS)

    Akeson, R. L.; Jensen, E. L. N.

    2014-01-01

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10 –4 M ☉ . We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F mm ∝M ∗ 1.5--2.0 to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  15. Circumstellar disks around binary stars in Taurus

    Energy Technology Data Exchange (ETDEWEB)

    Akeson, R. L. [NASA Exoplanet Science Institute, IPAC/Caltech, Pasadena, CA 91125 (United States); Jensen, E. L. N. [Swarthmore College, Department of Physics and Astronomy, Swarthmore, PA 19081 (United States)

    2014-03-20

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10{sup –4} M {sub ☉}. We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F{sub mm}∝M{sub ∗}{sup 1.5--2.0} to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  16. Improper colouring of (random) unit disk graphs

    NARCIS (Netherlands)

    Kang, R.J.; Müller, T.; Sereni, J.S.

    2008-01-01

    For any graph G, the k-improper chromatic number ¿k(G) is the smallest number of colours used in a colouring of G such that each colour class induces a subgraph of maximum degree k. We investigate ¿k for unit disk graphs and random unit disk graphs to generalise results of McDiarmid and Reed

  17. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eve J.; Chiang, Eugene, E-mail: evelee@berkeley.edu, E-mail: echiang@astro.berkeley.edu [Department of Astronomy, University of California Berkeley, Berkeley, CA 94720-3411 (United States)

    2016-08-20

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  18. A PRIMER ON UNIFYING DEBRIS DISK MORPHOLOGIES

    International Nuclear Information System (INIS)

    Lee, Eve J.; Chiang, Eugene

    2016-01-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  19. A Primer on Unifying Debris Disk Morphologies

    Science.gov (United States)

    Lee, Eve J.; Chiang, Eugene

    2016-08-01

    A “minimum model” for debris disks consists of a narrow ring of parent bodies, secularly forced by a single planet on a possibly eccentric orbit, colliding to produce dust grains that are perturbed by stellar radiation pressure. We demonstrate how this minimum model can reproduce a wide variety of disk morphologies imaged in scattered starlight. Five broad categories of disk shape can be captured: “rings,” “needles,” “ships-and-wakes,” “bars,” and “moths (a.k.a. fans),” depending on the viewing geometry. Moths can also sport “double wings.” We explain the origin of morphological features from first principles, exploring the dependence on planet eccentricity, disk inclination dispersion, and the parent body orbital phases at which dust grains are born. A key determinant in disk appearance is the degree to which dust grain orbits are apsidally aligned. Our study of a simple steady-state (secularly relaxed) disk should serve as a reference for more detailed models tailored to individual systems. We use the intuition gained from our guidebook of disk morphologies to interpret, informally, the images of a number of real-world debris disks. These interpretations suggest that the farthest reaches of planetary systems are perturbed by eccentric planets, possibly just a few Earth masses each.

  20. Grinding Glass Disks On A Belt Sander

    Science.gov (United States)

    Lyons, James J., III

    1995-01-01

    Small machine attached to table-top belt sander makes possible to use belt sander to grind glass disk quickly to specified diameter within tolerance of about plus or minus 0.002 in. Intended to be used in place of production-shop glass grinder. Held on driveshaft by vacuum, glass disk rotated while periphery ground by continuous sanding belt.

  1. Recent development of disk lasers at TRUMPF

    Science.gov (United States)

    Schad, Sven-Silvius; Gottwald, Tina; Kuhn, Vincent; Ackermann, Matthias; Bauer, Dominik; Scharun, Michael; Killi, Alexander

    2016-03-01

    The disk laser is one of the most important laser concepts for today's industrial laser market. Offering high brilliance at low cost, high optical efficiency and great application flexibility the disk laser paved the way for many industrial laser applications. Over the past years power and brightness increased and the disk laser turned out to be a very versatile laser source, not only for welding but also for cutting. Both, the quality and speed of cutting are superior to CO2-based lasers for a vast majority of metals, and, most important, in a broad thickness range. In addition, due to the insensitivity against back reflections the disk laser is well suited for cutting highly reflective metal such as brass or copper. These advantages facilitate versatile cutting machines and explain the high and growing demand for disk lasers for applications besides welding applications that can be observed today. From a today's perspective the disk principle has not reached any fundamental limits regarding output power per disk or beam quality, and offers numerous advantages over other high power resonator concepts, especially over fiber lasers or direct diode lasers. This paper will give insight in the latest progress in kilowatt class cw disk laser technology at TRUMPF and will discuss recent power scaling results as well.

  2. Disk Galaxies : Building Blocks of the Universe?

    OpenAIRE

    Bower, Richard

    2016-01-01

    In my talk I look at the origin of disk galaxies from the theoretical perspective. In particular I look at simple ways to use the properties of disk galaxies, and their evolution, to test our current paradigm for galaxy formation within the CDM scenario.

  3. Protoplanetary disks and exoplanets in scattered light

    NARCIS (Netherlands)

    Stolker, T.

    2017-01-01

    High-contrast imaging facilitates the direct detection of protoplanetary disks in scattered light and self-luminous exoplanets on long-period orbits. The combined power of extreme adaptive optics and differential imaging techniques delivers high spatial resolution images of disk morphologies down to

  4. 10 MB disk platter from CDC 7638

    CERN Multimedia

    1974-01-01

    This magnetic disk was one of three which interfaced with various Control Data machines. This single platter came from a Control Data 7638 Disk Storage Subsystem and could contain up to 10MB - about the size of a few MP4's on your iPod.

  5. A combined disc method with resazurin agar plate assay for early phenotypic screening of KPC, MBL and OXA-48 carbapenemases among Enterobacteriaceae.

    Science.gov (United States)

    Teethaisong, Y; Eumkeb, G; Nakouti, I; Evans, K; Hobbs, G

    2016-08-01

    To validate a combined disc method along with resazurin chromogenic agar for early screening and differentiation of Klebsiella pneumoniae carbapenemase, metallo-β-lactamase and OXA-48 carbapenemase-producing Enterobacteriaceae. The combined disc test comprising of meropenem alone and with EDTA, phenylboronic acid or both EDTA and phenylboronic acid, and temocillin alone were evaluated with the resazurin chromogenic agar plate assay against a total of 86 molecularly confirmed Enterobacteriaceae clinical isolates (11 metallo-β-lactamases, eight Kl. pneumoniae carbapenemases, 11 OXA-48, 32 AmpC and 15 extended-spectrum-β-lactamase producers and nine co-producers of extended-spectrum-β-lactamase and AmpC). The inhibition zone diameters were measured and interpreted at 7 h for the presence of carbapenemase. All carbapenemase producers were phenotypically distinguished by this assay with 100% sensitivity and specificity. This early phenotypic method is very simple, inexpensive, and reliable in the detection and differentiation of carbapenemase-producing Enterobacteriaceae. It could be exploited in any microbiological laboratory for diagnosis of these recalcitrant bacteria. This assay poses excellent performance in discrimination of Kl. pneumoniae carbapenemase, metallo-β-lactamase and OXA-48 carbapenemases within 7 h, which is much faster than conventional disc diffusion methods. The rapid detection could help clinicians screen patients, control infection and provide epidemiological surveillance. © 2016 The Society for Applied Microbiology.

  6. Pebble Accretion in Turbulent Protoplanetary Disks

    Science.gov (United States)

    Xu, Ziyan; Bai, Xue-Ning; Murray-Clay, Ruth A.

    2017-09-01

    It has been realized in recent years that the accretion of pebble-sized dust particles onto planetary cores is an important mode of core growth, which enables the formation of giant planets at large distances and assists planet formation in general. The pebble accretion theory is built upon the orbit theory of dust particles in a laminar protoplanetary disk (PPD). For sufficiently large core mass (in the “Hill regime”), essentially all particles of appropriate sizes entering the Hill sphere can be captured. However, the outer regions of PPDs are expected to be weakly turbulent due to the magnetorotational instability (MRI), where turbulent stirring of particle orbits may affect the efficiency of pebble accretion. We conduct shearing-box simulations of pebble accretion with different levels of MRI turbulence (strongly turbulent assuming ideal magnetohydrodynamics, weakly turbulent in the presence of ambipolar diffusion, and laminar) and different core masses to test the efficiency of pebble accretion at a microphysical level. We find that accretion remains efficient for marginally coupled particles (dimensionless stopping time {τ }s˜ 0.1{--}1) even in the presence of strong MRI turbulence. Though more dust particles are brought toward the core by the turbulence, this effect is largely canceled by a reduction in accretion probability. As a result, the overall effect of turbulence on the accretion rate is mainly reflected in the changes in the thickness of the dust layer. On the other hand, we find that the efficiency of pebble accretion for strongly coupled particles (down to {τ }s˜ 0.01) can be modestly reduced by strong turbulence for low-mass cores.

  7. Continuum Reverberation Mapping of AGN Accretion Disks

    Energy Technology Data Exchange (ETDEWEB)

    Fausnaugh, Michael M. [Department of Astronomy, Ohio State University, Columbus, OH (United States); MIT Kavli Institute for Astrophysics and Space Research, Cambridge, MA (United States); Peterson, Bradley M. [Department of Astronomy, Ohio State University, Columbus, OH (United States); Center for Cosmology and AstroParticle Physics, Ohio State University, Columbus, OH (United States); Space Telescope Science Institute, Baltimore, MD (United States); Starkey, David A. [SUPA Physics and Astronomy, University of St. Andrews, Scotland (United Kingdom); Department of Astronomy, University of Illinois at Urbana-Champaign, Urbana, IL (United States); Horne, Keith, E-mail: faus@mit.edu [SUPA Physics and Astronomy, University of St. Andrews, Scotland (United Kingdom); Collaboration: the AGN STORM Collaboration

    2017-12-05

    We show recent detections of inter-band continuum lags in three AGN (NGC 5548, NGC 2617, and MCG+08-11-011), which provide new constraints on the temperature profiles and absolute sizes of the accretion disks. We find lags larger than would be predicted for standard geometrically thin, optically thick accretion disks by factors of 2.3–3.3. For NGC 5548, the data span UV through optical/near-IR wavelengths, and we are able to discern a steeper temperature profile than the T ~ R{sup −3/4} expected for a standard thin disk. Using a physical model, we are also able to estimate the inclinations of the disks for two objects. These results are similar to those found from gravitational microlensing of strongly lensed quasars, and provide a complementary approach for investigating the accretion disk structure in local, low luminosity AGN.

  8. Chemical evolution of the galactic disk

    International Nuclear Information System (INIS)

    Wyse, R.F.G.; Gilmore, G.

    1987-01-01

    The distribution of enriched material in the stars and gas of their Galaxy contains information pertaining to the chemical evolution of the Milky Way from its formation epoch to the present day, and provides general constraints on theories of galaxy formation. The separate stellar components of the Galaxy cannot readily be understood if treated in isolation, but a reasonably self-consistent model for Galactic chemical evolution may be found if one considers together the chemical properties of the extreme spheroid, thick disk and thin disk populations of the Galaxy. The three major stellar components of the Galaxy are characterized by their distinct spatial distributions, metallicity structure, and kinematics, with the newly-identified thick disk being approximately three times more massive than the classical metal-poor, non-rotating extreme spheroid. Stellar evolution in the thick disk straightforwardly provides the desired pre-enrichment for resolution of the thin disk G dwarf problem

  9. Hydrodynamical winds from a geometrically thin disk

    International Nuclear Information System (INIS)

    Fukue, Jun

    1989-01-01

    Hydrodynamical winds emanating from the surface of a geometrically thin disk under the gravitational field of the central object are examined. The attention is focused on the transonic nature of the flow. For a given configuration of streamlines, the flow fields are divided into three regions: the inner region where the gas near the disk plane is gravitationally bound to form a corona; the intermediate wind region where multiple critical points appear and the gas flows out from the disk passing through critical points; and the outer region where the gas is unbound to escape to infinity without passing through critical points. This behavior of disk winds is due to the shape of the gravitational potential of the central object along the streamline and due to the energy source distribution at the flow base on the disk plane where the potential in finite. (author)

  10. Disk Evolution and the Fate of Water

    Science.gov (United States)

    Hartmann, Lee; Ciesla, Fred; Gressel, Oliver; Alexander, Richard

    2017-10-01

    We review the general theoretical concepts and observational constraints on the distribution and evolution of water vapor and ice in protoplanetary disks, with a focus on the Solar System. Water is expected to freeze out at distances greater than 1-3 AU from solar-type central stars; more precise estimates are difficult to obtain due to uncertainties in the complex processes involved in disk evolution, including dust growth, settling, and radial drift, and the level of turbulence and viscous dissipation within disks. Interferometric observations are now providing constraints on the positions of CO snow lines, but extrapolation to the unresolved regions where water ice sublimates will require much better theoretical understanding of mass and angular momentum transport in disks as well as more refined comparison of observations with sophisticated disk models.

  11. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  12. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  13. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  14. Development of Powered Disk Type Sugar Cane Stubble Saver

    Directory of Open Access Journals (Sweden)

    Radite P.A.S.

    2009-04-01

    Full Text Available The objective of this research was to design, fabricate and test a prototype of sugar cane stubble saver based on powered disk mechanism. In this research, a heavy duty disk plow or disk harrow was used as a rotating knife to cut the sugarcane stubble. The parabolic disk was chosen because it is proven reliable as soil working tools and it is available in the market as spare part of disk plow or disk harrow unit. The prototype was mounted on the four wheel tractor’s three point hitch, and powered by PTO of the tractor. Two kinds of disks were used in these experiments, those were disk with regular edge or plain disk and disk with scalloped edge or scalloped disk. Both disks had diameter of 28 inch. Results of field test showed that powered disk mechanism could satisfy cut sugar cane’s stubble. However, scalloped disk type gave smoother stubble cuts compared to that of plain disk. Plain disk type gave broken stubble cut. Higher rotation (1000 rpm resulted better cuts as compared to lower rotation (500 rpm both either on plain disk and scalloped disk. The developed prototype could work below the soil surface at depth of 5 to 10 cm. With tilt angle setting 20O and disk angle 45O the width of cut was about 25 cm.

  15. THE DARK DISK OF THE MILKY WAY

    International Nuclear Information System (INIS)

    Purcell, Chris W.; Bullock, James S.; Kaplinghat, Manoj

    2009-01-01

    Massive satellite accretions onto early galactic disks can lead to the deposition of dark matter in disk-like configurations that co-rotate with the galaxy. This phenomenon has potentially dramatic consequences for dark matter detection experiments. We utilize focused, high-resolution simulations of accretion events onto disks designed to be Galaxy analogues, and compare the resultant disks to the morphological and kinematic properties of the Milky Way's thick disk in order to bracket the range of co-rotating accreted dark matter. In agreement with previous results, we find that the Milky Way's merger history must have been unusually quiescent compared to median Λ cold dark matter expectations and, therefore, its dark disk must be relatively small: the fraction of accreted dark disk material near the Sun is about 20% of the host halo density or smaller and the co-rotating dark matter fraction near the Sun, defined as particles moving with a rotational velocity lag less than 50 km s -1 , is enhanced by about 30% or less compared to a standard halo model. Such a dark disk could contribute dominantly to the low energy (of order keV for a dark matter particle with mass 100 GeV) nuclear recoil event rate of direct detection experiments, but it will not change the likelihood of detection significantly. These dark disks provide testable predictions of weakly interacting massive particle dark matter models and should be considered in detailed comparisons to experimental data. Our findings suggest that the dark disk of the Milky Way may provide a detectable signal for indirect detection experiments, contributing up to about 25% of the dark matter self-annihilation signal in the direction of the center of the Galaxy, lending the signal a noticeably oblate morphology.

  16. Equilibrium figures for beta Lyrae type disks

    International Nuclear Information System (INIS)

    Wilson, R.E.

    1981-01-01

    Accumulated evidence for a geometrically and optically thick disk in the β Lyrae system has now established the disk's basic external configuration. Since the disk has been constant in its main properties over the historical interval of β Lyrae observations and also seems to have a basically well-defined photosphere, it is now time to being consideration of its sturcture. Here, we compute equilibrium figures for self-gravitating disks around stars in binary systems as a start toward eventual computation of complete disk models. A key role is played by centrifugally limited rotation of the central star, which would naturally arise late in the rapid phase of mass transfer. Beta Lyrae is thus postulated to be a double-contact binary, which makes possible nonarbitrary separation of star and disk into separate structures. The computed equilibrium figures are three-dimensional, as the gravitation of the second star is included. Under the approximation that the gravitational potential of the disk is that of a thin wire and that the local disk angular velocity is proportional to u/sup n/ (u = distance from rotation axis), we comptue the total potential and locate equipotential surfaces. The centrifugal potential is written in a particularly convenient form which permits one to change the rotation law discontinuously (for example, at the star-disk coupling point) while ensuring that centrifugal potential and centrifigual force are continuous functions of position. With such a one-parameter rotation law, one can find equilibrium disk figures with dimensions very similar to those found in β Lyrae, but considerations of internal consistency demand at least a two-parameter law

  17. DUST FILTRATION BY PLANET-INDUCED GAP EDGES: IMPLICATIONS FOR TRANSITIONAL DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Zhaohuan; Dong Ruobing [Department of Astrophysical Sciences, 4 Ivy Lane, Peyton Hall, Princeton University, Princeton, NJ 08544 (United States); Nelson, Richard P. [Astronomy Unit, Queen Mary University of London, Mile End Road, London E1 4NS (United Kingdom); Espaillat, Catherine [Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Hartmann, Lee, E-mail: zhzhu@astro.princeton.edu, E-mail: rdong@astro.princeton.edu, E-mail: lhartm@umich.edu, E-mail: r.p.nelson@qmul.ac.uk, E-mail: cespaillat@cfa.harvard.edu [Department of Astronomy, University of Michigan, 500 Church St., Ann Arbor, MI 48109 (United States)

    2012-08-10

    By carrying out two-dimensional two-fluid global simulations, we have studied the response of dust to gap formation by a single planet in the gaseous component of a protoplanetary disk-the so-called dust filtration mechanism. We have found that a gap opened by a giant planet at 20 AU in an {alpha} = 0.01, M-dot =10{sup -8} M{sub Sun} yr{sup -1} disk can effectively stop dust particles larger than 0.1 mm drifting inward, leaving a submillimeter (submm) dust cavity/hole. However, smaller particles are difficult to filter by a gap induced by a several M{sub J} planet due to (1) dust diffusion and (2) a high gas accretion velocity at the gap edge. Based on these simulations, an analytic model is derived to understand what size particles can be filtered by the planet-induced gap edge. We show that a dimensionless parameter T{sub s} /{alpha}, which is the ratio between the dimensionless dust stopping time and the disk viscosity parameter, is important for the dust filtration process. Finally, with our updated understanding of dust filtration, we have computed Monte Carlo radiative transfer models with variable dust size distributions to generate the spectral energy distributions of disks with gaps. By comparing with transitional disk observations (e.g., GM Aur), we have found that dust filtration alone has difficulties depleting small particles sufficiently to explain the near-IR deficit of moderate M-dot transitional disks, except under some extreme circumstances. The scenario of gap opening by multiple planets studied previously suffers the same difficulty. One possible solution is to invoke both dust filtration and dust growth in the inner disk. In this scenario, a planet-induced gap filters large dust particles in the disk, and the remaining small dust particles passing to the inner disk can grow efficiently without replenishment from fragmentation of large grains. Predictions for ALMA have also been made based on all these scenarios. We conclude that dust filtration

  18. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  19. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  20. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  1. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  2. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  3. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  4. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  5. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  6. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  7. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  8. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  9. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  10. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  11. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  12. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  13. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  14. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  15. Diffusive separation of particles by diffusion in swirled turbulent flows

    International Nuclear Information System (INIS)

    Arbuzov, V.N.; Shiliaev, M.I.

    1984-01-01

    An analysis of the dynamics of turbulent flow and diffusive separation of solid particles in a centrifugal air separator (consisting of two flat disks rotating at the same angular velocity) is presented. A closed set of balances for all the components of the tensor of turbulent stresses, extended to the entire flow region, is employed in the numerical analysis of transition and turbulent air flows between the rotating disks. The analytical relationships obtained for the case of the mixed flow for the various components of the average velocity, energy of fluctuations, and turbulence level in the circumferential direction agreed well with the theoretical and experimental distributions of Bakke, et al. (1973). It is shown that at high Reynolds numbers the flow is isotropic, the dependence of the circumferential component of the average velocity obeys a power law, and the generation of the radial component is controlled by the local centrifugal field. The sharpness of particle separation was calculated by the eddy diffusion equation and was found to depend on the geometry and the operating conditions. 8 references

  16. Modeling collisions in circumstellar debris disks

    Science.gov (United States)

    Nesvold, Erika

    2015-10-01

    Observations of resolved debris disks show a spectacular variety of features and asymmetries, including inner cavities and gaps, inclined secondary disks or warps, and eccentric, sharp-edged rings. Embedded exoplanets could create many of these features via gravitational perturbations, which sculpt the disk directly and by generating planetesimal collisions. In this thesis, I present the Superparticle Model/Algorithm for Collisions in Kuiper belts and debris disks (SMACK), a new method for simultaneously modeling, in 3-D, the collisional and dynamical evolution of planetesimals in a debris disk with planets. SMACK can simulate azimuthal asymmetries and how these asymmetries evolve over time. I show that SMACK is stable to numerical viscosity and numerical heating over 107 yr, and that it can reproduce analytic models of disk evolution. As an example of the algorithm's capabilities, I use SMACK to model the evolution of a debris ring containing a planet on an eccentric orbit and demonstrate that differential precession creates a spiral structure as the ring evolves, but collisions subsequently break up the spiral, leaving a narrower eccentric ring. To demonstrate SMACK's utility in studying debris disk physics, I apply SMACK to simulate a planet on a circular orbit near a ring of planetesimals that are experiencing destructive collisions. Previous simulations of a planet opening a gap in a collisionless debris disk have found that the width of the gap scales as the planet mass to the 2/7th power (alpha = 2/7). I find that gap sizes in a collisional disk still obey a power law scaling with planet mass, but that the index alpha of the power law depends on the age of the system t relative to the collisional timescale t coll of the disk by alpha = 0.32(t/ tcoll)-0.04, with inferred planet masses up to five times smaller than those predicted by the classical gap law. The increased gap sizes likely stem from the interaction between collisions and the mean motion

  17. Time-Dependent Variations of Accretion Disk

    Directory of Open Access Journals (Sweden)

    Hye-Weon Na

    1987-06-01

    Full Text Available In dward nova we assume the primary star as a white dwarf and the secondary as the late type star which filled Roche lobe. Mass flow from the secondary star leads to the formation of thin accretion disk around the white dwarf. We use the α parameter as viscosity to maintain the disk form and propose that the outburst in dwarf nova cause the steep increase of source term. With these assumptions we solve the basic equations of stellar structure using Newton-Raphson method. We show the physical parameters like temperature, density, pressure, opacity, surface density, height and flux to the radius of disk. Changing the value of α, we compare several parameters when mass flow rate is constant with those of when luminosity of disk is brightest. At the same time, we obtain time-dependent variations of luminosity and mass of disk. We propose the suitable range of α is 0.15-0.18 to the difference of luminosity. We compare several parameters of disk with those of the normal late type stars which have the same molecular weight of disk is lower. Maybe the outburst in dwarf nova is due to the variation of the α value instead of increment of mass flow from the secondary star.

  18. Dynamics of acoustically levitated disk samples.

    Science.gov (United States)

    Xie, W J; Wei, B

    2004-10-01

    The acoustic levitation force on disk samples and the dynamics of large water drops in a planar standing wave are studied by solving the acoustic scattering problem through incorporating the boundary element method. The dependence of levitation force amplitude on the equivalent radius R of disks deviates seriously from the R3 law predicted by King's theory, and a larger force can be obtained for thin disks. When the disk aspect ratio gamma is larger than a critical value gamma(*) ( approximately 1.9 ) and the disk radius a is smaller than the critical value a(*) (gamma) , the levitation force per unit volume of the sample will increase with the enlargement of the disk. The acoustic levitation force on thin-disk samples ( gammaacoustic field for stable levitation of a large water drop is to adjust the reflector-emitter interval H slightly above the resonant interval H(n) . The simulation shows that the drop is flattened and the central parts of its top and bottom surface become concave with the increase of sound pressure level, which agrees with the experimental observation. The main frequencies of the shape oscillation under different sound pressures are slightly larger than the Rayleigh frequency because of the large shape deformation. The simulated translational frequencies of the vertical vibration under normal gravity condition agree with the theoretical analysis.

  19. The CDF Run II disk inventory manager

    International Nuclear Information System (INIS)

    Hubbard, Paul; Lammel, Stephan

    2001-01-01

    The Collider Detector at Fermilab (CDF) experiment records and analyses proton-antiproton interactions at a center-of-mass energy of 2 TeV. Run II of the Fermilab Tevatron started in April of this year. The duration of the run is expected to be over two years. One of the main data handling strategies of CDF for Run II is to hide all tape access from the user and to facilitate sharing of data and thus disk space. A disk inventory manager was designed and developed over the past years to keep track of the data on disk, to coordinate user access to the data, and to stage data back from tape to disk as needed. The CDF Run II disk inventory manager consists of a server process, a user and administrator command line interfaces, and a library with the routines of the client API. Data are managed in filesets which are groups of one or more files. The system keeps track of user access to the filesets and attempts to keep frequently accessed data on disk. Data that are not on disk are automatically staged back from tape as needed. For CDF the main staging method is based on the mt-tools package as tapes are written according to the ANSI standard

  20. GIANT PLANET MIGRATION, DISK EVOLUTION, AND THE ORIGIN OF TRANSITIONAL DISKS

    International Nuclear Information System (INIS)

    Alexander, Richard D.; Armitage, Philip J.

    2009-01-01

    We present models of giant planet migration in evolving protoplanetary disks. Our disks evolve subject to viscous transport of angular momentum and photoevaporation, while planets undergo Type II migration. We use a Monte Carlo approach, running large numbers of models with a range in initial conditions. We find that relatively simple models can reproduce both the observed radial distribution of extrasolar giant planets, and the lifetimes and accretion histories of protoplanetary disks. The use of state-of-the-art photoevaporation models results in a degree of coupling between planet formation and disk clearing, which has not been found previously. Some accretion across planetary orbits is necessary if planets are to survive at radii ∼<1.5 AU, and if planets of Jupiter mass or greater are to survive in our models they must be able to form at late times, when the disk surface density in the formation region is low. Our model forms two different types of 'transitional' disks, embedded planets and clearing disks, which show markedly different properties. We find that the observable properties of these systems are broadly consistent with current observations, and highlight useful observational diagnostics. We predict that young transition disks are more likely to contain embedded giant planets, while older transition disks are more likely to be undergoing disk clearing.

  1. CT-guided percutaneous laser disk decompression for cervical and lumbar disk hernia

    International Nuclear Information System (INIS)

    Shimizu, Kanichiro; Koyama, Tutomu; Harada, Junta; Abe, Toshiaki

    2008-01-01

    Percutaneous laser disk decompression under X-ray fluoroscopy was first reported in 1987 for minimally invasive therapy of lumbar disk hernia. In patients with disk hernia, laser vaporizes a small portion of the intervertebral disk thereby reducing the volume and pressure of the affected disk. We present the efficacy and safety of this procedure, and analysis of fair or poor response cases. In our study, 226 cases of lumbar disk hernia and 7 cases of cervical disk hernia were treated under CT guided PLDD. Japan Orthopedic Association (JOA) score and Mac-Nab criteria were investigated to evaluate the response to treatment. Improvement ratio based on the JOA score was calculated as follows. Overall success rate was 91.6% in cases lumber disk hernia, and 100% in cases of cervical disk hernia. We experienced two cases with two cases with postoperative complication. Both cases were treated conservatively. The majority of acute cases and post operative cases were reported to be 'good' on Mac-Nab criteria. Cases of fair or poor response on Mac-Nab criteria were lateral type, foraminal stenosis or large disk hernia. CT-guided PLDD is a safe and accurate procedure. The overall success rate can be increased by carefully selecting patients. (author)

  2. Latest advances in high brightness disk lasers

    Science.gov (United States)

    Kuhn, Vincent; Gottwald, Tina; Stolzenburg, Christian; Schad, Sven-Silvius; Killi, Alexander; Ryba, Tracey

    2015-02-01

    In the last decade diode pumped solid state lasers have become an important tool for many industrial materials processing applications. They combine ease of operation with efficiency, robustness and low cost. This paper will give insight in latest progress in disk laser technology ranging from kW-class CW-Lasers over frequency converted lasers to ultra-short pulsed lasers. The disk laser enables high beam quality at high average power and at high peak power at the same time. The power from a single disk was scaled from 1 kW around the year 2000 up to more than 10 kW nowadays. Recently was demonstrated more than 4 kW of average power from a single disk close to fundamental mode beam quality (M²=1.38). Coupling of multiple disks in a common resonator results in even higher power. As an example we show 20 kW extracted from two disks of a common resonator. The disk also reduces optical nonlinearities making it ideally suited for short and ultrashort pulsed lasers. In a joint project between TRUMPF and IFSW Stuttgart more than 1.3 kW of average power at ps pulse duration and exceptionally good beam quality was recently demonstrated. The extremely low saturated gain makes the disk laser ideal for internal frequency conversion. We show >1 kW average power and >6 kW peak power in multi ms pulsed regime from an internally frequency doubled disk laser emitting at 515 nm (green). Also external frequency conversion can be done efficiently with ns pulses. >500 W of average UV power was demonstrated.

  3. Magnetically Induced Disk Winds and Transport in the HL Tau Disk

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Yasuhiro; Flock, Mario; Turner, Neal J. [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Okuzumi, Satoshi, E-mail: yasuhiro@caltech.edu [Department of Earth and Planetary Sciences, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551 (Japan)

    2017-08-10

    The mechanism of angular momentum transport in protoplanetary disks is fundamental to understanding the distributions of gas and dust in the disks. The unprecedented ALMA observations taken toward HL Tau at high spatial resolution and subsequent radiative transfer modeling reveal that a high degree of dust settling is currently achieved in the outer part of the HL Tau disk. Previous observations, however, suggest a high disk accretion rate onto the central star. This configuration is not necessarily intuitive in the framework of the conventional viscous disk model, since efficient accretion generally requires a high level of turbulence, which can suppress dust settling considerably. We develop a simplified, semi-analytical disk model to examine under what condition these two properties can be realized in a single model. Recent, non-ideal MHD simulations are utilized to realistically model the angular momentum transport both radially via MHD turbulence and vertically via magnetically induced disk winds. We find that the HL Tau disk configuration can be reproduced well when disk winds are properly taken into account. While the resulting disk properties are likely consistent with other observational results, such an ideal situation can be established only if the plasma β at the disk midplane is β {sub 0} ≃ 2 × 10{sup 4} under the assumption of steady accretion. Equivalently, the vertical magnetic flux at 100 au is about 0.2 mG. More detailed modeling is needed to fully identify the origin of the disk accretion and quantitatively examine plausible mechanisms behind the observed gap structures in the HL Tau disk.

  4. Magnetically Induced Disk Winds and Transport in the HL Tau Disk

    International Nuclear Information System (INIS)

    Hasegawa, Yasuhiro; Flock, Mario; Turner, Neal J.; Okuzumi, Satoshi

    2017-01-01

    The mechanism of angular momentum transport in protoplanetary disks is fundamental to understanding the distributions of gas and dust in the disks. The unprecedented ALMA observations taken toward HL Tau at high spatial resolution and subsequent radiative transfer modeling reveal that a high degree of dust settling is currently achieved in the outer part of the HL Tau disk. Previous observations, however, suggest a high disk accretion rate onto the central star. This configuration is not necessarily intuitive in the framework of the conventional viscous disk model, since efficient accretion generally requires a high level of turbulence, which can suppress dust settling considerably. We develop a simplified, semi-analytical disk model to examine under what condition these two properties can be realized in a single model. Recent, non-ideal MHD simulations are utilized to realistically model the angular momentum transport both radially via MHD turbulence and vertically via magnetically induced disk winds. We find that the HL Tau disk configuration can be reproduced well when disk winds are properly taken into account. While the resulting disk properties are likely consistent with other observational results, such an ideal situation can be established only if the plasma β at the disk midplane is β 0 ≃ 2 × 10 4 under the assumption of steady accretion. Equivalently, the vertical magnetic flux at 100 au is about 0.2 mG. More detailed modeling is needed to fully identify the origin of the disk accretion and quantitatively examine plausible mechanisms behind the observed gap structures in the HL Tau disk.

  5. Golden mean Siegel disk universality and renormalization

    OpenAIRE

    Gaidashev, Denis; Yampolsky, Michael

    2016-01-01

    We provide a computer-assisted proof of one of the central open questions in one-dimensional renormalization theory -- universality of the golden-mean Siegel disks. We further show that for every function in the stable manifold of the golden-mean renormalization fixed point the boundary of the Siegel disk is a quasicircle which coincides with the closure of the critical orbit, and that the dynamics on the boundary of the Siegel disk is rigid. Furthermore, we extend the renormalization from on...

  6. Disk degeneration in 14 year old children

    International Nuclear Information System (INIS)

    Erkintalo, M.; Salminen, J.J.; Paajanen, H.; Terho, P.; Kormano, M.

    1989-01-01

    This paper reports low back symptoms of 1,500 school children (14 years old) evaluated with a questionnaire and with a standardized clinical examination. Forty children who complained of recurrent and/or persistent low back pain and 40 matching symptomless controls were randomly chosen to undergo MR imaging of the lumbar spine. Premature disk degeneration was seen in 25.5% of asymptomatic children and in 40% of those with low back pain. The difference was statistically not significant. Disk degeneration is a surprisingly frequent MR finding in symptomless children. Premature disk degeneration may be the cause of low back pain in some children but is not always symptomatic in childhood

  7. Gas Flow Across Gaps in Protoplanetary Disks

    OpenAIRE

    Lubow, Steve H.; D'Angelo, Gennaro

    2005-01-01

    We analyze the gas accretion flow through a planet-produced gap in a protoplanetary disk. We adopt the alpha disk model and ignore effects of planetary migration. We develop a semi-analytic, one-dimensional model that accounts for the effects of the planet as a mass sink and also carry out two-dimensional hydrodynamical simulations of a planet embedded in a disk. The predictions of the mass flow rate through the gap based on the semi-analytic model generally agree with the hydrodynamical simu...

  8. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  9. Mottled Protoplanetary Disk Ionization by Magnetically Channeled T Tauri Star Energetic Particles

    Science.gov (United States)

    Fraschetti, F.; Drake, J. J.; Cohen, O.; Garraffo, C.

    2018-02-01

    The evolution of protoplanetary disks is believed to be driven largely by angular momentum transport resulting from magnetized disk winds and turbulent viscosity. The ionization of the disk that is essential for these processes has been thought to be due to host star coronal X-rays but could also arise from energetic particles produced by coronal flares, or traveling shock waves, and advected by the stellar wind. We have performed test-particle numerical simulations of energetic protons propagating into a realistic T Tauri stellar wind, including a superposed small-scale magnetostatic turbulence. The isotropic (Kolmogorov power spectrum) turbulent component is synthesized along the individual particle trajectories. We have investigated the energy range [0.1–10] GeV, consistent with expectations from Chandra X-ray observations of large flares on T Tauri stars and recent indications by the Herschel Space Observatory of a significant contribution of energetic particles to the disk ionization of young stars. In contrast with a previous theoretical study finding a dominance of energetic particles over X-rays in the ionization throughout the disk, we find that the disk ionization is likely dominated by X-rays over much of its area, except within narrow regions where particles are channeled onto the disk by the strongly tangled and turbulent magnetic field. The radial thickness of such regions is 5 stellar radii close to the star and broadens with increasing radial distance. This likely continues out to large distances from the star (10 au or greater), where particles can be copiously advected and diffused by the turbulent wind.

  10. PROPERTIES OF BULGELESS DISK GALAXIES. II. STAR FORMATION AS A FUNCTION OF CIRCULAR VELOCITY

    Energy Technology Data Exchange (ETDEWEB)

    Watson, Linda C. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Martini, Paul; Wong, Man-Hong [Department of Astronomy, Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Lisenfeld, Ute [Departamento de Fisica Teorica y del Cosmos, Universidad de Granada, 18071 Granada (Spain); Boeker, Torsten [European Space Agency, Keplerlaan 1, 2200 AG Noordwijk (Netherlands); Schinnerer, Eva, E-mail: lwatson@cfa.harvard.edu [Max-Planck-Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany)

    2012-06-01

    We study the relation between the surface density of gas and star formation rate in 20 moderately inclined, bulgeless disk galaxies (Sd-Sdm Hubble types) using CO(1-0) data from the IRAM 30 m telescope, H I emission line data from the VLA/EVLA, H{alpha} data from the MDM Observatory, and polycyclic aromatic hydrocarbon emission data derived from Spitzer IRAC observations. We specifically investigate the efficiency of star formation as a function of circular velocity (v{sub circ}). Previous work found that the vertical dust structure and disk stability of edge-on, bulgeless disk galaxies transition from diffuse dust lanes with large scale heights and gravitationally stable disks at v{sub circ} < 120 km s{sup -1} (M{sub *} {approx}< 10{sup 10} M{sub Sun }) to narrow dust lanes with small scale heights and gravitationally unstable disks at v{sub circ} > 120 km s{sup -1}. We find no transition in star formation efficiency ({Sigma}{sub SFR}/{Sigma}{sub Hi+H{sub 2}}) at v{sub circ} = 120 km s{sup -1} or at any other circular velocity probed by our sample (v{sub circ} = 46-190 km s{sup -1}). Contrary to previous work, we find no transition in disk stability at any circular velocity in our sample. Assuming our sample has the same dust structure transition as the edge-on sample, our results demonstrate that scale height differences in the cold interstellar medium of bulgeless disk galaxies do not significantly affect the molecular fraction or star formation efficiency. This may indicate that star formation is primarily affected by physical processes that act on smaller scales than the dust scale height, which lends support to local star formation models.

  11. SURFACE LAYER ACCRETION IN CONVENTIONAL AND TRANSITIONAL DISKS DRIVEN BY FAR-ULTRAVIOLET IONIZATION

    International Nuclear Information System (INIS)

    Perez-Becker, Daniel; Chiang, Eugene

    2011-01-01

    Whether protoplanetary disks accrete at observationally significant rates by the magnetorotational instability (MRI) depends on how well ionized they are. Disk surface layers ionized by stellar X-rays are susceptible to charge neutralization by small condensates, ranging from ∼0.01 μm sized grains to angstrom-sized polycyclic aromatic hydrocarbons (PAHs). Ion densities in X-ray-irradiated surfaces are so low that ambipolar diffusion weakens the MRI. Here we show that ionization by stellar far-ultraviolet (FUV) radiation enables full-blown MRI turbulence in disk surface layers. Far-UV ionization of atomic carbon and sulfur produces a plasma so dense that it is immune to ion recombination on grains and PAHs. The FUV-ionized layer, of thickness 0.01-0.1 g cm -2 , behaves in the ideal magnetohydrodynamic limit and can accrete at observationally significant rates at radii ∼> 1-10 AU. Surface layer accretion driven by FUV ionization can reproduce the trend of increasing accretion rate with increasing hole size seen in transitional disks. At radii ∼<1-10 AU, FUV-ionized surface layers cannot sustain the accretion rates generated at larger distance, and unless turbulent mixing of plasma can thicken the MRI-active layer, an additional means of transport is needed. In the case of transitional disks, it could be provided by planets.

  12. THE PDS 66 CIRCUMSTELLAR DISK AS SEEN IN POLARIZED LIGHT WITH THE GEMINI PLANET IMAGER

    International Nuclear Information System (INIS)

    Wolff, Schuyler G.; Greenbaum, Alexandra Z.; Perrin, Marshall; Hines, Dean C.; Millar-Blanchaer, Maxwell A.; Nielsen, Eric L.; Wang, Jason; Dong, Ruobing; Duchêne, Gaspard; Graham, James R.; Kalas, Paul; Cardwell, Andrew; Chilcote, Jeffrey; Draper, Zachary H.; Fitzgerald, Michael P.; Hung, Li-Wei; Goodsell, Stephen J.; Grady, Carol A.; Hartung, Markus; Hibon, Pascale

    2016-01-01

    We present H- and K-band imaging polarimetry for the PDS 66 circumstellar disk obtained during the commissioning of the Gemini Planet Imager (GPI). Polarization images reveal a clear detection of the disk in to the 0.″12 inner working angle (IWA) in the H band, almost three times closer to the star than the previous Hubble Space Telescope (HST) observations with NICMOS and STIS (0.″35 effective IWA). The centro-symmetric polarization vectors confirm that the bright inner disk detection is due to circumstellar scattered light. A more diffuse disk extends to a bright outer ring centered at 80 AU. We discuss several physical mechanisms capable of producing the observed ring + gap structure. GPI data confirm enhanced scattering on the east side of the disk that is inferred to be nearer to us. We also detect a lateral asymmetry in the south possibly due to shadowing from material within the IWA. This likely corresponds to a temporally variable azimuthal asymmetry observed in HST/STIS coronagraphic imaging

  13. THE PDS 66 CIRCUMSTELLAR DISK AS SEEN IN POLARIZED LIGHT WITH THE GEMINI PLANET IMAGER

    Energy Technology Data Exchange (ETDEWEB)

    Wolff, Schuyler G.; Greenbaum, Alexandra Z. [Department of Physics and Astronomy, Johns Hopkins University, Baltimore, MD 21218 (United States); Perrin, Marshall; Hines, Dean C. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Millar-Blanchaer, Maxwell A. [Department of Astronomy and Astrophysics, University of Toronto, Toronto, ON M5S 3H4 (Canada); Nielsen, Eric L. [Kavli Institute for Particle Astrophysics and Cosmology, Stanford University, Stanford, CA 94305 (United States); Wang, Jason; Dong, Ruobing; Duchêne, Gaspard; Graham, James R.; Kalas, Paul [Astronomy Department, University of California, Berkeley, Berkeley, CA 94720 (United States); Cardwell, Andrew [LBT Observatory, University of Arizona, 933 N. Cherry Avenue, Room 552, Tucson, AZ 85721 (United States); Chilcote, Jeffrey [Dunlap Institute for Astronomy and Astrophysics, University of Toronto, Toronto, ON M5S 3H4 (Canada); Draper, Zachary H. [University of Victoria, 3800 Finnerty Road, Victoria, BC V8P 5C2 (Canada); Fitzgerald, Michael P.; Hung, Li-Wei [Department of Physics and Astronomy, University of California, Los Angeles, 430 Portola Plaza, Los Angeles, CA 90095 (United States); Goodsell, Stephen J. [Gemini Observatory, 670 N. A’ohoku Place, Hilo, HI 96720 (United States); Grady, Carol A. [Eureka Scientific, 2452 Delmer, Suite 100, Oakland, CA 96002 (United States); Hartung, Markus; Hibon, Pascale, E-mail: swolff9@jh.edu [Gemini Observatory, Casilla 603, La Serena (Chile); and others

    2016-02-10

    We present H- and K-band imaging polarimetry for the PDS 66 circumstellar disk obtained during the commissioning of the Gemini Planet Imager (GPI). Polarization images reveal a clear detection of the disk in to the 0.″12 inner working angle (IWA) in the H band, almost three times closer to the star than the previous Hubble Space Telescope (HST) observations with NICMOS and STIS (0.″35 effective IWA). The centro-symmetric polarization vectors confirm that the bright inner disk detection is due to circumstellar scattered light. A more diffuse disk extends to a bright outer ring centered at 80 AU. We discuss several physical mechanisms capable of producing the observed ring + gap structure. GPI data confirm enhanced scattering on the east side of the disk that is inferred to be nearer to us. We also detect a lateral asymmetry in the south possibly due to shadowing from material within the IWA. This likely corresponds to a temporally variable azimuthal asymmetry observed in HST/STIS coronagraphic imaging.

  14. Rotating disk electrode system for elevated pressures and temperatures.

    Science.gov (United States)

    Fleige, M J; Wiberg, G K H; Arenz, M

    2015-06-01

    We describe the development and test of an elevated pressure and temperature rotating disk electrode (RDE) system that allows measurements under well-defined mass transport conditions. As demonstrated for the oxygen reduction reaction on polycrystalline platinum (Pt) in 0.5M H2SO4, the setup can easily be operated in a pressure range of 1-101 bar oxygen, and temperature of 140 °C. Under such conditions, diffusion limited current densities increase by almost two orders of magnitude as compared to conventional RDE setups allowing, for example, fuel cell catalyst studies under more realistic conditions. Levich plots demonstrate that the mass transport is indeed well-defined, i.e., at low electrode potentials, the measured current densities are fully diffusion controlled, while at higher potentials, a mixed kinetic-diffusion controlled regime is observed. Therefore, the setup opens up a new field for RDE investigations under temperature and current density conditions relevant for low and high temperature proton exchange membrane fuel cells.

  15. Rotating disk electrode system for elevated pressures and temperatures

    International Nuclear Information System (INIS)

    Fleige, M. J.; Wiberg, G. K. H.; Arenz, M.

    2015-01-01

    We describe the development and test of an elevated pressure and temperature rotating disk electrode (RDE) system that allows measurements under well-defined mass transport conditions. As demonstrated for the oxygen reduction reaction on polycrystalline platinum (Pt) in 0.5M H 2 SO 4 , the setup can easily be operated in a pressure range of 1–101 bar oxygen, and temperature of 140 °C. Under such conditions, diffusion limited current densities increase by almost two orders of magnitude as compared to conventional RDE setups allowing, for example, fuel cell catalyst studies under more realistic conditions. Levich plots demonstrate that the mass transport is indeed well-defined, i.e., at low electrode potentials, the measured current densities are fully diffusion controlled, while at higher potentials, a mixed kinetic-diffusion controlled regime is observed. Therefore, the setup opens up a new field for RDE investigations under temperature and current density conditions relevant for low and high temperature proton exchange membrane fuel cells

  16. Rotating disk electrode system for elevated pressures and temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Fleige, M. J.; Wiberg, G. K. H.; Arenz, M. [Department of Chemistry and Nano-Science Center, University of Copenhagen, Universitetsparken 5, 2100 Ø Copenhagen (Denmark)

    2015-06-15

    We describe the development and test of an elevated pressure and temperature rotating disk electrode (RDE) system that allows measurements under well-defined mass transport conditions. As demonstrated for the oxygen reduction reaction on polycrystalline platinum (Pt) in 0.5M H{sub 2}SO{sub 4}, the setup can easily be operated in a pressure range of 1–101 bar oxygen, and temperature of 140 °C. Under such conditions, diffusion limited current densities increase by almost two orders of magnitude as compared to conventional RDE setups allowing, for example, fuel cell catalyst studies under more realistic conditions. Levich plots demonstrate that the mass transport is indeed well-defined, i.e., at low electrode potentials, the measured current densities are fully diffusion controlled, while at higher potentials, a mixed kinetic-diffusion controlled regime is observed. Therefore, the setup opens up a new field for RDE investigations under temperature and current density conditions relevant for low and high temperature proton exchange membrane fuel cells.

  17. Rotating disk electrode system for elevated pressures and temperatures

    Science.gov (United States)

    Fleige, M. J.; Wiberg, G. K. H.; Arenz, M.

    2015-06-01

    We describe the development and test of an elevated pressure and temperature rotating disk electrode (RDE) system that allows measurements under well-defined mass transport conditions. As demonstrated for the oxygen reduction reaction on polycrystalline platinum (Pt) in 0.5M H2SO4, the setup can easily be operated in a pressure range of 1-101 bar oxygen, and temperature of 140 °C. Under such conditions, diffusion limited current densities increase by almost two orders of magnitude as compared to conventional RDE setups allowing, for example, fuel cell catalyst studies under more realistic conditions. Levich plots demonstrate that the mass transport is indeed well-defined, i.e., at low electrode potentials, the measured current densities are fully diffusion controlled, while at higher potentials, a mixed kinetic-diffusion controlled regime is observed. Therefore, the setup opens up a new field for RDE investigations under temperature and current density conditions relevant for low and high temperature proton exchange membrane fuel cells.

  18. DUST FILTRATION BY PLANET-INDUCED GAP EDGES: IMPLICATIONS FOR TRANSITIONAL DISKS

    International Nuclear Information System (INIS)

    Zhu Zhaohuan; Dong Ruobing; Nelson, Richard P.; Espaillat, Catherine; Hartmann, Lee

    2012-01-01

    By carrying out two-dimensional two-fluid global simulations, we have studied the response of dust to gap formation by a single planet in the gaseous component of a protoplanetary disk—the so-called dust filtration mechanism. We have found that a gap opened by a giant planet at 20 AU in an α = 0.01, M-dot =10 -8 M ☉ yr -1 disk can effectively stop dust particles larger than 0.1 mm drifting inward, leaving a submillimeter (submm) dust cavity/hole. However, smaller particles are difficult to filter by a gap induced by a several M J planet due to (1) dust diffusion and (2) a high gas accretion velocity at the gap edge. Based on these simulations, an analytic model is derived to understand what size particles can be filtered by the planet-induced gap edge. We show that a dimensionless parameter T s /α, which is the ratio between the dimensionless dust stopping time and the disk viscosity parameter, is important for the dust filtration process. Finally, with our updated understanding of dust filtration, we have computed Monte Carlo radiative transfer models with variable dust size distributions to generate the spectral energy distributions of disks with gaps. By comparing with transitional disk observations (e.g., GM Aur), we have found that dust filtration alone has difficulties depleting small particles sufficiently to explain the near-IR deficit of moderate M-dot transitional disks, except under some extreme circumstances. The scenario of gap opening by multiple planets studied previously suffers the same difficulty. One possible solution is to invoke both dust filtration and dust growth in the inner disk. In this scenario, a planet-induced gap filters large dust particles in the disk, and the remaining small dust particles passing to the inner disk can grow efficiently without replenishment from fragmentation of large grains. Predictions for ALMA have also been made based on all these scenarios. We conclude that dust filtration with planet(s) in the disk is a

  19. Accretion disks in active galactic nuclei

    International Nuclear Information System (INIS)

    Shields, G.A.

    1989-01-01

    Active galactic nuclei (AGN) have taunted astrophysicists for a quarter century. How do these objects produce huge luminosities---in some cases, far outshining our galaxy---from a region perhaps no larger than the solar system? Accretion onto supermassive black holes has been widely considered the best buy in theories of AGN. Much work has gone into accretion disk theory, searches for black holes in galactic nuclei, and observational tests. These efforts have not proved the disk model, but there is progress. Evidence for black holes in the nuclei of nearby galaxies is provided by observations of stellar velocities, and radiation from the disk's hot surface may be observed in the ultraviolet (UV) and neighboring spectral bands. In the review, the author describe some of the recent work on accretion disks in AGN, with an emphasis on points of contact between theory and observation

  20. Effect of massive disks on bulge isophotes

    International Nuclear Information System (INIS)

    Monet, D.G.; Richstone, D.O.; Schechter, P.L.

    1981-01-01

    Massive disks produce flattened equipotentials. Unless the stars in a galaxy bulge are preferentially hotter in the z direction than in the plane, the isophotes will be at least as flat as the equipotentials. The comparison of two galaxy models having flat rotation curves with the available surface photometry for five external galaxies does not restrict the mass fraction which might reside in the disk. However, star counts in our own Galaxy indicate that unless the disk terminates close to the solar circle, no more than half the mass within that circle lies in the disk. The remaining half must lie either in the bulge or, more probably, in a third dark, round, dynamically distinct component

  1. Gravitomagnetic acceleration from black hole accretion disks

    International Nuclear Information System (INIS)

    Poirier, J; Mathews, G J

    2016-01-01

    We demonstrate how the motion of the neutral masses in an accretion disk orbiting a black hole creates a general-relativistic magnetic-like (gravitomagnetic) field that vertically accelerates neutral particles near an accretion disk upward and then inward toward the axis of the accretion disk. Even though this gravitomagnetic field is not the only mechanism contributing to the production of jets, it presents a novel means to identify one general relativistic effect from a much more complicated problem. In addition, as the accelerated material above or below the accretion disk nears the axis with a nearly vertical direction, a frame-dragging effect twists the trajectories around the axis thus contributing to the collimation of the jet. (note)

  2. Gravitomagnetic acceleration from black hole accretion disks

    Science.gov (United States)

    Poirier, J.; Mathews, G. J.

    2016-05-01

    We demonstrate how the motion of the neutral masses in an accretion disk orbiting a black hole creates a general-relativistic magnetic-like (gravitomagnetic) field that vertically accelerates neutral particles near an accretion disk upward and then inward toward the axis of the accretion disk. Even though this gravitomagnetic field is not the only mechanism contributing to the production of jets, it presents a novel means to identify one general relativistic effect from a much more complicated problem. In addition, as the accelerated material above or below the accretion disk nears the axis with a nearly vertical direction, a frame-dragging effect twists the trajectories around the axis thus contributing to the collimation of the jet.

  3. Review of gravitomagnetic acceleration from accretion disks

    Science.gov (United States)

    Poirier, J.; Mathews, G. J.

    2015-11-01

    We review the development of the equations of gravitoelectromagnetism and summarize how the motion of the neutral masses in an accretion disk orbiting a black hole creates a general-relativistic magnetic-like (gravitomagnetic) field that vertically accelerates neutral particles near the accretion disk upward and then inward toward the axis of the accretion disk. Even though this gravitomagnetic field is not the only mechanism to produce collimated jets, it is a novel means to identify one general relativistic effect from a much more complicated problem. In addition, as the accelerated material above or below the accretion disk nears the axis with a nearly vertical direction, a frame-dragging effect twists the trajectories around the axis thus contributing to the collimation of the jet.

  4. CO Gas Inside the Protoplanetary Disk Cavity in HD 142527: Disk Structure from ALMA

    OpenAIRE

    Perez, S.; Casassus, S.; Ménard, F.; Roman, P.; van der Plas, G.; Cieza, L.; Pinte, C.; Christiaens, Valentin; Hales, A. S.

    2014-01-01

    Inner cavities and annular gaps in circumstellar disks are possible signposts of giant planet formation. The young star HD 142527 hosts a massive protoplanetary disk with a large cavity that extends up to 140 AU from the central star, as seen in continuum images at infrared and millimeter wavelengths. Estimates of the survival of gas inside disk cavities are needed to discriminate between clearing scenarios. We present a spatially and spectrally resolved carbon monoxide isotopologue 2-1 line ...

  5. Contact statuses between functionally graded brake disk and pure pad disk

    International Nuclear Information System (INIS)

    Shahzamanian, M.M.; Sahari, B.B.; Bayat, M.; Mustapha, F.; Ismarrubie, Z.N.; Shahrjerdi, A.

    2009-01-01

    Full text: The contact statuses between functionally graded (FG) brake disks and pure pad disk are investigated by using finite element method (FEM). Two types of variation is considered for FG brake disk, the variation of materials are considered change in radial and thickness direction of disk. The material properties of these two types of FG brake disks are assumed to be represented by power-law distributions in the radius and thickness direction. The results are obtained and then compared. For the radial FG brake disk, the inner and outer surfaces are considered metal and ceramic respectively, and friction coefficient between metal surface and ceramic surface of FG brake dick with pad are considered 1.4 and 0.75 respectively. For the thickness FG brake disk the contact surface with pure pad brake disk is ceramic and the free surface is metal and friction coefficient between ceramic (contact) surface and pure pad brake disk is considered 0.75. In both types of FG brake disks the Coulomb contact friction is applied. Mechanical response of FG brake disks are compared and verified with the known results in the literatures. Three types of contact statuses are introduced as Sticking, Contact and Near Contact. The contact status between pad and disk for different values for pad thickness, grading index,n , and percentage of friction coefficient (λ) is shown. It can be seen that for all values of percentage of friction coefficient,λ , and grading indices, n, by increasing the thickness of pad cause the contact status changes from sticking to contact and then to near contact. (author)

  6. EARTH, MOON, SUN, AND CV ACCRETION DISKS

    International Nuclear Information System (INIS)

    Montgomery, M. M.

    2009-01-01

    Net tidal torque by the secondary on a misaligned accretion disk, like the net tidal torque by the Moon and the Sun on the equatorial bulge of the spinning and tilted Earth, is suggested by others to be a source to retrograde precession in non-magnetic, accreting cataclysmic variable (CV) dwarf novae (DN) systems that show negative superhumps in their light curves. We investigate this idea in this work. We generate a generic theoretical expression for retrograde precession in spinning disks that are misaligned with the orbital plane. Our generic theoretical expression matches that which describes the retrograde precession of Earths' equinoxes. By making appropriate assumptions, we reduce our generic theoretical expression to those generated by others, or to those used by others, to describe retrograde precession in protostellar, protoplanetary, X-ray binary, non-magnetic CV DN, quasar, and black hole systems. We find that spinning, tilted CV DN systems cannot be described by a precessing ring or by a precessing rigid disk. We find that differential rotation and effects on the disk by the accretion stream must be addressed. Our analysis indicates that the best description of a retrogradely precessing spinning, tilted, CV DN accretion disk is a differentially rotating, tilted disk with an attached rotating, tilted ring located near the innermost disk annuli. In agreement with the observations and numerical simulations by others, we find that our numerically simulated CV DN accretion disks retrogradely precess as a unit. Our final, reduced expression for retrograde precession agrees well with our numerical simulation results and with selective observational systems that seem to have main-sequence secondaries. Our results suggest that a major source to retrograde precession is tidal torques like that by the Moon and the Sun on the Earth. In addition, these tidal torques should be common to a variety of systems where one member is spinning and tilted, regardless if

  7. Disk partition function and oscillatory rolling tachyons

    International Nuclear Information System (INIS)

    Jokela, Niko; Jaervinen, Matti; Keski-Vakkuri, Esko; Majumder, Jaydeep

    2008-01-01

    An exact cubic open string field theory rolling tachyon solution was recently found by Kiermaier et al and Schnabl. This oscillatory solution has been argued to be related by a field redefinition to the simple exponential rolling tachyon deformation of boundary conformal theory. In the latter approach, the disk partition function takes a simple form. Out of curiosity, we compute the disk partition function for an oscillatory tachyon profile, and find that the result is nevertheless almost the same

  8. CLUSTER DYNAMICS LARGELY SHAPES PROTOPLANETARY DISK SIZES

    Energy Technology Data Exchange (ETDEWEB)

    Vincke, Kirsten; Pfalzner, Susanne, E-mail: kvincke@mpifr-bonn.mpg.de [Max Planck Institute for Radio Astronomy, Auf dem Hügel 69, D-53121 Bonn (Germany)

    2016-09-01

    To what degree the cluster environment influences the sizes of protoplanetary disks surrounding young stars is still an open question. This is particularly true for the short-lived clusters typical for the solar neighborhood, in which the stellar density and therefore the influence of the cluster environment change considerably over the first 10 Myr. In previous studies, the effect of the gas on the cluster dynamics has often been neglected; this is remedied here. Using the code NBody6++, we study the stellar dynamics in different developmental phases—embedded, expulsion, and expansion—including the gas, and quantify the effect of fly-bys on the disk size. We concentrate on massive clusters (M {sub cl} ≥ 10{sup 3}–6 ∗ 10{sup 4} M {sub Sun}), which are representative for clusters like the Orion Nebula Cluster (ONC) or NGC 6611. We find that not only the stellar density but also the duration of the embedded phase matters. The densest clusters react fastest to the gas expulsion and drop quickly in density, here 98% of relevant encounters happen before gas expulsion. By contrast, disks in sparser clusters are initially less affected, but because these clusters expand more slowly, 13% of disks are truncated after gas expulsion. For ONC-like clusters, we find that disks larger than 500 au are usually affected by the environment, which corresponds to the observation that 200 au-sized disks are common. For NGC 6611-like clusters, disk sizes are cut-down on average to roughly 100 au. A testable hypothesis would be that the disks in the center of NGC 6611 should be on average ≈20 au and therefore considerably smaller than those in the ONC.

  9. Capillary condensation between disks in two dimensions

    OpenAIRE

    Gil, Tamir; Ipsen, John Hjorth

    1997-01-01

    Capillary condensation between two two-dimensional wetted circular substrates (disks) is studied by an effective free energy description of the wetting interface. The interfacial free-energy potential is developed on the basis of the theory for the wetting of a single disk, where interfacial capillary fluctuations play a dominant role. A simple approximative analytical expression of the interfacial free energy is developed and is validated numerically. The capillary condensation is characteri...

  10. A New M Dwarf Debris Disk Candidate in a Young Moving Group Discovered with Disk Detective

    Science.gov (United States)

    Silverberg, Steven M.; Kuchner, Marc J.; Wisniewski, John P.; Gagne, Jonathan; Bans, Alissa S.; Bhattacharjee, Shambo; Currie, Thayne R.; Debes, John R.; Biggs, Joseph R; Bosch, Milton

    2016-01-01

    We used the Disk Detective citizen science project and the BANYAN II Bayesian analysis tool to identify a new candidate member of a nearby young association with infrared excess. WISE J080822.18-644357.3, an M5.5-type debris disk system with significant excess at both 12 and 22 microns, is a likely member (approx.90% BANYAN II probability) of the approx.45 Myr old Carina association. Since this would be the oldest M dwarf debris disk detected in a moving group, this discovery could be an important constraint on our understanding of M dwarf debris disk evolution.

  11. YottaYotta announces new world record set for TCP disk-to-disk bulk transfer

    CERN Document Server

    2002-01-01

    The Yottabyte NetStorage(TM) Company, today announced a new world record for TCP disk-to-disk data transfer using the company's NetStorager(R) System. The record-breaking demonstration transferred 5 terabytes of data between Chicago, Il. to Vancouver, BC and Ottawa, ON, at a sustained average throughput of 11.1 gigabits per second. Peak throughput exceeded 11.6 gigabits per second, more than 15-times faster than previous records for TCP transfer from disk-to-disk (1 page).

  12. Empirical Temperature Measurement in Protoplanetary Disks

    Science.gov (United States)

    Weaver, Erik; Isella, Andrea; Boehler, Yann

    2018-02-01

    The accurate measurement of temperature in protoplanetary disks is critical to understanding many key features of disk evolution and planet formation, from disk chemistry and dynamics, to planetesimal formation. This paper explores the techniques available to determine temperatures from observations of single, optically thick molecular emission lines. Specific attention is given to issues such as the inclusion of optically thin emission, problems resulting from continuum subtraction, and complications of real observations. Effort is also made to detail the exact nature and morphology of the region emitting a given line. To properly study and quantify these effects, this paper considers a range of disk models, from simple pedagogical models to very detailed models including full radiative transfer. Finally, we show how the use of the wrong methods can lead to potentially severe misinterpretations of data, leading to incorrect measurements of disk temperature profiles. We show that the best way to estimate the temperature of emitting gas is to analyze the line peak emission map without subtracting continuum emission. Continuum subtraction, which is commonly applied to observations of line emission, systematically leads to underestimation of the gas temperature. We further show that once observational effects such as beam dilution and noise are accounted for, the line brightness temperature derived from the peak emission is reliably within 10%–15% of the physical temperature of the emitting region, assuming optically thick emission. The methodology described in this paper will be applied in future works to constrain the temperature, and related physical quantities, in protoplanetary disks observed with ALMA.

  13. Stratified Simulations of Collisionless Accretion Disks

    Energy Technology Data Exchange (ETDEWEB)

    Hirabayashi, Kota; Hoshino, Masahiro, E-mail: hirabayashi-k@eps.s.u-tokyo.ac.jp [Department of Earth and Planetary Science, The University of Tokyo, Tokyo, 113-0033 (Japan)

    2017-06-10

    This paper presents a series of stratified-shearing-box simulations of collisionless accretion disks in the recently developed framework of kinetic magnetohydrodynamics (MHD), which can handle finite non-gyrotropy of a pressure tensor. Although a fully kinetic simulation predicted a more efficient angular-momentum transport in collisionless disks than in the standard MHD regime, the enhanced transport has not been observed in past kinetic-MHD approaches to gyrotropic pressure anisotropy. For the purpose of investigating this missing link between the fully kinetic and MHD treatments, this paper explores the role of non-gyrotropic pressure and makes the first attempt to incorporate certain collisionless effects into disk-scale, stratified disk simulations. When the timescale of gyrotropization was longer than, or comparable to, the disk-rotation frequency of the orbit, we found that the finite non-gyrotropy selectively remaining in the vicinity of current sheets contributes to suppressing magnetic reconnection in the shearing-box system. This leads to increases both in the saturated amplitude of the MHD turbulence driven by magnetorotational instabilities and in the resultant efficiency of angular-momentum transport. Our results seem to favor the fast advection of magnetic fields toward the rotation axis of a central object, which is required to launch an ultra-relativistic jet from a black hole accretion system in, for example, a magnetically arrested disk state.

  14. Transport coefficients for dense hard-disk systems.

    Science.gov (United States)

    García-Rojo, Ramón; Luding, Stefan; Brey, J Javier

    2006-12-01

    A study of the transport coefficients of a system of elastic hard disks based on the use of Helfand-Einstein expressions is reported. The self-diffusion, the viscosity, and the heat conductivity are examined with averaging techniques especially appropriate for event-driven molecular dynamics algorithms with periodic boundary conditions. The density and size dependence of the results are analyzed, and comparison with the predictions from Enskog's theory is carried out. In particular, the behavior of the transport coefficients in the vicinity of the fluid-solid transition is investigated and a striking power law divergence of the viscosity with density is obtained in this region, while all other examined transport coefficients show a drop in that density range in relation to the Enskog's prediction. Finally, the deviations are related to shear band instabilities and the concept of dilatancy.

  15. HD95881 : a gas rich to gas poor transition disk?

    NARCIS (Netherlands)

    Verhoeff, A. P.; Min, M.; Acke, B.; van Boekel, R.; Pantin, E.; Waters, L. B. F. M.; Tielens, A. G. G. M.; van den Ancker, M. E.; Mulders, G. D.; de Koter, A.; Bouwman, J.

    2010-01-01

    Context. Based on the far infrared excess the Herbig class of stars is divided into a group with flaring circumstellar disks (group I) and a group with flat circumstellar disks (group II). Dust sedimentation is generally proposed as an evolution mechanism to transform flaring disks into flat disks.

  16. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  17. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  18. Head-Disk Interface Technology: Challenges and Approaches

    Science.gov (United States)

    Liu, Bo

    Magnetic hard disk drive (HDD) technology is believed to be one of the most successful examples of modern mechatronics systems. The mechanical beauty of magnetic HDD includes simple but super high accuracy positioning head, positioning technology, high speed and stability spindle motor technology, and head-disk interface technology which keeps the millimeter sized slider flying over a disk surface at nanometer level slider-disk spacing. This paper addresses the challenges and possible approaches on how to further reduce the slider disk spacing whilst retaining the stability and robustness level of head-disk systems for future advanced magnetic disk drives.

  19. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  20. A High-mass Protobinary System with Spatially Resolved Circumstellar Accretion Disks and Circumbinary Disk

    Energy Technology Data Exchange (ETDEWEB)

    Kraus, S.; Kluska, J.; Kreplin, A.; Bate, M.; Harries, T. J.; Hone, E.; Anugu, A. [School of Physics, Astrophysics Group, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom); Hofmann, K.-H.; Weigelt, G. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Monnier, J. D. [Department of Astronomy, University of Michigan, 311 West Hall, 1085 South University Avenue, Ann Arbor, MI 48109 (United States); De Wit, W. J. [ESO, Alonso de Cordova 3107, Vitacura, Santiago 19 (Chile); Wittkowski, M., E-mail: skraus@astro.ex.ac.uk [ESO, Karl-Schwarzschild-Str. 2, D-85748 Garching bei München (Germany)

    2017-01-20

    High-mass multiples might form via fragmentation of self-gravitational disks or alternative scenarios such as disk-assisted capture. However, only a few observational constraints exist on the architecture and disk structure of high-mass protobinaries and their accretion properties. Here, we report the discovery of a close (57.9 ± 0.2 mas = 170 au) high-mass protobinary, IRAS17216-3801, where our VLTI/GRAVITY+AMBER near-infrared interferometry allows us to image the circumstellar disks around the individual components with ∼3 mas resolution. We estimate the component masses to ∼20 and ∼18 M {sub ⊙} and find that the radial intensity profiles can be reproduced with an irradiated disk model, where the inner regions are excavated of dust, likely tracing the dust sublimation region in these disks. The circumstellar disks are strongly misaligned with respect to the binary separation vector, which indicates that the tidal forces did not have time to realign the disks, pointing toward a young dynamical age of the system. We constrain the distribution of the Br γ and CO-emitting gas using VLTI/GRAVITY spectro-interferometry and VLT/CRIRES spectro-astrometry and find that the secondary is accreting at a higher rate than the primary. VLT/NACO imaging shows L ′-band emission on (3–4)× larger scales than the binary separation, matching the expected dynamical truncation radius for the circumbinary disk. The IRAS17216-3801 system is ∼3× more massive and ∼5× more compact than other high-mass multiplies imaged at infrared wavelength and the first high-mass protobinary system where circumstellar and circumbinary dust disks could be spatially resolved. This opens exciting new opportunities for studying star–disk interactions and the role of multiplicity in high-mass star formation.

  1. THE SPITZER INFRARED SPECTROGRAPH SURVEY OF PROTOPLANETARY DISKS IN ORION A. I. DISK PROPERTIES

    Energy Technology Data Exchange (ETDEWEB)

    Kim, K. H. [Korea Astronomy and Space Science Institute (KASI), 776, Daedeokdae-ro, Yuseong-gu, Daejeon 305-348 (Korea, Republic of); Watson, Dan M.; Manoj, P.; Forrest, W. J. [Department of Physics and Astronomy, University of Rochester, Rochester, NY 14627 (United States); Furlan, Elise [Infrared Processing and Analysis Center, Caltech, 770 S. Wilson Avenue, Pasadena, CA 91125 (United States); Najita, Joan [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Sargent, Benjamin [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Dr., Rochester, NY 14623 (United States); Hernández, Jesús [Centro de Investigaciones de Astronomía, Apdo. Postal 264, Mérida 5101-A (Venezuela, Bolivarian Republic of); Calvet, Nuria [Department of Astronomy, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States); Adame, Lucía [Facultad de Ciencias Físico-Matemáticas, Universidad Autónoma de Nuevo León, Av. Universidad S/N, San Nicolás de los Garza, Nuevo León, C.P. 66451, México (Mexico); Espaillat, Catherine [Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Megeath, S. T. [Ritter Astrophysical Research Center, Department of Physics and Astronomy, University of Toledo, 2801 W. Bancroft St., Toledo, OH 43606 (United States); Muzerolle, James, E-mail: quarkosmos@kasi.re.kr [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); and others

    2016-09-01

    We present our investigation of 319 Class II objects in Orion A observed by Spitzer /IRS. We also present the follow-up observations of 120 of these Class II objects in Orion A from the Infrared Telescope Facility/SpeX. We measure continuum spectral indices, equivalent widths, and integrated fluxes that pertain to disk structure and dust composition from IRS spectra of Class II objects in Orion A. We estimate mass accretion rates using hydrogen recombination lines in the SpeX spectra of our targets. Utilizing these properties, we compare the distributions of the disk and dust properties of Orion A disks with those of Taurus disks with respect to position within Orion A (Orion Nebular Cluster [ONC] and L1641) and with the subgroups by the inferred radial structures, such as transitional disks (TDs) versus radially continuous full disks (FDs). Our main findings are as follows. (1) Inner disks evolve faster than the outer disks. (2) The mass accretion rates of TDs and those of radially continuous FDs are statistically significantly displaced from each other. The median mass accretion rate of radially continuous disks in the ONC and L1641 is not very different from that in Taurus. (3) Less grain processing has occurred in the disks in the ONC compared to those in Taurus, based on analysis of the shape index of the 10 μ m silicate feature ( F {sub 11.3}/ F {sub 9.8}). (4) The 20–31 μ m continuum spectral index tracks the projected distance from the most luminous Trapezium star, θ {sup 1} Ori C. A possible explanation is UV ablation of the outer parts of disks.

  2. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  3. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  4. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  5. RADIALLY MAGNETIZED PROTOPLANETARY DISK: VERTICAL PROFILE

    International Nuclear Information System (INIS)

    Russo, Matthew; Thompson, Christopher

    2015-01-01

    This paper studies the response of a thin accretion disk to an external radial magnetic field. Our focus is on protoplanetary disks (PPDs), which are exposed during their later evolution to an intense, magnetized wind from the central star. A radial magnetic field is mixed into a thin surface layer, wound up by the disk shear, and pushed downward by a combination of turbulent mixing and ambipolar and ohmic drift. The toroidal field reaches much greater strengths than the seed vertical field that is usually invoked in PPD models, even becoming superthermal. Linear stability analysis indicates that the disk experiences the magnetorotational instability (MRI) at a higher magnetization than a vertically magnetized disk when both the effects of ambipolar and Hall drift are taken into account. Steady vertical profiles of density and magnetic field are obtained at several radii between 0.06 and 1 AU in response to a wind magnetic field B r ∼ (10 −4 –10 −2 )(r/ AU) −2 G. Careful attention is given to the radial and vertical ionization structure resulting from irradiation by stellar X-rays. The disk is more strongly magnetized closer to the star, where it can support a higher rate of mass transfer. As a result, the inner ∼1 AU of a PPD is found to evolve toward lower surface density. Mass transfer rates around 10 −8 M ⊙ yr −1 are obtained under conservative assumptions about the MRI-generated stress. The evolution of the disk and the implications for planet migration are investigated in the accompanying paper

  6. RADIALLY MAGNETIZED PROTOPLANETARY DISK: VERTICAL PROFILE

    Energy Technology Data Exchange (ETDEWEB)

    Russo, Matthew [Department of Physics, University of Toronto, 60 St. George St., Toronto, ON M5S 1A7 (Canada); Thompson, Christopher [Canadian Institute for Theoretical Astrophysics, 60 St. George St., Toronto, ON M5S 3H8 (Canada)

    2015-11-10

    This paper studies the response of a thin accretion disk to an external radial magnetic field. Our focus is on protoplanetary disks (PPDs), which are exposed during their later evolution to an intense, magnetized wind from the central star. A radial magnetic field is mixed into a thin surface layer, wound up by the disk shear, and pushed downward by a combination of turbulent mixing and ambipolar and ohmic drift. The toroidal field reaches much greater strengths than the seed vertical field that is usually invoked in PPD models, even becoming superthermal. Linear stability analysis indicates that the disk experiences the magnetorotational instability (MRI) at a higher magnetization than a vertically magnetized disk when both the effects of ambipolar and Hall drift are taken into account. Steady vertical profiles of density and magnetic field are obtained at several radii between 0.06 and 1 AU in response to a wind magnetic field B{sub r} ∼ (10{sup −4}–10{sup −2})(r/ AU){sup −2} G. Careful attention is given to the radial and vertical ionization structure resulting from irradiation by stellar X-rays. The disk is more strongly magnetized closer to the star, where it can support a higher rate of mass transfer. As a result, the inner ∼1 AU of a PPD is found to evolve toward lower surface density. Mass transfer rates around 10{sup −8} M{sub ⊙} yr{sup −1} are obtained under conservative assumptions about the MRI-generated stress. The evolution of the disk and the implications for planet migration are investigated in the accompanying paper.

  7. The age of the galactic disk

    International Nuclear Information System (INIS)

    Sandage, A.

    1988-07-01

    The galactic disk is a dissipative structure and must, therefore be younger than the halo if galaxy formation generally proceeds by collapse. Just how much younger the oldest stars in the galactic disk are than the oldest halo stars remains an open question. A fast collapse (on a time scale no longer than the rotation period of the extended protogalaxy) permits an age gap of the order of approximately 10 to the 9th power years. A slow collapse, governed by the cooling rate of the partially pressure supported falling gas that formed into what is now the thick stellar disk, permits a longer age gap, claimed by some to be as long as 6 Gyr. Early methods of age dating the oldest components of the disk contain implicit assumptions concerning the details of the age-metallicity relation for stars in the solar neighborhood. The discovery that this relation for open clusters outside the solar circle is different that in the solar neighborhood (Geisler 1987), complicates the earlier arguments. The oldest stars in the galactic disk are at least as old as NGC 188. The new data by Janes on NGC 6791, shown first at this conference, suggest a disk age of at least 12.5 Gyr, as do data near the main sequence termination point of metal rich, high proper motion stars of low orbital eccentricity. Hence, a case can still be made that the oldest part of the galactic thick disk is similar in age to the halo globular clusters, if their ages are the same as 47 Tuc

  8. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  9. The Tilt between Acretion Disk and Stellar Disk Shiyin Shen1,2 ...

    Indian Academy of Sciences (India)

    80 Nandan Road, Shanghai 200030, China. 2Key Lab for Astrophysics, Shanghai 200234, China. ∗ e-mail: ssy@shao.ac.cn. Abstract. The orientations .... shows the model prediction from the stellar dust model (section 5). 4. Result: The tilt between the accretion disk and stellar disk. We parameterize the inclinations of the ...

  10. Cold disks : Spitzer spectroscopy of disks around young stars with large gaps

    NARCIS (Netherlands)

    Blake, G. A.; Dullemond, C. P.; Merin, B.; Augereau, J. C.; Boogert, A. C. A.; Evans, N. J.; Geers, V. C.; Lahuis, F.; Kessler-Silacci, J. E.; Pontoppidan, K. M.; van Dishoeck, E. F.; Brown, J.M.

    2007-01-01

    We have identified four circumstellar disks with a deficit of dust emission from their inner 15-50 AU. All four stars have F-G spectral type and were uncovered as part of the Spitzer Space Telescope "Cores to Disks" Legacy Program Infrared Spectrograph (IRS) first-look survey of similar to 100 pre -

  11. Equilibrium configuration of a stratus floating above accretion disks: Full-disk calculation

    Science.gov (United States)

    Itanishi, Yusuke; Fukue, Jun

    2017-06-01

    We examine floating strati above a luminous accretion disk, supported by the radiative force from the entire disk, and calculate the equilibrium locus, which depends on the disk luminosity and the optical depth of the stratus. Due to the radiative transfer effect (albedo effect), the floating height of the stratus with a finite optical depth generally becomes high, compared with the particle case. In contrast to the case of the near-disk approximation, moreover, the floating height becomes yet higher in the present full-disk calculation, since the intense radiation from the inner disk is taken into account. As a result, when the disk luminosity normalized by the Eddington luminosity is ˜0.3 and the stratus optical depth is around unity, the stable configuration disappears at around r ˜ 50 rg, rg being the Schwarzschild radius, and the stratus would be blown off as a cloudy wind consisting of many strati with appropriate conditions. This luminosity is sufficiently smaller than the Eddington one, and the present results suggest that the radiation-driven cloudy wind can be easily blown off from the sub-Eddington disk, and this can explain various outflows observed in ultra-fast outflow objects as well as in broad-absorption-line quasars.

  12. Multipassage diffuser

    International Nuclear Information System (INIS)

    Lalis, A.; Rouviere, R.; Simon, G.

    1976-01-01

    A multipassage diffuser having 2p passages comprises a leak-tight cylindrical enclosure closed by a top cover and a bottom end-wall, parallel porous tubes which are rigidly assembled in sectors between tube plates and through which the gas mixture flows, the tube sectors being disposed at uniform intervals on the periphery of the enclosure. The top tube plates are rigidly fixed to an annular header having the shape of a half-torus and adapted to communicate with the tubes of the corresponding sector. Each passage is constituted by a plurality of juxtaposed sectors in which the mixture circulates in the same direction, the header being divided into p portions limited by radial partition-walls and each constituting two adjacent passages. The diffuser is provided beneath the bottom end-wall with p-1 leak-tight chambers each adapted to open into two different portions of the header, and with two collector-chambers each fitted with a nozzle for introducing the gas mixture and discharging the fraction of the undiffused mixture. By means of a central orifice formed in the bottom end-wall the enclosure communicates with a shaft for discharging the diffused fraction of the gas mixture

  13. SURFACE LAYER ACCRETION IN TRANSITIONAL AND CONVENTIONAL DISKS: FROM POLYCYCLIC AROMATIC HYDROCARBONS TO PLANETS

    International Nuclear Information System (INIS)

    Perez-Becker, Daniel; Chiang, Eugene

    2011-01-01

    'Transitional' T Tauri disks have optically thin holes with radii ∼>10 AU, yet accrete up to the median T Tauri rate. Multiple planets inside the hole can torque the gas to high radial speeds over large distances, reducing the local surface density while maintaining accretion. Thus multi-planet systems, together with reductions in disk opacity due to grain growth, can explain how holes can be simultaneously transparent and accreting. There remains the problem of how outer disk gas diffuses into the hole. Here it has been proposed that the magnetorotational instability (MRI) erodes disk surface layers ionized by stellar X-rays. In contrast to previous work, we find that the extent to which surface layers are MRI-active is limited not by ohmic dissipation but by ambipolar diffusion, the latter measured by Am: the number of times a neutral hydrogen molecule collides with ions in a dynamical time. Simulations by Hawley and Stone showed that Am ∼ 100 is necessary for ions to drive MRI turbulence in neutral gas. We calculate that in X-ray-irradiated surface layers, Am typically varies from ∼10 -3 to 1, depending on the abundance of charge-adsorbing polycyclic aromatic hydrocarbons, whose properties we infer from Spitzer observations. We conclude that ionization of H 2 by X-rays and cosmic rays can sustain, at most, only weak MRI turbulence in surface layers 1-10 g cm -2 thick, and that accretion rates in such layers are too small compared to observed accretion rates for the majority of disks.

  14. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  16. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  18. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  19. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  20. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  3. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  4. Preparation of thin actinide metal disks using a multiple disk casting technique

    International Nuclear Information System (INIS)

    Conner, W.V.

    1975-01-01

    A casting technique has been developed for preparing multiple actinide metal disks which have a minimum thickness of 0.006 inch. This technique was based on an injection casting procedure which utilizes the weight of a tantalum metal rod to force the molten metal into the mold cavity. Using the proper mold design and casting parameters, it has been possible to prepare ten 1/2 inch diameter neptunium or plutonium metal disks in a single casting, This casting technique is capable of producing disks which are very uniform. The average thickness of the disks from a typical casting will vary no more than 0.001 inch and the variation in the thickness of the individual disks will range from 0.0001 to 0.0005 inch. (Auth.)

  5. Preparation of thin actinide metal disks using a multiple disk casting technique

    International Nuclear Information System (INIS)

    Conner, W.V.

    1976-01-01

    A casting technique has been developed for preparing multiple actinide metal disks which have a minimum thickness of 0.006 inch. This technique was based on an injection casting procedure which utilizes the weight of a tantalum metal rod to force the molten metal into the mold cavity. Using the proper mold design and casting parameters, it has been possible to prepare ten 1/2 inch diameter neptunium or plutonium metal disks in a single casting. This casting technique is capable of producing disks which are very uniform. The average thickness of the disks from a typical casting will vary no more than 0.001 inch and the variation in the thickness of the individual disks will range from 0.0001 to 0.0005 inch. (author)

  6. Manipulation of magnetic vortex parameters in disk-on-disk nanostructures with various geometry

    Directory of Open Access Journals (Sweden)

    Maxim E. Stebliy

    2015-03-01

    Full Text Available Magnetic nanostructures in the form of a sandwich consisting of two permalloy (Py disks with diameters of 600 and 200 nm separated by a nonmagnetic interlayer are studied. Magnetization reversal of the disk-on-disk nanostructures depends on the distance between centers of the small and big disks and on orientation of an external magnetic field applied during measurements. It is found that manipulation of the magnetic vortex chirality and the trajectory of the vortex core in the big disk is only possible in asymmetric nanostructures. Experimentally studied peculiarities of a motion path of the vortex core and vortex parameters by the magneto-optical Kerr effect (MOKE magnetometer are supported by the magnetic force microscopy imaging and micromagnetic simulations.

  7. Probing Protoplanetary Disks: From Birth to Planets

    Science.gov (United States)

    Cox, Erin Guilfoil

    2018-01-01

    Disks are very important in the evolution of protostars and their subsequent planets. How early disks can form has implications for early planet formation. In the youngest protostars (i.e., Class 0 sources) magnetic fields can control disk growth. When the field is parallel to the collapsing core’s rotation axis, infalling material loses angular momentum and disks form in later stages. Sub-/millimeter polarization continuum observations of Class 0 sources at ~1000 au resolution support this idea. However, in the inner (~100 au), denser regions, it is unknown if the polarization only traces aligned dust grains. Recent theoretical studies have shown that self-scattering of thermal emission in the disk may contribute significantly to the polarization. Determining the scattering contribution in these sources is important to disentangle the magnetic field. At older times (the Class II phase), the disk structure can both act as a modulator and signpost of planet formation, if there is enough of a mass reservoir. In my dissertation talk, I will present results that bear on disk evolution at both young and late ages. I will present 8 mm polarization results of two Class 0 protostars (IRAS 4A and IC348 MMS) from the VLA at ~50 au resolution. The inferred magnetic field of IRAS 4A has a circular morphology, reminiscent of material being dragged into a rotating structure. I will show results from SOFIA polarization data of the area surrounding IRAS 4A at ~4000 au. I will also present ALMA 850 micron polarization data of ten protostars in the Perseus Molecular Cloud. Most of these sources show very ordered patterns and low (~0.5%) polarization in their inner regions, while having very disordered patterns and high polarization patterns in their extended emission that may suggest different mechanisms in the inner/outer regions. Finally, I will present results from our ALMA dust continuum survey of protoplanetary disks in Rho Ophiuchus; we measured both the sizes and fluxes of

  8. Hydraulic jumps in ''viscous'' accretion disks

    International Nuclear Information System (INIS)

    Michel, F.C.

    1984-01-01

    We propose that the dissipative process necessary for rapid accretion disk evolution is driven by hydraulic jump waves on the surface of the disk. These waves are excited by the asymmetric nature of the central rotator (e.g., neutron star magnetosphere) and spiral out into the disk to form a pattern corotating with the central object. Disk matter in turn is slowed slightly at each encounter with the jump and spirals inward. In this process, the disk is heated by true turbulence produced in the jumps. Additional effects, such as a systematic misalignment of the magnetic moment of the neutron star until it is nearly orthogonal, and systematic distortion of the magnetosphere in such a way as to form an even more asymmetric central ''paddle wheel'' may enhance the interaction with inflowing matter. The application to X-ray sources corresponds to the ''slow'' solutions of Ghosh and Lamb, and therefore to rms magnetic fields of about 4 x 10 10 gauss. Analogous phenomena have been proposed to act in the formation of galactic spiral structure

  9. IONIZATION AND DUST CHARGING IN PROTOPLANETARY DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Ivlev, A. V.; Caselli, P. [Max-Planck-Institut für Extraterrestrische Physik, Giessenbachstr. 1, D-85748 Garching (Germany); Akimkin, V. V., E-mail: ivlev@mpe.mpg.de [Institute of Astronomy of the Russian Academy of Sciences, Pyatnitskaya Street 48, 119017 Moscow (Russian Federation)

    2016-12-10

    Ionization–recombination balance in dense interstellar and circumstellar environments is a key factor for a variety of important physical processes, such as chemical reactions, dust charging and coagulation, coupling of the gas with magnetic field, and development of instabilities in protoplanetary disks. We determine a critical gas density above which the recombination of electrons and ions on the grain surface dominates over the gas-phase recombination. For this regime, we present a self-consistent analytical model, which allows us to calculate exactly the abundances of charged species in dusty gas, without making assumptions on the grain charge distribution. To demonstrate the importance of the proposed approach, we check whether the conventional approximation of low grain charges is valid for typical protoplanetary disks, and discuss the implications for dust coagulation and development of the “dead zone” in the disk. The presented model is applicable for arbitrary grain-size distributions and, for given dust properties and conditions of the disk, has only one free parameter—the effective mass of the ions, shown to have a small effect on the results. The model can be easily included in numerical simulations following the dust evolution in dense molecular clouds and protoplanetary disks.

  10. Chemical Evolution of a Protoplanetary Disk

    Science.gov (United States)

    Semenov, Dmitry A.

    2011-12-01

    In this paper we review recent progress in our understanding of the chemical evolution of protoplanetary disks. Current observational constraints and theoretical modeling on the chemical composition of gas and dust in these systems are presented. Strong variations of temperature, density, high-energy radiation intensities in these disks, both radially and vertically, result in a peculiar disk chemical structure, where a variety of processes are active. In hot, dilute and heavily irradiated atmosphere only the most photostable simple radicals and atoms and atomic ions exist, formed by gas-phase processes. Beneath the atmosphere a partly UV-shielded, warm molecular layer is located, where high-energy radiation drives rich ion-molecule and radical-radical chemistry, both in the gas phase and on dust surfaces. In a cold, dense, dark disk midplane many molecules are frozen out, forming thick icy mantles where surface chemistry is active and where complex polyatomic (organic) species are synthesized. Dynamical processes affect disk chemical composition by enriching it in abundances of complex species produced via slow surface processes, which will become detectable with ALMA.

  11. Theory of Disk-to-Vesicle Transformation

    Science.gov (United States)

    Li, Jianfeng; Shi, An-Chang

    2009-03-01

    Self-assembled membranes from amphiphilic molecules, such as lipids and block copolymers, can assume a variety of morphologies dictated by energy minimization of system. The membrane energy is characterized by a bending modulus (κ), a Gaussian modulus (κG), and the line tension (γ) of the edge. Two basic morphologies of membranes are flat disks that minimize the bending energy at the cost of the edge energy, and enclosed vesicles that minimize the edge energy at the cost of bending energy. In our work, the transition from disk to vesicle is studied theoretically using the string method, which is designed to find the minimum energy path (MEP) or the most probable transition path between two local minima of an energy landscape. Previous studies of disk-to-vesicle transition usually approximate the transitional states by a series of spherical cups, and found that the spherical cups do not correspond to stable or meta-stable states of the system. Our calculation demonstrates that the intermediate shapes along the MEP are very different from spherical cups. Furthermore, some of these transitional states can be meta-stable. The disk-to-vesicle transition pathways are governed by two scaled parameters, κG/κ and γR0/4κ, where R0 is the radius of the disk. In particular, a meta-stable intermediate state is predicted, which may correspond to the open morphologies observed in experiments and simulations.

  12. HOT GAS HALOS AROUND DISK GALAXIES: CONFRONTING COSMOLOGICAL SIMULATIONS WITH OBSERVATIONS

    International Nuclear Information System (INIS)

    Rasmussen, Jesper; Sommer-Larsen, Jesper; Pedersen, Kristian; Toft, Sune; Grove, Lisbeth F.; Benson, Andrew; Bower, Richard G.

    2009-01-01

    Models of disk galaxy formation commonly predict the existence of an extended reservoir of accreted hot gas surrounding massive spirals at low redshift. As a test of these models, we use X-ray and Hα data of the two massive, quiescent edge-on spirals NGC 5746 and NGC 5170 to investigate the amount and origin of any hot gas in their halos. Contrary to our earlier claim, the Chandra analysis of NGC 5746, employing more recent calibration data, does not reveal any significant evidence for diffuse X-ray emission outside the optical disk, with a 3σ upper limit to the halo X-ray luminosity of 4 x 10 39 erg s -1 . An identical study of the less massive NGC 5170 also fails to detect any extraplanar X-ray emission. By extracting hot halo properties of disk galaxies formed in cosmological hydrodynamical simulations, we compare these results to expectations for cosmological accretion of hot gas by spirals. For Milky-Way-sized galaxies, these high-resolution simulations predict hot halo X-ray luminosities which are lower by a factor of ∼2 compared to our earlier results reported by Toft et al. We find the new simulation predictions to be consistent with our observational constraints for both NGC 5746 and NGC 5170, while also confirming that the hot gas detected so far around more actively star-forming spirals is in general probably associated with stellar activity in the disk. Observational results on quiescent disk galaxies at the high-mass end are nevertheless providing powerful constraints on theoretical predictions, and hence on the assumed input physics in numerical studies of disk galaxy formation and evolution.

  13. EVOLUTION OF WARPED ACCRETION DISKS IN ACTIVE GALACTIC NUCLEI. I. ROLES OF FEEDING AT THE OUTER BOUNDARIES

    International Nuclear Information System (INIS)

    Li, Yan-Rong; Wang, Jian-Min; Cheng, Cheng; Qiu, Jie

    2013-01-01

    We investigate the alignment processes of spinning black holes and their surrounding warped accretion disks in a frame of two different types of feeding at the outer boundaries. We consider (1) fixed flows in which gas is continually fed with a preferred angular momentum, and (2) free flows in which there is no gas supply and the disks diffuse freely at their outer edges. As expected, we find that for the cases of fixed flows the black hole disk systems always align on timescales of several 10 6 yr, irrespective of the initial inclinations. If the initial inclination angles are larger than π/2, the black hole accretion transits from retrograde to prograde fashion, and the accreted mass onto the black holes during these two phases is comparable. On the other hand, for the cases of free flows, both alignments and anti-alignments can occur, depending on the initial inclinations and the ratios of the angular momentum of the disks to that of the black holes. In such cases, the disks will be consumed within timescales of 10 6 yr by black holes accreting at the Eddington limit. We propose that there is a close connection between the black hole spin and the lifetime for which the feeding persists, which determines the observable episodic lifetimes of active galactic nuclei. We conclude that careful inclusion of the disk feeding at the outer boundaries is crucial for modeling the evolution of the black hole spin.

  14. Developmental changes in the adhesive disk during Giardia differentiation.

    Science.gov (United States)

    Palm, Daniel; Weiland, Malin; McArthur, Andrew G; Winiecka-Krusnell, Jadwiga; Cipriano, Michael J; Birkeland, Shanda R; Pacocha, Sarah E; Davids, Barbara; Gillin, Frances; Linder, Ewert; Svärd, Staffan

    2005-06-01

    Giardia lamblia is a protozoan parasite infecting the upper mammalian small intestine. Infection relies upon the ability of the parasite to attach to the intestine via a unique cytoskeletal organelle, the ventral disk. We determined the composition and structure of the disk throughout the life cycle of the parasite and identified a new disk protein, SALP-1. SALP-1 is an immunodominant protein related to striated fiber-assemblin (SFA). The disk is disassembled during encystation and stored as four fragments in the immobile cyst. Serial Analysis of Gene Expression (SAGE) showed that the mRNA levels of the disk proteins decreased in encystation but two-dimensional protein gels showed that the protein levels were more constant. The parasite emerges without a functional disk but the four disk fragments are quickly reassembled into two new disks on the dividing, early excysting form. Thus, disk proteins are stored within the cyst, ready to be used in the rapid steps of excystation.

  15. Chemical constraints on the formation of the Galactic thick disk

    Directory of Open Access Journals (Sweden)

    Feltzing S.

    2012-02-01

    Full Text Available We highlight some results from our detailed abundance analysis study of 703 kinematically selected F and G dwarf stars in the solar neighbourhood. The analysis is based on spectra of high-resolution (R = 45000 to 110 000 and high signal-to-noise (S/N ≈ 150 to 300. The main findings include: (1 at a given metallicity, the thick disk abundance trends are more α-enhanced than those of the thin disk; (2 the metal-rich limit of the thick disk reaches at least solar metallicities; (3 the metal-poor limit of the thin disk is around [Fe/H] ≈−0.8; (4 the thick disk shows an age-metallicity gradient; (5 the thin disk does not show an age-metallicity gradient; (6 the most metal-rich thick disk stars at [Fe/H] ≈ 0 are significantly older than the most metal-poor thin disk stars at [Fe/H] ≈−0.7; (7 based on our elemental abundances we find that kinematical criteria produce thin and thick disk stellar samples that are biased in the sense that stars from the low-velocity tail of the thick disk are classified as thin disk stars, and stars from the high-velocity tail of the thin disk are classified as thick disk stars; (8 age criteria appears to produce thin and thick disk stellar samples with less contamination.

  16. Numerical Analysis of The Effect of Hydrodynamics and Operating Conditions on Biodiesel Synthesis in a Rotor-Stator Spinning Disk Reactor

    Directory of Open Access Journals (Sweden)

    Wen Zhuqing

    2017-06-01

    Full Text Available A rotor-stator spinning disk reactor for intensified biodiesel synthesis is described and numerically simulated in the present research. The reactor consists of two flat disks, located coaxially and parallel to each other with a gap ranging from 0.1 mm to 0.2 mm between the disks. The upper disk is located on a rotating shaft while the lower disk is stationary. The feed liquids, triglycerides (TG and methanol are injected into the reactor from centres of rotating disk and stationary disk, respectively. Fluid hydrodynamics in the reactor for synthesis of biodiesel from TG and methanol in the presence of a sodium hydroxide catalyst are simulated, using convection-diffusion-reaction multicomponent transport model with the CFD software ANSYS©Fluent v. 13.0. Effect of operating conditions on TG conversion is particularly investigated. Simulation results indicate that there is occurrence of back flow close to the stator at the outlet zone. Small gap size and fast rotational speed generally help to intensify mixing among reagents, and consequently enhance TG conversion. However, increasing rotational speed of spinning disk leads to more backflow, which decreases TG conversion. Large flow rate of TG at inlet is not recommended as well because of the short mean residence time of reactants inside the reactor.

  17. Intelligent multi-unit disk controller

    International Nuclear Information System (INIS)

    Poirot, Lucien

    1982-01-01

    This controller has been designed as a link between a 16 bits minicomputer and two types of disks units interface: the SMD interface and an equivalent to the DRI unit interface. Four units of each type can be handled by the controller. A bit slice microprocessor controls the interface with the disks units. The maximum exchange rate is 8 megabits per second. A CRC feature has been provided for error detection. A 16 bits microprocessor implements the interface to the computer, assuring head positioning, the management of bad tracks, as well as the supervision of each transfer. A internal buffer memory allows an asynchronous dialogue with the computer. The implementation of the controller makes easy the adaptation to disks units of various types, and though it has been initially intended for a minicomputer of the MITRA type, its microprocessor based design makes it fitted to any minicomputer. (author) [fr

  18. Industrial application of high power disk lasers

    Science.gov (United States)

    Brockmann, Rüdiger; Havrilla, David

    2008-02-01

    Laser welding has become one of the fastest growing areas for industrial laser applications. The increasing cost effectiveness of the laser process is enabled by the development of new highly efficient laser sources, such as the Disk laser, coupled with decreasing cost per Watt. TRUMPF introduced the Disk laser several years ago, and today it has become the most reliable laser tool on the market. The excellent beam quality and output powers of up to 10 kW enable its application in the automotive industry as well as in the range of thick plate welding, such as heavy construction and ship building. This serves as an overview of the most recent developments on the TRUMPF Disk laser and its industrial applications like cutting, welding, remote welding and hybrid welding, too. The future prospects regarding increased power and even further improved productivity and economics are presented.

  19. CARBON ISOTOPE FRACTIONATION IN PROTOPLANETARY DISKS

    International Nuclear Information System (INIS)

    Woods, Paul M.; Willacy, Karen

    2009-01-01

    We investigate the gas-phase and grain-surface chemistry in the inner 30 AU of a typical protoplanetary disk (PPD) using a new model which calculates the gas temperature by solving the gas heating and cooling balance and which has an improved treatment of the UV radiation field. We discuss inner-disk chemistry in general, obtaining excellent agreement with recent observations which have probed the material in the inner regions of PPDs. We also apply our model to study the isotopic fractionation of carbon. Results show that the fractionation ratio, 12 C/ 13 C, of the system varies with radius and height in the disk. Different behavior is seen in the fractionation of different species. We compare our results with 12 C/ 13 C ratios in the solar system comets, and find a stark contrast, indicative of reprocessing.

  20. Multimegawatt disk generator system for space applications

    International Nuclear Information System (INIS)

    Solbes, A.; Iwata, H.

    1988-01-01

    The conceptual design of a 100 megawatt - 500 seconds disk MHD generator system suitable as a burst power source for a space based neutral particle beam (NPB) is presented. The system features two disk generators operated in the magnetic field produced by a single circular superconducting magnet. Gelled reactants are used as the energy source. The oxidizer gel includes the alkali seed. The high heat flux areas of the power train are water cooled. Heat is rejected to a hydrogen stream which is also used for cooling of the exit section. The hydrogen is also used to mitigate the effects of the exhaust products of combustion on the platform. The two disk channels are operated in parallel. A dc to dc converter consolidates the channel's output into a single 100 kilovolt dc output

  1. Seeded inert gas driven disk generator

    International Nuclear Information System (INIS)

    Joshi, N.K.; Venkatramani, N.; Rohatgi, V.K.

    1987-01-01

    This report outlines the present status of work being carried out in closed cycle MHD and disk generators. It gives the basic principles and discusses a proposal for setting up an experimental facility to study nonequilibrium plasmas using an inert gas driven disk generator. Disk geometry is a near ideal geometry for plasma studies since it has single or few pair electrodes combined with near perfect insulating walls. The proposed outlay of facility with components and subsystem is given. The facility may also be used to study the concept of fully ionized seed and to develop advanced diagnostic techniques. The absic equation describing the working parameters of such a system is also given in the Appendix. (author). 57 refs

  2. METALLICITY GRADIENTS OF THICK DISK DWARF STARS

    Energy Technology Data Exchange (ETDEWEB)

    Carrell, Kenneth; Chen Yuqin; Zhao Gang, E-mail: carrell@nao.cas.cn [Key Laboratory of Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China)

    2012-12-01

    We examine the metallicity distribution of the Galactic thick disk using F, G, and K dwarf stars selected from the Sloan Digital Sky Survey, Data Release 8. Using the large sample of dwarf stars with proper motions and spectroscopically determined stellar parameters, metallicity gradients in the radial direction for various heights above the Galactic plane and in the vertical direction for various radial distances from the Galaxy center have been found. In particular, we find a vertical metallicity gradient of -0.113 {+-} 0.010 (-0.125 {+-} 0.008) dex kpc{sup -1} using an isochrone (photometric) distance determination in the range 1 kpc <|Z| < 3 kpc, which is the vertical height range most consistent with the thick disk of our Galaxy. In the radial direction, we find metallicity gradients between +0.02 and +0.03 dex kpc{sup -1} for bins in the vertical direction between 1 kpc <|Z| < 3 kpc. Both of these results agree with similar values determined from other populations of stars, but this is the first time a radial metallicity gradient for the thick disk has been found at these vertical heights. We are also able to separate thin and thick disk stars based on kinematic and spatial probabilities in the vertical height range where there is significant overlap of these two populations. This should aid further studies of the metallicity gradients of the disk for vertical heights lower than those studied here but above the solar neighborhood. Metallicity gradients in the thin and thick disks are important probes into possible formation scenarios for our Galaxy and a consistent picture is beginning to emerge from results using large spectroscopic surveys, such as the ones presented here.

  3. Destruction of Refractory Carbon in Protoplanetary Disks

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Dana E.; Blake, Geoffrey A. [Division of Geological and Planetary Sciences, California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125 (United States); Bergin, Edwin A. [Department of Astronomy, University of Michigan, 1085 S. University, Ann Arbor, MI 48109-1107 (United States); Ciesla, Fred J. [Department of Geophysical Sciences, The University of Chicago, 5734 South Ellis Ave., Chicago, IL 60637 (United States); Visser, Ruud [European Southern Observatory, Karl-Schwarzschild-Str. 2, D-85748, Garching (Germany); Lee, Jeong-Eun [School of Space Research, Kyung Hee University, 1732, Deogyeong-daero, Giheung-gu, Yongin-si, Gyeonggi-do 17104 (Korea, Republic of)

    2017-08-10

    The Earth and other rocky bodies in the inner solar system contain significantly less carbon than the primordial materials that seeded their formation. These carbon-poor objects include the parent bodies of primitive meteorites, suggesting that at least one process responsible for solid-phase carbon depletion was active prior to the early stages of planet formation. Potential mechanisms include the erosion of carbonaceous materials by photons or atomic oxygen in the surface layers of the protoplanetary disk. Under photochemically generated favorable conditions, these reactions can deplete the near-surface abundance of carbon grains and polycyclic aromatic hydrocarbons by several orders of magnitude on short timescales relative to the lifetime of the disk out to radii of ∼20–100+ au from the central star depending on the form of refractory carbon present. Due to the reliance of destruction mechanisms on a high influx of photons, the extent of refractory carbon depletion is quite sensitive to the disk’s internal radiation field. Dust transport within the disk is required to affect the composition of the midplane. In our current model of a passive, constant- α disk, where α = 0.01, carbon grains can be turbulently lofted into the destructive surface layers and depleted out to radii of ∼3–10 au for 0.1–1 μ m grains. Smaller grains can be cleared out of the planet-forming region completely. Destruction may be more effective in an actively accreting disk or when considering individual grain trajectories in non-idealized disks.

  4. z~2: An Epoch of Disk Assembly

    Science.gov (United States)

    Simons, Raymond C.; Kassin, Susan A.; Weiner, Benjamin; Heckman, Timothy M.; Trump, Jonathan; SIGMA, DEEP2

    2018-01-01

    At z = 0, the majority of massive star-forming galaxies contain thin, rotationally supported gas disks. It was once accepted that galaxies form thin disks early: collisional gas with high velocity dispersion should dissipate energy, conserve angular momentum, and develop strong rotational support in only a few galaxy crossing times (~few hundred Myr). However, this picture is complicated at high redshift, where the processes governing galaxy assembly tend to be violent and inhospitable to disk formation. We present results from our SIGMA survey of star-forming galaxy kinematics at z = 2. These results challenge the simple picture described above: galaxies at z = 2 are unlike local well-ordered disks. Their kinematics tend to be much more disordered, as quantified by their low ratios of rotational velocity to gas velocity dispersion (Vrot/σg): less than 35% of galaxies have Vrot/σg > 3. For comparison, nearly 100% of local star-forming galaxies meet this same threshold. We combine our high redshift sample with a similar low redshift sample from the DEEP2 survey. This combined sample covers a continuous redshift baseline over 0.1 < z < 2.5, spanning 10 Gyrs of cosmic time. Over this period, galaxies exhibit remarkably smooth kinematic evolution on average. All galaxies tend towards rotational support with time, and it is reached earlier in higher mass systems. This is due to both a significant decline in gas velocity dispersion and a mild rise in ordered rotational motions. These results indicate that z = 2 is a period of disk assembly, during which the strong rotational support present in today’s massive disk galaxies is only just beginning to emerge.

  5. Quantum diffusion

    International Nuclear Information System (INIS)

    Habib, S.

    1994-01-01

    We consider a simple quantum system subjected to a classical random force. Under certain conditions it is shown that the noise-averaged Wigner function of the system follows an integro-differential stochastic Liouville equation. In the simple case of polynomial noise-couplings this equation reduces to a generalized Fokker-Planck form. With nonlinear noise injection new ''quantum diffusion'' terms rise that have no counterpart in the classical case. Two special examples that are not of a Fokker-Planck form are discussed: the first with a localized noise source and the other with a spatially modulated noise source

  6. Hereditary Diffuse Gastric Cancer

    Science.gov (United States)

    ... Hereditary Diffuse Gastric Cancer Request Permissions Hereditary Diffuse Gastric Cancer Approved by the Cancer.Net Editorial Board , 10/2017 What is hereditary diffuse gastric cancer? Hereditary diffuse gastric cancer (HDGC) is a rare ...

  7. SHAKEN, NOT STIRRED: THE DISRUPTED DISK OF THE STARBURST GALAXY NGC 253

    International Nuclear Information System (INIS)

    Davidge, T. J.

    2010-01-01

    Near-infrared images obtained with WIRCam on the Canada-France-Hawaii Telescope are used to investigate the recent history of the nearby Sculptor Group spiral NGC 253, which is one of the nearest starburst galaxies. Bright asymptotic giant branch (AGB) stars are traced out to projected distances of ∼22-26 kpc (∼13-15 disk scale lengths) along the major axis. The distribution of stars in the disk is lopsided, in the sense that the projected density of AGB stars in the northeast portion of the disk between 10 and 20 kpc from the galaxy center is ∼0.5 dex higher than on the opposite side of the galaxy. A large population of red supergiants is also found in the northeast portion of the disk and, with the exception of the central 2 kpc, this area appears to have been the site of the highest levels of star-forming activity in the galaxy during the past ∼0.1 Gyr. It is argued that such high levels of localized star formation may have produced a fountain that ejected material from the disk, and the extraplanar H I detected by Boomsma et al. may be one manifestation of such activity. Diffuse stellar structures are found in the periphery of the disk, and the most prominent of these is to the south and east of the galaxy. Bright AGB stars, including cool C stars that are identified based on their J - K colors, are detected out to 15 kpc above the disk plane, and these are part of a diffusely distributed, flattened extraplanar component. Comparisons between observed and model luminosity functions suggest that the extraplanar regions contain stars that formed throughout much of the age of the universe. Additional evidence of a diffuse, extraplanar stellar component that contains moderately young stars comes from archival Galaxy Evolution Explorer images. It is suggested that the disk of NGC 253 was disrupted by a tidal encounter with a now defunct companion. This encounter introduced asymmetries that remain to this day, and the projected distribution of stars in and

  8. WL 17: A Young Embedded Transition Disk

    OpenAIRE

    Sheehan, Patrick D.; Eisner, Josh A.

    2017-01-01

    We present the highest spatial resolution ALMA observations to date of the Class I protostar WL 17 in the $\\rho$ Ophiuchus L1688 molecular cloud complex, which show that it has a 12 AU hole in the center of its disk. We consider whether WL 17 is actually a Class II disk being extincted by foreground material, but find that such models do not provide a good fit to the broadband SED and also require such high extinction that it would presumably arise from dense material close to the source such...

  9. Frequency modulation of semiconductor disk laser pulses

    Energy Technology Data Exchange (ETDEWEB)

    Zolotovskii, I O; Korobko, D A; Okhotnikov, O G [Ulyanovsk State University, Ulyanovsk (Russian Federation)

    2015-07-31

    A numerical model is constructed for a semiconductor disk laser mode-locked by a semiconductor saturable absorber mirror (SESAM), and the effect that the phase modulation caused by gain and absorption saturation in the semiconductor has on pulse generation is examined. The results demonstrate that, in a laser cavity with sufficient second-order dispersion, alternating-sign frequency modulation of pulses can be compensated for. We also examine a model for tuning the dispersion in the cavity of a disk laser using a Gires–Tournois interferometer with limited thirdorder dispersion. (control of radiation parameters)

  10. On radial flow between parallel disks

    International Nuclear Information System (INIS)

    Wee, A Y L; Gorin, A

    2015-01-01

    Approximate analytical solutions are presented for converging flow in between two parallel non rotating disks. The static pressure distribution and radial component of the velocity are developed by averaging the inertial term across the gap in between parallel disks. The predicted results from the first approximation are favourable to experimental results as well as results presented by other authors. The second approximation shows that as the fluid approaches the center, the velocity at the mid channel slows down which is due to the struggle between the inertial term and the flowrate. (paper)

  11. Capillary condensation between disks in two dimensions

    DEFF Research Database (Denmark)

    Gil, Tamir; Ipsen, John Hjorth

    1997-01-01

    Capillary condensation between two two-dimensional wetted circular substrates (disks) is studied by an effective free energy description of the wetting interface. The interfacial free-energy potential is developed on the basis of the theory for the wetting of a single disk, where interfacial...... capillary fluctuations play a dominant role. A simple approximative analytical expression of the interfacial free energy is developed and is validated numerically. The capillary condensation is characterized by the analysis of the coverage of the condensed phase, its stability, and asymptotic behaviors...

  12. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  13. Development of Disk Rover, wall-climbing robot using permanent magnet disk

    International Nuclear Information System (INIS)

    Hirose, Shigeo; Tsutsumitake; Hiroshi; Toyama, Ryousei; Kobayashi, Kengo.

    1992-01-01

    A new type of wall climbing robot, named Disk Rover, using permanent magnet disks are developed. The newly introduced permanent magnet disk is to rotate the magnet disk on the surface of wall with partly contacted posture. It allows to produce high magnetic attraction force compared with conventional permanent wheel which utilizes only a small portion of the magnet installed around the wheel. The optimum design of the magnetic wheel is done by using finit element method and it is shown that the magnetic attraction force vs. weight ratio can be designed about three times higher than conventional type magnet wheel. The developed Disk Rover is 25 kg in weight including controller and battery, about 685 mm in diameter, 239 mm in height and has a pair of permanent magnet disks. It is demonstrated by the experiments that the Disk Rover can move around on the surface of the wall quite smoothly by radio control and has payload of about its own weight. Several considerations are also done in order to surmount bead weld. (author)

  14. Debris Disks in Aggregate: Using Hubble Space Telescope Coronagraphic Imagery to Understand the Scattered-Light Disk Detection Rate

    Science.gov (United States)

    Grady, Carol A.

    2011-01-01

    Despite more than a decade of coronagraphic imaging of debris disk candidate stars, only 16 have been imaged in scattered light. Since imaged disks provide our best insight into processes which sculpt disks, and can provide signposts of the presence of giant planets at distances which would elude radial velocity and transit surveys, we need to understand under what conditions we detect the disks in scattered light, how these disks differ from the majority of debris disks, and how to increase the yield of disks which are imaged with 0.1" angular resolution. In this talk, I will review what we have learned from a shallow HSTINICMOS NIR survey of debris disks, and present first results from our on-going HST /STIS optical imaging of bright scattered-light disks.

  15. Subaru/SCExAO First-light Direct Imaging of a Young Debris Disk around HD 36546

    International Nuclear Information System (INIS)

    Currie, Thayne; Guyon, Olivier; Kudo, Tomoyuki; Jovanovic, Nemanja; Lozi, Julien; Tamura, Motohide; Kuzuhara, Masayuki; Schlieder, Joshua E.; Brandt, Timothy D.; Kuhn, Jonas; Serabyn, Eugene; Singh, Garima; Janson, Markus; Carson, Joseph; Groff, Tyler; Kasdin, N. Jeremy; McElwain, Michael W.; Grady, Carol; Uyama, Taichi; Akiyama, Eiji

    2017-01-01

    We present H -band scattered light imaging of a bright debris disk around the A0 star HD 36546 obtained from the Subaru Coronagraphic Extreme Adaptive Optics (SCExAO) system with data recorded by the HiCIAO camera using the vector vortex coronagraph. SCExAO traces the disk from r ∼ 0.″3 to r ∼1″ (34–114 au). The disk is oriented in a near east–west direction (PA ∼ 75°), is inclined by i ∼ 70°–75°, and is strongly forward-scattering (g > 0.5). It is an extended disk rather than a sharp ring; a second, diffuse dust population extends from the disk’s eastern side. While HD 36546 intrinsic properties are consistent with a wide age range (t ∼ 1–250 Myr), its kinematics and analysis of coeval stars suggest a young age (3–10 Myr) and a possible connection to Taurus-Auriga’s star formation history. SCExAO’s planet-to-star contrast ratios are comparable to the first-light Gemini Planet Imager contrasts; for an age of 10 Myr, we rule out planets with masses comparable to HR 8799 b beyond a projected separation of 23 au. A massive icy planetesimal disk or an unseen super-Jovian planet at r > 20 au may explain the disk’s visibility. The HD 36546 debris disk may be the youngest debris disk yet imaged, is the first newly identified object from the now-operational SCExAO extreme AO system, is ideally suited for spectroscopic follow-up with SCExAO/CHARIS in 2017, and may be a key probe of icy planet formation and planet–disk interactions.

  16. Subaru/SCExAO First-light Direct Imaging of a Young Debris Disk around HD 36546

    Energy Technology Data Exchange (ETDEWEB)

    Currie, Thayne; Guyon, Olivier; Kudo, Tomoyuki; Jovanovic, Nemanja; Lozi, Julien [National Astronomical Observatory of Japan, Subaru Telescope, National Institutes of Natural Sciences, Hilo, HI 96720 (United States); Tamura, Motohide; Kuzuhara, Masayuki [Astrobiology Center, National Institutes of Natural Sciences, 2-21-1 Osawa, Mitaka, Tokyo (Japan); Schlieder, Joshua E. [IPAC-NExScI, Mail Code 100-22, Caltech, 1200 E. California Boulevard, Pasadena, CA 91125 (United States); Brandt, Timothy D. [Astrophysics Department, Institute for Advanced Study, Princeton, NJ (United States); Kuhn, Jonas [Institute for Astronomy, ETH-Zurich, Wolfgang-Pauli-Str. 27, 8093 Zurich (Switzerland); Serabyn, Eugene; Singh, Garima [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA (United States); Janson, Markus [Department of Astronomy, Stockholm University, AlbaNova University Center, SE-106 91 Stockholm (Sweden); Carson, Joseph [Department of Physics and Astronomy, College of Charleston, 66 George Street, Charleston, SC (United States); Groff, Tyler; Kasdin, N. Jeremy [Department of Mechanical and Aerospace Engineering, Princeton University, Princeton, NJ (United States); McElwain, Michael W.; Grady, Carol [Exoplanets and Stellar Astrophysics Laboratory, Code 667, NASA-Goddard Space Flight Center, Greenbelt, MD (United States); Uyama, Taichi [Department of Astronomy, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo (Japan); Akiyama, Eiji [Chile Observatory, National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo (Japan); and others

    2017-02-10

    We present H -band scattered light imaging of a bright debris disk around the A0 star HD 36546 obtained from the Subaru Coronagraphic Extreme Adaptive Optics (SCExAO) system with data recorded by the HiCIAO camera using the vector vortex coronagraph. SCExAO traces the disk from r ∼ 0.″3 to r ∼1″ (34–114 au). The disk is oriented in a near east–west direction (PA ∼ 75°), is inclined by i ∼ 70°–75°, and is strongly forward-scattering (g > 0.5). It is an extended disk rather than a sharp ring; a second, diffuse dust population extends from the disk’s eastern side. While HD 36546 intrinsic properties are consistent with a wide age range (t ∼ 1–250 Myr), its kinematics and analysis of coeval stars suggest a young age (3–10 Myr) and a possible connection to Taurus-Auriga’s star formation history. SCExAO’s planet-to-star contrast ratios are comparable to the first-light Gemini Planet Imager contrasts; for an age of 10 Myr, we rule out planets with masses comparable to HR 8799 b beyond a projected separation of 23 au. A massive icy planetesimal disk or an unseen super-Jovian planet at r > 20 au may explain the disk’s visibility. The HD 36546 debris disk may be the youngest debris disk yet imaged, is the first newly identified object from the now-operational SCExAO extreme AO system, is ideally suited for spectroscopic follow-up with SCExAO/CHARIS in 2017, and may be a key probe of icy planet formation and planet–disk interactions.

  17. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  18. FOMALHAUT'S DEBRIS DISK AND PLANET: CONSTRAINING THE MASS OF FOMALHAUT B FROM DISK MORPHOLOGY

    International Nuclear Information System (INIS)

    Chiang, E.; Kalas, P.; Graham, J. R.; Kite, E.; Clampin, M.

    2009-01-01

    Following the optical imaging of exoplanet candidate Fomalhaut b (Fom b), we present a numerical model of how Fomalhaut's debris disk is gravitationally shaped by a single interior planet. The model is simple, adaptable to other debris disks, and can be extended to accommodate multiple planets. If Fom b is the dominant perturber of the belt, then to produce the observed disk morphology it must have a mass M pl J , an orbital semimajor axis a pl > 101.5 AU, and an orbital eccentricity e pl = 0.11-0.13. These conclusions are independent of Fom b's photometry. To not disrupt the disk, a greater mass for Fom b demands a smaller orbit farther removed from the disk; thus, future astrometric measurement of Fom b's orbit, combined with our model of planet-disk interaction, can be used to determine the mass more precisely. The inner edge of the debris disk at a ∼ 133 AU lies at the periphery of Fom b's chaotic zone, and the mean disk eccentricity of e ∼ 0.11 is secularly forced by the planet, supporting predictions made prior to the discovery of Fom b. However, previous mass constraints based on disk morphology rely on several oversimplifications. We explain why our constraint is more reliable. It is based on a global model of the disk that is not restricted to the planet's chaotic zone boundary. Moreover, we screen disk parent bodies for dynamical stability over the system age of ∼ 100 Myr, and model them separately from their dust grain progeny; the latter's orbits are strongly affected by radiation pressure and their lifetimes are limited to ∼ 0.1 Myr by destructive grain-grain collisions. The single planet model predicts that planet and disk orbits be apsidally aligned. Fomalhaut b's nominal space velocity does not bear this out, but the astrometric uncertainties may be large. If the apsidal misalignment proves real, our calculated upper mass limit of 3M J still holds. If the orbits are aligned, our model predicts M pl = 0.5M J , a pl = 115 AU, and e pl = 0

  19. HERSCHEL OBSERVATIONS OF THE T CHA TRANSITION DISK: CONSTRAINING THE OUTER DISK PROPERTIES

    OpenAIRE

    Cieza, Lucas A.; Olofsson, Johan; Harvey, Paul M.; Pinte, Christophe; Merin, Bruno; Augereau, Jean-Charles; Evans, Neal J., II; Najita, Joan; Henning, Thomas; Menard, Francois

    2011-01-01

    T Cha is a nearby (d = 100 pc) transition disk known to have an optically thin gap separating optically thick inner and outer disk components. Huelamo et al. (2011) recently reported the presence of a low-mass object candidate within the gap of the T Cha disk, giving credence to the suspected planetary origin of this gap. Here we present the Herschel photometry (70, 160, 250, 350, and 500 micron) of T Cha from the "Dust, Ice, and Gas in Time" (DIGIT) Key Program, which bridges the wavelength ...

  20. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  1. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  3. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  4. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  5. TOWARD A GLOBAL EVOLUTIONARY MODEL OF PROTOPLANETARY DISKS

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Xue-Ning, E-mail: xbai@cfa.harvard.edu [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden St., MS-51, Cambridge, MA 02138 (United States)

    2016-04-20

    A global picture of the evolution  of protoplanetary disks (PPDs) is key to understanding almost every aspect of planet formation, where standard α-disk models have been continually employed for their simplicity. In the meantime, disk mass loss has been conventionally attributed to photoevaporation, which controls disk dispersal. However, a paradigm shift toward accretion driven by magnetized disk winds has taken place in recent years, thanks to studies of non-ideal magnetohydrodynamic effects in PPDs. I present a framework of global PPD evolution aiming to incorporate these advances, highlighting the role of wind-driven accretion and wind mass loss. Disk evolution is found to be largely dominated by wind-driven processes, and viscous spreading is suppressed. The timescale of disk evolution is controlled primarily by the amount of external magnetic flux threading the disks, and how rapidly the disk loses the flux. Rapid disk dispersal can be achieved if the disk is able to hold most of its magnetic flux during the evolution. In addition, because wind launching requires a sufficient level of ionization at the disk surface (mainly via external far-UV (FUV) radiation), wind kinematics is also affected by the FUV penetration depth and disk geometry. For a typical disk lifetime of a few million years, the disk loses approximately the same amount of mass through the wind as through accretion onto the protostar, and most of the wind mass loss proceeds from the outer disk via a slow wind. Fractional wind mass loss increases with increasing disk lifetime. Significant wind mass loss likely substantially enhances the dust-to-gas mass ratio and promotes planet formation.

  6. TOWARD A GLOBAL EVOLUTIONARY MODEL OF PROTOPLANETARY DISKS

    International Nuclear Information System (INIS)

    Bai, Xue-Ning

    2016-01-01

    A global picture of the evolution  of protoplanetary disks (PPDs) is key to understanding almost every aspect of planet formation, where standard α-disk models have been continually employed for their simplicity. In the meantime, disk mass loss has been conventionally attributed to photoevaporation, which controls disk dispersal. However, a paradigm shift toward accretion driven by magnetized disk winds has taken place in recent years, thanks to studies of non-ideal magnetohydrodynamic effects in PPDs. I present a framework of global PPD evolution aiming to incorporate these advances, highlighting the role of wind-driven accretion and wind mass loss. Disk evolution is found to be largely dominated by wind-driven processes, and viscous spreading is suppressed. The timescale of disk evolution is controlled primarily by the amount of external magnetic flux threading the disks, and how rapidly the disk loses the flux. Rapid disk dispersal can be achieved if the disk is able to hold most of its magnetic flux during the evolution. In addition, because wind launching requires a sufficient level of ionization at the disk surface (mainly via external far-UV (FUV) radiation), wind kinematics is also affected by the FUV penetration depth and disk geometry. For a typical disk lifetime of a few million years, the disk loses approximately the same amount of mass through the wind as through accretion onto the protostar, and most of the wind mass loss proceeds from the outer disk via a slow wind. Fractional wind mass loss increases with increasing disk lifetime. Significant wind mass loss likely substantially enhances the dust-to-gas mass ratio and promotes planet formation

  7. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  8. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  9. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  10. The Distribution of Water in a Viscous Protoplanetary Disk

    Science.gov (United States)

    Ciesla, F. J.; Cuzzi, J. N.

    2005-01-01

    The distribution of water in the solar nebula is important to understand for a number of reasons. Firstly, in the inner regions of the solar nebula, the concentration of water vapor is expected to have played a major role in determining its oxidation state, and therefore would control which minerals would form there. Secondly, in the outer nebula, water would be a major condensable, making up nearly 50% of the mass of the solids and thus possibly playing a role in determining where giant planets formed. Lastly, liquid water is important for forming and sustaining life, and therefore understanding where and how water was transported to the habitable zone of a a star is critical to understanding how common life may be in the galaxy. Because of its importance, the distribution of water in the solar nebula has been studied by a number of authors. The main transport mechanisms which would determine the distribution of water would be diffusion and gas drag migration. Water vapor and small solids would diffuse in the nebula, moving away from areas of high concentrations. Larger bodies, while also subject to diffusion, though to a lesser extent, would experience gas drag migration, causing them to move inwards with time. The bodies most affected by this transport mechanism would be on the order of 1 meter in size. As objects continued to grow larger, their inertia would also grow, making them nearly immobile to gas drag. While efforts have been made to understand how water would be distributed in a protoplanetary disk, none of the published models simultaneously consider the effects of nebular evolution, transport of material throughout the nebula, and the existence of solids of various sizes at a given location of the nebula. We are currently developing a model which allows for these effects and is consistent with models for the accretion of bodies in the solar nebula.

  11. In-vitro transdentinal diffusion of monomers from adhesives.

    Science.gov (United States)

    Putzeys, Eveline; Duca, Radu Corneliu; Coppens, Lieve; Vanoirbeek, Jeroen; Godderis, Lode; Van Meerbeek, Bart; Van Landuyt, Kirsten L

    2018-06-01

    Biocompatibility of adhesives is important since adhesives may be applied on dentin near the pulp. Accurate knowledge of the quantity of monomers reaching the pulp is important to determine potential side effects. The aim of this study was to assess the transdentinal diffusion of residual monomers from dental adhesive systems using an in-vitro pulp chamber model. Dentin disks with a thickness of 300 µm were produced from human third molars. These disks were fixed between two open-ended glass tubes, representing an in-vitro pulp chamber. The etch-and-rinse adhesive OptiBond FL and the self-etch adhesive Clearfil SE Bond were applied to the dentin side of the disks, while on in the pulpal side, the glass tube was filled with 600 µL water. The transdentinal diffusion of different monomers was quantified using ultra-performance liquid chromatography-tandem mass spectrometry. The monomers HEMA, CQ, BisGMA, GPDM, 10-MDP and UDMA eluted from the dental materials and were able to diffuse through the dentin disks to a certain extent. Compounds with a lower molecular weight (uncured group: HEMA 7850 nmol and CQ 78.2 nmol) were more likely to elute and diffuse compared to monomers with a higher molecular weight (uncured group: BisGMA 0.42 nmol). When the adhesives were left uncured, diffusion was up to 10 times higher compared to the cured conditions. This in-vitro research resulted in the quantification of various monomers able to diffuse through dentin and therefore contributes to a more detailed understanding about the potential exposure of the dental pulp to monomers from dental adhesives. Biocompatibility of adhesives is important since adhesives may be applied on dentin near the pulp, where tubular density and diameter are greatest. Copyright © 2018. Published by Elsevier Ltd.

  12. Intervertebral disk prolapse in a ferret.

    Science.gov (United States)

    Morera, Neus; Valls, Xavier; Mascort, Joan

    2006-09-01

    This case report describes the diagnosis and resolution of an inter-vertebral disk prolapse in a 6-year-old ferret. No predisposing causes were found in the patient's history. A right hemilaminectomy, performed 1 week after presentation, was chosen to treat the patient surgically, and complete remission of clinical signs was achieved 2 months after presentation.

  13. Dust in Protoplanetary Disks: Properties and Evolution

    NARCIS (Netherlands)

    Natta, A.; Testi, L.; Calvet, N.; Henning, T.; Waters, R.; Wilner, D.

    2007-01-01

    We review the properties of dust in protoplanetary disks around optically visible pre-main-sequence stars obtained with a variety of observational techniques, from measurements of scattered light at visual and infrared wavelengths to mid-infrared spectroscopy and millimeter interferometry. A general

  14. Dust coagulation in protoplanetary disks : porosity matters

    NARCIS (Netherlands)

    Ormel, C. W.; Spaans, M.; Tielens, A. G. G. M.

    Context. Sticking of colliding dust particles through van der Waals forces is the first stage in the grain growth process in protoplanetary disks, eventually leading to the formation of comets, asteroids and planets. A key aspect of the collisional evolution is the coupling between dust and gas

  15. Planetary Torque in 3D Isentropic Disks

    International Nuclear Information System (INIS)

    Fung, Jeffrey; Masset, Frédéric; Velasco, David; Lega, Elena

    2017-01-01

    Planetary migration is inherently a three-dimensional (3D) problem, because Earth-size planetary cores are deeply embedded in protoplanetary disks. Simulations of these 3D disks remain challenging due to the steep resolution requirements. Using two different hydrodynamics codes, FARGO3D and PEnGUIn, we simulate disk–planet interaction for a one to five Earth-mass planet embedded in an isentropic disk. We measure the torque on the planet and ensure that the measurements are converged both in resolution and between the two codes. We find that the torque is independent of the smoothing length of the planet’s potential ( r s ), and that it has a weak dependence on the adiabatic index of the gaseous disk ( γ ). The torque values correspond to an inward migration rate qualitatively similar to previous linear calculations. We perform additional simulations with explicit radiative transfer using FARGOCA, and again find agreement between 3D simulations and existing torque formulae. We also present the flow pattern around the planets that show active flow is present within the planet’s Hill sphere, and meridional vortices are shed downstream. The vertical flow speed near the planet is faster for a smaller r s or γ , up to supersonic speeds for the smallest r s and γ in our study.

  16. The short circuit instability in protoplanetary disks

    DEFF Research Database (Denmark)

    Hubbard, A.; McNally, C.P.; Mac Low, M.M.

    2013-01-01

    We introduce a magneto-hydrodynamic instability which occurs, among other locations, in the inner, hot regions of protoplanetary disks, and which alters the way in which resistive dissipation of magnetic energy into heat proceeds. This instability can be likened to both an electrical short circui...

  17. Stochastic Oscillations of General Relativistic Disks Described

    Indian Academy of Sciences (India)

    4

    spectral slope at high frequencies of the power spectrum density of disk ..... has a negative sign, the process is antipersistence or anti-correlated. ..... We can find that the computation of a Grünwald-Letnikov derivative requires knowledge of.

  18. Planetary Torque in 3D Isentropic Disks

    Energy Technology Data Exchange (ETDEWEB)

    Fung, Jeffrey [Department of Astronomy, University of California at Berkeley, Campbell Hall, Berkeley, CA 94720-3411 (United States); Masset, Frédéric; Velasco, David [Instituto de Ciencias Físicas, Universidad Nacional Autónoma de México, Av. Universidad s/n, 62210 Cuernavaca, Mor. (Mexico); Lega, Elena, E-mail: jeffrey.fung@berkeley.edu [Université de la Côte d’Azur, Observatoire de la Côte d’Azur, CNRS, Laboratoire Lagrange UMR 7293, Nice (France)

    2017-03-01

    Planetary migration is inherently a three-dimensional (3D) problem, because Earth-size planetary cores are deeply embedded in protoplanetary disks. Simulations of these 3D disks remain challenging due to the steep resolution requirements. Using two different hydrodynamics codes, FARGO3D and PEnGUIn, we simulate disk–planet interaction for a one to five Earth-mass planet embedded in an isentropic disk. We measure the torque on the planet and ensure that the measurements are converged both in resolution and between the two codes. We find that the torque is independent of the smoothing length of the planet’s potential ( r {sub s}), and that it has a weak dependence on the adiabatic index of the gaseous disk ( γ ). The torque values correspond to an inward migration rate qualitatively similar to previous linear calculations. We perform additional simulations with explicit radiative transfer using FARGOCA, and again find agreement between 3D simulations and existing torque formulae. We also present the flow pattern around the planets that show active flow is present within the planet’s Hill sphere, and meridional vortices are shed downstream. The vertical flow speed near the planet is faster for a smaller r {sub s} or γ , up to supersonic speeds for the smallest r {sub s} and γ in our study.

  19. QPOs and Resonance in Accretion Disks

    Czech Academy of Sciences Publication Activity Database

    Kluzniak, W.; Abramowicz, M. A.; Bursa, Michal; Török, G.

    2007-01-01

    Roč. 27, Marzo 2007 (2007), s. 18-25 ISSN 1405-2059 R&D Projects: GA AV ČR IAA300030510 Institutional research plan: CEZ:AV0Z10030501 Keywords : quasi-periodic oscillations * accretion disks * general relativity Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  20. Disk accretion onto magnetic T Tauri stars

    International Nuclear Information System (INIS)

    Koenigl, A.

    1991-01-01

    The dynamical and radiative consequences of disk accretion onto magnetic T Tauri stars (TTS) are examined using the Ghosh and Lamb model. It is shown that a prolonged disk accretion phase is compatible with the low rotation rates measured in these stars if they possess a kilogauss strength field that disrupts the disk at a distance of a few stellar radii from the center. It is estimated that a steady state in which the net torque exerted on the star is zero can be attained on a time scale that is shorter than the age of the youngest visible TTS. Although the disk does not develop an ordinary shear boundary layer in this case, one can account for the observed UV excess and Balmer emission in terms of the shocks that form at the bottom of the high-latitude magnetic accretion columns on the stellar surface. This picture also provides a natural explanation of some of the puzzling variability properties of stars like DF Tau and RY Lup. YY Ori stars are interpreted as magnetic TTS in which the observer's line of sight is roughly parallel to an accretion column. 37 refs