WorldWideScience

Sample records for disease tolerant lines

  1. Plant breeding by using radiation mutation - Development of disease tolerant lines of hotpepper by using radiation and interspecific hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yong Su; Song, Hi Sup; Kim, Jin Kyu; Shin, In Chul [Nongwoo Seed Co., Suwon (Korea)

    2000-04-01

    To obtain disease resistant mutant lines, 6 inbred lines were hotppepers were irradiated with 250Gy of gamma ray and crossed between cultivar and wild species. 1) 4500 M{sub 1} plants were cultivated for obtaining M{sub 2} seed in 6 inbred lines of hotpeppers irradiated with 250 Gy of gamma ray. 2) Crossability was not generally existed among interspecific crosses, crossability between C. annum and C. chacoense was successful except crosses between C. annum, C. pubescens and C. eximium. 3) The embryo disected 45 days after pollination was suitable for embryo culture. 4) Hybrid plants were obtained from the embryo culture of the combination between C. annum and C. chacoense, while abnormal hybrid plants occurred from the combination between C. annum and C. baccatum. 15 refs., 4 figs., 4 tabs. (Author)

  2. Boron tolerance in NS wheat lines

    Directory of Open Access Journals (Sweden)

    Brdar Milka

    2006-01-01

    Full Text Available Boron is an essential micronutrient for higher plants. Present in excessive amounts boron becomes toxic and can limit plant growth and yield. Suppression of root growth is one of the symptoms of boron toxicity in wheat. This study was undertaken to investigate the response of 10 perspective NS lines of wheat to high concentrations of boron. Analysis of root growth was done on young plants, germinated and grown in the presence of different concentrations of boric acid (0, 50,100 and 150 mg/1. Significant differences occurred between analyzed genotypes and treatments regarding root length. Average suppression of root growth was between 11,6 and 34,2%, for line NS 252/02 are even noted 61,4% longer roots at treatments in relation to the control. Lines with mean suppression of root growth less than 20% (NS 101/02, NS 138/01, NS 53/03 and NS 73/02 may be considered as boron tolerant. Spearmans coefficients showed high level of agreement regarding rang of root length for genotypes treated with 100 and 150 mg H3BO3/l.

  3. Evaluation of Drought Tolerance of Bread Wheat Recombinant Inbred Lines

    Directory of Open Access Journals (Sweden)

    N Zafar Naderi

    2014-10-01

    Full Text Available To evaluateresponse of bread wheat recombinant inbred lines to water deficit, a split plot experiment arranged in randomized complete block design (CRBD was conducted using eight recombinant inbred lines and their parental cultivars (Roshan and Super Head with three replications under three irrigation levels (80, 120 and 160 mm evaporation from class A pan at the Agriculture Research Station of Islamic Azad University, Tabriz Branch during 2009. The results of analysis of variance data collected revealed significant difference among lines and irrigation levels for grain yield. While line × irrigation level interaction was non significant for grain yield. Based on SSI and TOL, drought tolerance indices lines number 1, 7, 41 and Roshan cultivar under 120 mm evaporation, and lines number 7 and 19 under 160 mm evaporation were the tolerant lines. Under both stress conditions according to STI, MP and GMP indices, lines number 37, 38 and Roshan cultivar were recognized as the tolerant lines to water deficiet. Cluster analyses based on grain yield and drought tolerance indices recognized the lines number 1, 30, 32, 37, 38, 41 and Roshan cultivar under 120 mm and lines number 30, 37 and 38 and Roshan under 160 mm evaporation as the most drought tolerants and higher producers.

  4. Screening of recombinant inbred lines for salinity tolerance in bread ...

    African Journals Online (AJOL)

    Screening a large number of plants for salinity tolerance is not easy, therefore this investigation was performed to evaluate and screen 186 F8 recombinant inbred lines (RILs) derived from a cross between Superhead#2 (Super Seri) and Roshan wheat varieties for salinity tolerance. All the individuals were evaluated under ...

  5. Oral Tolerance: Therapeutic Implications for Autoimmune Diseases

    Directory of Open Access Journals (Sweden)

    Ana M. C. Faria

    2006-01-01

    Full Text Available Oral tolerance is classically defined as the suppression of immune responses to antigens (Ag that have been administered previously by the oral route. Multiple mechanisms of tolerance are induced by oral Ag. Low doses favor active suppression, whereas higher doses favor clonal anergy/deletion. Oral Ag induces Th2 (IL-4/IL-10 and Th3 (TGF-β regulatory T cells (Tregs plus CD4+CD25+ regulatory cells and LAP+T cells. Induction of oral tolerance is enhanced by IL-4, IL-10, anti-IL-12, TGF-β, cholera toxin B subunit (CTB, Flt-3 ligand, anti-CD40 ligand and continuous feeding of Ag. In addition to oral tolerance, nasal tolerance has also been shown to be effective in suppressing inflammatory conditions with the advantage of a lower dose requirement. Oral and nasal tolerance suppress several animal models of autoimmune diseases including experimental allergic encephalomyelitis (EAE, uveitis, thyroiditis, myasthenia, arthritis and diabetes in the nonobese diabetic (NOD mouse, plus non-autoimmune diseases such as asthma, atherosclerosis, colitis and stroke. Oral tolerance has been tested in human autoimmune diseases including MS, arthritis, uveitis and diabetes and in allergy, contact sensitivity to DNCB, nickel allergy. Positive results have been observed in phase II trials and new trials for arthritis, MS and diabetes are underway. Mucosal tolerance is an attractive approach for treatment of autoimmune and inflammatory diseases because of lack of toxicity, ease of administration over time and Ag-specific mechanism of action. The successful application of oral tolerance for the treatment of human diseases will depend on dose, developing immune markers to assess immunologic effects, route (nasal versus oral, formulation, mucosal adjuvants, combination therapy and early therapy.

  6. Evaluation of some bean lines tolerance to alkaline soil

    Directory of Open Access Journals (Sweden)

    Abeer A. Radi

    2012-01-01

    Full Text Available Introduction: In less arid climates, salts are less concentrated and sodium dominates in carbonate and bicarbonate forms, which enhance the formation of alkaline soils. The development and identification of salt-tolerant crop cultivars or lines would complement salt management programs to improve the productivity and yields of salt stressed plants.Materials and methods: This work was to study the evaluation of alkalinity tolerance of some bean lines grown under different levels of sodium carbonate (Na2CO3 to select the most alkalinity tolerant lines versus the most-sensitive ones out of 6 lines of the test plants.Results: The symptoms induced by alkalinity included reduction in root, shoot growth, and leaf area which were more severe in some bean lines. Potassium leakage was severely affected by alkalinity in some lines at all tested levels, while in some others a moderate damage was manifested only at the higher levels. The increase in Na2CO3 level was associated with a gradual fall in chlorophyll a and b biosynthesis of all the test bean lines. However, alkalinity at low and moderate levels had a favorable effect on the biosynthesis of carotenoids in all the test bean lines. The increase in Na2CO3 supply had a considerable stimulatory effect on sodium accumulation, while potassium accumulation fluctuated in organs of bean lines.Conclusion: Assiut 1104 out of all the different lines investigated was found to display the lowest sensitivity to alkalinity stress, while Assiut 12/104 was the most sensitive one.

  7. Lattice design and tolerance analysis of the CBA transport line

    International Nuclear Information System (INIS)

    Weng, W.T.

    1983-01-01

    The beam transport line from the AGS to CBA is 600 m long and consists of 70 bending magnets and 20 quadrupoles, as well as several special injection components. The beam has to bend 117 0 horizontally and drop 1.8 m in elevation. To insure that it has momentum acceptance of δP/P = +-1% and the transverse emittance dilution is within 30%, a detailed tolerance analysis has been carried out on the requirements of the AGS beam properties, magnetic field quality of the transport magnets, and misalignment errors. Field quality tolerances of δB 0 /B less than or equal to 1 x 10 - 3 for bending field, δ G/G less than or equal to 5 x 10 - 3 for gradient field, and δB 2 /B less than or equal to 2.5 x 10 - 4 cm - 2 of the sextupole components in the bending magnets are indicated

  8. Sulfasalazine efficacy and tolerability in rheumatic diseases

    Directory of Open Access Journals (Sweden)

    V. V. Badokin

    2005-01-01

    Full Text Available Sulfasalazine is one of the main disease modifying drugs for the treatment of chronic inflammatory joint and spine diseases. The article describes mechanism of action of sulfasalazine and its main metabolites. Detailed information about anti-inflammatory and immunosuppressive action of the drug is presented. Results of many studies of sulfasalazine efficacy in rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis and reactive arthritis are discussed from the evidence based medicine point of view. Data on sulfasalazine tolerability and safety are presented with separate discussion of hypersensitivity and dose-dependent adverse reactions so as their treatment and prophylaxis.

  9. Induced mutation of new cotton lines tolerant to verticillium wilt with improved characters

    International Nuclear Information System (INIS)

    Rastegary, G.; Hoseiny Neghad, Z.

    1998-01-01

    Induction of mutation for genetic variation has been used in crop improvement for many years. The mutant lines can be used either directly or as a new genetic source in cross breeding. In cotton 'eleven' and 'two' mutant varieties as new genetic sources have been evolved directly and indirectly, respectively. One of the major obstacles in cotton production in northern region of Iran, Gorgan and Gonbad (where they are known as the main cultivation area of this crop), is the presence of verticillium wilt fungal disease. Since this fungus is soil-born, and can not be controlled chemically, the most efficient way of combating against the disease is to breed for the tolerance/resistance of the species. For this purpose, a mutation breeding technique was applied using gamma radiation as mutagen. The seeds of four varieties (Shirpan, Tashkand, Bakhtegan, and Sahel) were irradiated after reaching a proper absorbed humidity. The radiation doses of 150 to 350 Gy were applied and the seeds were cultivated in two different locations (Varamin and Kordkuy) as M1 generation. The cotton balls of each individual healthy plant was harvested to attain the seeds of M2 rows. In M2, the plants with different degrees of tolerance to the disease were compared to the selected parents (taking into consideration that the soil was contaminated). The good yielding lines with different level of tolerance were taken up to the 5th generation, yielding 70 lines of superior qualitative and quantitative traits. (author)

  10. Selection and characterizations of radiation-induced salinity-tolerant lines in rice

    International Nuclear Information System (INIS)

    Lee, I.S.; Kim, D.S.; Lee, S.J.; Song, H.S.; Lim, Y.P.; Lee, Y.I.

    2003-01-01

    NaCl tolerant cell lines were selected from irradiated callus, which were generated from seed cultures. M 1 -regenerates were obtained from the salt-tolerant callus cultured on the auxin-free medium for 30 days. Some regenerants were more tolerant than the parent variety (Dongjinbyeo) on a medium containing 0.75 % NaCl. Seeds (M 3 5,000 lines) derived from M 2 lines were grown to the 3 leaf stage. M 3 lines were soaked with a 0.75 % salt solution for 3 weeks and 350 salt-tolerant genotypes were selected. Among the M 3 350 lines, forty tolerant lines were selected from a saline field (10~14 mS) near the sea coast. Of the forty lines, two lines (18-1 and 50-1) showed more improved plant height, panicle length, tillering number, spikelet number and yield than those of the original variety. Thirty primers were screened and two RAPD markers were identified, which appeared in both the salt-tolerant lines (18-1 and 50-1). From DNA-hybridization experiments, it appeared that the fragment arose from the middle-repetitive copy sequences. The transcript involved in the marker showed a higher expression in the salt-tolerant lines than the sensitive lines. The salt-tolerant lines would be useful as a resource for salt-tolerant breeding. (author)

  11. TEST OF COTTON LINES WITH DROUGHT TOLERANT INTERCROPPED WITH MAIZE

    Directory of Open Access Journals (Sweden)

    Kadarwati F.T.

    2017-12-01

    Full Text Available The distribution of cotton cultivation is mostly located in the sub-optimal land due to competition with the field crop. The cotton cultivation in Indonesia is always done through intercropping with pulses. This research aims to test the suitability of cotton lines with drought-tolerant intercropped with maize. The research is conducted in February to August 2016 at Asembagus Experimental Garden, Situbondo. Planting materials used in this research are 6 lines and 2 varieties of drought-tolerant cotton consist of strain 03001/9, 03008/24, 03008/25, 03017/13, 06062/3, 06063/3, kanesia 10 and kanesia 14. The research prepared by the draft randomized group with three replications. The observation parameter consists of plant height, canopy width, number of generative branches, number of fruits, fruits weight, the yield of seed cotton, and corn dry results. The research result shows that the strain 03017/13 and 03008/24 have the highest consecutive acceptance of IDR 17,860,681 and IDR 17,520,879, the increase in revenue compared to monoculture is IDR 6,278,473 and IDR 5,668,191, seed cotton production amounted to 2470.01 kg/ha and 2329.72 kg/ha, maize production amounted to 2001.54 kg/ha and 2112.74 kg/ha, LER 1.68 and 1.60, number of harvested fruit of 12.66 and 11.76 fruits/plant, fruit weight of 4.05 and 4.17 g/fruit.

  12. B Cell Tolerance in Health and Disease

    Directory of Open Access Journals (Sweden)

    Murali Gururajan

    2014-02-01

    Full Text Available B lymphocyte receptors are generated randomly during the bone marrow developmental phase of B cells. Hence, the B cell repertoire consists of both self and foreign antigen specificities necessitating specific tolerance mechanisms to eliminate self-reactive B cells. This review summarizes the major mechanisms of B cell tolerance, which include clonal deletion, anergy and receptor editing. In the bone marrow presentation of antigen in membrane bound form is more effective than soluble form and the role of dendritic cells in this process is discussed. Toll like receptor derived signals affect activation of B cells by certain ligands such as nucleic acids and have been shown to play crucial roles in the development of autoimmunity in several animal models. In the periphery availability of BAFF, a B cell survival factor plays a critical role in the survival of self-reactive B cells. Antibodies against BAFF have been found to be effective therapeutic agents in lupus like autoimmune diseases. Recent developments are targeting anergy to control the growth of chronic lymphocytic leukemia cells.

  13. Screening of recombinant inbred lines for salinity tolerance in bread ...

    African Journals Online (AJOL)

    Jane

    2011-10-05

    Oct 5, 2011 ... 2Department of Molecular Physiology, Agricultural Biotechnology Research Institute of Iran ... indexes for screening bread wheat genotypes for salinity tolerance. ... published on screening methods in salinity tolerance in.

  14. Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.

    Directory of Open Access Journals (Sweden)

    Alfi Inayati

    2016-04-01

    Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.

  15. Heterosis and Combining Ability of Drought-Tolerant Maize Lines for ...

    African Journals Online (AJOL)

    In drought prone areas of Ethiopia, maize is produced by small-scale farmers' where additional inputs are rarely applied. Although genetic tolerance is recommended for moisture stress, there is limited information on drought-tolerant genotypes reaction to variable environments. In this study, eight drought tolerant lines and ...

  16. Is salinity tolerance of rice lines concerned to endogenous ABA ...

    African Journals Online (AJOL)

    In this work we tested its putative relationship of Abscisic acid with the degree of tolerance to this abiotic stress. For this purpose, we have examined the responses of sensitive (IR29) and tolerant (IR651) varieties of indica rice (Oryza sativa L.) to a range of salinity (0 (control) and 90 mM NaCl. Shoot and root dry weight ...

  17. Selection on resilience improves disease resistance and tolerance to infections

    NARCIS (Netherlands)

    Mulder, H.A.; Rashidi, H.

    2017-01-01

    Response to infection in animals has 2 main mechanisms: resistance (ability to control pathogen burden) and tolerance (ability to maintain performance given the pathogen burden). Selection on disease resistance and tolerance to infections seems a promising avenue to increase productivity of animals

  18. Effective selection criteria for screening drought tolerant recombinant inbred lines of sunflower

    Directory of Open Access Journals (Sweden)

    Abdi Nishtman

    2013-01-01

    Full Text Available In this study, seventy two sunflower recombinant inbred lines were tested for their yielding ability under both water-stressed and well-watered states. The inbred lines were evaluated in a rectangular 8´9 lattice design with two replications in both well-watered and water-stressed conditions, separately. Eight drought tolerance indices including stability tolerance index (STI, mean productivity (MP, geometric mean productivity (GMP, harmonic mean (HM, stress susceptibility index (SSI, tolerance index (TOL, yield index (YI and yield stability index (YSI were calculated based on grain yield for every genotype. Results showed the highest values of mean productivity (MP index, geometric mean productivity (GMP, yield index (YI, harmonic mean (HM and stress tolerance index (STI indices for ‘C134a’ inbred line and least values of stress susceptibility index (SSI and tolerance (TOL for C61 inbred line. According to correlation of indices with yield performance under both drought stress and non-stress states and principle component analysis, indices including HM, MP, GMP and STI could properly distinguish drought tolerant sunflower inbred lines with high yield performance under both states. Cluster analysis of inbred lines using Ys, Yp and eight indices, categorized them into four groups including 19, 6, 26 and 19 inbred lines.

  19. Physiological and molecular analysis of selected Kenyan maize lines for aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) toxicity is an important limitation to maize production in many tropical and sub-tropical acid soil areas. The aim of this study was to survey the variation in Al tolerance in a panel of maize lines adapted for Kenya and look for novel sources of Al tolerance. 112 Kenyan maize accessio...

  20. Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

    Science.gov (United States)

    Houde, Mario; Diallo, Amadou Oury

    2008-08-27

    Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

  1. Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines

    Directory of Open Access Journals (Sweden)

    Diallo Amadou

    2008-08-01

    Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

  2. Physiological Evaluation of Alkali-Salt Tolerance of Thirty Switchgrass (Panicum virgatum Lines.

    Directory of Open Access Journals (Sweden)

    Guofu Hu

    Full Text Available Soil salt-alkalization is a major limiting factor for crop production in many regions. Switchgrass (Panicum virgatum L. is a warm-season C4 perennial rhizomatous bunchgrass and a target lignocellulosic biofuel species. The objective of this study was to evaluate relative alkali-salt tolerance among 30 switchgrass lines. Tillers of each switchgrass line were transplanted into pots filled with fine sand. Two months after transplanting, plants at E5 developmental stage were grown in either half strength Hoagland's nutrient solution with 0 mM Na+ (control or half strength Hoagland's nutrient solution with 150 mM Na+ and pH of 9.5 (alkali-salt stress treatment for 20 d. Alkali-salt stress damaged cell membranes [higher electrolyte leakage (EL], reduced leaf relative water content (RWC, net photosynthetic rate (Pn, stomatal conductance (gs, and transpiration rate (Tr. An alkali-salt stress tolerance trait index (ASTTI for each parameter was calculated based on the ratio of the value under alkali-salt stress and the value under non-stress conditions for each parameter of each line. Relative alkali-salt tolerance was determined based on principal components analysis and cluster analysis of the physiological parameters and their ASTTI values. Significant differences in alkali-salt stress tolerance were found among the 30 lines. Lowland lines TEM-SEC, Alamo, TEM-SLC and Kanlow were classified as alkali-salt tolerant. In contrast, three lowland lines (AM-314/MS-155, BN-13645-64 and two upland lines (Caddo and Blackwell-1 were classified as alkali-salt sensitive. The results suggest wide variations exist in alkali-salt stress tolerance among the 30 switchgrass lines. The approach of using a combination of principal components and cluster analysis of the physiological parameters and related ASTTI is feasible for evaluating alkali-salt tolerance in switchgrass.

  3. Physiological Evaluation of Alkali-Salt Tolerance of Thirty Switchgrass (Panicum virgatum) Lines.

    Science.gov (United States)

    Hu, Guofu; Liu, Yiming; Zhang, Xunzhong; Yao, Fengjiao; Huang, Yan; Ervin, Erik H; Zhao, Bingyu

    2015-01-01

    Soil salt-alkalization is a major limiting factor for crop production in many regions. Switchgrass (Panicum virgatum L.) is a warm-season C4 perennial rhizomatous bunchgrass and a target lignocellulosic biofuel species. The objective of this study was to evaluate relative alkali-salt tolerance among 30 switchgrass lines. Tillers of each switchgrass line were transplanted into pots filled with fine sand. Two months after transplanting, plants at E5 developmental stage were grown in either half strength Hoagland's nutrient solution with 0 mM Na+ (control) or half strength Hoagland's nutrient solution with 150 mM Na+ and pH of 9.5 (alkali-salt stress treatment) for 20 d. Alkali-salt stress damaged cell membranes [higher electrolyte leakage (EL)], reduced leaf relative water content (RWC), net photosynthetic rate (Pn), stomatal conductance (gs), and transpiration rate (Tr). An alkali-salt stress tolerance trait index (ASTTI) for each parameter was calculated based on the ratio of the value under alkali-salt stress and the value under non-stress conditions for each parameter of each line. Relative alkali-salt tolerance was determined based on principal components analysis and cluster analysis of the physiological parameters and their ASTTI values. Significant differences in alkali-salt stress tolerance were found among the 30 lines. Lowland lines TEM-SEC, Alamo, TEM-SLC and Kanlow were classified as alkali-salt tolerant. In contrast, three lowland lines (AM-314/MS-155, BN-13645-64) and two upland lines (Caddo and Blackwell-1) were classified as alkali-salt sensitive. The results suggest wide variations exist in alkali-salt stress tolerance among the 30 switchgrass lines. The approach of using a combination of principal components and cluster analysis of the physiological parameters and related ASTTI is feasible for evaluating alkali-salt tolerance in switchgrass.

  4. Tolerance of corn lines seeds to high drying temperature

    OpenAIRE

    José, Solange Carvalho Barrios Roveri; Pinho, Édila Vilela de Resende Von; Pinho, Renzo Garcia Von; Silveira, César Martoreli da

    2004-01-01

    Cultivares tolerantes a altas temperaturas de secagem proporcionam redução no tempo de secagem, uma etapa crítica no sistema de produção de sementes de milho (Zea mays L.). Nesta pesquisa, foi avaliada a tolerância à alta temperatura de secagem de sementes de linhagens de milho, por meio de testes de germinação e vigor. As sementes foram colhidas manualmente em espigas com teor de água em torno de 35% e secas artificialmente à 45 C até atingirem 11% de teor de água. Em seguida, foram submetid...

  5. Distribution Line Parameter Estimation Under Consideration of Measurement Tolerances

    DEFF Research Database (Denmark)

    Prostejovsky, Alexander; Gehrke, Oliver; Kosek, Anna Magdalena

    2016-01-01

    conductance that the absolute compensated error is −1.05% and −1.07% for both representations, as opposed to the expected uncompensated error of −79.68%. Identification of a laboratory distribution line using real measurement data grid yields a deviation of 6.75% and 4.00%, respectively, from a calculation...

  6. Screening of inbred popcorn lines for tolerance to low phosphorus.

    Science.gov (United States)

    Santos, O J A P; Gonçalves, L S A; Scapim, C A; S M de Sousa, de; Castro, C R; Y Baba, V; de Oliveira, A L M

    2016-05-06

    Increasing phosphorus use efficiency in agriculture is essential for sustainable food production. Thus, the aims of this study were: i) to identify phosphorus use efficiency (PUE) in popcorn lines during the early plant stages, ii) to study the relationship between traits correlated with PUE, and iii) to analyze genetic diversity among lines. To accomplish this, 35 popcorn lines from Universidade Estadual de Maringá breeding program were studied. The experiment was conducted in a growth chamber using a nutrient solution containing two concentrations of phosphorus (P): 2.5 μM or low P (LP) and 250 μM or high P (HP). After 13 days in the nutrient solution, root morphology traits, shoot and root dry weight, and P content of the maize seedlings were measured. A deviance analysis showed there was a high level of genetic variability. An unweighted pair group method with arithmetic mean (UPGMA) clustering analysis identified three groups for the LP treatment (efficient, intermediate, and inefficient) and three groups for the HP treatment (responsive, moderately responsive, and unresponsive). The results of a principal component analysis and selection index were consistent with the UPGMA analysis, and lines 1, 2, 13, 17, 26, and 31 were classified as PUE.

  7. Evaluation of Durum Wheat Lines for Tolerance to Early Season Cold via Early Planting

    Directory of Open Access Journals (Sweden)

    V. Rashidi

    2010-10-01

    Full Text Available Cold stress is one of the environmental factors that affect planting date of durum wheat in mountainous North West areas of Iran. To study tolerance of 36 Durum wheat lines for cold, an experiment was conducted in mid winter (mid of February at the Agricultural Research Station of Islamic Azad University, Tabriz Branch, in 2007. Experimental design used was simple lattice. The results of analysis of variance showed that the lines under study responded differently to cold as to traits like percentage of survival, yield and its components. This indicates existence of genetic diversity among durum wheat lines. Percentage of survival of the lines 30, 5, 16, 27, 31 and 35 were for higher than those at other lines. Thus, they can be considered to be tolerant to early season cold. Comparison of means showed that lines 35, 31, 16 and 5 possessed higher percentage of survival and other percent survival also correlated positive with plant height, number of fertile spike seed yield and 1000 grain weight. As a whole line 35 was found to be more tolerant to early season cold than the others were. Cluster analysis was divided 36 lines into three groups. Lines in the third group possessed higher percentage of survival, plant height, number of fertile spike, biomass and high yield than their over all means.

  8. Registration of four post-flowering drought tolerant grain sorghum lines with early season cold tolerance

    Science.gov (United States)

    Four sorghum (Sorghum bicolor L.) germplasm lines— PSLS-SGCTB01 (Reg. No.), PSLS-SGCTR02 (Reg. No.), PSLS-SGCTB03 (Reg. No.) and PSLS-SGCTB04 (Reg. No.) — were developed by the USDA-ARS in Lubbock TX, in 2017. The primary purpose for the release of these lines is to provide an alternative germplasm ...

  9. Quinoa Well Tolerated in Patients with Celiac Disease

    Science.gov (United States)

    ... Maryland (January 21, 2014) – Adding quinoa to the gluten-free diet of patients with celiac disease is well-tolerated, ... grain, is traditionally recommended as part of a gluten-free diet. However, in-vitro data suggests that quinoa storage ...

  10. Aspects of Salt Tolerance in a NaCl-Selected Stable Cell Line of Citrus sinensis.

    Science.gov (United States)

    Ben-Hayyim, G; Kochba, J

    1983-07-01

    A NaCl-tolerant cell line which was selected from ovular callus of ;Shamouti' orange (Citrus sinensis L. Osbeck) proved to be a true cell line variant. This conclusion is based on the following observations. (a) Cells which have been removed from the selection pressure for at least four passages retain the same NaCl tolerance as do cells which are kept constantly on 0.2 molar NaCl. (b) Na(+) and Cl(-) uptake are considerably lower in salt-tolerant cells (R-10) than in salt-sensitive cells (L-5) at a given external NaCl concentration. (c) Growth of salt-tolerant cells is markedly suppressed upon replacement of NaCl by KCl, whereas the growth of salt-sensitive cells is only slightly affected. Accumulation of K(+) and Cl(-) accompanies the inhibition of growth. Experiments carried out with sodium and potassium sulfate suggest that the toxic effect is due to the accumulated Cl(-). (d) Removal of Ca(2+) from the growth medium severely inhibits the growth of salt-tolerant cells in the presence of NaCl, while it has a minor effect on growth of salt-sensitive cells in the presence of NaCl. (e) Electron micrographs show that the salt-tolerant cells have very big vacuoles when exposed to salt, while the size of the vacuoles of the salt-sensitive cells does not change.

  11. Improved tolerance toward fungal diseases in transgenic Cavendish banana (Musa spp. AAA group) cv. Grand Nain.

    Science.gov (United States)

    Vishnevetsky, Jane; White, Thomas L; Palmateer, Aaron J; Flaishman, Moshe; Cohen, Yuval; Elad, Yigal; Velcheva, Margarita; Hanania, Uri; Sahar, Nachman; Dgani, Oded; Perl, Avihai

    2011-02-01

    The most devastating disease currently threatening to destroy the banana industry worldwide is undoubtedly Sigatoka Leaf spot disease caused by Mycosphaerella fijiensis. In this study, we developed a transformation system for banana and expressed the endochitinase gene ThEn-42 from Trichoderma harzianum together with the grape stilbene synthase (StSy) gene in transgenic banana plants under the control of the 35S promoter and the inducible PR-10 promoter, respectively. The superoxide dismutase gene Cu,Zn-SOD from tomato, under control of the ubiquitin promoter, was added to this cassette to improve scavenging of free radicals generated during fungal attack. A 4-year field trial demonstrated several transgenic banana lines with improved tolerance to Sigatoka. As the genes conferring Sigatoka tolerance may have a wide range of anti-fungal activities we also inoculated the regenerated banana plants with Botrytis cinerea. The best transgenic lines exhibiting Sigatoka tolerance were also found to have tolerance to B. cinerea in laboratory assays.

  12. Transcriptome alteration in a rice introgression line with enhanced alkali tolerance.

    Science.gov (United States)

    Zhang, Yunhong; Lin, Xiuyun; Ou, Xiufang; Hu, Lanjuan; Wang, Jinming; Yang, Chunwu; Wang, Shucai; Liu, Bao

    2013-07-01

    Alkali stress inhibits plant growth and development and thus limits crop productivity. To investigate the possible genetic basis of alkali tolerance in rice, we generated an introgressed rice line (K83) with significantly enhanced tolerance to alkali stress compared to its recipient parental cultivar (Jijing88). By using microarray analysis, we examined the global gene expression profiles of K83 and Jijing88, and found that more than 1200 genes were constitutively and differentially expressed in K83 in comparison to Jijing88 with 572 genes up- and 654 down-regulated. Upon alkali treatment, a total of 347 genes were found up- and 156 down-regulated in K83 compared to 591 and 187, respectively, in Jijing88. Among the up-regulated genes in both K83 and Jijing88, only 34 were constitutively up-regulated in K83, suggesting that both the constitutive differentially expressed genes in K83 and those induced by alkali treatment are most likely responsible for enhanced alkali tolerance. A gene ontology analysis based on all annotated, differentially expressed genes revealed that genes with expression alterations were enriched in pathways involved in metabolic processes, catalytic activity, and transport and transcription factor activities, suggesting that these pathways are associated with alkali stress tolerance in rice. Our results illuminated the novel genetic aspects of alkali tolerance in rice and established a repertory of potential target genes for biotechnological manipulations that can be used to generate alkali-tolerant rice cultivars. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  13. Comparative proteome analysis of drought-sensitive and drought-tolerant rapeseed roots and their hybrid F1 line under drought stress.

    Science.gov (United States)

    Mohammadi, Payam Pour; Moieni, Ahmad; Komatsu, Setsuko

    2012-11-01

    Rapeseed (Brassica napus L.), which is the third leading source of vegetable oil, is sensitive to drought stress during the early vegetative growth stage. To investigate the initial response of rapeseed to drought stress, changes in the protein expression profiles of drought-sensitive (RGS-003) and drought-tolerant lines (SLM-003), and their F1 hybrid, were analyzed using a proteomics approach. Seven-day-old rapeseed seedlings were treated with drought stress by restricting water for 7 days, and proteins were extracted from roots and separated by two-dimensional polyacrylamide gel electrophoresis. In the sensitive rapeseed line, 35 protein spots were differentially expressed under drought stress, and proteins related to metabolism, energy, disease/defense, and transport were decreased. In the tolerant line, 32 protein spots were differentially expressed under drought stress, and proteins involved in metabolism, disease/defense, and transport were increased, while energy-related proteins were decreased. Six protein spots in F1 hybrid were common among expressed proteins in the drought-sensitive and -tolerant lines. Notably, tubulin beta-2 and heat shock protein 70 were decreased in the drought-sensitive line and hybrid F1 plants, while jasmonate-inducible protein and 20S proteasome subunit PAF1 were increased in the F1 hybrids and drought-tolerant line. These results indicate that (1) V-type H(+) ATPase, plasma-membrane associated cation-binding protein, HSP 90, and elongation factor EF-2 have a role in the drought tolerance of rapeseed; (2) The decreased levels of heat shock protein 70 and tubulin beta-2 in the drought-sensitive and hybrid F1 lines might explain the reduced growth of these lines in drought conditions.

  14. Tolerance, immunocompetence, and secondary disease in fully allogeneic radiation chimeras

    International Nuclear Information System (INIS)

    Rayfield, L.S.; Brent, L.

    1983-01-01

    The aim of this study was to ascertain the extent to which secondary disease and mortality in fully allogeneic chimeras (C57BL leads to CBA) is caused (if at all) by a delayed graft-versus-host reaction. Adult CBA males were thymectomized, irradiated, and reconstituted with T-lymphocyte-depleted C57BL or CBA bone marrow cells (BMC), followed three weeks after irradiation by implantation under the kidney capsule of thymic lobes from C57BL or CBA fetal or adult donors. These mice were observed for the development of secondary disease for periods in excess of 250 days, and they were examined at 5 weeks or 4 months for T lymphocyte reactivity and tolerance to alloantigens, using the cell-mediated lympholysis assay (CML). The following results were obtained. First, removal of T lymphocytes with anti-Thy 1 antibody and complement from allogeneic bone marrow did not prevent wasting and eventual death, although it prolonged the lifespan of mice substantially. Second, T lymphocytes generated from bone marrow-derived precursor cells became tolerant of the histocompatibility antigens of the thymus donor strain but remained normally reactive to third-party antigens. Third, allogeneic radiation chimeras did not survive as well as animals reconstituted with syngeneic cells, even when they were demonstrably tolerant in CML. Fourth, C57BL BMC maturing in a CBA host equipped with a C57BL thymus graft did not become tolerant of host antigens, indicating that extra-thymic tolerance does not occur in fully allogeneic--as opposed to semiallogeneic--chimeras. It is argued that the function of B lymphocytes and/or accessory cells is impaired in fully allogeneic radiation chimeras, and that the mortality observed was directly related to the resulting immunodeficiency. The relevance of the results described in this paper to clinical bone marrow transplantation is discussed

  15. Water-deficit tolerant classification in mutant lines of indica rice

    Directory of Open Access Journals (Sweden)

    Suriyan Cha-um

    2012-04-01

    Full Text Available Water shortage is a major abiotic stress for crop production worldwide, limiting the productivity of crop species, especially in dry-land agricultural areas. This investigation aimed to classify the water-deficit tolerance in mutant rice (Oryza sativa L. spp. indica genotypes during the reproductive stage. Proline content in the flag leaf of mutant lines increased when plants were subjected to water deficit. Relative water content (RWC in the flag leaf of different mutant lines dropped in relation to water deficit stress. A decrease RWC was positively related to chlorophyll a degradation. Chlorophyll a , chlorophyll b , total chlorophyll , total carotenoids , maximum quantum yield of PSII , stomatal conductance , transpiration rate and water use efficiency in mutant lines grown under water deficit conditions declined in comparison to the well-watered, leading to a reduction in net-photosynthetic rate. In addition, when exposed to water deficit, panicle traits, including panicle length and fertile grains were dropped. The biochemical and physiological data were subjected to classify the water deficit tolerance. NSG19 (positive control and DD14 were identified as water deficit tolerant, and AA11, AA12, AA16, BB13, BB16, CC12, CC15, EE12, FF15, FF17, G11 and IR20 (negative control as water deficit sensitive, using Ward's method.

  16. Evaluation of Drought response in Some Rice Mutant Lines Using Stress Tolerance Indices

    Directory of Open Access Journals (Sweden)

    H Aminpanah

    2018-05-01

    Full Text Available Introduction Drought is a major problem that limits the adoption of high-yielding rice varieties in drought-prone rainfed rice environments. To improve crop productivity, it is necessary to understand the mechanism of plant responses to drought conditions with the ultimate goal of improving crop performance in the vast areas of the world where rainfall is limiting or unreliable. Safaei Chaeikar et al. (2008 reported that MP, GMP, HM and STI indices, which showed the highest correlation with grain yield under both optimal and stress conditions, can be used as the best indices to introduce drought-tolerant genotypes in rice breeding programs. They also were introduced Nemat, Sepidrood, IR64, IR50 and Bejar genotypes as tolerant varieties. The present study was conducted to determine how drought affects grain yield in rice mutant lines and also to test this hypothesis in order to identify the most suitable indices/genotypes. Materials and Methods A field trial was conducted at Iranian Rice Research Centers in North of Iran, Rasht (latitude 37◦28', longitude 49◦28'E and altitude 7m below the sea level, during the 2014-2015 growing season. The seeds were sown in a nursery on the 10 May and 25 day old seedlings were transplanted to the field. Two separately experiment was carried out under reproductive stage drought stress and controlled conditions based on randomized complete block design with three replications, in four-row plots of three m length. Transplanting was done using 1 seedling per hill; at hill spacing of 25 cm × 25 cm. 18 rice genotypes were consisted 14 M5 mutant lines and their four parental cultivars. Results and Discussion Analysis of variance indicated significant effects of drought stress, genotype and interaction effects of two factors on grain yield, plant height, flag leaf area, tiller number and grain fertility percentage. Drought stress at reproductive stage caused reduction in grain yield (59.47%, grain fertility

  17. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    is linked to a different set of circumstances than the ones suggested by existing models in contemporary democratic theory. Reorienting the discussion of tolerance, the book raises the question of how to disclose new possibilities within our given context of affect and perception. Once we move away from......Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated...... by the desire to experiment and to become otherwise. The objective is to discuss what gets lost, conceptually as well as politically, when we neglect the subsistence of active tolerance within other practices of tolerance, and to develop a theory of active tolerance in which tolerance's mobilizing character...

  18. Flooding tolerance in interspecific introgression lines containing chromosome segments from teosinte (Zea nicaraguensis) in maize (Zea mays subsp. mays)

    Science.gov (United States)

    Mano, Y.; Omori, F.

    2013-01-01

    Background and Aims Nicaraguan teosinte (Zea nicaraguensis), a species found in frequently flooded areas, provides useful germplasm for breeding flooding-tolerant maize (Z. mays subsp. mays). The objective of this study was to select flooding-tolerant lines using a library of introgression lines (ILs), each containing a chromosome segment from Z. nicaraguensis in the maize inbred line Mi29. Methods To produce the ILs, a single F1 plant derived from a cross between maize Mi29 and Z. nicaraguensis was backcrossed to Mi29 three times, self-pollinated four times and genotyped using simple sequence repeat markers. Flooding tolerance was evaluated at the seedling stage under reducing soil conditions. Key Results By backcrossing and selfing, a series of 45 ILs were developed covering nearly the entire maize genome. Five flooding-tolerant lines were identified from among the ILs by evaluating leaf injury. Among these, line IL#18, containing a Z. nicaraguensis chromosome segment on the long arm of chromosome 4, showed the greatest tolerance to flooding, suggesting the presence of a major quantitative trait locus (QTL) in that region. The presence of the QTL was verified by examining flooding tolerance in a population segregating for the candidate region of chromosome 4. There was no significant relationship between the capacity to form constitutive aerenchyma and flooding tolerance in the ILs, indicating the presence of other factors related to flooding tolerance under reducing soil conditions. Conclusions A flooding-tolerant genotype, IL#18, was identified; this genotype should be useful for maize breeding. In addition, because the chromosome segments of Z. nicaraguensis in the ILs cover nearly the entire genome and Z. nicaraguensis possesses several unique traits related to flooding tolerance, the ILs should be valuable material for additional QTL detection and the development of flooding-tolerant maize lines. PMID:23877074

  19. Flooding tolerance in interspecific introgression lines containing chromosome segments from teosinte (Zea nicaraguensis) in maize (Zea mays subsp. mays).

    Science.gov (United States)

    Mano, Y; Omori, F

    2013-10-01

    Nicaraguan teosinte (Zea nicaraguensis), a species found in frequently flooded areas, provides useful germplasm for breeding flooding-tolerant maize (Z. mays subsp. mays). The objective of this study was to select flooding-tolerant lines using a library of introgression lines (ILs), each containing a chromosome segment from Z. nicaraguensis in the maize inbred line Mi29. To produce the ILs, a single F1 plant derived from a cross between maize Mi29 and Z. nicaraguensis was backcrossed to Mi29 three times, self-pollinated four times and genotyped using simple sequence repeat markers. Flooding tolerance was evaluated at the seedling stage under reducing soil conditions. By backcrossing and selfing, a series of 45 ILs were developed covering nearly the entire maize genome. Five flooding-tolerant lines were identified from among the ILs by evaluating leaf injury. Among these, line IL#18, containing a Z. nicaraguensis chromosome segment on the long arm of chromosome 4, showed the greatest tolerance to flooding, suggesting the presence of a major quantitative trait locus (QTL) in that region. The presence of the QTL was verified by examining flooding tolerance in a population segregating for the candidate region of chromosome 4. There was no significant relationship between the capacity to form constitutive aerenchyma and flooding tolerance in the ILs, indicating the presence of other factors related to flooding tolerance under reducing soil conditions. A flooding-tolerant genotype, IL#18, was identified; this genotype should be useful for maize breeding. In addition, because the chromosome segments of Z. nicaraguensis in the ILs cover nearly the entire genome and Z. nicaraguensis possesses several unique traits related to flooding tolerance, the ILs should be valuable material for additional QTL detection and the development of flooding-tolerant maize lines.

  20. THE ADAPTATION TEST ON YARDLONG BEAN LINES TOLERANT TO APHIDS AND HIGH YIELD

    Directory of Open Access Journals (Sweden)

    Kuswanto

    2011-06-01

    Full Text Available The adaptation trial was applied to determine the benefits of genotype-environmental inter-action, adaptability and stability of lines. The previous research successfully obtained 8 UB lines which had high yield and tolerant to aphids. These lines belong to plant breeding laboratory of Brawijaya University, which had stability and a high potential can be immediately released to the public. Research was conducted in 2010, dry and rainy season, on 3 locations of yardlong bean, namely Malang, Kediri and Jombang. Randomized Block Design was applied in these locations.Genotype-environment interaction was analyzed with combined analysis of nested design.The adaptability and stability were known from regression analysis based on the stability of Eberhart and Russel. There were 6 stabile lines, namely UB7070P1, UB24089X1, UB606572, UB61318, UB7023J44, and UB715, respectively. They were recommended to be released as new varieties which had pest tolerance and high yield. The UBPU was suitable to be developed in marginal land. The 6 new varieties had registered to Agriculture Department Republic of Indonesia, namely, Brawijaya 1, Brawijaya 3, Brawijaya 4, Bagong 2, Bagong 3 dan Bagong Ungu, respectively.

  1. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated by the d...... these alternatives by returning to the notion of tolerance as the endurance of pain, linking this notion to exemplars and theories relevant to the politics of multiculturalism, religious freedom, and free speech....

  2. Agronomic and molecular evaluation of maize inbred lines for drought tolerance

    International Nuclear Information System (INIS)

    Mikić, S.; Zorić, M.; Stanisavljević, D.; Kondić-Špika, A.; Brbaklić, L.; Kobiljski, B.; Nastasić, A.; Mitrović, B.; Šurlan-Momirović, G.

    2016-01-01

    Drought is a severe threat to maize yield stability in Serbia and other temperate Southeast European countries occurring occasionally but with significant yield losses. The development of resilient genotypes that perform well under drought is one of the main focuses of maize breeding programmes. To test the tolerance of newly developed elite maize inbred lines to drought stress, field trials for grain yield performance and anthesis silk interval (ASI) were set in drought stressed environments in 2011 and 2012. Inbred lines performing well under drought, clustered into a group with short ASI and a smaller group with long ASI, were considered as a potential source for tolerance. The former contained inbreds from different heterotic groups and with a proportion of local germplasm. The latter consisted of genotypes with mixed exotic and Lancaster germplasm, which performed better in more drought-affected environments. Three inbreds were selected for their potential drought tolerance, showing an above-average yield and small ASI in all environments. Association analysis indicated significant correlations between ASI and grain yield and three microsatellites (bnlg1525, bnlg238 and umc1025). Eight alleles were selected for their favourable concurrent effect on yield increase and ASI decrease. The proportion of phenotypic variation explained by the markers varied across environments from 5.7% to 22.4% and from 4.6% to 8.1% for ASI and yield, respectively. The alleles with strongest effect on performance of particular genotypes and their interactions in specific environments were identified by the mean of partial least square interactions analysis indicating potential suitability of the makers for tolerant genotype selection.

  3. Agronomic and molecular evaluation of maize inbred lines for drought tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Mikić, S.; Zorić, M.; Stanisavljević, D.; Kondić-Špika, A.; Brbaklić, L.; Kobiljski, B.; Nastasić, A.; Mitrović, B.; Šurlan-Momirović, G.

    2016-07-01

    Drought is a severe threat to maize yield stability in Serbia and other temperate Southeast European countries occurring occasionally but with significant yield losses. The development of resilient genotypes that perform well under drought is one of the main focuses of maize breeding programmes. To test the tolerance of newly developed elite maize inbred lines to drought stress, field trials for grain yield performance and anthesis silk interval (ASI) were set in drought stressed environments in 2011 and 2012. Inbred lines performing well under drought, clustered into a group with short ASI and a smaller group with long ASI, were considered as a potential source for tolerance. The former contained inbreds from different heterotic groups and with a proportion of local germplasm. The latter consisted of genotypes with mixed exotic and Lancaster germplasm, which performed better in more drought-affected environments. Three inbreds were selected for their potential drought tolerance, showing an above-average yield and small ASI in all environments. Association analysis indicated significant correlations between ASI and grain yield and three microsatellites (bnlg1525, bnlg238 and umc1025). Eight alleles were selected for their favourable concurrent effect on yield increase and ASI decrease. The proportion of phenotypic variation explained by the markers varied across environments from 5.7% to 22.4% and from 4.6% to 8.1% for ASI and yield, respectively. The alleles with strongest effect on performance of particular genotypes and their interactions in specific environments were identified by the mean of partial least square interactions analysis indicating potential suitability of the makers for tolerant genotype selection.

  4. Efficacy and tolerability of a facial serum for fine lines, wrinkles, and photodamaged skin.

    Science.gov (United States)

    McCall-Perez, Fred; Stephens, Thomas J; Herndon, James H

    2011-07-01

    Dermatology visits for the prevention and treatment of aging skin are rapidly increasing. The clinical sequelae including wrinkling, pigmentary changes, roughness, laxity, and telangiectasia can all result in the appearance of aging skin, impacting quality of life. A facial serum was developed with ingredients associated with an improvement in the appearance of fine lines and wrinkles and increase in stratum corneum barrier function. Patients were instructed to use a gentle wash before applying the formulation and a moisturizer afterwards. To assess the efficacy and tolerability of a facial serum in improving the appearance of fine lines, wrinkles, and signs of photodamage. Thirty-four female subjects (Fitzpatrick classification I-IV) with early to advanced photodamaged skin in a 12-week, single-arm, open-label clinical trial. Visits were scheduled at Baseline and Weeks 4, 8, and 12. Efficacy was assessed using visual grading of facial and periocular skin (modified 10-point scales); changes in viscoelasticity properties were assessed by cutometry. Cutaneous tolerability was evaluated both clinically and subjectively using a 4-point scale and monitoring adverse events. Digital photography documented treatment-related changes in skin appearance. Subjects completed self-assessments at Baseline and Weeks 4, 8, and 12. Significant improvements in all parameters and skin condition were seen as early as Week 4 (p≤0.05). There was an 18-percent improvement in overall appearance by Week 12 (p≤0.05). Fine lines and coarse winkles improved by 27 and 15 percent, respectively (both p≤0.05). Significant improvements were also seen in uneven pigmentation, firmness/elasticity, toned/resiliency, skin radiance, tone, and tactile roughness/smoothness (10%, 11%, 18%, 21%, 16%, and 47%, respectively; allp≤0.05). By Week 12 subjects reported a 43-percent improvement in overall facial skin appearance and 24-percent reduction in mean scores for facial lines and wrinkles (bothp≤0

  5. High-throughput phenotyping to detect drought tolerance QTL in wild barley introgression lines.

    Directory of Open Access Journals (Sweden)

    Nora Honsdorf

    Full Text Available Drought is one of the most severe stresses, endangering crop yields worldwide. In order to select drought tolerant genotypes, access to exotic germplasm and efficient phenotyping protocols are needed. In this study the high-throughput phenotyping platform "The Plant Accelerator", Adelaide, Australia, was used to screen a set of 47 juvenile (six week old wild barley introgression lines (S42ILs for drought stress responses. The kinetics of growth development was evaluated under early drought stress and well watered treatments. High correlation (r=0.98 between image based biomass estimates and actual biomass was demonstrated, and the suitability of the system to accurately and non-destructively estimate biomass was validated. Subsequently, quantitative trait loci (QTL were located, which contributed to the genetic control of growth under drought stress. In total, 44 QTL for eleven out of 14 investigated traits were mapped, which for example controlled growth rate and water use efficiency. The correspondence of those QTL with QTL previously identified in field trials is shown. For instance, six out of eight QTL controlling plant height were also found in previous field and glasshouse studies with the same introgression lines. This indicates that phenotyping juvenile plants may assist in predicting adult plant performance. In addition, favorable wild barley alleles for growth and biomass parameters were detected, for instance, a QTL that increased biomass by approximately 36%. In particular, introgression line S42IL-121 revealed improved growth under drought stress compared to the control Scarlett. The introgression line showed a similar behavior in previous field experiments, indicating that S42IL-121 may be an attractive donor for breeding of drought tolerant barley cultivars.

  6. High-throughput phenotyping to detect drought tolerance QTL in wild barley introgression lines

    KAUST Repository

    Honsdorf, Nora

    2014-05-13

    Drought is one of the most severe stresses, endangering crop yields worldwide. In order to select drought tolerant genotypes, access to exotic germplasm and efficient phenotyping protocols are needed. In this study the high-throughput phenotyping platform "The Plant Accelerator", Adelaide, Australia, was used to screen a set of 47 juvenile (six week old) wild barley introgression lines (S42ILs) for drought stress responses. The kinetics of growth development was evaluated under early drought stress and well watered treatments. High correlation (r = 0.98) between image based biomass estimates and actual biomass was demonstrated, and the suitability of the system to accurately and non-destructively estimate biomass was validated. Subsequently, quantitative trait loci (QTL) were located, which contributed to the genetic control of growth under drought stress. In total, 44 QTL for eleven out of 14 investigated traits were mapped, which for example controlled growth rate and water use efficiency. The correspondence of those QTL with QTL previously identified in field trials is shown. For instance, six out of eight QTL controlling plant height were also found in previous field and glasshouse studies with the same introgression lines. This indicates that phenotyping juvenile plants may assist in predicting adult plant performance. In addition, favorable wild barley alleles for growth and biomass parameters were detected, for instance, a QTL that increased biomass by approximately 36%. In particular, introgression line S42IL-121 revealed improved growth under drought stress compared to the control Scarlett. The introgression line showed a similar behavior in previous field experiments, indicating that S42IL-121 may be an attractive donor for breeding of drought tolerant barley cultivars. © 2014 Honsdorf et al.

  7. Generation of American elm trees with tolerance to Dutch elm disease through controlled crosses and selection

    Science.gov (United States)

    James M. Slavicek; Kathleen S. Knight

    2012-01-01

    The goal of our research and development efforts is to generate new and/or improved selections of the American elm (Ulmus americana L.) with tolerance/resistance to Dutch elm disease (DED). The approaches we are taking for this effort include: 1) controlled breeding using known DED -tolerant selections, 2) controlled breeding using DED-tolerant...

  8. Intelligent on-line fault tolerant control for unanticipated catastrophic failures.

    Science.gov (United States)

    Yen, Gary G; Ho, Liang-Wei

    2004-10-01

    As dynamic systems become increasingly complex, experience rapidly changing environments, and encounter a greater variety of unexpected component failures, solving the control problems of such systems is a grand challenge for control engineers. Traditional control design techniques are not adequate to cope with these systems, which may suffer from unanticipated dynamic failures. In this research work, we investigate the on-line fault tolerant control problem and propose an intelligent on-line control strategy to handle the desired trajectories tracking problem for systems suffering from various unanticipated catastrophic faults. Through theoretical analysis, the sufficient condition of system stability has been derived and two different on-line control laws have been developed. The approach of the proposed intelligent control strategy is to continuously monitor the system performance and identify what the system's current state is by using a fault detection method based upon our best knowledge of the nominal system and nominal controller. Once a fault is detected, the proposed intelligent controller will adjust its control signal to compensate for the unknown system failure dynamics by using an artificial neural network as an on-line estimator to approximate the unexpected and unknown failure dynamics. The first control law is derived directly from the Lyapunov stability theory, while the second control law is derived based upon the discrete-time sliding mode control technique. Both control laws have been implemented in a variety of failure scenarios to validate the proposed intelligent control scheme. The simulation results, including a three-tank benchmark problem, comply with theoretical analysis and demonstrate a significant improvement in trajectory following performance based upon the proposed intelligent control strategy.

  9. Nitrogen and carbon relationships between the parasitic weed Orobanche foetida and susceptible and tolerant faba bean lines.

    Science.gov (United States)

    Abbes, Zouhaier; Kharrat, Mohamed; Delavault, Philippe; Chaïbi, Wided; Simier, Philippe

    2009-02-01

    The parasitic weed Orobanche foetida (Poiret) is an emergent agronomical problem on faba bean in Tunisia. The Tunisian breeding programs for faba bean resistance to O. foetida have produced several tolerant lines including the line XBJ90.03-16-1-1-1, which limits both parasite attachments to the host roots and growth of the attached parasites. The present study aims to provide a better understanding of the nutritional relationships between the parasite and this tolerant line in comparison with the susceptible Bachaar genotype. Phloem saps of faba bean were harvested using phloem exudation experiments. The major organic compounds potentially transferred from both faba bean genotypes to the parasite were identified as sucrose, raffinose, stachyose, citrate, malate, asparagine (ASN), aspartate (ASP), glutamine, glutamate, serine, alanine and GABA. However, the phloem exudates of the tolerant line were highly deficient in nitrogen when compared to that of the susceptible line. When attached to roots of the tolerant line, the parasite displayed limited activities of soluble invertases in tubercles, and especially in shoots, suggesting that the low performance of the broomrapes attached to the tolerant line resulted from a reduced capacity to utilize the host-derived carbohydrates. On the other hand, the mechanisms involved in the osmotic adjustment and primary metabolism of the parasite did not differ significantly according to the host genotype: mineral cations, especially potassium and calcium, predominated as the major osmotically-active compounds in both tubercles and shoots; shoots accumulated preferentially hexoses as organic solutes although tubercles accumulated preferentially starch and soluble amino acids, especially ASP and ASN. This suggests an important role for a glutamine-dependent asparagine synthetase (EC 6.3.5.4) in the N metabolism of the parasite.

  10. Evaluating Genetic Variability of Sorghum Mutant Lines Tolerant to Acid Soil

    International Nuclear Information System (INIS)

    Puspitasari, W.; Human, S.; Wirnas, D.; Trikoesoemaningtyas

    2012-01-01

    High rainfall in some parts in Indonesia causes soil become acidic. The main constraint of acid soil is phosphor (P) deficiency and aluminum (Al) toxicity which decrease plant productivity. To overcome this problem, it is important to develop a crop variety tolerant to such conditions. Sorghum is probably one of the potential crops to meet that objective. Sorghum has been reported to have wide adaptability to various agro-ecology and can be used as food and animal feed. Unfortunately, sorghum is not Indonesian origin so its genetic variability is still low. From previous breeding works with induced mutation, some promising mutant lines have been developed. These mutant lines were included in the experiment carried out in Tenjo with soil condition was classified as acid soil with pH 4.8 and exchangeable-Al content 2.43 me/100 g. The objectives of this experiment were to study the magnitude of genetic variability of agronomy and grain quality characters in sorghum in order to facilitate the breeding improvement of the species. Plant materials used in this study were ten genotypes, including 6 mutant lines and 4 control varieties. The randomized block design with three replications was used in the experiment. The genetic variabilities of agronomic and grain quality characters existed among genotypes, such as plant height, number of leaves, stalk diameter, biomass weight, panicle length, grain yield per plant, 100 seed weight and tannin content in the grain. The broad sense heritabilities of agronomic characters were estimated ranging from medium to high. Grain yield showed significantly positive correlation with agronomic characters observed, but it was negatively correlated with protein content (author)

  11. Improvement of pigenonpea and cowpea for drought, disease and insect pest tolerance through induced mutations

    International Nuclear Information System (INIS)

    Omanga, P.A.

    1997-01-01

    Pigeonpea and cowpea are widely grown in the semi-arid and arid regions of Kenya by small scale farmers. The average yields are usually low due to insect pests, diseases and long growth duration of the local land races. Little success has been achieved through conventional breeding methods for tolerance to insect pests and diseases despite the development of high yielding and early maturing lines. Therefore, mutation induction was initiated to widen the genetic variability in the improved lines. Seeds of three promising pigeonpea cultivars KAT 60/8, KAT 777 and KAT E31/4 and of cowpea KAT 419, K80 and M66 were subjected to three doses of gamma rays; 80, 120 and 150 Gy for pigeonpea and 160, 200 and 250 Gy for cowpea. In M 1 generation, doses of 150 Gy and 250 Gy reduced emergence by about 50% and increased seedling deformities in both crops. In M 2 generation of KAT 60/8, high yielding mutants with oval shaped seeds (T 1 P 58 ) and branching (T 3 P 28 ) were identified. Two progenies of KAT 777 (T 1 P 7 and T 1 P 11 ) had small slender leaves. Selected plant progenies in M 3 , M 4 and M 5 generation gave some promising high yielding variants. Although, the difference in days to flower and maturity of mutant progenies and untreated bulk were small, some mutant progenies of KAT 777 and KAT 60/8 showed tolerance to Fusarium wilt. None of the progenies of KAT E31/4 gave better score for Cercospora leaf-spot compared to the check. (author). 2 refs, 4 tabs

  12. Improvement of pigenonpea and cowpea for drought, disease and insect pest tolerance through induced mutations

    Energy Technology Data Exchange (ETDEWEB)

    Omanga, P A [National Dryland Farming Research Centre, Kenya Agricultural Research Inst., Machakos (Kenya)

    1997-07-01

    Pigeonpea and cowpea are widely grown in the semi-arid and arid regions of Kenya by small scale farmers. The average yields are usually low due to insect pests, diseases and long growth duration of the local land races. Little success has been achieved through conventional breeding methods for tolerance to insect pests and diseases despite the development of high yielding and early maturing lines. Therefore, mutation induction was initiated to widen the genetic variability in the improved lines. Seeds of three promising pigeonpea cultivars KAT 60/8, KAT 777 and KAT E31/4 and of cowpea KAT 419, K80 and M66 were subjected to three doses of gamma rays; 80, 120 and 150 Gy for pigeonpea and 160, 200 and 250 Gy for cowpea. In M{sub 1} generation, doses of 150 Gy and 250 Gy reduced emergence by about 50% and increased seedling deformities in both crops. In M{sub 2} generation of KAT 60/8, high yielding mutants with oval shaped seeds (T{sub 1} P{sub 58}) and branching (T{sub 3} P{sub 28}) were identified. Two progenies of KAT 777 (T{sub 1} P{sub 7} and T{sub 1} P{sub 11}) had small slender leaves. Selected plant progenies in M{sub 3}, M{sub 4} and M{sub 5} generation gave some promising high yielding variants. Although, the difference in days to flower and maturity of mutant progenies and untreated bulk were small, some mutant progenies of KAT 777 and KAT 60/8 showed tolerance to Fusarium wilt. None of the progenies of KAT E31/4 gave better score for Cercospora leaf-spot compared to the check. (author). 2 refs, 4 tabs.

  13. Aspects of Salt Tolerance in a NaCl-Selected Stable Cell Line of Citrus sinensis1

    Science.gov (United States)

    Ben-Hayyim, Gozal; Kochba, Joshua

    1983-01-01

    A NaCl-tolerant cell line which was selected from ovular callus of `Shamouti' orange (Citrus sinensis L. Osbeck) proved to be a true cell line variant. This conclusion is based on the following observations. (a) Cells which have been removed from the selection pressure for at least four passages retain the same NaCl tolerance as do cells which are kept constantly on 0.2 molar NaCl. (b) Na+ and Cl− uptake are considerably lower in salt-tolerant cells (R-10) than in salt-sensitive cells (L-5) at a given external NaCl concentration. (c) Growth of salt-tolerant cells is markedly suppressed upon replacement of NaCl by KCl, whereas the growth of salt-sensitive cells is only slightly affected. Accumulation of K+ and Cl− accompanies the inhibition of growth. Experiments carried out with sodium and potassium sulfate suggest that the toxic effect is due to the accumulated Cl−. (d) Removal of Ca2+ from the growth medium severely inhibits the growth of salt-tolerant cells in the presence of NaCl, while it has a minor effect on growth of salt-sensitive cells in the presence of NaCl. (e) Electron micrographs show that the salt-tolerant cells have very big vacuoles when exposed to salt, while the size of the vacuoles of the salt-sensitive cells does not change. Images Fig. 3 PMID:16663067

  14. Parkinson's disease and Alzheimer's disease: hypersensitivity to X-rays in cultured cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Robbins, J H; Otsuka, Fujio; Tarone, R E; Polinsky, R J; Nee, L E; Brumback, R A

    1985-09-01

    Fibroblast and/or lymphoblastoid lines from patients with several inherited primary neuronal degenerations are hypersensitive to DNA-damaging agents. Therefore, lymphoblastoid lines were irradiated from patients with sporadic Parkinson's disease (PD), Alzheimer's disease, and amyotrophic lateral sclerosis. The mean survival values of the eight Parkinson's disease and of the six Alzheimer's disease lines, but not of the five amyotrophic lateral sclerosis lines, were less than that of the 28 normal lines. Our results with Parkinson's disease and Alzheimer's disease cells can be explained by a genetic defect arising as a somatic mutation during embryogenesis, causing defective repair of the X-ray type of DNA damage. Such a DNA repair defect could cause an abnormal accumulation of spontaneously occurring DNA damage in Parkinson's disease and Alzheimer's disease neurons in vivo, resulting in their premature death.

  15. Parkinson's disease and Alzheimer's disease: hypersensitivity to X-rays in cultured cell lines

    International Nuclear Information System (INIS)

    Robbins, J.H.; Otsuka, Fujio; Tarone, R.E.; Polinsky, R.J.; Nee, L.E.; Brumback, R.A.

    1985-01-01

    Fibroblast and/or lymphoblastoid lines from patients with several inherited primary neuronal degenerations are hypersensitive to DNA-damaging agents. Therefore, lymphoblastoid lines were irradiated from patients with sporadic Parkinson's disease (PD), Alzheimer's disease, and amyotrophic lateral sclerosis. The mean survival values of the eight Parkinson's disease and of the six Alzheimer's disease lines, but not of the five amyotrophic lateral sclerosis lines, were less than that of the 28 normal lines. Our results with Parkinson's disease and Alzheimer's disease cells can be explained by a genetic defect arising as a somatic mutation during embryogenesis, causing defective repair of the X-ray type of DNA damage. Such a DNA repair defect could cause an abnormal accumulation of spontaneously occurring DNA damage in Parkinson's disease and Alzheimer's disease neurons in vivo, resulting in their premature death. (author)

  16. Tolerância de sementes de linhagens de milho à alta temperatura de secagem Tolerance of corn lines seeds to high drying temperature

    Directory of Open Access Journals (Sweden)

    Solange Carvalho Barrios Roveri José

    2004-10-01

    Full Text Available Cultivares tolerantes a altas temperaturas de secagem proporcionam redução no tempo de secagem, uma etapa crítica no sistema de produção de sementes de milho (Zea mays L.. Nesta pesquisa, foi avaliada a tolerância à alta temperatura de secagem de sementes de linhagens de milho, por meio de testes de germinação e vigor. As sementes foram colhidas manualmente em espigas com teor de água em torno de 35% e secas artificialmente à 45 C até atingirem 11% de teor de água. Em seguida, foram submetidas aos testes de primeira contagem e contagem final de germinação, envelhecimento acelerado, teste de frio sem solo e de condutividade elétrica. Houve diferenças significativas nos valores de germinação e vigor de sementes das diferentes linhagens, sendo então classificadas em tolerantes e intolerantes. Pelos resultados, conclui-se que a sensibilidade das sementes à injúria por secagem à alta temperatura é dependente da linhagem.High drying temperature tolerant cultivars provide a reduction in the drying period, a critical phase of the corn seeds (Zea mays L. production system. In this research the tolerance of corn lines seeds to high drying temperature was evaluated by the germination and vigor tests. Seeds were handpicked in ears with water content around 35% and dried artificially at 45ºC up to 11% water content. Then, the seeds were submitted to the first and final germination counting tests, accelerated aging, cold test without soil and electrical conductivity. There were significant differences in the germination and vigor values of seeds from different lines, being classified into tolerant and intolerant. The results permitted to conclude that sensitivity of seeds to high drying temperature injury depends on the lines.

  17. Comparison between the DNA Fingerprints Obtained from the Yellow Vein Mosaic Disease Tolerant Okra Mutants and Their Parental Variety

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Puripunyavanich, Vichai; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen

    2006-01-01

    The yellow vein mosaic disease (YVMD) is a widespread disease that is found among export orchards of okra. In this report, we studied gamma radiation-induced YVMD tolerant okra mutants and other commercial okra varieties at DNA level. We found that DNA extraction method that utilized sodium dodecyl sulfate and potassium acetate to precipitate other biomolecules was a suitable method to use for DNA finger printing of okra. The MFLP finger printing technique was superior to the AFLP technique in finding polymorphisms among different okra varieties. Also polymorphisms between the YVMD-tolerant mutant lines and their parental variety could be detected, indicating that gamma radiation could induce some changes at DNA level in these plants

  18. Unilateral segmental Darier disease following Blaschko lines: A case report

    Directory of Open Access Journals (Sweden)

    César Bimbi

    2017-07-01

    Full Text Available Darier disease is an autosomal-dominant disorder of keratin production which leads to a loss in epithelial adhesion and abnormal keratinization. The clinical correspondence is keratotic papules grouped in sebaceous areas of trunk, scalp, forehead and flexures. It is a rare disease and the variant focused on here of unilateral segmental distribution following the lines of Blaschko is rarer still, considering the fact that this presentation counts for only 10% of this already uncommom disease and with only 40 cases being reported in English medical literature. Mutation in this gene is expressed in the skin and brain. The treatment of Darier disease can be challenging and is often difficult and sometimes unsatisfactory. Systemic retinoids are considered the drug of choice for treating Darier disease. However, their use is limited by potential side effects. We described the case a metalworker male with unilateral segmental Darier disease following Blaschko lines and we review the literature on this subject.

  19. The genetics of tolerance to tristeza disease in citrus rootstocks

    Directory of Open Access Journals (Sweden)

    Rita Bordignon

    2004-01-01

    Full Text Available Controlled pollinations between four elite citrus rootstocks, Citrus limonia - 'Limeira' rangpur lime (Cravo, C. sunki - 'Sunki' mandarin (Sunki, C. aurantium - 'São Paulo' sour orange (Azeda and Poncirus trifoliata - 'Davis A' trifoliate orange (Trifoliata, resulted in 1614 nucelar and 1938 hybrid plants identified by the isozyme loci Pgi-1, Pgm-1, Got-1, Got-2, Aps-1, Me-1, Prxa-1 and or by the morphological markers broadness of leaf petiole wing or trifoliolate leaves. Tolerance to the citrus tristeza virus (CTV was evaluated under nursery and field conditions for several years by the reaction of Valencia orange infected with a severe strain of CTV and grafted onto the hybrids and nucellar clones. Genetic analyses indicated that tolerance was controlled by at least two loci designated here as Az and t interacting in dominant-recessive epistasis. Genotypes Az__ __ __ and __ __ tt were tolerant while azaz T__ was intolerant. The intolerant Azeda was azaz TT, the tolerant rootstocks Sunki and Cravo were Azaz tt and the Trifoliata was Azaz TT. The different degrees of intolerance seen in some hybrids may reflect the inability of segregating modifiers from parental clones to overcome the epistatic interaction that controls the major tolerance reaction.

  20. Food plant derived disease tolerance and resistance in a natural butterfly-plant-parasite interactions.

    Science.gov (United States)

    Sternberg, Eleanore D; Lefèvre, Thierry; Li, James; de Castillejo, Carlos Lopez Fernandez; Li, Hui; Hunter, Mark D; de Roode, Jacobus C

    2012-11-01

    Organisms can protect themselves against parasite-induced fitness costs through resistance or tolerance. Resistance includes mechanisms that prevent infection or limit parasite growth while tolerance alleviates the fitness costs from parasitism without limiting infection. Although tolerance and resistance affect host-parasite coevolution in fundamentally different ways, tolerance has often been ignored in animal-parasite systems. Where it has been studied, tolerance has been assumed to be a genetic mechanism, unaffected by the host environment. Here we studied the effects of host ecology on tolerance and resistance to infection by rearing monarch butterflies on 12 different species of milkweed food plants and infecting them with a naturally occurring protozoan parasite. Our results show that monarch butterflies experience different levels of tolerance to parasitism depending on the species of milkweed that they feed on, with some species providing over twofold greater tolerance than other milkweed species. Resistance was also affected by milkweed species, but there was no relationship between milkweed-conferred resistance and tolerance. Chemical analysis suggests that infected monarchs obtain highest fitness when reared on milkweeds with an intermediate concentration, diversity, and polarity of toxic secondary plant chemicals known as cardenolides. Our results demonstrate that environmental factors-such as interacting species in ecological food webs-are important drivers of disease tolerance. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  1. The genetic characteristics in cytology and plant physiology of two wheat (Triticum aestivum) near isogenic lines with different freezing tolerances.

    Science.gov (United States)

    Wang, Wenqiang; Hao, Qunqun; Wang, Wenlong; Li, Qinxue; Wang, Wei

    2017-11-01

    Freezing tolerance in taft plants relied more upon an ABA-independent- than an ABA-dependent antifreeze signaling pathway. Two wheat (Triticum aestivum) near isogenic lines (NIL) named tafs (freezing sensitivity) and taft (freezing tolerance) were isolated in the laboratory and their various cytological and physiological characteristics under freezing conditions were studied. Proplastid, cell membrane, and mitochondrial ultrastructure were less damaged by freezing treatment in taft than tafs plants. Chlorophyll, ATP, and thylakoid membrane protein contents were significantly higher, but malondialdehyde content was significantly lower in taft than tafs plants under freezing condition. Antioxidant capacity, as indicated by reactive oxygen species accumulation and antioxidant enzyme activity, and the relative gene expression were significantly greater in taft than tafs plants. Soluble sugars and abscisic acid (ABA) contents were significantly higher in taft plants than in tafs plants under both normal and freezing conditions. The upregulated expression levels of certain freezing tolerance-related genes were greater in taft than tafs plants under freezing treatment. The addition of sodium tungstate, an ABA synthesis inhibitor, led to only partial freezing tolerance inhibition in taft plants and the down-regulated expression of some ABA-dependent genes. Thus, both ABA-dependent and ABA-independent signaling pathways are involved in the freezing tolerance of taft plants. At the same time, freezing tolerance in taft plants relied more upon an ABA-independent- than an ABA-dependent antifreeze signaling pathway.

  2. Comparative study of SOS2 and a novel PMP3-1 gene expression in two sunflower (Helianthus annuus L.) lines differing in salt tolerance.

    Science.gov (United States)

    Saadia, Mubshara; Jamil, Amer; Ashraf, Muhammad; Akram, Nudrat Aisha

    2013-06-01

    Gene expression pattern of two important regulatory proteins, salt overly sensitive 2 (SOS2) and plasma membrane protein 3-1 (PMP3-1), involved in ion homeostasis, was analyzed in two salinity-contrasting sunflower (Helianthus annuus L.) lines, Hysun-38 (salt tolerant) and S-278 (moderately salt tolerant). The pattern was studied at selected time intervals (24 h) under 150 mM NaCl treatment. Using reverse transcription PCR, SOS2 gene fragment was obtained from young leaf and root tissues of opposing lines while that for PMP3-1 was obtained only from young root tissues. Both tolerant and moderately tolerant lines showed a gradual increase in SOS2 expression in sunflower root tissues. Leaf tissues showed the gradually increasing pattern of SOS2 expression in tolerant plants as compared to that for moderately tolerant ones that showed a relatively lower level of expression for this gene. We found the highest level of PMP 3-1 expression in the roots of tolerant sunflower line at 6 and 12 h postsalinity treatment. The moderately tolerant line showed higher expression of PMP3-1 at 12 and 24 h after salt treatment. Overall, the expression of genes for both the regulator proteins varied significantly in the two sunflower lines differing in salinity tolerance.

  3. Registration of an oilseed sunflower germplasm line HA-BSR1 highly tolerant to Sclerotinia basal stalk rot

    Science.gov (United States)

    Basal stalk rot (BSR) caused by Sclerotinia sclerotiorum (Lib.) de Bary is a devastating disease that causes a significant damage to worldwide sunflower (Helianthus annuus L.) production by reducing seed yield and quality. The objective of this research was to develop highly BSR tolerant sunflower g...

  4. Detecting differences in some elite wheat lines for salt tolerance through multi parameters evaluation i. morphological and yield parameters

    International Nuclear Information System (INIS)

    Akram, M.; Afzal, M.; Ashraf, M.

    2011-01-01

    Salt tolerance potential of a newly developed wheat genotype (N-9760: V3) was assessed by comparing it with a known salt tolerant line (N-1073:V2) and a commercial cultivar (Inqlab: V1) using various growth parameters measured at the vegetative and maturity stages, The objectives were to know qualitative and quantitative tolerance status and possible utilization of the new genotype as well as to examine as to whether the parameters used to assess the tolerance at vegetative and maturity stages are affected differentially by various salinity levels. The experiment was conducted in pots using four salinity levels (EC 1.5, 5, 10 and 15 dS m/sup -1/). Root and shoot length, root and shoot fresh and dry weight, number of leaves and leaf area were recorded at the vegetative stage, while plant height, number of tillers, spike length and grain yield plant/sup -1/ were recorded at the maturity stage. Fresh weight of shoots, fresh and dry weights of roots, plant height, number of productive tillers and grain yield were least affected in V3 while shoot length, shoot fresh weight, number of leaves, leaf area and spike length were least affected in V2 by EC 15 dS m/sup -1/. Both genotypes appeared tolerant but all the parameters studied at both stages were affected differentially by salinity levels and genotypes hence, testing of every new genotype appeared essential. (author)

  5. Simultaneous induction of jasmonic acid and disease-responsive genes signifies tolerance of American elm to Dutch elm disease

    Science.gov (United States)

    Sherif , S. M.; Shukla, M. R.; Murch, S. J.; Bernier, L.; Saxena, P. K.

    2016-01-01

    Dutch elm disease (DED), caused by three fungal species in the genus Ophiostoma, is the most devastating disease of both native European and North American elm trees. Although many tolerant cultivars have been identified and released, the tolerance mechanisms are not well understood and true resistance has not yet been achieved. Here we show that the expression of disease-responsive genes in reactions leading to tolerance or susceptibility is significantly differentiated within the first 144 hours post-inoculation (hpi). Analysis of the levels of endogenous plant defense molecules such as jasmonic acid (JA) and salicylic acid (SA) in tolerant and susceptible American elm saplings suggested SA and methyl-jasmonate as potential defense response elicitors, which was further confirmed by field observations. However, the tolerant phenotype can be best characterized by a concurrent induction of JA and disease-responsive genes at 96 hpi. Molecular investigations indicated that the expression of fungal genes (i.e. cerato ulmin) was also modulated by endogenous SA and JA and this response was unique among aggressive and non-aggressive fungal strains. The present study not only provides better understanding of tolerance mechanisms to DED, but also represents a first, verified template for examining simultaneous transcriptomic changes during American elm-fungus interactions. PMID:26902398

  6. The Line-drawing Problem in Disease Definition.

    Science.gov (United States)

    Rogers, Wendy A; Walker, Mary Jean

    2017-08-01

    Biological dysfunction is regarded, in many accounts, as necessary and perhaps sufficient for disease. But although disease is conceptualized as all-or-nothing, biological functions often differ by degree. A tension is created by attempting to use a continuous variable as the basis for a categorical definition, raising questions about how we are to pinpoint the boundary between health and disease. This is the line-drawing problem. In this paper, we show how the line-drawing problem arises within "dysfunction-requiring" accounts of disease, such as those of Christopher Boorse and Jerome Wakefield. We then provide several detailed examples to establish that biological dysfunction cannot provide a boundary. We examine potential ways of resolving the line-drawing problem, either by dropping one of the claims that generates it, or by appealing to additional criteria. We argue that two of these options are plausible, and that each of these can be applied with regard to different diseases. © The Author 2017. Published by Oxford University Press, on behalf of the Journal of Medicine and Philosophy Inc. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Cross tolerance of osmotically and ionically adapted cell lines of rice ...

    African Journals Online (AJOL)

    saad

    2012-01-10

    Jan 10, 2012 ... The phenomenon of cross tolerance in osmotically and ionically adapted rice .... the mean values of 5 replicates ± standard error. variance showed .... Education Commission of Pakistan and Pakistan Science. Foundation.

  8. Pathogenesis and Treatment of Sole Ulcers and White Line Disease.

    Science.gov (United States)

    Shearer, J K; van Amstel, Sarel R

    2017-07-01

    Sole ulcers and white line disease are 2 of the most common claw horn lesions in confined dairy cattle. Predisposing causes include unbalanced weight bearing, and metabolic, enzymatic, and hormonal changes. The white line serves as the junction between the sole and axial and abaxial wall. It is vulnerable to trauma and separation, permitting organic matter to become entrapped. Colonization contributes to retrograde movement of the infection to the solar and perioplic corium, where an abscess forms resulting in pain and lameness. Successful treatment requires an orthopedic foot block to the healthy claw and corrective trimming of the lesion. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Accuracy and simultaneous selection gains for N-stress tolerance and N-use efficiency in maize tropical lines

    Directory of Open Access Journals (Sweden)

    Leandro de Freitas Mendonça

    Full Text Available ABSTRACT Maize plants can be N-use efficient or N-stress tolerant. The first have high yields in favorable environments but is drastically affected under stress conditions; whereas the second show satisfactory yields in stressful environments but only moderate ones under optimal conditions. In this context, our aim was to assess the possibility of selecting tropical maize lines that are simultaneously N-stress tolerant and N-use efficient and check for differences between simultaneous selection statistical methods. Sixty-four tropical maize lines were evaluated for Nitrogen Agronomic Efficiency (NAE and Low Nitrogen Tolerance (LNTI response indices and two per se selection indices, Low Nitrogen Agronomic Efficiency (LNAE and Harmonic Mean of Relative Performance (HMRP. We performed eight selection scenarios: LNAE; HMRP; Additive index; Mulamba-Mock index; and Independent culling levels. The last three was predicted by REML/BLUP single-trait and multi-trait using genotypic values of NAE and LNTI. The REML/BLUP multi-trait analysis was superior to the single-trait analysis due to high unfavorable correlation between NAE and LNTI. However, the accuracy and genotypic determination coefficient of NAE and LNTI were too low. Thus, neither single- nor multi-trait analysis achieved a good result for simultaneous selection nor N-use efficiency nor N-stress tolerance. LNAE obtained satisfactorily accurate values and genotypic determination coefficient, but its performance in selection gain was worse than HMRP, particularly in terms of N-use efficiency. Therefore, because of the superior performance in accuracy, genotypic determination coefficient and selection, HMRP was considered the best simultaneous selection methodology of the scenarios tested for N-use efficiency and N-stress tolerance.

  10. QTL Mapping of Agronomic Waterlogging Tolerance Using Recombinant Inbred Lines Derived from Tropical Maize (Zea mays L) Germplasm

    Science.gov (United States)

    Zaidi, Pervez Haider; Rashid, Zerka; Vinayan, Madhumal Thayil; Almeida, Gustavo Dias; Phagna, Ramesh Kumar; Babu, Raman

    2015-01-01

    Waterlogging is an important abiotic stress constraint that causes significant yield losses in maize grown throughout south and south-east Asia due to erratic rainfall patterns. The most economic option to offset the damage caused by waterlogging is to genetically incorporate tolerance in cultivars that are grown widely in the target agro-ecologies. We assessed the genetic variation in a population of recombinant inbred lines (RILs) derived from crossing a waterlogging tolerant line (CAWL-46-3-1) to an elite but sensitive line (CML311-2-1-3) and observed significant range of variation for grain yield (GY) under waterlogging stress along with a number of other secondary traits such as brace roots (BR), chlorophyll content (SPAD), % stem and root lodging (S&RL) among the RILs. Significant positive correlation of GY with BR and SPAD and negative correlation with S&RL indicated the potential use of these secondary traits in selection indices under waterlogged conditions. RILs were genotyped with 331 polymorphic single nucleotide polymorphism (SNP) markers using KASP (Kompetitive Allele Specific PCR) Platform. QTL mapping revealed five QTL on chromosomes 1, 3, 5, 7 and 10, which together explained approximately 30% of phenotypic variance for GY based on evaluation of RIL families under waterlogged conditions, with effects ranging from 520 to 640 kg/ha for individual genomic regions. 13 QTL were identified for various secondary traits associated with waterlogging tolerance, each individually explaining from 3 to 14% of phenotypic variance. Of the 22 candidate genes with known functional domains identified within the physical intervals delimited by the flanking markers of the QTL influencing GY and other secondary traits, six have previously been demonstrated to be associated with anaerobic responses in either maize or other model species. A pair of flanking SNP markers has been identified for each of the QTL and high throughput marker assays were developed to facilitate

  11. Sow line differences in heat stress tolerance expressed in reproductive performance traits

    NARCIS (Netherlands)

    Bloemhof, S.; Waaij, van der E.H.; Merks, J.W.M.; Knol, E.F.

    2008-01-01

    The objectives of this study were 1) to investigate if there were differences in the relation between temperature and reproductive performance traits in 2 different sow lines, a Yorkshire line producing mainly in temperate climates and a Large White line producing mainly in warm climates, and 2) to

  12. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    Directory of Open Access Journals (Sweden)

    Luhua Zhang

    Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  13. YF22 Model With On-Board On-Line Learning Microprocessors-Based Neural Algorithms for Autopilot and Fault-Tolerant Flight Control Systems

    National Research Council Canada - National Science Library

    Napolitano, Marcello

    2002-01-01

    This project focused on investigating the potential of on-line learning 'hardware-based' neural approximators and controllers to provide fault tolerance capabilities following sensor and actuator failures...

  14. semi-dwarf tef lines for high seed yield and lodging tolerance

    African Journals Online (AJOL)

    ACSS

    Three genotypes, namely RIL- 91, RIL-244 and RIL-11, gave the highest seed yield, ranging between 4.4 to 4.7 t ha-1, compared to .... lodging tolerant tef varieties, adapting to the changing ..... moisture stress areas (Tsedey) was grouped.

  15. Chronic ethanol tolerance as a result of free-choice drinking in alcohol-preferring rats of the WHP line.

    Science.gov (United States)

    Dyr, Wanda; Taracha, Ewa

    2012-01-01

    The development of tolerance to alcohol with chronic consumption is an important criterion for an animal model of alcoholism and may be an important component of the genetic predisposition to alcoholism. The aim of this study was to determine whether the selectively bred Warsaw High Preferring (WHP) line of alcohol-preferring rats would develop behavioral and metabolic tolerance during the free-choice drinking of ethanol. Chronic tolerance to ethanol-induced sedation was tested. The loss of righting reflex (LRR) paradigm was used to record sleep duration in WHP rats. Ethanol (EtOH)-naive WHP rats received a single intraperitoneal (i.p.) injection of 5.0 g ethanol/kg body weight (b.w.), and sleep duration was measured. Subsequently, rats had access to a 10% ethanol solution under a free-choice condition with water and food for 12 weeks. After 12 weeks of the free-choice intake of ethanol, the rats received another single i.p. injection of 5.0 g ethanol/kg b.w., and sleep duration was reassessed. The blood alcohol content (BAC) for each rat was determined after an i.p. injection of 5 g/kg of ethanol in naive rats and again after chronic alcohol drinking at the time of recovery of the righting reflex (RR). The results showed that the mean ethanol intake was 9.14 g/kg/24 h, and both sleep duration and BAC were decreased after chronic ethanol intake. In conclusion, WHP rats exposed to alcohol by free-choice drinking across 12 weeks exhibited increased alcohol elimination rates. Studies have demonstrated that WHP rats after chronic free-choice drinking (12 weeks) of alcohol develop metabolic tolerance. Behavioral tolerance to ethanol was demonstrated by reduced sleep duration, but this decrease in sleep duration was not significant.

  16. Proteomics approach to identify unique xylem sap proteins in Pierce's disease-tolerant Vitis species.

    Science.gov (United States)

    Basha, Sheikh M; Mazhar, Hifza; Vasanthaiah, Hemanth K N

    2010-03-01

    Pierce's disease (PD) is a destructive bacterial disease of grapes caused by Xylella fastidiosa which is xylem-confined. The tolerance level to this disease varies among Vitis species. Our research was aimed at identifying unique xylem sap proteins present in PD-tolerant Vitis species. The results showed wide variation in the xylem sap protein composition, where a set of polypeptides with pI between 4.5 and 4.7 and M(r) of 31 kDa were present in abundant amount in muscadine (Vitis rotundifolia, PD-tolerant), in reduced levels in Florida hybrid bunch (Vitis spp., PD-tolerant) and absent in bunch grapes (Vitis vinifera, PD-susceptible). Liquid chromatography/mass spectrometry/mass spectrometry analysis of these proteins revealed their similarity to beta-1, 3-glucanase, peroxidase, and a subunit of oxygen-evolving enhancer protein 1, which are known to play role in defense and oxygen generation. In addition, the amount of free amino acids and soluble sugars was found to be significantly lower in xylem sap of muscadine genotypes compared to V. vinifera genotypes, indicating that the higher nutritional value of bunch grape sap may be more suitable for Xylella growth. These data suggest that the presence of these unique proteins in xylem sap is vital for PD tolerance in muscadine and Florida hybrid bunch grapes.

  17. Cuticular wax accumulation is associated with drought tolerance in wheat near-isogenic lines

    Directory of Open Access Journals (Sweden)

    Jianmin Song

    2016-11-01

    Full Text Available Previous studies have shown that wheat grain yield is seriously affected by drought stress, and leaf cuticular wax is reportedly associated with drought tolerance. However, most studies have focused on cuticular wax biosynthesis and model species. The effects of cuticular wax on wheat drought tolerance have rarely been studied. The aims of the current study were to study the effects of leaf cuticular wax on wheat grain yield under drought stress using the above-mentioned wheat NILs and to discuss the possible physiological mechanism of cuticular wax on high grain yield under drought stress. Compared to water-irrigated (WI conditions, the cuticular wax content (CWC in glaucous and non-glaucous NILs under drought-stress (DS conditions both increased; mean increase values were 151.1% and 114.4%, respectively, which was corroborated by scanning electronic microscopy images of large wax particles loaded on the surfaces of flag leaves. The average yield of glaucous NILs was higher than that of non-glaucous NILs under DS conditions in 2014 and 2015; mean values were 7368.37 kg·ha-1 and 7103.51 kg·ha-1. This suggested that glaucous NILs were more drought-tolerant than non-glaucous NILs (P = 0.05, which was supported by the findings of drought tolerance indices TOL and SSI in both years, the relatively high water potential and relative water content, and the low ELWL. Furthermore, the photosynthesis rate (Pn of glaucous and non-glaucous wheat NILs under DS conditions decreased by 7.5% and 9.8%, respectively; however, glaucous NILs still had higher mean values of Pn than those of non-glaucous NILs, which perhaps resulted in the higher yield of glaucous NILs. This could be explained by the fact that glaucous NILs had a smaller Fv/Fm reduction, a smaller PI reduction and a greater ABS/RC increase than non-glaucous NILs under DS conditions. This is the first report to show that wheat cuticular wax accumulation is associated with drought tolerance. Moreover

  18. Salt-induced root protein profile changes in seedlings of maize inbred lines with differing salt tolerances

    Directory of Open Access Journals (Sweden)

    Yujing Cheng

    2014-12-01

    Full Text Available Salt stress is one of the severest growth limited-factors to agriculture production. To gain in-depth knowledge of salt-stress response mechanisms, the proteomics analysis from two maize (Zea mays L. inbred lines was carried out using two-dimensional gel electrophoresis (2-DGE and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/TOF-MS. There were 57 salt-regulated proteins identified, 21 and 36 proteins were differentially regulated in inbred lines 'Nongda 1145' (salt-resistant and 'D340' (salt-sensitive, respectively. The identified proteins were distributed in 11 biological processes and seven molecular functions. Under salt stress, proteins related to antioxidation and lignin synthesis were increased in both inbred lines. The relative abundance of proteins involved in translation initiation, elongation, and protein proteolysis increased in 'Nongda 1145' and decreased in 'D340'. In addition, the abundance of proteins involved in carbohydrate metabolism, protein refolding, ATP synthase and transcription differed between the two inbred lines. Our results suggest that the enhanced ability of salt-tolerant inbred line 'Nongda 1145' to combat salt stress occurs via regulation of transcription factors promoting increased antioxidation and lignin biosynthesis, enhanced energy production, and acceleration of protein translation and protein proteolysis.

  19. The shutdown of celiac disease-related gliadin epitopes in bread wheat by RNAi provides flours with increased stability and better tolerance to over-mixing.

    Directory of Open Access Journals (Sweden)

    Javier Gil-Humanes

    Full Text Available Celiac disease is a food-sensitive enteropathy triggered by the ingestion of wheat gluten proteins and related proteins from barley, rye, and some varieties of oat. There are no interventional therapies and the only solution is a lifelong gluten-free diet. The down-regulation of gliadins by RNAi provides wheat lines with all the gliadin fractions strongly down-regulated (low-gliadin. The technological properties of doughs prepared from the low-gliadin lines indicated a general weakening effect, although some of the lines displayed similar properties to that of the wild-type lines. In contrast, the stability was increased significantly in some of the transgenic lines, indicating better tolerance to over-mixing. Results reported here are the first analyses of the mixing and bread-making quality of the wheat lines with all gliadin fractions strongly down-regulated. Flour from these lines may be an important breakthrough in the development of new products for the celiac community. These lines might be used directly or blended with other non-toxic cereals, as raw material for developing food products that can be safely tolerated by CD patients and others with gluten intolerance or gluten sensitivity, incrementing the range of available food products and enhancing their diet.

  20. The shutdown of celiac disease-related gliadin epitopes in bread wheat by RNAi provides flours with increased stability and better tolerance to over-mixing.

    Science.gov (United States)

    Gil-Humanes, Javier; Pistón, Fernando; Barro, Francisco; Rosell, Cristina M

    2014-01-01

    Celiac disease is a food-sensitive enteropathy triggered by the ingestion of wheat gluten proteins and related proteins from barley, rye, and some varieties of oat. There are no interventional therapies and the only solution is a lifelong gluten-free diet. The down-regulation of gliadins by RNAi provides wheat lines with all the gliadin fractions strongly down-regulated (low-gliadin). The technological properties of doughs prepared from the low-gliadin lines indicated a general weakening effect, although some of the lines displayed similar properties to that of the wild-type lines. In contrast, the stability was increased significantly in some of the transgenic lines, indicating better tolerance to over-mixing. Results reported here are the first analyses of the mixing and bread-making quality of the wheat lines with all gliadin fractions strongly down-regulated. Flour from these lines may be an important breakthrough in the development of new products for the celiac community. These lines might be used directly or blended with other non-toxic cereals, as raw material for developing food products that can be safely tolerated by CD patients and others with gluten intolerance or gluten sensitivity, incrementing the range of available food products and enhancing their diet.

  1. comparative study with commercial rootstocks to determine the tolerance to heavy metal (Pb in the drought and salt stress tolerant eggplant breeding lines

    Directory of Open Access Journals (Sweden)

    Mevlüde Nur TOPAL

    2017-06-01

    Full Text Available Negative effects of heavy metals on plants are peroxidation of lipids in cell membranes, production of free oxygen radicals, disorders in photosynthesis, damages in DNAs and as a result death of the cell. Plant development, productivity and quality of the fruits are decreased in the plants that are exposed to Pb stress which is one of the most toxic heavy metals. Usage of rootstocks which is mainly used against biotic stress conditions also seems to be defined as a solution to abiotic stress conditions such as heavy metal stresses. In eggplant production, wild species and hybrids are used as rootstocks against soil based pathogens and nematode. Reactions of improvement lines derived from local gene resources for rootstock improvement to heavy metal stress which is one of the abiotic stresses were determined. While determining the resistance against Pb stress, commercially used eggplant rootstocks are compared. In this study 4 eggplant cultivars (S. melongena: Burdur Bucak, Mardin Kızıltepe, Artvin Hopa and Kemer whose resistance potential against salt and drought stresses had been previously revealed and 6 rootstocks of wild eggplant species or hybrids (AGR-703, Doyran, Hawk, Hikyaku, Köksal-F1 and Vista-306 were tested against Pb stress. Eggplant seedlings were applied to 0, 150 and 300 ppm Pb solutions (Pb(NO32 during 4-5 true leaf stage. 20 days after the stress application wet and dry weight of green parts and roots, height of the body part and leaf areas were measured. Pb tolerance of Köksal F1 and AGR703 rootstocks were higher than other commercial rootstocks. Mardin Kızıltepe and Burdur Merkez genotypes which have high tolerances against abiotic stress gave lower values with respect to Artvin Hopa and Kemer which are sensitive genotypes and many other rootstocks while comparing the reduction ratios of stress signs such as shoot fresh weight and shoot length according to control under Pb stress.

  2. Exercise tolerance in mitral stenosis and chronic obstructive pulmonary disease

    International Nuclear Information System (INIS)

    Uenami, Atsushi; Mizuno, Toshikazu; Chiba, Hiroshi; Ohno, Masanori; Wakino, Kouichi; Sawada, Yoshihiro; Ohno, Joichi; Kume, Kiyoshi.

    1986-01-01

    Serial radionuclide ventriculography was performed using a newly developed ''real-time'' system, and left ventricular ejection fraction (LVEF), right ventricular ejection fraction (RVEF), stroke volume (SV), and cardiac output (CO) were measured during graded supine exercise in five patients with mitral stenosis (MS), in five patients with chronic obstructive pulmonary disease (COPD) and in five healthy subjects. Simultaneous pulmonary gas exchange analysis permitted determining the anaerobic threshold, which is the point during incremental exercise when lactate begins to accumulate in the blood. LVEF at the anaerobic threshold was not significantly changed in any patient groups and in healthy subjects, but RVEF at the anaerobic threshold was lower in COPD and MS patients as compared with healthy subjects. In MS, SV during exercise was reduced at the anaerobic threshold, but not in COPD or in healthy subjects. In conclusion, reduced working capacity is related to decreased RVEF in both COPD and MS, but the inhibited increase in CO during exercise is also important for the working capacity in MS. (author)

  3. IMMUNOPATHOLOGIC SYNDROMES: IMMUNE AUTOAGGRESSION DISEASES, PATHOLOGIC TOLERANCE, «TRANSPLANT AGAINST HOST» REACTIONS

    Directory of Open Access Journals (Sweden)

    P.F. Litvitsky

    2007-01-01

    Full Text Available This publication is the fourth and last in the series of the brief lectures devoted to the role of the system, exercising the immunobiological supervision over the individual and continuous antigenic contents of the body both in normal conditions and in the event of the pathology. It reviews the etiology, pathogenesis and main manifestations of the immune auto aggression diseases, pathologic tolerance and «transplant against host» reactions.Key words: immune auto aggression, idiotype, antigenic mimicry, tolerance, «transplant against host» reactions.

  4. Discrepancy between stimulus response and tolerance of pain in Alzheimer disease

    DEFF Research Database (Denmark)

    Jensen-Dahm, Christina; Werner, Mads U; Jensen, Troels Staehelin

    2015-01-01

    BACKGROUND: Affective-motivational and sensory-discriminative aspects of pain were investigated in patients with mild to moderate Alzheimer disease (AD) and healthy elderly controls using the cold pressor test tolerance and repetitive stimuli of warmth and heat stimuli, evaluating the stimulus....... The results further suggest that the attenuated cold pressor pain tolerance may relate to impairment of coping abilities. Paradoxically, we found an attenuated stimulus-response function, compared to controls, suggesting that AD dementia interferes with pain ratings over time, most likely due to memory...

  5. Progress in selection for sodium chloride, 2,4-D dichlorophenoxy acetic acid (2,4-D) and streptomycin tolerance in Citrus sinensis ovular callus lines

    International Nuclear Information System (INIS)

    Kochba, J.; Spiegel-Roy, P.

    1982-01-01

    Citrus sinensis (cultivar Shamouti) nucellar embryogenic callus lines with greatly increased tolerance to salinity (NaCl), 2,4-D and streptomycin were selected. Selected lines were found stable after removal of selection pressure. Gamma irradiation at 8-16 kR was also employed and found to speed up selections. Embryos from NaCl and 2,4-D tolerant lines also showed increased tolerance. Embryogenesis in selected lines, suppressed during selection procedures, was regained by growing cultures in the presence of galactose or lactose as the sole carbon source. A schedule was worked out furthering development of embryos into plantlets. Conditions for adventive shoot formation from embryonic shoot segments were established, thus allowing cloning of embryos. A procedure was worked out for suspension culture and agar plating of cell groups. (author)

  6. Efficacy and Tolerability of a Facial Serum for Fine Lines, Wrinkles, and Photodamaged Skin

    OpenAIRE

    Mccall-Perez, Fred; Stephens, Thomas J.; Herndon, James H.

    2011-01-01

    Background: Dermatology visits for the prevention and treatment of aging skin are rapidly increasing. The clinical sequelae including wrinkling, pigmentary changes, roughness, laxity, and telangiectasia can all result in the appearance of aging skin, impacting quality of life. A facial serum was developed with ingredients associated with an improvement in the appearance of fine lines and wrinkles and increase in stratum corneum barrier function. Patients were instructed to use a gentle wash b...

  7. What do we know about mechanisms for tolerating pathogens, and can tolerance be applied to managing tree diseases?

    Science.gov (United States)

    Bitty A. Roy

    2012-01-01

    The terms "resistance" and "tolerance" have been used by different scientists to refer to different things, and they have often been measured (and thus operationally defined) in ways that confuse the two concepts with each other. In keeping with the emerging consensus on resistance and tolerance, the following conceptual distinction is useful:...

  8. Semi-dwarf tef lines for high seed yield and lodging tolerance in ...

    African Journals Online (AJOL)

    The grain of tef is not only nutritious but also gluten-free, the cause for celiac disease, which affects humans world wide. The objective of this study was to evaluate the morpho-agronomic performance of newly developed semi-dwarf tef genotypes for grain yield and yield related agronomic traits under diverse environmental ...

  9. A novel match-line selective charging scheme for high-speed, low-power and noise-tolerant content-addressable memory

    KAUST Repository

    Hasan, Muhammad Mubashwar; Rashid, Abdul B M Harun Ur; Hussain, Muhammad Mustafa

    2010-01-01

    Content-addressable memory (CAM) is an essential component for high-speed lookup intensive applications. This paper presents a match-line selective charging technique to increase speed and reduce the energy per bit per search while increasing the noise-tolerance. Simulation in TSMC 0.18 μm technology with 64×72 Ternary CAM shows the match-line energy reduction of 45% compared to the conventional currentsaving scheme with the reduction of minimum cycle time by 68% and the improvement of noise-tolerance by 96%.

  10. A novel match-line selective charging scheme for high-speed, low-power and noise-tolerant content-addressable memory

    KAUST Repository

    Hasan, Muhammad Mubashwar

    2010-06-01

    Content-addressable memory (CAM) is an essential component for high-speed lookup intensive applications. This paper presents a match-line selective charging technique to increase speed and reduce the energy per bit per search while increasing the noise-tolerance. Simulation in TSMC 0.18 μm technology with 64×72 Ternary CAM shows the match-line energy reduction of 45% compared to the conventional currentsaving scheme with the reduction of minimum cycle time by 68% and the improvement of noise-tolerance by 96%.

  11. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.

    Science.gov (United States)

    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal

    2016-04-01

    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Efficacy, safety and tolerability of rasagiline as adjunctive therapy in elderly patients with Parkinson's disease.

    Science.gov (United States)

    Tolosa, E; Stern, M B

    2012-02-01

    Rasagiline, an MAO-B inhibitor, is indicated for the treatment of Parkinson's disease (PD). In this post hoc analysis, the efficacy, safety and tolerability of rasagiline as an adjunct to levodopa were compared with placebo in elderly (≥70 years) and younger (Rasagiline: Efficacy and Safety on the Treatment of 'OFF' and Lasting effect in Adjunct therapy with Rasagiline Given Once daily randomized, double-blind, placebo-controlled trials with the primary efficacy end-point being the reduction from baseline in daily OFF time. Secondary efficacy end-points included scores for Clinical Global Improvement (CGI)-Examiner during ON time, Unified Parkinson's Disease Rating Scale (UPDRS)-ADL during OFF time, UPDRS-Motor during ON time and total daily ON time with and without troublesome dyskinesia. Tolerability was evaluated from adverse events (AEs) in the two age groups. Rasagiline decreased daily OFF time versus placebo (Prasagiline but were not significant. Between-group comparisons (≥70 vs. efficacy was unaffected by age for all end-points (P>0.1), and rasagiline was well tolerated amongst both groups of patients with a comparable incidence of total and dopaminergic AEs (P>0.1). Adjunct rasagiline is efficacious and well tolerated in elderly non-demented patients (≥70 years) with moderate to advanced PD. Confirmation of the efficacy and safety of rasagiline in the elderly patient subgroup is especially relevant because of the increasing number of elderly patients with PD. © 2011 The Author(s). European Journal of Neurology © 2011 EFNS.

  13. Genetic dissection of Sharka disease tolerance in peach (P. persica L. Batsch).

    Science.gov (United States)

    Cirilli, Marco; Rossini, Laura; Geuna, Filippo; Palmisano, Francesco; Minafra, Angelantonio; Castrignanò, Tiziana; Gattolin, Stefano; Ciacciulli, Angelo; Babini, Anna Rosa; Liverani, Alessandro; Bassi, Daniele

    2017-11-03

    Plum pox virus (PPV), agent of Sharka disease, is the most important quarantine pathogen of peach (P. persica L. Batsch). Extensive evaluation of peach germplasm has highlighted the lack of resistant sources, while suggesting the presence of a quantitative disease resistance, expressed as reduction in the intensity of symptoms. Unravelling the genetic architecture of peach response to PPV infection is essential for pyramiding resistant genes and for developing more tolerant varieties. For this purpose, a genome-wide association (GWA) approach was applied in a panel of accessions phenotyped for virus susceptibility and genotyped with the IPSC peach 9 K SNP Array, and coupled with an high-coverage resequencing of the tolerant accession 'Kamarat'. Genome-wide association identified three highly significant associated loci on chromosome 2 and 3, accounting for most of the reduction in PPV-M susceptibility within the analysed peach population. The exploration of associated intervals through whole-genome comparison of the tolerant accession 'Kamarat' and other susceptible accessions, including the PPV-resistant wild-related species P. davidiana, allow the identification of allelic variants in promising candidate genes, including an RTM2-like gene already characterized in A. thaliana. The present study is the first effort to identify genetic factors involved in Sharka disease in peach germplasm through a GWA approach. We provide evidence of the presence of quantitative resistant loci in a collection of peach accessions, identifying major loci and highly informative SNPs that could be useful for marker assisted selection. These results could serve as reference bases for future research aimed at the comprehension of genetic mechanism regulating the complex peach-PPV interaction.

  14. Exercise tolerance in asymptomatic patients with moderate-severe valvular heart disease and preserved ejection fraction.

    Science.gov (United States)

    Olaf, Schulz; Debora, Brala; Ricarda, Bensch; Gunnar, Berghöfer; Jochen, Krämer; Schimke, Ingolf; Halle, Martin; Jaffe, Allan

    2012-12-20

    For asymptomatic patients with moderate-severe valvular heart disease, in whom symptoms may be obscured, objective exercise tolerance measures are warranted for decisions concerning physical activities and surgical treatment. We compared 61 patients (39 with aortic stenosis, 22 with aortic or mitral regurgitation) to 23 controls without valvular heart disease but with indications for stress testing. All participants underwent cardiopulmonary function testing and dobutamine stress echocardiography. Blood was drawn before as well as after bicycle stress to assess high-sensitivity cardiac troponin T (hscTnT). Patients who underwent surgery were re-evaluated 1.5 ±0.9 years after the operation. Conventional bicycle test following guideline criteria revealed a pathologic result in 26% of the patients, whereas spiroergometry showed an objectively reduced exercise tolerance in 59%, reaching a prognostically relevant feature in 39%. Stress echocardiography detected a reduced systolic reserve in 33% and elevated filling pressures in 62%. These abnormalities were significantly less present in the control group (4, 17, 9, 9, 4% respectively, p valvular heart disease beyond stress-test criteria recommended in recent guidelines. High-sensitivity cardiac troponin I may be of additional value. Results of these tests presage post-operative function.

  15. Improvement of pigeonpea for drought, disease and insect tolerance/resistance through induced mutations

    Energy Technology Data Exchange (ETDEWEB)

    Ngugi, E C.K.; Omanga, P A [National Dryland Farming Research Centre, Katumani, Machakos (Kenya)

    1997-12-01

    Pigeonpea (Cajanus cajan L. Millsp) is the second most important grain legume after cowpea (Vigna unguiculata L. Walp) in the semi-arid areas of Kenya. At the farm level, the grain yield of pigeonpea is lower than that of other grain legumes and cereals. The low grain yields are mainly attributed to the late-maturity of the local land-races which are prone to drought, insect attack and disease damage. Recently, a mutation breeding program was initiated to augment the conventional breeding approaches to alleviate some of these constraints. Three varieties, namely, Kat 60/8, Kat E31/4 and Kat 777, representing early, medium and late maturing groups were irradiated with three doses of gamma rays, namely 80-100 Gy, 110-125 Gy, and 140-150 Gy. Single plant progenies from the M{sub 2} and M{sub 3} generations of were screened and selected for tolerance to drought, tolerance/resistance to Fusarium wilt and insect tolerance in the field. Selections were advanced to M{sub 4} generation. In this paper, preliminary results of these studies reported. (author). 5 refs, 7 tabs.

  16. Improvement of pigeonpea for drought, disease and insect tolerance/resistance through induced mutations

    International Nuclear Information System (INIS)

    Ngugi, E.C.K.; Omanga, P.A.

    1997-01-01

    Pigeonpea (Cajanus cajan L. Millsp) is the second most important grain legume after cowpea (Vigna unguiculata L. Walp) in the semi-arid areas of Kenya. At the farm level, the grain yield of pigeonpea is lower than that of other grain legumes and cereals. The low grain yields are mainly attributed to the late-maturity of the local land-races which are prone to drought, insect attack and disease damage. Recently, a mutation breeding program was initiated to augment the conventional breeding approaches to alleviate some of these constraints. Three varieties, namely, Kat 60/8, Kat E31/4 and Kat 777, representing early, medium and late maturing groups were irradiated with three doses of gamma rays, namely 80-100 Gy, 110-125 Gy, and 140-150 Gy. Single plant progenies from the M 2 and M 3 generations of were screened and selected for tolerance to drought, tolerance/resistance to Fusarium wilt and insect tolerance in the field. Selections were advanced to M 4 generation. In this paper, preliminary results of these studies reported. (author). 5 refs, 7 tabs

  17. Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel disease (IBD)

    Science.gov (United States)

    Duchmann, R; Kaiser, I; Hermann, E; Mayet, W; Ewe, K; Meyer zum Büschenfelde, K H

    1995-12-01

    Hyporesponsiveness to a universe of bacterial and dietary antigens from the gut lumen is a hallmark of the intestinal immune system. Since hyperresponsiveness against these antigens might be associated with inflammation, we studied the immune response to the indigenous intestinal microflora in peripheral blood, inflamed and non-inflamed human intestine. Lamina propria monocuclear cells (LPMC) isolated from inflamed intestine but not peripheral blood mononuclear cells (PBMC) of IBD patients with active inflammatory disease strongly proliferated after co-culture with sonicates of bacteria from autologous intestine (BsA). Proliferation was inhibitable by anti-MHC class II MoAb, suggesting that it was driven by antigen. LPMC from adjacent non-inflamed intestinal areas of the same IBD patients and PBMC or LPMC isolated from non-inflamed intestine of controls and patients with IBD in remission, in contrast, did not proliferate. PBMC or LPMC which had been tolerant to bacteria from autologous intestine, however, strongly proliferated after co-culture with bacterial sonicates from heterologous intestine (BsH). This proliferation was associated with an expansion of CD8+ T cells, increased expression of activation markers on both CD4+ and CD8+ lymphocyte subsets, and production of IL-12, interferon-gamma (IFN-gamma), and IL-10 protein. These results show that tolerance selectively exists to intestinal flora from autologous but not heterologous intestine, and that tolerance is broken in intestinal inflammation. This may be an important mechanism for the perpetuation of chronic IBD.

  18. Induction of Oral Tolerance with Transgenic Plants Expressing Antigens for Prevention/Treatment of Autoimmune, Allergic and Inflammatory Diseases.

    Science.gov (United States)

    Ma, Shengwu; Liao, Yu-Cai; Jevnikar, Anthony M

    2015-01-01

    The prevalence and incidence of autoimmune and allergic diseases have increased dramatically over the last several decades, especially in the developed world. The treatment of autoimmune and allergic diseases is typically with the use of non-specific immunosuppressive agents that compromise the integrity of the host immune system and therefore, increase the risk of infections. Antigenspecific immunotherapy by reinstating immunological tolerance towards self antigens without compromising immune functions is a much desired goal for the treatment of autoimmune and allergic diseases. Mucosal administration of antigen is a long-recognized method of inducing antigen-specific immune tolerance known as oral tolerance, which is viewed as having promising potential in the treatment of autoimmune and allergic diseases. Plant-based expression and delivery of recombinant antigens provide a promising new platform to induce oral tolerance, having considerable advantages including reduced cost and increased safety. Indeed, in recent years the use of tolerogenic plants for oral tolerance induction has attracted increasing attention, and considerable progress has been made. This review summarizes recent advances in using plants to deliver tolerogens for induction of oral tolerance in the treatment of autoimmune, allergic and inflammatory diseases.

  19. Tolerância à toxicidade de alumínio de linhagens e híbridos de milho em solução nutritiva Aluminium toxicity tolerance of maize inbred lines and hybrids evaluated in nutrient solution

    Directory of Open Access Journals (Sweden)

    Maria Elisa Ayres Guidetti Zagatto Paterniani

    2002-04-01

    Full Text Available Avaliaram-se dez linhagens de milho do programa de melhoramento do Instituto Agronômico (IAC, em cruzamentos dialélicos e os 45 híbridos resultantes quanto à tolerância à toxicidade de alumínio em laboratório. Estimou-se a tolerância pelo comprimento líquido da radícula (CLR de plântulas em solução nutritiva contendo 4,5 mg.L-1 de alumínio, em ensaio sob delineamento experimental de blocos casualizados com quatro repetições, utilizando-se como padrões linhagens sensível e tolerante de IAC Taiúba. Apresentam-se, ainda, resultados da produtividade desses cruzamentos em ensaios de campo. Identificaram-se linhagens que constituem fontes de tolerância (L 06 e L 09 e híbridos tolerantes à toxicidade de alumínio com elevada produtividade em solos corrigidos. Na análise dialélica, o desdobramento dos efeitos de tratamentos, em capacidade geral (CGC e específica (CEC de combinação, indicou a predominância de efeitos aditivos na manifestação da tolerância ao alumínio tóxico. Obtiveram-se elevados valores de heterose, indicando a existência de interações não alélicas na manifestação do CLR. O híbrido HS 10X11 (denominado IAC 21 aliou alta produtividade e tolerância ao alumínio, apresentando a maior estimativa da CEC para CLR.Ten inbred lines and the resulting forty-five hybrids from the maize IAC breeding program were evaluated for Al tolerance by the nutrient solution technique. Net radicle lengths (CLR of plants grown with 4.5 mg.L-1 were used to estimate Al tolerance. The experimental design was randomized complete block with four replications, and it was used two divergent inbred lines IAC Taiuba as control for Al tolerance and sensitivity, respectively. In addition to these data, it is shown also the grain yield of the same materials from field plots. It was identified two inbred lines (L 06 and L 09 as Al tolerance sources and hybrids potentially adapted to acid soil conditions (tolerant to Al toxicity

  20. Therapeutic applications of nanomedicine in autoimmune diseases: from immunosuppression to tolerance induction.

    Science.gov (United States)

    Gharagozloo, Marjan; Majewski, Slawomir; Foldvari, Marianna

    2015-05-01

    Autoimmune diseases are chronic, destructive diseases that can cause functional disability and multiple organ failure. Despite significant advances in the range of therapeutic agents, especially biologicals, limitations of the routes of administration, requirement for frequent long-term dosing and inadequate targeting options often lead to suboptimal effects, systemic adverse reactions and patient non-compliance. Nanotechnology offers promising strategies to improve and optimize autoimmune disease treatment with the ability to overcome many of the limitations common to the current immunosuppressive and biological therapies. Here we focus on nanomedicine-based delivery strategies of biological immunomodulatory agents for the treatment of autoimmune disorders including psoriasis, rheumatoid arthritis, systemic lupus erythematous, scleroderma, multiple sclerosis and type 1 diabetes. This comprehensive review details the concepts and clinical potential of novel nanomedicine approaches for inducing immunosuppression and immunological tolerance in autoimmune diseases in order to modulate aberrant and pathologic immune responses. The treatment of autoimmune diseases remains a significant challenge. The authors here provided a comprehensive review, focusing on the current status and potential of nanomedicine-based delivery strategies of immunomodulatory agents for the treatment of autoimmune disorders including psoriasis, rheumatoid arthritis, systemic lupus erythematous, scleroderma, multiple sclerosis, and type 1 diabetes. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Morphological and functional responses of a metal-tolerant sunflower mutant line to a copper-contaminated soil series.

    Science.gov (United States)

    Kolbas, Aliaksandr; Kolbas, Natallia; Marchand, Lilian; Herzig, Rolf; Mench, Michel

    2018-04-02

    The potential use of a metal-tolerant sunflower mutant line for biomonitoring Cu phytoavailability, Cu-induced soil phytotoxicity, and Cu phytoextraction was assessed on a Cu-contaminated soil series (13-1020 mg Cu kg -1 ) obtained by fading a sandy topsoil from a wood preservation site with a similar uncontaminated soil. Morphological and functional plant responses as well as shoot, leaf, and root ionomes were measured after a 1-month pot experiment. Hypocotyl length, shoot and root dry weight (DW) yields, and leaf area gradually decreased as soil Cu exposure rose. Their dose-response curves (DRC) plotted against indicators of Cu exposure were generally well fitted by sigmoidal curves. The half-maximal effective concentration (EC 50 ) of morphological parameters ranged between 203 and 333 mg Cu kg -1 soil, corresponding to 290-430 μg Cu L -1 in the soil pore water, and 20 ± 5 mg Cu kg -1 DW in the shoots. The EC 10 for shoot Cu concentration (13-15 mg Cu kg -1 DW) coincided to 166 mg Cu kg -1 soil. Total chlorophyll content and total antioxidant capacity (TAC) were early biomarkers (EC 10 : 23 and 51 mg Cu kg -1 soil). Their DRC displayed a biphasic response. Photosynthetic pigment contents, e.g., carotenoids, correlated with TAC. Ionome was changed in Cu-stressed roots, shoots, and leaves. Shoot Cu removal peaked roughly at 280 μg Cu L -1 in the soil pore water.

  2. Selection of common bean inbred lines with tolerance to high moisture at harvest Seleção de linhagens de feijão com tolerância a alta umidade no momento da colheita

    Directory of Open Access Journals (Sweden)

    Lidiane Kely de Lima

    2013-04-01

    Full Text Available The occurrence of precipitation / rain in harvest bean causes damage to the product and reduces the yield. The main alternative to mitigate this problem is to obtain cultivars presenting low germination of beans in the pods under conditions of high moisture. The purpose of this study was to verify if there is genetic variability among the common bean inbred lines that are in the phase of recommendation for the South of Minas Gerais, Brazil in regard to tolerance to moisture after harvest, and identify traits that may be routinely used in selection of tolerant lines to these conditions. Ninety-five lines in the phase of recommendation by the Genetic Breeding Program from UFLA were used. After harvest, a sample of plants from each plot was removed for assessments of seed germination in the pods in a moist chamber and water absorption by pod and seed. Eight days after harvest, another sample was removed to assess seed appearance using a scoring scale. The data were submitted to analysis of variance and estimates of the Pearson phenotypic correlations were obtained among traits. Lines differ in relation to tolerance to moisture at the time of harvest, with those of higher tolerance having lighter colored seeds. The main difficulty in selection of common bean lines for tolerance to high moisture at harvest is the repeatability of the environmental conditions among crop seasons. The alternative is assessing the amount of water absorbed by pods.A ocorrência de precipitação / chuva na colheita do feijão comum provoca danos ao produto e reduz o rendimento. A principal alternativa para mitigar este problema é a obtenção de cultivares com baixa germinação de grãos nas vagens em condições de alta umidade. Neste trabalho, objetivou-se vrificar se há variabilidade genética entre as linhagens do feijoeiro que estão em fase de recomendação para o Sul de Minas Gerais quanto à tolerância à umidade após a colheita e identificar caracteres que

  3. Review of Mouse Models of Graves' Disease and Orbitopathy-Novel Treatment by Induction of Tolerance.

    Science.gov (United States)

    Ungerer, Martin; Faßbender, Julia; Li, Zhongmin; Münch, Götz; Holthoff, Hans-Peter

    2017-04-01

    Various approaches have been used to model human Graves' disease in mice, including transfected fibroblasts, and plasmid or adenoviral immunisations with the extracellular A subunit of the human thyrotropin receptor (TSHR). Some of these models were only observed for a short time period or were self-limiting. A long-term model for human Graves' disease was established in mice using continuing immunisations (4-weekly injections) with recombinant adenovirus expressing TSHR. Generation of TSHR binding cAMP-stimulatory antibodies, thyroid enlargement and alterations, elevated serum thyroxin levels, tachycardia and cardiac hypertrophy were maintained for at least 9 months in all Ad-TSHR-immunised mice. Here, we show that these mice suffer from orbitopathy, which was detected by serial orbital sectioning and histomorphometry. Attempts to treat established Graves' disease in preclinical mouse model studies have included small molecule allosteric antagonists and specific antagonist antibodies which were isolated from hypothyroid patients. In addition, novel peptides have been conceived which mimic the cylindrical loops of the TSHR leucine-rich repeat domain, in order to re-establish tolerance toward the antigen. Here, we show preliminary results that one set of these peptides improves or even cures all signs and symptoms of Graves' disease in mice after six consecutive monthly injections. First beneficial effects were observed 3-4 months after starting these therapies. In immunologically naïve mice, administration of the peptides did not induce any immune response.

  4. Evaluation of sugarcane introgression lines for resistance to brown rust disease caused by Puccinia melanocephala

    OpenAIRE

    Wang, Xiao-Yan; Wen-Feng, Li; Ying-Kun, Huang; Xin, Lu; Zhi-Ming, Luo; Jiong, Yin; Hong-Li, Shan; Rong-Yue, Zhang

    2013-01-01

    Sugarcane brown rust disease caused by Puccinia melanocephala is one of the important fungal diseases affecting sugarcane yield around the world. Cultivar resistance is the most appropriate control method for this disease. In this study, 62 introgression lines chosen from the crossing Saccharum officinarum L. cv. Ludashi x Erianthus rockii Yunnan 95-19 were evaluated for brown rust resistance using artificial inoculation. More than 30% of the introgression lines were identified as resistant. ...

  5. Proinflammatory and Prothrombotic State in Subjects with Different Glucose Tolerance Status before Cardiovascular Disease

    Directory of Open Access Journals (Sweden)

    Irma Isordia-Salas

    2014-01-01

    Full Text Available Background. Inflammation has been associated with insulin resistance, type 2 diabetes mellitus (T2DM, and atherothrombosis. Aim. To determine differences in levels of proinflammatory and prothrombotic markers such as high sensitivity C-reactive protein (hs-CRP and fibrinogen in subjects with normal glucose tolerance (NGT, prediabetes, and T2DM and to establish their relationship with other cardiovascular risk factors before clinical manifestations of cardiovascular disease. Methods. We conducted a nonrandomized, cross-sectional assay in a hospital at México City. The levels of hs-CRP and fibrinogen were measured and compared according to glucose tolerance status. Results. We enrolled 1047 individuals and they were distributed into NGT n=473, pre-DM n=250, and T2DM n=216. There was a statistical difference between NGT and T2DM groups for fibrinogen (P=0.01 and hs-CRP (P=0.05. Fibrinogen and hs-CRP showed a significant positive correlation coefficient (r=0.53, P<0.0001. In a multiple stepwise regression analysis, the variability in fibrinogen levels was explained by age, HbA1c, and hs-CRP (adjusted R2=0.31, P<0.0001, and for hs-CRP it was explained by BMI and fibrinogen (adjusted R2=0.33, P<0.0001. Conclusion. Inflammation and prothrombotic state are present in people with T2DM lacking cardiovascular disease. Fibrinogen and Hs-CRP are positively correlated. Fibrinogen and hs-CRP concentrations are predominantly determined by BMI rather than glucose levels.

  6. Comparative analysis of root transcriptome profiles of two pairs of drought-tolerant and susceptible rice near-isogenic lines under different drought stress

    Directory of Open Access Journals (Sweden)

    Moumeni Ali

    2011-12-01

    Full Text Available Abstract Background Plant roots are important organs to uptake soil water and nutrients, perceiving and transducing of soil water deficit signals to shoot. The current knowledge of drought stress transcriptomes in rice are mostly relying on comparative studies of diverse genetic background under drought. A more reliable approach is to use near-isogenic lines (NILs with a common genetic background but contrasting levels of resistance to drought stress under initial exposure to water deficit. Here, we examined two pairs of NILs in IR64 background with contrasting drought tolerance. We obtained gene expression profile in roots of rice NILs under different levels of drought stress help to identify genes and mechanisms involved in drought stress. Results Global gene expression analysis showed that about 55% of genes differentially expressed in roots of rice in response to drought stress treatments. The number of differentially expressed genes (DEGs increased in NILs as the level of water deficits, increased from mild to severe condition, suggesting that more genes were affected by increasing drought stress. Gene onthology (GO test and biological pathway analysis indicated that activated genes in the drought tolerant NILs IR77298-14-1-2-B-10 and IR77298-5-6-B-18 were mostly involved in secondary metabolism, amino acid metabolism, response to stimulus, defence response, transcription and signal transduction, and down-regulated genes were involved in photosynthesis and cell wall growth. We also observed gibberellic acid (GA and auxin crosstalk modulating lateral root formation in the tolerant NILs. Conclusions Transcriptome analysis on two pairs of NILs with a common genetic background (~97% showed distinctive differences in gene expression profiles and could be effective to unravel genes involved in drought tolerance. In comparison with the moderately tolerant NIL IR77298-5-6-B-18 and other susceptible NILs, the tolerant NIL IR77298-14-1-2-B-10 showed

  7. Residential Distance to High-voltage Power Lines and Risk of Neurodegenerative Diseases

    DEFF Research Database (Denmark)

    Frei, Patrizia; Poulsen, Aslak Harbo; Mezei, Gabor

    2013-01-01

    period 5-20 years before diagnosis were computed. The risks for developing dementia, Parkinson's disease, multiple sclerosis, and motor neuron disease were not increased in persons living within close vicinity of a power line. The risk of Alzheimer's disease was not increased for ever living within 50 m...... of a power line (hazard ratio = 1.04, 95% confidence interval: 0.69, 1.56). No dose-response according to number of years of living within 50 m of a power line was observed, but there were weak indications of an increased risk for persons diagnosed by the age of 75 years. Overall, there was little support...

  8. Effectiveness and tolerability of transdermal rivastigmine in the treatment of Alzheimer’s disease in daily practice

    Directory of Open Access Journals (Sweden)

    Seibert J

    2012-04-01

    Full Text Available Johannes Seibert1, Ferenc Tracik2,3, Konstantin Articus2, Stefan Spittler41Outpatient Clinic, Heidelberg, Germany; 2Novartis Pharma, Nürnberg, Germany; 3Department of Neurology, Heinrich-Heine University, Düsseldorf, Germany; 4Alexianer Krefeld, Maria Hilf Clinic, Krefeld, GermanyBackground: Oral cholinesterase inhibitors at doses efficacious for the treatment of Alzheimer’s disease (AD are often prematurely discontinued due to gastrointestinal side effects. In controlled clinical trials, transdermal rivastigmine demonstrated less such effects at similar efficacy. The current study aimed to verify the validity of this data in daily practice.Methods: This was a prospective, multicenter, observational study on transdermal rivastigmine in Germany. Eligible patients were those with AD who had not yet been treated with rivastigmine. Outcome measures were changes in clock-drawing test, Mini-Mental State Examination (MMSE, Caregiver Burden Scale, Clinical Global Impression (CGI, physicians’ assessments of tolerability, and the incidence of adverse events (AEs over 4 months of treatment.Results: In 257 centers 1113 patients were enrolled; 614 women and 499 men, mean age 76.5 years. In 58% of patients AD was treated for the first time and in 42% therapy was switched to transdermal rivastigmine, mostly due to lack of tolerability (13.6% or effectiveness (26.9%. After 4 months, 67.4% of patients were on the target dose of 9.5 mg/day and 21.8% were still on 4.6 mg/day. MMSE significantly improved in patients with and without pretreatment (ΔMMSE, 0.9 ± 3.4 and 0.8 ± 3.4, respectively, both P < 0.001; the CGI score improved in 60.9% and 61.3% of patients, respectively. Overall 11.7% of patients had AEs, mainly affecting the skin or the gastrointestinal tract; in 1.1% of cases AEs were serious; 14.7% of patients discontinued therapy, 6.0% due to AEs. With rivastigmine treatment the percentage of patients taking psychotropic comedication decreased

  9. Treating catfish diseases: walking the line between excess and moderation

    Science.gov (United States)

    Cost savings by using a cheaper disease treatment will increase profitability of any catfish farm. This invited producer presentation will discuss costs savings using copper sulfate in catfish production and a summation of our research, specifically in the hatchery. Copper sulfate is not approved ...

  10. Efficacy and tolerability of yoga breathing in patients with chronic obstructive pulmonary disease: a pilot study.

    Science.gov (United States)

    Pomidori, Luca; Campigotto, Federica; Amatya, Tara Man; Bernardi, Luciano; Cogo, Annalisa

    2009-01-01

    Yoga-derived breathing has been reported to improve gas exchange in patients with chronic heart failure and in participants exposed to high-altitude hypoxia. We investigated the tolerability and effect of yoga breathing on ventilatory pattern and oxygenation in patients with chronic obstructive pulmonary disease (COPD). Patients with COPD (N = 11, 3 women) without previous yoga practice and taking only short-acting beta2-adrenergic blocking drugs were enrolled. Ventilatory pattern and oxygen saturation were monitored by means of inductive plethysmography during 30-minute spontaneous breathing at rest (sb) and during a 30-minute yoga lesson (y). During the yoga lesson, the patients were requested to mobilize in sequence the diaphragm, lower chest, and upper chest adopting a slower and deeper breathing. We evaluated oxygen saturation (SaO2%), tidal volume (VT), minute ventilation (E), respiratory rate (i>f), inspiratory time, total breath time, fractional inspiratory time, an index of thoracoabdominal coordination, and an index of rapid shallow breathing. Changes in dyspnea during the yoga lesson were assessed with the Borg scale. During the yoga lesson, data showed the adoption of a deeper and slower breathing pattern (VTsb L 0.54[0.04], VTy L 0.74[0.08], P = .01; i>fsb 20.8[1.3], i>fy 13.8[0.2], P = .001) and a significant improvement in SaO2% with no change in E (SaO2%sb 91.5%[1.13], SaO2%y 93.5%[0.99], P = .02; Esb L/min 11.2[1.1], Ey L/min 10.2[0.9]). All the participants reported to be comfortable during the yoga lesson, with no increase in dyspnea index. We conclude that short-term training in yoga is well tolerated and induces favorable respiratory changes in patients with COPD.

  11. Association of promising germplasm exhibiting tolerance to psyllids, aphids, and zebra chip disease with foliar host chemistry

    Science.gov (United States)

    Long term, sustainable management of zebra chip disease of potato, caused by “Candidatus Liberibacter solanacearum” (Lso) and vectored by potato psyllids (Bactericera cockerelli Sulc), will require development of new cultivars resistant or tolerant to infection and/or capable of reducing spread. The...

  12. Tolerability of Aquaretic-Related Symptoms Following Tolvaptan for Autosomal Dominant Polycystic Kidney Disease: Results From TEMPO 3:4

    Directory of Open Access Journals (Sweden)

    Olivier Devuyst

    2017-11-01

    Discussion: In this study, AAEs were common but well tolerated in ADPKD patients on tolvaptan. ADPKD patients in earlier stages of disease progression may be more sensitive to aquaretic symptoms, which may help in guiding tolvaptan dosing and titration decisions in the future.

  13. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Science.gov (United States)

    Lawson, Bianca; Clulow, Simon; Mahony, Michael J; Clulow, John

    2013-01-01

    Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60%) over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+)-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research directions for

  14. Towards gene banking amphibian maternal germ lines: short-term incubation, cryoprotectant tolerance and cryopreservation of embryonic cells of the frog, Limnodynastes peronii.

    Directory of Open Access Journals (Sweden)

    Bianca Lawson

    Full Text Available Gene banking is arguably the best method available to prevent the loss of genetic diversity caused by declines in wild populations, when the causes of decline cannot be halted or reversed. For one of the most impacted vertebrate groups, the amphibians, gene banking technologies have advanced considerably, and gametes from the male line can be banked successfully for many species. However, cryopreserving the female germ line remains challenging, with attempts at cryopreserving oocytes unsuccessful due to their large size and yolk content. One possible solution is to target cryopreservation of early embryos that contain the maternal germ line, but consist of smaller cells. Here, we investigate the short term incubation, cryoprotectant tolerance, and cryopreservation of dissociated early embryonic cells from gastrulae and neurulae of the Striped Marsh Frog, Limnodynastes peronii. Embryos were dissociated and cells were incubated for up to 24 hours in various media. Viability of both gastrula and neurula cells remained high (means up to 40-60% over 24 hours of incubation in all media, although viability was maintained at a higher level in Ca(2+-free Simplified Amphibian Ringer; low speed centrifugation did not reduce cell viability. Tolerance of dissociated embryonic cells was tested for two cryoprotectants, glycerol and dimethyl sulphoxide; dissociated cells of both gastrulae and neurulae were highly tolerant to both-indeed, cell viability over 24 hours was higher in media containing low-to-medium concentrations than in equivalent cryoprotectant-free media. Viability over 24 hours was lower in concentrations of cryoprotectant higher than 10%. Live cells were recovered following cryopreservation of both gastrula and neurula cells, but only at low rates. Optimal cryodiluents were identified for gastrula and neurula cells. This is the first report of a slow cooling protocol for cryopreservation of amphibian embryonic cells, and sets future research

  15. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  16. ANTI-B-CELL THERAPY AT IMMUNE INFLAMMATORY RHEUMATIC DISEASES: EFFICACY AND TOLERABILITY IN 229 PATIENTS

    Directory of Open Access Journals (Sweden)

    L. P. Ananieva

    2014-01-01

    Full Text Available Objective: to assess the efficacy and tolerability of Rituximab treatment in patients with serious immune inflammatory rheumatic diseases (IRD like systemic lupus erythematosus (SLE, systemic sclerosis (SS, systemic vasculitis (SV, Sjogren syndrome (SjS, dermatomyositis/polymyositis (DM/PM.Subjects and methods. The clinical efficacy has been analyzed in 229 patients with IRD: SLE (n=97, SV (n=50, SS (n=40, SjS (n=23 and DM/PM (n=19. Rituximab treatment was accompanied by administration of glucocorticoids and/or immunosuppressive drugs. Most patients demonstrated resistance to or low tolerability of standard therapy. Efficacy of treatment was analyzed in each group with the criteria relevant for each disease. To compare clinical response to the treatment between the groups we used gradations accepted by international registries: complete (good response, partial response, no response. Average duration of monitoring comprised 72 (1–288 weeks after the first introduction of Rituximab. Average Rituximab dose administered to patients over the period of monitoring was low and varied from 1.6±0.84 in DM/PM to 3.1±1.75 in SV. About 80% of patients received one or two courses of Rituximab except for patients with SS (half of them received three and more courses.Results. «Complete response» was observed in 50.6%, «partial response» – in 35% of patients. Rituximab courses provided positive dynamics in clinical scores and allowed to reduce supportive dose of glucocorticoids and to lower the dose or withdraw of immune-stimulating drugs. Multiple Rituximab courses provided stable and longlasting effect. Recurrences were observed less frequently, whereas efficacy of the therapy increased during a year and longer. Occurrence of adverse events and mortality rate were comparable to data of other national Rituximab registries.Conclusion. The results of the study may prove administration of Rituximab in patients with resistance to standard

  17. Allopregnanolone preclinical acute pharmacokinetic and pharmacodynamic studies to predict tolerability and efficacy for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Ronald W Irwin

    Full Text Available To develop allopregnanolone as a therapeutic for Alzheimer's disease, we investigated multiple formulations and routes of administration in translationally relevant animal models of both sexes. Subcutaneous, topical (transdermal and intranasal, intramuscular, and intravenous allopregnanolone were bolus-administered. Pharmacokinetic analyses of intravenous allopregnanolone in rabbit and mouse indicated that peak plasma and brain levels (3-fold brain/plasma ratios at 5min were sufficient to activate neuroregenerative responses at sub-sedative doses. Slow-release subcutaneous suspension of allopregnanolone displayed 5-fold brain/plasma ratio at Cmax at 30min. At therapeutic doses by either subcutaneous or intravenous routes, allopregnanolone mouse plasma levels ranged between 34-51ng/ml by 30min, comparable to published endogenous human level in the third trimester of pregnancy. Exposure to subcutaneous, topical, intramuscular, and intravenous allopregnanolone, at safe and tolerable doses, increased hippocampal markers of neurogenesis including BrdU and PCNA in young 3xTgAD and aged wildtype mice. Intravenous allopregnanolone transiently and robustly phosphorylated CREB within 5min and increased levels of neuronal differentiation transcription factor NeuroD within 4h. Neurogenic efficacy was achieved with allopregnanolone brain exposure of 300-500hr*ng/g. Formulations were tested to determine the no observable adverse effect level (NOAEL and maximally tolerated doses (MTD in male and female rats by sedation behavior time course. Sex differences were apparent, males exhibited ≥40% more sedation time compared to females. Allopregnanolone formulated in sulfobutyl-ether-beta-cyclodextrin at optimized complexation ratio maximized allopregnanolone delivery and neurogenic efficacy. To establish the NOAEL and MTD for Allo-induced sedation using a once-per-week intravenous regenerative treatment regimen: In female rats the NOAEL was 0.5mg/kg and MTD 2mg

  18. Evaluation of drought stress tolerance in promising lines of chickpea (Cicer arietinum L. using drought resistance indices

    Directory of Open Access Journals (Sweden)

    Akbar Shabani

    2018-06-01

    Full Text Available Introduction Chickpea (Cicer arietinum L. is an annual grain legume or “pulse crop” that is 2th legume after soybean in the world and was cultivated in 60 country. Legume, spatially chickpea is the most important tolerant crop in arid and semi-arid country in western of Asia such as Iran. Chickpea can growth in poor soil and undesirable environment conditions. Drought is an important factors that influencing chickpea production and quality. As area of cultivation is in dryland conditions thus aim of researches is reach to tolerant genotypes. The objective of current study was to evaluate the genetic variation and drought resistance advanced genotypes in chickpea Materials and methods For investigation of genetic variation and drought resistance, 64 advanced genotypes were evaluated in a simple latis (LD with two replications under normal and drought stress conditions in deputy of Dryland Agricultural Research Institute of Kermanshah during 2013-2014 cropping season. Plant spacing was as plots with four rows in 4 m in length, 30 cm apart. The seed were sowed in row with 10 cm distance and the seeding rate was 33 seeds per m2 for all plots. At maturity stage after separation of border effects from each plot, grain yield was measured. Statistical analysis was performed using SAS, SPSS and STATISTICA packages. some drought resistance indices such as mean productivity (MP, geometric mean productivity (GMP, harmonic mean (HAM, stress tolerance index (STI, stress susceptibility index (SSI, yield index (YI, K1 and K2 were measured based on yield in both conditions. Also we used stress tolerance score (STS method for selection genotypes according to all indices. Results and discussion Study on correlation between Yp, Ys and drought resistance indices showed that Yp and Ys had positive and significant correlated with MP, GMP, STI, YI, HAM, K1 and K2 thus these indices were the most suitable drought tolerance criteria for screening of chickpea

  19. Biomarker Discovery In Chronic Obstructive Pulmonary Disease (COPD) Using Epithelial Lining Fluid : A Proteomic Approach

    NARCIS (Netherlands)

    Franciosi, L.; Govorukhina, N.; Fusetti, F.; Poolman, B.; Hacken, N. ten; Postma, D.; Bischoff, R.

    2011-01-01

    RATIONALE Chronic Obstructive Pulmonary Disease (COPD) is the third most frequent disease worldwide with increasing mortality. Cigarette smoking is the principle risk factor and 15-20% of smokers develop COPD. Epithelial Lining Fluid (ELF) covers the internal part of the airways and can be collected

  20. The Tolerability and Efficacy of Rapid Infliximab Infusions in Patients with Inflammatory Bowel Disease.

    Science.gov (United States)

    Qazi, Taha; Shah, Bhavesh; El-Dib, Mohammed; Farraye, Francis A

    2016-02-01

    Few studies have assessed the loss of efficacy or patient and caregiver satisfaction with rapid infliximab infusions. The aim of this study is to assess the tolerability, loss of efficacy and to describe the impact on resource utilization and patient satisfaction in rapid infliximab infusions. Subjects with inflammatory bowel disease receiving rapid infliximab infusions were included in the study. Subjects received maintenance infusions from June 2011 to June 2013. Incidence of adverse reactions and the total number of rapid infliximab infusions were recorded. Efficacy was compared to published studies evaluating the long-term efficacy of infliximab infusions. Patient satisfaction was addressed through a survey following the implementation of the rapid infusion protocol. Seventy-five subjects with IBD were included in the study. Five hundred and twenty-two rapid infliximab infusions were provided to patients. There were no acute or delayed infusion reactions. Ten subjects (13 %) required either a dose escalation or interval adjustment between infliximab infusions. A majority of patients reported increased satisfaction with 1-h infliximab infusions, and 97 % of surveyed patients opted to continue rapid infusions. The rapid infliximab infusion protocol increased infusion unit efficiency by increasing capacity by 15 %. Cost savings in the elimination of nursing time translated to approximately $108,150 savings at our institution. Rapid infliximab infusions do not appear to increase the risk of loss of response compared to historical studies of long-term infliximab efficiency. A rapid infliximab infusion protocol improved efficiency in our infusion unit and increased patient and nursing satisfaction.

  1. Data mining strategies to improve multiplex microbead immunoassay tolerance in a mouse model of infectious diseases.

    Directory of Open Access Journals (Sweden)

    Akshay Mani

    Full Text Available Multiplex methodologies, especially those with high-throughput capabilities generate large volumes of data. Accumulation of such data (e.g., genomics, proteomics, metabolomics etc. is fast becoming more common and thus requires the development and implementation of effective data mining strategies designed for biological and clinical applications. Multiplex microbead immunoassay (MMIA, on xMAP or MagPix platform (Luminex, which is amenable to automation, offers a major advantage over conventional methods such as Western blot or ELISA, for increasing the efficiencies in serodiagnosis of infectious diseases. MMIA allows detection of antibodies and/or antigens efficiently for a wide range of infectious agents simultaneously in host blood samples, in one reaction vessel. In the process, MMIA generates large volumes of data. In this report we demonstrate the application of data mining tools on how the inherent large volume data can improve the assay tolerance (measured in terms of sensitivity and specificity by analysis of experimental data accumulated over a span of two years. The combination of prior knowledge with machine learning tools provides an efficient approach to improve the diagnostic power of the assay in a continuous basis. Furthermore, this study provides an in-depth knowledge base to study pathological trends of infectious agents in mouse colonies on a multivariate scale. Data mining techniques using serodetection of infections in mice, developed in this study, can be used as a general model for more complex applications in epidemiology and clinical translational research.

  2. Tolerability and efficacy of benazepril in cats with chronic kidney disease.

    Science.gov (United States)

    King, Jonathan N; Gunn-Moore, Danielle A; Tasker, Séverine; Gleadhill, Allison; Strehlau, Günther

    2006-01-01

    The objective of the study was to test the effect of the angiotensin-converting enzyme inhibitor (ACEI) benazepril in cats with chronic kidney disease (CKD). A total of 192 cats with CKD with an initial plasma creatinine concentration > or = 2 mg/dL (> or = 177 micromol/L) and urine specific gravity benazepril x HCl at a dosage of 0.5-1.0 mg/kg (n = 96) for up to 1,119 days. Most cats were fed exclusively a diet containing low amounts of phosphate, protein, and sodium. Benazepril produced a significant reduction in proteinuria, assessed by the urine protein-to-creatinine ratio (UPC, P = .005). This effect of benazepril was present in all subgroups tested, including cats with UPC benazepril as compared with placebo during treatment in cats with initial UPC benazepril and 520 +/- 323 days with placebo (P = .47). Mean +/- SD renal survival times in the 13 cats with initial UPC > or = 1 were 402 +/- 202 days with benazepril and 149 +/- 90 days with placebo (P = .27). Cats with initial UPC > or = 1 treated with benazepril had better appetite (P = .017) as compared with those treated with placebo. Benazepril was well tolerated. In conclusion, benazepril decreased proteinuria in cats with CKD.

  3. Tolerability profile of thiopurines in inflammatory bowel disease: a prospective experience.

    Science.gov (United States)

    Macaluso, Fabio Salvatore; Renna, Sara; Maida, Marcello; Dimarco, Mariangela; Sapienza, Chiara; Affronti, Marco; Orlando, Emanuele; Rizzuto, Giulia; Orlando, Rosalba; Ventimiglia, Marco; Cottone, Mario; Orlando, Ambrogio

    2017-09-01

    The occurrence of thiopurine-related adverse events (AEs) may complicate the management of patients with inflammatory bowel disease (IBD). We aimed to evaluate the tolerability of thiopurines in a current IBD setting. All consecutive patients who started a treatment with azathioprine (AZA) from January 2010 to March 2016 were entered in a prospectively maintained database, and the AEs which led to the permanent discontinuation of the drug were reported. Two hundred and fifty three patients were included. Median total follow-up was 32 months (range: 0.2-75 months). At the end of the study, AZA was discontinued in 160 patients (63.2%). The main reason leading to drug withdrawal was the occurrence of AEs (109/160 patients [68.1%]; cumulative incidence among the entire cohort: 43.1%). Overall, the most frequent AEs leading to treatment withdrawal were nausea (31/253 patients, 12.3%) and subjective symptoms, i.e., poorly defined side effects such as fatigue, headache and muscle pain (20/253 patients, 7.9%). Among the 109 AZA-intolerant patients, a switch to 6-mercaptopurine (6-MP) was performed in 44 cases (40.4%). At the end of follow-up, 6-MP was discontinued in 35/44 patients (79.5%), mostly due to AEs (29/35 patients, 82.8%). Azathioprine-induced hepatic and pancreatic toxicity was associated with male gender (p = .01 and p = .03, respectively), and occurrence of nausea with Crohn's disease (p = .04). Our real-life prospective cohort showed the higher cumulative incidence of thiopurine withdrawal due to AEs reported to date. Switching from AZA to 6-MP was often ineffective.

  4. Defining Resistance and Tolerance to Cancer

    Directory of Open Access Journals (Sweden)

    Adler R. Dillman

    2015-11-01

    Full Text Available There are two ways to maintain fitness in the face of infection: resistance is a host’s ability to reduce microbe load and disease tolerance is the ability of the host to endure the negative health effects of infection. Resistance and disease tolerance should be applicable to any insult to the host and have been explored in depth with regards to infection but have not been examined in the context of cancer. Here, we establish a framework for measuring and separating resistance and disease tolerance to cancer in Drosophila melanogaster. We plot a disease tolerance curve to cancer in wild-type flies and then compare this to natural variants, identifying a line with reduced cancer resistance. Quantitation of these two traits opens an additional dimension for analysis of cancer biology.

  5. Melhoramento do trigo: XXX. Avaliação de linhagens com tolerância a toxicidade de alumínio, manganês e ferro em condições de campo Wheat breeding: XXX. Evaluation of inbred lines tolerant to aluminum, manganese and iron toxicities under field conditions

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    cultivars used as parents were evaluated in four trials carried out in acid soils, at Itararé (1990-92 and Capão Bonito (1992 Experimental Stations and in five trials carried out in limed soils, at Campinas (1990-92 Experimental Center and in a private farm located in Cruzália (1990-91. The following parameters were assessed: grain yield, agronomic characteristics and disease resistance. Twenty inbred lines and 'BH-1146' presented greater grain yield than 'Siete Cerros' in acid soils indicating that Al3+ toxicity was one of the main factors limiting yield. In limed soils, differences in yield were not observed, considering all studied genotypes, showing that no association between low yield and Al3+ tolerance was found in this condition. The line 21 was moderately resistant to powdery mildew. All studied genotypes presented susceptibility to the causal agents of leaf spots. 'Siete Cerros' and the lines 3 to 12 exhibited short stature associated with logding resistance; the lines 13, 14 and 23 showed long heads; the line 12, the highest number of spikelets and grains per spike; and the line 17, the heaviest grains. These genotypes represented, valuable genetic sources for these characteristics.

  6. Productivity of determinate growth tomato lines tolerant to heat under the organic system Produtividade de linhagens de tomate rasteiro tolerantes ao calor sob o sistema orgânico

    Directory of Open Access Journals (Sweden)

    Cândido A da Costa

    2011-12-01

    Full Text Available The objective of the present work was to evaluate the productive response of heat tolerant lines of determinate growth tomato under the organic production system. The experiment was carried out in the Instituto de Ciências Agrárias of UFMG, Montes Claros, Minas Gerais state, Brazil. The experimental design was of randomized complete blocks with eight treatments and four replications. The treatments consisted of eight heat tolerant processing type tomato lines obtained from the Asian Vegetable Research and Development Center (AVRDC, China: CLN1621L, CLN1621F, CLN1621E, CLN1466P, CLN2026E, CLN2026D, CLN2026C and CLN2001C. There was an inverse relationship between the average weight of the fruits and the number of fruits per plant. The highest average fruit weight of some lines was compensated by the lowest quantity of fruits, in such a way that there were no significant differences among the lines. Symptoms of nutritional deficiency and incidences of pests and diseases were not verified in any of the studied lines. All lines presented potential for genetic improvement research and cultivation using organic production systems under higher temperature conditions.O objetivo do presente trabalho foi avaliar o desempenho produtivo de linhagens de tomate rasteiro tolerantes ao calor sob o sistema orgânico de produção. O experimento foi realizado no Núcleo de Ciências Agrárias da UFMG, Montes Claros-MG. Foi utilizado o delineamento em blocos casualizados com oito tratamentos e quatro repetições. Os tratamentos consistiram de oito linhagens de tomate do tipo rasteiro tolerantes ao calor obtidos na Asian Vegetable Research and Development Center (AVRDC, China: CLN1621L, CLN1621F, CLN1621E, CLN1466P, CLN2026E, CLN2026D, CLN2026C e CLN2001C. Houve uma relação inversa entre o peso médio dos frutos e o número de frutos produzidos por planta. O maior peso médio de frutos de algumas linhagens foi compensado pelo menor número de frutos, de tal

  7. Derivation of Huntington Disease affected Genea046 human embryonic stem cell line

    Directory of Open Access Journals (Sweden)

    Biljana Dumevska

    2016-03-01

    Full Text Available The Genea046 human embryonic stem cell line was derived from a donated, fully commercially consented ART blastocyst, carrying HTT gene CAG expansion of 45 repeats, indicative of Huntington Disease. Following ICM outgrowth on inactivated human feeders, karyotype was confirmed as 46, XX by CGH and STR analysis demonstrated a female Allele pattern. The hESC line had pluripotent cell morphology, 85% of cells expressed Nanog, 92% Oct4, 75% Tra1–60 and 99% SSEA4 and demonstrated Alkaline Phosphatase activity. The cell line was negative for Mycoplasma and visible contamination.

  8. Dietary supplementation of yeast (Saccharomyces cerevisiae) improves growth, stress tolerance, and disease resistance in juvenile Nile tilapia (Oreochromis niloticus)

    DEFF Research Database (Denmark)

    Abass, David Attim; Obirikorang, Kwasi Adu; Campion, Benjamin Betey

    2018-01-01

    resistance in juvenile (body mass ~ 21 g) Nile tilapia (Oreochromis niloticus). Fish were randomly distributed in groups of 20 into 12 1-m³ hapas and fed isoenergetic (~ 17 kJ g⁻¹ gross energy) and isonitrogenous (~ 300 g kg⁻¹ crude protein) diets at 3% of their bulk weight daily. Specific growth rates were...... as an additive in Nile tilapia diets has beneficial impacts on growth, stress tolerance, and disease resistance...

  9. Physical self-concept and its link to cardiopulmonary exercise tolerance among adolescents with mild congenital heart disease.

    Science.gov (United States)

    Chen, Chi-Wen; Su, Wen-Jen; Wang, Jou-Kou; Yang, Hsiao-Ling; Chiang, Yueh-Tao; Moons, Philip

    2015-06-01

    Due to medical advances, most children with congenital heart disease (CHD) are expected to survive into adulthood. Establishing adequate physical self-concept and cardiopulmonary tolerance during the adolescent period can primarily enhance overall well-being. The purpose of this study was to undertake a gender-specific evaluation of the domain of physical self-concept among adolescents with mild CHD, and to examine the relationships between physical self-concept and cardiopulmonary exercise tolerance among adolescents with mild CHD. Four hundred and thirteen adolescents 12-20 years of age, whose cardiologists had not recommended any limitation of exercise, completed Physical Self-Description Questionnaires and three-minute step tests in two outpatient cardiology departments. The male participants had significantly greater scores in measures of overall physical self-concept, competence in sports, physical appearance, body fat, physical activity, endurance, and strength than did the female participants. More than 80% of the participants had at least an average cardiopulmonary exercise tolerance index. The perception of not being 'too fat' and being more physically active were significant correlates of better cardiopulmonary exercise tolerance for adolescents with mild CHD. The results provided evidence for gender-specific evaluation of domains of physical self-concept among adolescents with mild CHD. The three-minute step test to measure cardiopulmonary exercise tolerance in adolescents with mild CHD may be an appropriate objective measure for use in future research. Continued efforts are needed in early intervention to promote cardiopulmonary exercise tolerance. © The European Society of Cardiology 2014.

  10. Modulation of energy homeostasis in maize and Arabidopsis to develop lines tolerant to drought, genotoxic and oxidative stresses

    Directory of Open Access Journals (Sweden)

    Elizabeth Njuguna

    2018-02-01

    Full Text Available Abiotic stresses cause crop losses worldwide that reduce the average yield by more than 50%. Due to the high energy consumed to enhance the respiration rates, the excessive reactive oxygen species release provokes cell death and, ultimately, whole plant decay. A metabolic engineering approach in maize (Zea mays altered the expression of two poly(ADP-ribosylation metabolic pathway proteins, poly(ADP-ribose polymerase (PARP and ADP-ribose-specifIc Nudix hydrolase (NUDX genes that play a role in the maintenance of the energy homeostasis during stresses. By means of RNAi hairpin silencing and CRISPR/Cas9 gene editing strategies, the PARP expression in maize was downregulated or knocked down. The Arabidopsis NUDX7 gene and its two maize homologs, ZmNUDX2 and ZmNUDX8, were overexpressed in maize and Arabidopsis. Novel phenotypes were observed, such as significant tolerance to oxidative stress and improved yield in Arabidopsis and a trend of tolerance to mild drought stress in maize and in Arabidopsis. Key words: poly(ADP-ribose polymerase, Nudix hydrolase, CRISPR/Cas9, maize, oxidative stress, drought stress

  11. Verb Agreements during On-Line Sentence Processing in Alzheimer's Disease and Frontotemporal Dementia

    Science.gov (United States)

    Price, C.C.; Grossman, M.

    2005-01-01

    An on-line ''word detection'' paradigm was used to assess the comprehension of thematic and transitive verb agreements during sentence processing in individuals diagnosed with probable Alzheimer's Disease (AD, n=15) and Frontotemporal Dementia (FTD, n=14). AD, FTD, and control participants (n=17) were asked to listen for a word in a sentence.…

  12. Integrating Multiple On-line Knowledge Bases for Disease-Lab Test Relation Extraction.

    Science.gov (United States)

    Zhang, Yaoyun; Soysal, Ergin; Moon, Sungrim; Wang, Jingqi; Tao, Cui; Xu, Hua

    2015-01-01

    A computable knowledge base containing relations between diseases and lab tests would be a great resource for many biomedical informatics applications. This paper describes our initial step towards establishing a comprehensive knowledge base of disease and lab tests relations utilizing three public on-line resources. LabTestsOnline, MedlinePlus and Wikipedia are integrated to create a freely available, computable disease-lab test knowledgebase. Disease and lab test concepts are identified using MetaMap and relations between diseases and lab tests are determined based on source-specific rules. Experimental results demonstrate a high precision for relation extraction, with Wikipedia achieving the highest precision of 87%. Combining the three sources reached a recall of 51.40%, when compared with a subset of disease-lab test relations extracted from a reference book. Moreover, we found additional disease-lab test relations from on-line resources, indicating they are complementary to existing reference books for building a comprehensive disease and lab test relation knowledge base.

  13. Generation of a gene-corrected isogenic control cell line from an Alzheimer's disease patient iPSC line carrying a A79V mutation in PSEN1

    DEFF Research Database (Denmark)

    Pires, Carlota; Schmid, Benjamin; Petræus, Carina

    2016-01-01

    mutation in PSEN1 as an in vitro disease model. Here we generated a gene-corrected version from this hiPSC line by substituting the point mutation with the wild-type sequence. The reported A79V-GC-iPSCs line is a very useful resource in combination with the A79V-iPSC line in order to study pathological...

  14. Permissive tolerance of the patent ductus arteriosus may increase the risk of Chronic Lung Disease

    Directory of Open Access Journals (Sweden)

    Kaempf JW

    2013-03-01

    Full Text Available Joseph W Kaempf,1 Robert Huston,2 YingXing Wu,1 Andrew J Kaempf,1 Lian Wang,1 Gary Grunkemeier,1 Rebecca Mischel,2 Howard Cohen,3 Bret Freitag41Providence St Vincent Medical Center, Portland, OR, 2Randall Children’s Hospital at Legacy Emanuel, Portland, OR, 3Salem Hospital, Salem, OR, 4Legacy Salmon Creek Hospital, Vancouver, WA, USAPurpose: Because early closure therapies of the patent ductus arteriosus (PDA have not been shown to confer benefit to premature infants, the authors’ four neonatal intensive care units adopted a less aggressive PDA management protocol.Study design: A before–after investigation in infants with PDAs born 501–1500 g. Era 1 (January 2005 to December 2007 featured traditional management with indomethacin and/or surgical ligation used early to close PDAs; Era 2 (January 2008 to June 2009 featured fluid restriction and watchful waiting for PDA closure, limiting indomethacin or surgical ligation to only those infants with large PDAs needing significant respiratory support.Results: Era 2 infants (n = 129, mean ± standard deviation 27 ± 2 weeks received less and later indomethacin and less Day 1–28 total fluids as compared to Era 1 infants (n = 240, mean ± standard deviation 27 ± 2 weeks. The Chronic Lung Disease (CLD rate was higher in Era 2 (48% versus 34%, P < 0.01 as was the combined outcome of Death after Day 7 or CLD (57% versus 42%, P < 0.01. Multiple regression analysis showed Era 2 birth was a predictor of CLD. However, Poisson regression analysis determined the predictors of all seven major Vermont Oxford Network morbidities were earlier gestational age, lower birth weight, and male gender, not the era of birth. Significantly more infants were discharged home with PDAs in Era 2.Conclusion: Permissive tolerance of PDAs may increase the risk of CLD and Death after Day 7 or CLD but is not associated with significant changes in other Vermont Oxford Network morbidities.Keywords: premature infant

  15. A controlled clinical trial investigating the effects of cycle ergometry training on exercise tolerance, balance and quality of life in patients with Parkinson's disease.

    LENUS (Irish Health Repository)

    Lauhoff, Paula

    2013-03-01

    To establish the effect of a 6-week programme of cycle ergometry training on exercise tolerance, balance, activities of daily living (ADL) and quality of life in individuals with Parkinson\\'s disease (PD).

  16. A Study on the Glucose and Immunoreactive Insulin Response during Oral Glucose Tolerance Test in Patients with Chronic Liver Diseases

    International Nuclear Information System (INIS)

    Choe, Kang Won; Lee, Hong Kyu; Koh, Chang Soon; Lee, Mu Ho

    1973-01-01

    The blood glucose and plasma immunoreactive insulin (IRI) levels were measured during aral glucose tolerance test in 7 healthy subjects and 6 patients with chronic liver diseases. The glucose tolerance was impaired in 5 of the 6 patients and normal in I. Plasma IRI responses were markedly increased and delayed in all patients, suggesting endogenous insulin resistance. Patients with more glucose intolerance showed less increase in plasma IRI than the group with less intolerance. lt is suggested that some insulin antagonists may decrease the peripheral insulin sensitivity and stimulate compensatory hyperactivity of pancreatic islets. If the compensatory hyperactivity is inadequate due to gemetic predisposition to diabetes mellitus or exhaustion of β-cells of pancreatic islets, the glucose intolerance and overt diabetes mellitus may ensue.

  17. A Study on the Glucose and Immunoreactive Insulin Response during Oral Glucose Tolerance Test in Patients with Chronic Liver Diseases

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Kang Won; Lee, Hong Kyu; Koh, Chang Soon; Lee, Mu Ho [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1973-03-15

    The blood glucose and plasma immunoreactive insulin (IRI) levels were measured during aral glucose tolerance test in 7 healthy subjects and 6 patients with chronic liver diseases. The glucose tolerance was impaired in 5 of the 6 patients and normal in I. Plasma IRI responses were markedly increased and delayed in all patients, suggesting endogenous insulin resistance. Patients with more glucose intolerance showed less increase in plasma IRI than the group with less intolerance. lt is suggested that some insulin antagonists may decrease the peripheral insulin sensitivity and stimulate compensatory hyperactivity of pancreatic islets. If the compensatory hyperactivity is inadequate due to gemetic predisposition to diabetes mellitus or exhaustion of beta-cells of pancreatic islets, the glucose intolerance and overt diabetes mellitus may ensue.

  18. Expression of lycopene biosynthesis genes fused in line with Shine-Dalgarno sequences improves the stress-tolerance of Lactococcus lactis.

    Science.gov (United States)

    Dong, Xiangrong; Wang, Yanping; Yang, Fengyuan; Zhao, Shanshan; Tian, Bing; Li, Tao

    2017-01-01

    Lycopene biosynthetic genes from Deinococcus radiodurans were co-expressed in Lactococcus lactis to produce lycopene and improve its tolerance to stress. Lycopene-related genes from D. radiodurans, DR1395 (crtE), DR0862 (crtB), and DR0861 (crtI), were fused in line with S hine-Dalgarno (SD) sequences and co-expressed in L. lactis. The recombinant strain produced 0.36 mg lycopene g -1  dry cell wt after 48 h fermentation. The survival rate to UV irradiation of the recombinant strain was higher than that of the non-transformed strain. The L. lactis with co-expressed genes responsible for lycopene biosynthesis from D. radiodurans produced lycopene and exhibited increased resistance to UV stress, suggesting that the recombinant strain has important application potential in food industry.

  19. Goblet Cells Contribute to Ocular Surface Immune Tolerance-Implications for Dry Eye Disease

    NARCIS (Netherlands)

    Barbosa, Flavia L; Xiao, Yangyan; Bian, Fang; Coursey, Terry G; Ko, Byung Yi; Clevers, Hans; de Paiva, Cintia S; Pflugfelder, Stephen C

    2017-01-01

    Conjunctival goblet cell (GC) loss in dry eye is associated with ocular surface inflammation. This study investigated if conjunctival GCs contribute to ocular surface immune tolerance. Antigens applied to the ocular surface, imaged by confocal microscopy, passed into the conjunctival stroma through

  20. Molecular breeding for developing drought tolerant and disease resistant maize in sub Saharan Africa

    Science.gov (United States)

    The International Maize and Wheat Improvement Center (CIMMYT), in collaboration with public and private partners, is working on developing and disseminating drought tolerant maize for sub Saharan Africa (SSA) using pedigree selection and molecular breeding. In this paper, we provide an overview of ...

  1. An audit of the insulin-tolerance test in 255 patients with pituitary disease

    DEFF Research Database (Denmark)

    Lange, Martin; Svendsen, Ole L; Skakkebaek, Niels E

    2002-01-01

    The insulin-tolerance test (ITT) is currently considered to be the gold standard for evaluating adults suspected of GH deficiency (GHD). The aim of this study was to determine factors that may influence nadir blood glucose (BG) when using a mean insulin dose of 0.1 IU/kg body weight. Furthermore...

  2. PhenoLines: Phenotype Comparison Visualizations for Disease Subtyping via Topic Models.

    Science.gov (United States)

    Glueck, Michael; Naeini, Mahdi Pakdaman; Doshi-Velez, Finale; Chevalier, Fanny; Khan, Azam; Wigdor, Daniel; Brudno, Michael

    2018-01-01

    PhenoLines is a visual analysis tool for the interpretation of disease subtypes, derived from the application of topic models to clinical data. Topic models enable one to mine cross-sectional patient comorbidity data (e.g., electronic health records) and construct disease subtypes-each with its own temporally evolving prevalence and co-occurrence of phenotypes-without requiring aligned longitudinal phenotype data for all patients. However, the dimensionality of topic models makes interpretation challenging, and de facto analyses provide little intuition regarding phenotype relevance or phenotype interrelationships. PhenoLines enables one to compare phenotype prevalence within and across disease subtype topics, thus supporting subtype characterization, a task that involves identifying a proposed subtype's dominant phenotypes, ages of effect, and clinical validity. We contribute a data transformation workflow that employs the Human Phenotype Ontology to hierarchically organize phenotypes and aggregate the evolving probabilities produced by topic models. We introduce a novel measure of phenotype relevance that can be used to simplify the resulting topology. The design of PhenoLines was motivated by formative interviews with machine learning and clinical experts. We describe the collaborative design process, distill high-level tasks, and report on initial evaluations with machine learning experts and a medical domain expert. These results suggest that PhenoLines demonstrates promising approaches to support the characterization and optimization of topic models.

  3. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  4. Prevention of Lysosomal Storage Diseases and Derivation of Mutant Stem Cell Lines by Preimplantation Genetic Diagnosis

    Science.gov (United States)

    Altarescu, Gheona; Beeri, Rachel; Eiges, Rachel; Epsztejn-Litman, Silvina; Eldar-Geva, Talia; Elstein, Deborah; Zimran, Ari; Margalioth, Ehud J.; Levy-Lahad, Ephrat; Renbaum, Paul

    2012-01-01

    Preimplantation genetic diagnosis (PGD) allows birth of unaffected children for couples at risk for a genetic disorder. We present the strategy and outcome of PGD for four lysosomal storage disorders (LSD): Tay-Sachs disease (TSD), Gaucher disease (GD), Fabry disease (FD), and Hunter syndrome (HS), and subsequent development of stem cell lines. For each disease, we developed a family-specific fluorescent multiplex single-cell PCR protocol that included the familial mutation and informative markers surrounding the mutation. Embryo biopsy and PGD analysis were performed on either oocytes (polar bodies one and two) or on single blastomeres from a six-cell embryo. We treated twenty families carrying mutations in these lysosomal storage disorders, including 3 couples requiring simultaneous analysis for two disorders (TSD/GD, TSD/balanced Robertsonian translocation 45XYder(21;14), and HS/oculocutaneus albinism). These analyses led to an overall pregnancy rate/embryo transfer of 38% and the birth of 20 unaffected children from 17 families. We have found that PGD for lysosomal disorders is a safe and effective method to prevent birth of affected children. In addition, by using mutant embryos for the derivation of stem cell lines, we have successfully established GD and HS hESC lines for use as valuable models in LSD research. PMID:23320174

  5. Neuromuscular electrical stimulation improves exercise tolerance in chronic obstructive pulmonary disease patients with better preserved fat-free mass

    Directory of Open Access Journals (Sweden)

    Lara Maris Nápolis

    2011-01-01

    Full Text Available BACKGROUND: High-frequency neuromuscular electrical stimulation increases exercise tolerance in patients with advanced chronic obstructive pulmonary disease (COPD patients. However, it is conceivable that its benefits are more prominent in patients with better-preserved peripheral muscle function and structure. OBJECTIVE: To investigate the effects of high-frequency neuromuscular electrical stimulation in COPD patients with better-preserved peripheral muscle function. Design: Prospective and cross-over study. METHODS: Thirty COPD patients were randomly assigned to either home-based, high-frequency neuromuscular electrical stimulation or sham stimulation for six weeks. The training intensity was adjusted according to each subject's tolerance. Fat-free mass, isometric strength, six-minute walking distance and time to exercise intolerance (Tlim were assessed. RESULTS: Thirteen (46.4% patients responded to high-frequency neuromuscular electrical stimulation; that is, they had a post/pre Δ Tlim >10% after stimulation (unimproved after sham stimulation. Responders had a higher baseline fat-free mass and six-minute walking distance than their seventeen (53.6% non-responding counterparts. Responders trained at higher stimulation intensities; their mean amplitude of stimulation during training was significantly related to their fat-free mass (r = 0.65; p<0.01. Logistic regression revealed that fat-free mass was the single independent predictor of Tlim improvement (odds ratio [95% CI] = 1.15 [1.04-1.26]; p<0.05. CONCLUSIONS: We conclude that high-frequency neuromuscular electrical stimulation improved the exercise capacity of COPD patients with better-preserved fat-free mass because they tolerated higher training stimulus levels. These data suggest that early training with high-frequency neuromuscular electrical stimulation before tissue wasting begins might enhance exercise tolerance in patients with less advanced COPD.

  6. The genetic variance of resistance in M3 lines of rice against leaf blight disease

    International Nuclear Information System (INIS)

    Mugiono

    1979-01-01

    Seeds of Pelita I/1 rice variety were irradiated with 20, 30, 40 and 50 krad of gamma rays from a 60 Co source. Plants of M 3 lines were inoculated with bacterial leaf blight, Xanthomonas oryzae (Uzeda and Ishiyama) Downson, using clipping method. The coefficient of genetic variability of resistance against leaf blight disease increased with increasing dose. Highly significant difference in the genetic variance of resistance were found between the treated samples and the control. Dose of 20 krad gave good probability for selection of plants resistant against leaf blight disease. (author)

  7. Endogenous pyrogen production by Hodgkin's disease and human histiocytic lymphoma cell lines in vitro.

    OpenAIRE

    Bodel, P; Ralph, P; Wenc, K; Long, J C

    1980-01-01

    Fever not explained by infection may occur in patients with malignant lymphoma presumably caused by a release of endogenous pyrogen. Although pyrogen has been found in some tumors with a mixed cell population, production of endogenous pyrogen by the neoplastic cells has not been demonstrated. This report documents the apparently spontaneous synthesis and release of such pyrogen by two human tumor cell lines derived from patients with Hodgkin's disease and histiocytic lymphoma. The endogenous ...

  8. Mucosal tolerance disruption favors disease progression in an extraorbital lacrimal gland excision model of murine dry eye.

    Science.gov (United States)

    Guzmán, Mauricio; Keitelman, Irene; Sabbione, Florencia; Trevani, Analía S; Giordano, Mirta N; Galletti, Jeremías G

    2016-10-01

    Dry eye is a highly prevalent immune disorder characterized by a dysfunctional tear film and a Th1/Th17 T cell response at the ocular surface. The specificity of these pathogenic effector T cells remains to be determined, but auto-reactivity is considered likely. However, we have previously shown that ocular mucosal tolerance to an exogenous antigen is disrupted in a scopolamine-induced murine dry eye model and that it is actually responsible for disease progression. Here we report comparable findings in an entirely different murine model of dry eye that involves resection of the extraorbital lacrimal glands but no systemic muscarinic receptor blockade. Upon ocular instillation of ovalbumin, a delayed breakdown in mucosal tolerance to this antigen was observed in excised but not in sham-operated mice, which was mediated by interferon γ- and interleukin 17-producing antigen-specific T cells. Consistently, antigen-specific regulatory T cells were detectable in sham-operated but not in excised mice. As for other models of ocular surface disorders, epithelial activation of the NF-κB pathway by desiccating stress was determinant in the mucosal immune outcome. Underscoring the role of mucosal tolerance disruption in dry eye pathogenesis, its prevention by a topical NF-κB inhibitor led to reduced corneal damage in excised mice. Altogether these results show that surgically originated desiccating stress also initiates an abnormal Th1/Th17 T cell response to harmless exogenous antigens that reach the ocular surface. This event might actually contribute to corneal damage and challenges the conception of dry eye as a strictly autoimmune disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Effectiveness and tolerability of second-line therapy with vildagliptin vs. other oral agents in type 2 diabetes: A real-life worldwide observational study (EDGE)

    Science.gov (United States)

    Mathieu, C; Barnett, A H; Brath, H; Conget, I; de Castro, J J; Göke, R; Márquez Rodriguez, E; Nilsson, P M; Pagkalos, E; Penfornis, A; Schaper, NC; Wangnoo, S K; Kothny, W; Bader, G

    2013-01-01

    Aim Real-life studies are needed to confirm the clinical relevance of findings from randomised controlled trials (RCTs). This study aimed to assess the effectiveness and tolerability of vildagliptin add-on vs. other oral antihyperglycaemic drugs (OADs) added to OAD monotherapy in a real-life setting, and to explore the advantages and limitations of large-scale ‘pragmatic’ trials. Methods EDGE was a prospective, 1-year, worldwide, real-life observational study in which 2957 physicians reported on the effects of second-line OADs in 45,868 patients with T2DM not reaching glycaemic targets with monotherapy. Physicians could add any OAD, and patients entered either vildagliptin or (pooled) comparator cohort. The primary effectiveness and tolerability end-point (PEP) evaluated proportions of patients decreasing HbA1c > 0.3%, without hypoglycaemia, weight gain, peripheral oedema or gastrointestinal side effects. The most clinically relevant secondary end-point (SEP 3) was attainment of end-point HbA1c vildagliptin-based regimen. The adjusted odds ratio was 1.49 (95% CI: 1.42, 1.55; p vildagliptin-based combination and by 23% of those receiving comparator combinations. The adjusted odds ratio was 1.96 (95% CI: 1.85, 2.07; p vildagliptin and other OADs were consistent with previous data. Conclusion EDGE demonstrates that in a ‘real-life’ setting, vildagliptin as second OAD can lower HbA1c to target without well-recognised OAD side effects, more frequently than comparator OADs. In addition, EDGE illustrates that conducting large-scale, prospective, real-life studies poses challenges but yields valuable clinical information complementary to RCTs. PMID:23961850

  10. The SH-SY5Y cell line in Parkinson's disease research: a systematic review.

    Science.gov (United States)

    Xicoy, Helena; Wieringa, Bé; Martens, Gerard J M

    2017-01-24

    Parkinson's disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, are difficult to obtain and maintain as primary cells, current PD research is mostly performed with permanently established neuronal cell models, in particular the neuroblastoma SH-SY5Y lineage. This cell line is frequently chosen because of its human origin, catecholaminergic (though not strictly dopaminergic) neuronal properties, and ease of maintenance. However, there is no consensus on many fundamental aspects that are associated with its use, such as the effects of culture media composition and of variations in differentiation protocols. Here we present the outcome of a systematic review of scientific articles that have used SH-SY5Y cells to explore PD. We describe the cell source, culture conditions, differentiation protocols, methods/approaches used to mimic PD and the preclinical validation of the SH-SY5Y findings by employing alternative cellular and animal models. Thus, this overview may help to standardize the use of the SH-SY5Y cell line in PD research and serve as a future user's guide.

  11. Selection of Common Bean Lines, Recombinant Inbred Lines and Commercial Genotypes Tolerant to Low Phosphorus Availability in an Acrisol Soil on the Basis of Root Traits and Grain Yield

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, A.; Gomez, L. A.; Morales, A. [Instituto de Suelos, MINAG (Cuba); others, and

    2013-11-15

    Common bean (Phaseolus vulgaris L.) is the most important food legume for human consumption worldwide and especially in Latin America and Africa, but low soil phosphorus (P) availability limits grain production in these areas. For these reason eighty five recombinant inbred lines (RILs) of BAT 477 x DOR 364 and twenty commercial bean genotypes were sown in plots in an Acrisol soil with low P availability to evaluate nine root traits and grain yield. The study was carried out in Pinar del Rio province in Cuba between November 2006 and February 2009. The plots received basal fertilization (N and K) and P fertilization between 15 and 90 kg P{sub 2}O{sub 5} ha{sup -1}. Ten plants were sampled from each plot at R{sub 6} pod fill to evaluate root traits and shoot biomass, and at R{sub 9} physiological maturity to estimate grain yield. The 85 RILs showed great variability for root traits, grain yield and P stress tolerance calculated as relative grain yield. The commercial bean lines also showed large diversity in yield parameters. Principal Component Analysis showed that there were high and significant correlations between root traits (basal root number, primary root depth, adventitious root length and adventitious root number) and grain yield parameters (grain yield at 15 P level and relative grain yields). Adventitious root traits showed the greatest correlation with yield under low P. Promising RILs included 75.1.1, 60.1.1, 38.1.1, 14.1.1 and 38.1.1 and promising commercial bean lines included ICA Pijao, BAT 482, ICA 23, BAT 24 and BAT 832. (author)

  12. Enhanced disease resistance and drought tolerance in transgenic rice plants overexpressing protein elicitors from Magnaporthe oryzae.

    Science.gov (United States)

    Wang, Zhenzhen; Han, Qiang; Zi, Qian; Lv, Shun; Qiu, Dewen; Zeng, Hongmei

    2017-01-01

    Exogenous application of the protein elicitors MoHrip1 and MoHrip2, which were isolated from the pathogenic fungus Magnaporthe oryzae (M. oryzae), was previously shown to induce a hypersensitive response in tobacco and to enhance resistance to rice blast. In this work, we successfully transformed rice with the mohrip1 and mohrip2 genes separately. The MoHrip1 and MoHrip2 transgenic rice plants displayed higher resistance to rice blast and stronger tolerance to drought stress than wild-type (WT) rice and the vector-control pCXUN rice. The expression of salicylic acid (SA)- and abscisic acid (ABA)-related genes was also increased, suggesting that these two elicitors may trigger SA signaling to protect the rice from damage during pathogen infection and regulate the ABA content to increase drought tolerance in transgenic rice. Trypan blue staining indicated that expressing MoHrip1 and MoHrip2 in rice plants inhibited hyphal growth of the rice blast fungus. Relative water content (RWC), water usage efficiency (WUE) and water loss rate (WLR) were measured to confirm the high capacity for water retention in transgenic rice. The MoHrip1 and MoHrip2 transgenic rice also exhibited enhanced agronomic traits such as increased plant height and tiller number.

  13. LINE-1 Hypomethylation is Associated with the Risk of Coronary Heart Disease in Chinese Population

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Li [Department of Cardiology, The Fourth Affiliated Hospital of Harbin Medical University, Harbin (China); Liu, Shuchuan [Department of Hematology, The First Affiliated Hospital of Harbin Medical University, Harbin (China); Su, Zhendong; Cheng, Rongchao; Bai, Xiuping; Li, Xueqi, E-mail: xueqi-li@163.com [Department of Cardiology, The Fourth Affiliated Hospital of Harbin Medical University, Harbin (China)

    2014-05-15

    Global methylation level in blood leukocyte DNA has been associated with the risk of coronary heart disease (CHD), with inconsistent results in various populations. Similar data are lacking in Chinese population where different genetic, lifestyle and environmental factors may affect DNA methylation and its risk relationship with CHD. To examine whether global methylation is associated with the risk of CHD in Chinese population. A total of 334 cases with CHD and 788 healthy controls were included. Global methylation in blood leukocyte DNA was estimated by analyzing LINE-1 repeats using bisulfite pyrosequencing. In an initial analysis restricted to control subjects, LINE-1 level reduced significantly with aging, elevated total cholesterol, and diagnosis of diabetes. In the case-control analysis, reduced LINE-1 methylation was associated with increased risk of CHD; analysis by quartile revealed odds ratios (95%CI) of 0.9 (0.6-1.4), 1.9 (1.3-2.9) and 2.3 (1.6-3.5) for the third, second and first (lowest) quartile (P{sub trend} < 0.001), respectively, compared to the fourth (highest) quartile. Lower (LINE-1 methylation was associated with a 2.2-fold (95%CI = 1.7-3.0) increased risk of CHD. The lower LINE-1-related CHD risk estimates tended to be stronger among subjects with the highest tertile of homocysteine (P{sub interaction} = 0.042) and those with diagnosis of hypertension (P{sub interaction} = 0.012). LINE-1 hypomethylation is associated with the risk of CHD in Chinese population. Potential CHD risk factors such as older age, elevated total cholesterol, and diagnosis of diabetes may have impact on global DNA methylation, whereby exerting their effect on CHD risk.

  14. LINE-1 Hypomethylation is Associated with the Risk of Coronary Heart Disease in Chinese Population

    International Nuclear Information System (INIS)

    Wei, Li; Liu, Shuchuan; Su, Zhendong; Cheng, Rongchao; Bai, Xiuping; Li, Xueqi

    2014-01-01

    Global methylation level in blood leukocyte DNA has been associated with the risk of coronary heart disease (CHD), with inconsistent results in various populations. Similar data are lacking in Chinese population where different genetic, lifestyle and environmental factors may affect DNA methylation and its risk relationship with CHD. To examine whether global methylation is associated with the risk of CHD in Chinese population. A total of 334 cases with CHD and 788 healthy controls were included. Global methylation in blood leukocyte DNA was estimated by analyzing LINE-1 repeats using bisulfite pyrosequencing. In an initial analysis restricted to control subjects, LINE-1 level reduced significantly with aging, elevated total cholesterol, and diagnosis of diabetes. In the case-control analysis, reduced LINE-1 methylation was associated with increased risk of CHD; analysis by quartile revealed odds ratios (95%CI) of 0.9 (0.6-1.4), 1.9 (1.3-2.9) and 2.3 (1.6-3.5) for the third, second and first (lowest) quartile (P trend < 0.001), respectively, compared to the fourth (highest) quartile. Lower (LINE-1 methylation was associated with a 2.2-fold (95%CI = 1.7-3.0) increased risk of CHD. The lower LINE-1-related CHD risk estimates tended to be stronger among subjects with the highest tertile of homocysteine (P interaction = 0.042) and those with diagnosis of hypertension (P interaction = 0.012). LINE-1 hypomethylation is associated with the risk of CHD in Chinese population. Potential CHD risk factors such as older age, elevated total cholesterol, and diagnosis of diabetes may have impact on global DNA methylation, whereby exerting their effect on CHD risk

  15. Mutant lines of currant tomato, valuable germplasm with multiple disease resistance

    International Nuclear Information System (INIS)

    Govorova, G.F.; Khrustaleva, V.V.; Shcherbakov, V.K.

    1987-01-01

    Studies were carried out for two years on eight mutant lines of currant tomato at the Krymsk Experimental Breeding Station of the N.I. Vavilov All-Union Scientific Research Institute of Plant-Growing (VIR). The station is situated in an area of commercial field tomato growing (Krasnodar region). The mutant lines of currant tomato (VIR specimen No. k-4053) were obtained through chronic gamma-irradiation. A disease resistance evaluation of the mutants was carried out for Verticillium wilt (Verticillium albo-atrum Rein. and Berth.), for black bacterial spotting (Xanthomonas vesicatoria Dows.), for tobacco mosaic virus Nicotiana 1 Smith), for streak virus (Nicotiana 1), for the combination TMV with X and Y potato viruses, for cucumber virus (Cucumis 1), and also for top rot. Fifty plants of each mutant line were evaluated and checks were made three times in each season. A comparison of the currant tomato mutants with the standard tomato varieties demonstrates the better resistance shown by the mutant germplasm to the main pathogens. The degree to which some currant tomato mutants were affected by Verticillium was lower than that of the most VerticiIlium-resistant samples of tomato evaluated between 1975 and 1981. The mutants of currant tomato should therefore be of interest as germplasm in breeding tomatoes for improved multiple disease resistance

  16. Endogenous pyrogen production by Hodgkin's disease and human histiocytic lymphoma cell lines in vitro.

    Science.gov (United States)

    Bodel, P; Ralph, P; Wenc, K; Long, J C

    1980-02-01

    Fever not explained by infection may occur in patients with malignant lymphoma presumably caused by a release of endogenous pyrogen. Although pyrogen has been found in some tumors with a mixed cell population, production of endogenous pyrogen by the neoplastic cells has not been demonstrated. This report documents the apparently spontaneous synthesis and release of such pyrogen by two human tumor cell lines derived from patients with Hodgkin's disease and histiocytic lymphoma. The endogenous pyrogen from the two cell lines was similar and closely resembled that produced by normal human monocytes in antigenic properties as well as heat and pronase sensitivity. The Hodgkin's disease and histiocytic lymphoma cell lines do not require specific stimulation for the production of endogenous pyrogen suggesting that the mechanism of pyrogen release by neoplastic macrophage-related cells differs from that of normal phagocytic cells. The tumor-associated fever in some patients with malignant lymphoma may be caused by a release of endogenous pyrogen by proliferating neoplastic cells.

  17. Assessment of Tolerability and Safety of Monocomponent Complementary Food Products in the Diet of Infants With Risk for Allergic Diseases

    Directory of Open Access Journals (Sweden)

    L. S. Namazova-Baranova

    2016-01-01

    Full Text Available Background: Children with burdened allergological history and/or having preliminary allergy manifestations need the effective prevention of allergy from the first months of life.Objective: Our aim was to assess the tolerability, safety, and efficacy of monocomponent complementary food products in the diet of infants with high risk for allergic diseases.Methods: Tolerability, safety, and efficacy of monocomponent complementary food products (vegetable puree, fruit juices, and after 6 months — meat sauce were studied in a singlecentre, prospective, comparative study. The symptoms of indigestion, skin allergy symptoms were registered, the results of coprological research and immunogenicity of complementary food products were assessed.Results: The study included 200 children in the age from 5 months from the risk group of allergy developing. Children were divided into 4 groups of 50 people. It was found that complementary food products were well tolerated and assimilated by children, did not cause skin and gastrointestinal allergic reactions in healthy children with risk of allergy developing. Food antigens of complementary food components (pumpkin, rabbit meat, turkey meat, apples, pears, plums were characterized by low immunogenicity: the level of specific IgE to the specified products did not change in blood serum and remained at a low level at the beginning and at the end of the study (ranging from 0.01 to 0.03 kE/l.Conclusion: Studied complementary food products (vegetable-, fruit- and meat-based can be used in the diet of children with high risk for allergy.

  18. Are gastroenterologists less tolerant of treatment risks than patients? Benefit-risk preferences in Crohn's disease management.

    Science.gov (United States)

    Johnson, F Reed; Hauber, Brett; Özdemir, Semra; Siegel, Corey A; Hass, Steven; Sands, Bruce E

    2010-10-01

    treatment risk that exactly offsets the hypothetical increase in treatment benefit), was calculated using preference weights (parameter marginal log odds ratios) that were estimated with conjoint analysis (random parameters logit models). Gastroenterologists' and patients' mean MARs for 3 SAE risks were calculated for 6 improvements in Crohn's disease symptoms, and gastroenterologists' preference weights for each of the 3 patient profiles were compared. Gastroenterologists' MARs for a hypothetical middle-aged patient were then compared with predicted MARs derived using data from the patient study for male patients aged 40 to 50 years with 1 surgery. After exclusion of nonrespondents (n = 4,021 of 4,422 gastroenterologists; n = 681 of 1,285 patients) and nonevaluable respondents (n = 86 gastroenterologists; n = 24 patients), 315 gastroenterologists and 580 patients were included in the final analytic samples. There were no statistically significant differences in gastroenterologists' preference weights for the middle-aged versus young patient profiles. However, preference weights indicated that gastroenterologists are more concerned about 5% side-effect risks for the older patient profile than for the middle-aged patient profile. For symptomatic improvements from severe symptoms to remission, gastroenterologists' highest MARs were for lymphoma: 6.21%, 8.99%, and 25.00% for the young, middle-aged, and older patient types, respectively. In analyses of improvements from severe to moderate symptoms and from moderate symptoms to remission for hypothetical middle-aged patients, gastroenterologists' 10-year risk tolerance ranged between 1.96% lymphoma risk in return for an improvement from moderate symptoms to remission and 4.93% lymphoma risk for an improvement from severe to moderate symptoms; patients' 10-year risk tolerance for middle-aged patients ranged between 1.52% PML risk in return for an improvement from severe to moderate symptoms and 5.86% infection risk for an

  19. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  20. Antioxidant enzymatic activities and gene expression associated with heat tolerance in the stems and roots of two cucurbit species ("Cucurbita maxima" and "Cucurbita moschata") and their interspecific inbred line "Maxchata".

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-12-10

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant "C. moschata", thermolabile "C. maxima" and moderately heat-tolerant interspecific inbred line "Maxchata" genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. "C. moschata" exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2(-)) and malondialdehyde (MDA) contents in the roots compared to stems, followed by "Maxchata". The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among "C. maxima" and "Maxchata", most of these genes were highly induced under heat stress in "Maxchata", which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  1. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata”) and Their Interspecific Inbred Line “Maxchata”

    Science.gov (United States)

    Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2013-01-01

    The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2−) and malondialdehyde (MDA) contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration. PMID:24336062

  2. Antioxidant Enzymatic Activities and Gene Expression Associated with Heat Tolerance in the Stems and Roots of Two Cucurbit Species (“Cucurbita maxima” and “Cucurbita moschata” and Their Interspecific Inbred Line “Maxchata”

    Directory of Open Access Journals (Sweden)

    Neelam Ara

    2013-12-01

    Full Text Available The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C and severe (42 °C heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2, superoxide (O2− and malondialdehyde (MDA contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD, ascorbate peroxidase (APX, catalase (CAT and peroxidase (POD were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.

  3. Molecular markers for tolerance of European ash (Fraxinus excelsior) to dieback disease identified using Associative Transcriptomics

    DEFF Research Database (Denmark)

    Harper, Andrea L.; McKinney, Lea Vig; Nielsen, Lene Rostgaard

    2016-01-01

    panel scored for disease symptoms and identified markers strongly associated with canopy damage in infected trees. Using these markers we predicted phenotypes in a test panel of unrelated trees, successfully identifying individuals with a low level of susceptibility to the disease. Co......Tree disease epidemics are a global problem, impacting food security, biodiversity and national economies. The potential for conservation and breeding in trees is hampered by complex genomes and long lifecycles, with most species lacking genomic resources. The European Ash tree Fraxinus excelsior...

  4. Long-term efficacy and tolerability of azilsartan medoxomil/chlorthalidone vs olmesartan medoxomil/hydrochlorothiazide in chronic kidney disease.

    Science.gov (United States)

    Bakris, George L; Zhao, Lin; Kupfer, Stuart; Juhasz, Attila; Hisada, Michie; Lloyd, Eric; Oparil, Suzanne

    2018-04-01

    An open-label, long-term study evaluated safety and tolerability of azilsartan medoxomil/chlorthalidone (AZL-M/CLD) vs olmesartan/hydrochlorothiazide (OLM/HCTZ) in hypertensive participants with stage 3 chronic kidney disease. Initial therapy was AZL-M/CLD 20/12.5 mg (n = 77) or OLM/HCTZ 20/12.5 mg (n = 76), but could be up-titrated (AZL-M/CLD to 40/25 mg; OLM/HCTZ to 40/25 mg [US] or 20/25 mg [Europe]) with other agents added during weeks 4-52. Primary endpoint was proportion of participants with ≥ 1 adverse event (AE) through week 52. Baseline demographics were similar. AEs did not differ between groups (88.3%, AZL-M/CLD vs 76.3%, OLM/HCTZ; P = .058). AZL-M/CLD showed greater systolic BP reductions after initial dosing (P = .037) but not during long-term follow-up (P = .588). A greater proportion of participants up-titrated to the highest dose with OLM/HCTZ (48.7%) vs AZL-M/CLD (29.9%) (P = .021) and were taking additional antihypertensive medications (26.3% vs 16.9%). Both AZL-M/CLD and OLM/HCTZ showed similar efficacy and tolerability. ©2018 Wiley Periodicals, Inc.

  5. Fingerprinting and genetic purity assessment of F1 barley hybrids and their salt-tolerant parental lines using nSSR molecular markers.

    Science.gov (United States)

    Ben Romdhane, Mériam; Riahi, Leila; Jardak, Rahma; Ghorbel, Abdelwahed; Zoghlami, Nejia

    2018-01-01

    Hybridity and the genuineness of hybrids are prominent characteristics for quality control of seeds and thereby for varietal improvement. In the current study, the cross between two local barley genotypes (Ardhaoui: female; Testour: male) previously identified as susceptible/tolerant to salt stress in Tunisia was achieved. The hybrid genetic purity of the generated F 1 putative hybrids and the fingerprinting of the parents along with their offspring were assessed using a set of 17 nuclear SSR markers. Among the analyzed loci, 11 nSSR were shown polymorphic among the parents and their offspring. Based on the applied 11 polymorphic SSR loci, a total of 28 alleles were detected with an average of 2.54 alleles per locus. The locus HVM33 presented the highest number of alleles. The highest polymorphism information content value was detected for the locus HVM33 (0.6713) whereas the lowest PIC value (0.368) was revealed by the loci BMAC0156 , EBMAC0970 and BMAG0013 with a mean value of 0.4619. The probabilities of identical genotypes PI for the 11 microsatellite markers were 8.63 × 10 -7 . Banding patterns among parents and hybrids showed polymorphic fragments. The 11 SSR loci had produced unique fingerprints for each analyzed genotype and segregate between the two parental lines and their four hybrids. Parentage analysis confirms the hybrid purity of the four analyzed genotypes. Six Tunisian barley accessions were used as an outgroup in the multivariate analysis to confirm the efficiency of the employed 11 nSSR markers in genetic differentiation among various barley germplasms. Thus, neighbor joining and factorial analysis revealed clearly the discrimination among the parental lines, the four hybrids and the outgroup accessions. Out of the detected polymorphic 11 nuclear SSR markers, a set of five markers ( HVM33 , WMC1E8 , BMAC0154 , BMAC0040 and BMAG0007 ) were shown to be sufficient and informative enough to discriminate among the six genotypes representing the two

  6. Influence of pre-fermentation treatments on wine volatile and sensory profile of the new disease tolerant cultivar Solaris

    DEFF Research Database (Denmark)

    Zhang, Shujuan; Petersen, Mikael Agerlin; Liu, Jing

    2015-01-01

    Solaris is a new disease tolerant cultivar increasingly cultivated in cool climate regions. In order to explore the winemaking processes' potential to make different styles of Solaris wines, the effects of different pre-fermentation treatments (direct press after crushing, whole cluster press, cold...... maceration, and skin fermentation) on the volatile profile, chemical, and sensory properties of Solaris wines were investigated. Cold maceration treatment for 24 h and fermentation on skin led to wines with lower acidity and higher glycerol and total polyphenol indexes. Sensory analysis showed that cold...... maceration enhanced "apricot" and "apple" flavor while skin fermentation gave rise to increased "rose" and "elderflower" flavor. The PLS regression model revealed that fruity flavor of cold macerated wines was related to a combination of esters while β-damascenone and linalool were correlated to the "rose...

  7. Expression of the β-1,3-glucanase gene bgn13.1 from Trichoderma harzianum in strawberry increases tolerance to crown rot diseases but interferes with plant growth.

    Science.gov (United States)

    Mercado, José A; Barceló, Marta; Pliego, Clara; Rey, Manuel; Caballero, José L; Muñoz-Blanco, Juan; Ruano-Rosa, David; López-Herrera, Carlos; de Los Santos, Berta; Romero-Muñoz, Fernando; Pliego-Alfaro, Fernando

    2015-12-01

    The expression of antifungal genes from Trichoderma harzianum, mainly chitinases, has been used to confer plant resistance to fungal diseases. However, the biotechnological potential of glucanase genes from Trichoderma has been scarcely assessed. In this research, transgenic strawberry plants expressing the β-1,3-glucanase gene bgn13.1 from T. harzianum, under the control of the CaMV35S promoter, have been generated. After acclimatization, five out of 12 independent lines analysed showed a stunted phenotype when growing in the greenhouse. Moreover, most of the lines displayed a reduced yield due to both a reduction in the number of fruit per plant and a lower fruit size. Several transgenic lines showing higher glucanase activity in leaves than control plants were selected for pathogenicity tests. When inoculated with Colletotrichum acutatum, one of the most important strawberry pathogens, transgenic lines showed lower anthracnose symptoms in leaf and crown than control. In the three lines selected, the percentage of plants showing anthracnose symptoms in crown decreased from 61 % to a mean value of 16.5 %, in control and transgenic lines, respectively. Some transgenic lines also showed an enhanced resistance to Rosellinia necatrix, a soil-borne pathogen causing root and crown rot in strawberry. These results indicate that bgn13.1 from T. harzianum can be used to increase strawberry tolerance to crown rot diseases, although its constitutive expression affects plant growth and fruit yield. Alternative strategies such as the use of tissue specific promoters might avoid the negative effects of bgn13.1 expression in plant performance.

  8. Engineering Enhanced Vaccine Cell Lines To Eradicate Vaccine-Preventable Diseases: the Polio End Game.

    Science.gov (United States)

    van der Sanden, Sabine M G; Wu, Weilin; Dybdahl-Sissoko, Naomi; Weldon, William C; Brooks, Paula; O'Donnell, Jason; Jones, Les P; Brown, Cedric; Tompkins, S Mark; Oberste, M Steven; Karpilow, Jon; Tripp, Ralph A

    2016-02-15

    Vaccine manufacturing costs prevent a significant portion of the world's population from accessing protection from vaccine-preventable diseases. To enhance vaccine production at reduced costs, a genome-wide RNA interference (RNAi) screen was performed to identify gene knockdown events that enhanced poliovirus replication. Primary screen hits were validated in a Vero vaccine manufacturing cell line using attenuated and wild-type poliovirus strains. Multiple single and dual gene silencing events increased poliovirus titers >20-fold and >50-fold, respectively. Host gene knockdown events did not affect virus antigenicity, and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9-mediated knockout of the top candidates dramatically improved viral vaccine strain production. Interestingly, silencing of several genes that enhanced poliovirus replication also enhanced replication of enterovirus 71, a clinically relevant virus to which vaccines are being targeted. The discovery that host gene modulation can markedly increase virus vaccine production dramatically alters mammalian cell-based vaccine manufacturing possibilities and should facilitate polio eradication using the inactivated poliovirus vaccine. Using a genome-wide RNAi screen, a collection of host virus resistance genes was identified that, upon silencing, increased poliovirus and enterovirus 71 production by from 10-fold to >50-fold in a Vero vaccine manufacturing cell line. This report provides novel insights into enterovirus-host interactions and describes an approach to developing the next generation of vaccine manufacturing through engineered vaccine cell lines. The results show that specific gene silencing and knockout events can enhance viral titers of both attenuated (Sabin strain) and wild-type polioviruses, a finding that should greatly facilitate global implementation of inactivated polio vaccine as well as further reduce costs for live-attenuated oral polio vaccines. This work

  9. Tolerability and safety of souvenaid in patients with mild Alzheimer's disease

    NARCIS (Netherlands)

    Olde Rikkert, Marcel G.M.; Verhey, Frans R.; Blesa, Rafael; Arnim, Von Christine A.F.; Bongers, Anke; Harrison, John; Sijben, John; Scarpini, Elio; Vandewoude, Maurits F.J.; Vellas, Bruno; Witkamp, Renger; Kamphuis, Patrick J.G.H.; Scheltens, Philip

    2015-01-01

    Background: The medical food Souvenaid, containing the specific nutrient combination Fortasyn Connect, is designed to improve synapse formation and function in patients with Alzheimer's disease (AD). Two double-blind randomized controlled trials (RCT) with Souvenaid of 12 and 24 week duration

  10. Using Dutch elm disease-tolerant elm to restore floodplains impacted by emerald ash borer

    Science.gov (United States)

    Kathleen S. Knight; James M. Slavicek; Rachel Kappler; Elizabeth Pisarczyk; Bernadette Wiggin; Karen. Menard

    2012-01-01

    American elm (Ulmus Americana L.) was a dominant species in floodplains and swamps of the Midwest before Dutch elm disease (DED) (Ophiostoma ulmi and O.novo-ulmi) reduced its populations. In many areas, ash (Fraxinus spp.) became dominant in these ecosystems. Emerald ash borer (EAB) (...

  11. Identification of quantitative trait loci controlling root and shoot traits associated with drought tolerance in a lentil (Lens culinaris Medik. recombinant inbred line population

    Directory of Open Access Journals (Sweden)

    Omar Idrissi

    2016-08-01

    Full Text Available Drought is one of the major abiotic stresses limiting lentil productivity in rainfed production systems. Specific rooting patterns can be associated with drought avoidance mechanisms that can be used in lentil breeding programs. In all, 252 co-dominant and dominant markers were used for Quantitative Trait Loci (QTL analysis on 132 lentil recombinant inbred lines based on greenhouse experiments for root and shoot traits during two seasons under progressive drought-stressed conditions. Eighteen QTLs controlling a total of 14 root and shoot traits were identified. A QTL-hotspot genomic region related to a number of root and shoot characteristics associated with drought tolerance such as dry root biomass, root surface area, lateral root number, dry shoot biomass and shoot length was identified. Interestingly, a QTL related to root-shoot ratio, an important trait for drought avoidance, explaining the highest phenotypic variance of 27.6 % and 28.9 % for the two consecutive seasons, respectively, was detected. This QTL was closed to the co-dominant SNP marker TP6337 and also flanked by the two SNP TP518 and TP1280. An important QTL related to lateral root number was found close to TP3371 and flanked by TP5093 and TP6072 SNP markers. Also, a QTL associated with specific root length was identified close to TP1873 and flanked by F7XEM6b SRAP marker and TP1035 SNP marker. These two QTLs were detected in both seasons. Our results could be used for marker-assisted selection in lentil breeding programs targeting root and shoot characteristics conferring drought avoidance as an efficient alternative to slow and labour-intensive conventional breeding methods.

  12. Tolerability and safety of souvenaid in patients with mild Alzheimer's disease

    OpenAIRE

    Olde Rikkert, Marcel G.M.; Verhey, Frans R.; Blesa, Rafael; Arnim, Von, Christine A.F.; Bongers, Anke; Harrison, John; Sijben, John; Scarpini, Elio; Vandewoude, Maurits F.J.; Vellas, Bruno; Witkamp, Renger; Kamphuis, Patrick J.G.H.; Scheltens, Philip

    2015-01-01

    Background: The medical food Souvenaid, containing the specific nutrient combination Fortasyn Connect, is designed to improve synapse formation and function in patients with Alzheimer's disease (AD). Two double-blind randomized controlled trials (RCT) with Souvenaid of 12 and 24 week duration (Souvenir I and Souvenir II) showed that memory performance was improved in drug-naïve mild AD patients, whereas no effects on cognition were observed in a 24-week RCT (S-Connect) in mild to moderate AD ...

  13. Oral curcumin for Alzheimer's disease: tolerability and efficacy in a 24-week randomized, double blind, placebo-controlled study.

    Science.gov (United States)

    Ringman, John M; Frautschy, Sally A; Teng, Edmond; Begum, Aynun N; Bardens, Jenny; Beigi, Maryam; Gylys, Karen H; Badmaev, Vladimir; Heath, Dennis D; Apostolova, Liana G; Porter, Verna; Vanek, Zeba; Marshall, Gad A; Hellemann, Gerhard; Sugar, Catherine; Masterman, Donna L; Montine, Thomas J; Cummings, Jeffrey L; Cole, Greg M

    2012-01-01

    Curcumin is a polyphenolic compound derived from the plant Curcuma Long Lin that has been demonstrated to have antioxidant and anti-inflammatory effects as well as effects on reducing beta-amyloid aggregation. It reduces pathology in transgenic models of Alzheimer's disease (AD) and is a promising candidate for treating human AD. The purpose of the current study is to generate tolerability and preliminary clinical and biomarker efficacy data on curcumin in persons with AD. We performed a 24-week randomized, double blind, placebo-controlled study of Curcumin C3 Complex(®) with an open-label extension to 48 weeks. Thirty-six persons with mild-to-moderate AD were randomized to receive placebo, 2 grams/day, or 4 grams/day of oral curcumin for 24 weeks. For weeks 24 through 48, subjects that were receiving curcumin continued with the same dose, while subjects previously receiving placebo were randomized in a 1:1 ratio to 2 grams/day or 4 grams/day. The primary outcome measures were incidence of adverse events, changes in clinical laboratory tests and the Alzheimer's Disease Assessment Scale - Cognitive Subscale (ADAS-Cog) at 24 weeks in those completing the study. Secondary outcome measures included the Neuropsychiatric Inventory (NPI), the Alzheimer's Disease Cooperative Study - Activities of Daily Living (ADCS-ADL) scale, levels of Aβ1-40 and Aβ1-42 in plasma and levels of Aβ1-42, t-tau, p-tau181 and F2-isoprostanes in cerebrospinal fluid. Plasma levels of curcumin and its metabolites up to four hours after drug administration were also measured. Mean age of completers (n = 30) was 73.5 years and mean Mini-Mental Status Examination (MMSE) score was 22.5. One subject withdrew in the placebo (8%, worsened memory) and 5/24 subjects withdrew in the curcumin group (21%, 3 due to gastrointestinal symptoms). Curcumin C3 Complex(®) was associated with lowered hematocrit and increased glucose levels that were clinically insignificant. There were no differences between

  14. Inhibition of protease-resistant prion protein formation in a transformed deer cell line infected with chronic wasting disease

    NARCIS (Netherlands)

    Raymond, G.J.; Olsen, E.A.; Lee, K.S.; Raymond, L.D.; Bryant, P.K.; Baron, G.S.; Caughey, W.S.; Kocisko, D.A.; McHolland, L.E.; Favara, C.; Langeveld, J.P.M.; Zijderveld, van F.G.; Mayer, R.T.; Miller, M.W.; Williams, E.S.; Caughey, B.

    2006-01-01

    Chronic wasting disease (CWD) is an emerging transmissible spongiform encephalopathy (prion disease) of North American cervids, i.e., mule deer, white-tailed deer, and elk (wapiti). To facilitate in vitro studies of CWD, we have developed a transformed deer cell line that is persistently infected

  15. Characteristics and use of wheat mutants tolerant or resistant to Septoria nodorum Berk

    International Nuclear Information System (INIS)

    Fossati, A.; Kleijer, G.; Fried, P.M.

    1983-01-01

    Mutation induction was used to obtain mutants tolerant or resistant to Septoria nodorum. This technique is valuable but many genotypes had to be treated because mutants could not be selected from all the genotypes. Short tolerant mutants could be obtained from 3 of the 15 treated tall tolerant lines. Induction of tolerance in susceptible lines of good agronomic value succeeded for 2 of 5 treated varieties. All these mutants showed a reduction in yield potential. One mutant showed partial resistance to S. nodorum. The disease development on the leaves and the spikes of this mutant was much slower than on the original variety. The characteristics of this mutant are discussed in detail. The genetics of tolerance proved to be polygenic and additive, which has consequences on the breeding method. A good way of obtaining a stable system would be the combination of high tolerance and partial resistance in the same cultivar. (author)

  16. New insights into non-conventional epitopes as T cell targets: The missing link for breaking immune tolerance in autoimmune disease?

    Science.gov (United States)

    Harbige, James; Eichmann, Martin; Peakman, Mark

    2017-11-01

    The mechanism by which immune tolerance is breached in autoimmune disease is poorly understood. One possibility is that post-translational modification of self-antigens leads to peripheral recognition of neo-epitopes against which central and peripheral tolerance is inadequate. Accumulating evidence points to multiple mechanisms through which non-germline encoded sequences can give rise to these non-conventional epitopes which in turn engage the immune system as T cell targets. In particular, where these modifications alter the rules of epitope engagement with MHC molecules, such non-conventional epitopes offer a persuasive explanation for associations between specific HLA alleles and autoimmune diseases. In this review article, we discuss current understanding of mechanisms through which non-conventional epitopes may be generated, focusing on several recently described pathways that can transpose germline-encoded sequences. We contextualise these discoveries around type 1 diabetes, the prototypic organ-specific autoimmune disease in which specific HLA-DQ molecules confer high risk. Non-conventional epitopes have the potential to act as tolerance breakers or disease drivers in type 1 diabetes, prompting a timely re-evaluation of models of a etiopathogenesis. Future studies are required to elucidate the disease-relevance of a range of potential non-germline epitopes and their relationship to the natural peptide repertoire. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Metformin modifies the exercise training effects on risk factors for cardiovascular disease in impaired glucose tolerant adults

    Science.gov (United States)

    Malin, Steven K.; Nightingale, Joy; Choi, Sung-Eun; Chipkin, Stuart R.; Braun, Barry

    2012-01-01

    Impaired glucose tolerant (IGT) adults are at elevated risk for cardiovascular disease (CVD). Exercise or metformin reduce CVD risk, but the efficacy of combining treatments is unclear. To determine the effects of exercise training plus metformin, compared to each treatment alone, on CVD risk factors in IGT adults. Subjects were assigned to: placebo (P), metformin (M), exercise plus placebo (EP), or exercise plus metformin (EM) (8/group). In a double-blind design, P or 2000mg/d of M were administered for 12 weeks and half performed aerobic and resistance training 3 days/week for approximately 60 minutes/day at 70% pre-training heart rate peak. Outcomes included: adiposity, blood pressure (BP), lipids and high sensitivity C-reactive protein (hs-CRP). Z-scores were calculated to determine metabolic syndrome severity. M and EM, but not EP, decreased body weight compared to P (p metabolic syndrome Z-score compared to baseline (EP; trend p = 0.07 and EM or M; p exercise and/or metformin improve some CVD risk factors, only training or metformin alone lowered hs-CRP and BP. Thus, metformin may attenuate the effects of training on some CVD risk factors and metabolic syndrome severity in IGT adults. PMID:23505172

  18. Determination of Tolerance Levels of Cotton Genotypes Obtained from F6-F7 Generation against Verticillium Wilt Disease Caused by Verticillium dahliae Kleb.

    OpenAIRE

    Oktay EROĞAN; Emine KARADEMIR; Çetin KARADEMIR; Aydın UNAY

    2013-01-01

    The susceptibility of cotton genotypes obtained from F6 and F7 generations to Verticillium wilt (VW) disease (Verticillium dahliae Kleb.), was studied under artificial and natural infestation during 2009 and 2010 growing seasons at the Cotton Research Institute’s, Nazilli, Aydın, Turkey. In this study, fifteen cotton breeding lines and two control varieties were used as plant material. During the cotton growing season, foliar disease index (FDI), vascular disease index (VDI) and pot disease i...

  19. Establishment of new murine embryonic stem cell lines for the generation of mouse models of human genetic diseases

    Directory of Open Access Journals (Sweden)

    M.A. Sukoyan

    2002-05-01

    Full Text Available Embryonic stem cells are totipotent cells derived from the inner cell mass of blastocysts. Recently, the development of appropriate culture conditions for the differentiation of these cells into specific cell types has permitted their use as potential therapeutic agents for several diseases. In addition, manipulation of their genome in vitro allows the creation of animal models of human genetic diseases and for the study of gene function in vivo. We report the establishment of new lines of murine embryonic stem cells from preimplantation stage embryos of 129/Sv mice. Most of these cells had a normal karyotype and an XY sex chromosome composition. The pluripotent properties of the cell lines obtained were analyzed on the basis of their alkaline phosphatase activity and their capacity to form complex embryoid bodies with rhythmically contracting cardiomyocytes. Two lines, USP-1 and USP-3, with the best in vitro characteristics of pluripotency were used in chimera-generating experiments. The capacity to contribute to the germ line was demonstrated by the USP-1 cell line. This cell line is currently being used to generate mouse models of human diseases.

  20. Tolerability of Shortened Infliximab Infusion Times in Patients With Inflammatory Bowel Diseases : A Single-Center Cohort Study

    NARCIS (Netherlands)

    Breynaert, Christine; Ferrante, Marc; Fidder, Herma; Van Steen, Kristel; Noman, Maja; Ballet, Vera; Vermeire, Severine; Rutgeerts, Paul; Van Assche, Gert

    OBJECTIVES: Scheduled maintenance therapy with infliximab decreases the risk of infusion reactions. Many centers have accelerated infusion times to 1 h in selected patients who tolerate 5 mg/kg infliximab infusions. The aim of this study was to compare the tolerability of 1-h and 2-h infliximab

  1. Generation of an integration-free induced pluripotent stem cell line (CSC-43 from a patient with sporadic Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Ana Marote

    2018-03-01

    Full Text Available An induced pluripotent stem cell (iPSC line was generated from a 36-year-old patient with sporadic Parkinson's disease (PD. Skin fibroblasts were reprogrammed using the non-integrating Sendai virus technology to deliver OCT3/4, SOX2, c-MYC and KLF4 factors. The generated cell line (CSC-43 exhibits expression of common pluripotency markers, in vitro differentiation into three germ layers and normal karyotype. This iPSC line can be used to study the mechanisms underlying the development of PD.

  2. Screening of ten advanced chickpea lines for blight and wilt resistance

    International Nuclear Information System (INIS)

    Jamil, F.F.; Haq, I.; Sarwar, N.; Alam, S.S.; Khan, J.A.; Hanif, M.; Khan, I.A.; Sarwar, M.; Haq, M.A.

    2002-01-01

    Ten advanced chickpea lines developed at NIAB were screened for resistance to Ascochyta blight and Fusarium wilt diseases in different sets of experiments conducted under controlled environment. Inoculation of plants by spore suspension of virulent strains of Ascochyta rabiei revealed that one line (97313) was resistant tolerant, two lines (97305, 97392) were tolerant, six lines (97306, 97310, 97311, 97303, 97302, 97393) were tolerant/susceptible and one line (97301) was susceptible. Screening of the same lines against Fusarium wilt by water culture method showed that two lines (97301, 97313) were moderately resistant, four lines (97302, 97303, 97306, 97393) were tolerant and the remaining four lines were susceptible. Screening through phytotoxic culture filtrates revealed that two lines (97302, 97313) were less sensitive to culture filtrates of Ascochyta rabiei and Fusarium oxysporum than the resistant check (CM88). These lines were also analyzed spectrophotometrically for peroxidase enzyme activity. Maximum enzyme activity was detected after 48 hours of inoculation with A. rabiei in three lines (97305, 97311, 97313) and resistant check (CM88) while enzyme activity in the remaining lines reached its maximum after 72 hours of inoculation which was comparable to the susceptible check (Pb-1). These studies lead to the conclusion that one line (97313) exhibited resistance against both the diseases and can be used as a source of resistance for further improvement of chickpea germplasm. (author)

  3. QTLs for tolerance of drought and breeding for tolerance of abiotic and biotic stress: an integrated approach.

    Directory of Open Access Journals (Sweden)

    Shalabh Dixit

    Full Text Available BACKGROUND: The coupling of biotic and abiotic stresses leads to high yield losses in rainfed rice (Oryza sativa L. growing areas. While several studies target these stresses independently, breeding strategies to combat multiple stresses seldom exist. This study reports an integrated strategy that combines QTL mapping and phenotypic selection to develop rice lines with high grain yield (GY under drought stress and non-stress conditions, and tolerance of rice blast. METHODOLOGY: A blast-tolerant BC2F3-derived population was developed from the cross of tropical japonica cultivar Moroberekan (blast- and drought-tolerant and high-yielding indica variety Swarna (blast- and drought-susceptible through phenotypic selection for blast tolerance at the BC2F2 generation. The population was studied for segregation distortion patterns and QTLs for GY under drought were identified along with study of epistatic interactions for the trait. RESULTS: Segregation distortion, in favour of Moroberekan, was observed at 50 of the 59 loci. Majority of these marker loci co-localized with known QTLs for blast tolerance or NBS-LRR disease resistance genes. Despite the presence of segregation distortion, high variation for DTF, PH and GY was observed and several QTLs were identified under drought stress and non-stress conditions for the three traits. Epistatic interactions were also detected for GY which explained a large proportion of phenotypic variance observed in the population. CONCLUSIONS: This strategy allowed us to identify QTLs for GY along with rapid development of high-yielding purelines tolerant to blast and drought with considerably reduced efforts. Apart from this, it also allowed us to study the effects of the selection cycle for blast tolerance. The developed lines were screened at IRRI and in the target environment, and drought and blast tolerant lines with high yield were identified. With tolerance to two major stresses and high yield potential, these

  4. Tolerance induction between two different strains of parental mice prevents graft-versus-host disease in haploidentical hematopoietic stem cell transplantation to F1 mice

    International Nuclear Information System (INIS)

    Guo, Yixian; Zhang, Lanfang; Wan, Suigui; Sun, Xuejing; Wu, Yongxia; Yu, Xue-Zhong; Xia, Chang-Qing

    2014-01-01

    Highlights: • Injection of UVB-irradiated iDCs induces alloantigen tolerance. • This alloantigen tolerance may be associated regulatory T cell induction. • Tolerant mice serve as bone marrow donors reduces GVHD to their F1 recipients in allo-HSCT. • Tolerance is maintained in F1 recipients for long time post HSCT. - Abstract: Haploidentical hematopoietic stem cell transplantation (Haplo-HSCT) has been employed worldwide in recent years and led to favorable outcome in a group of patients who do not have human leukocyte antigen (HLA)-matched donors. However, the high incidence of severe graft-versus-host disease (GVHD) is a major problem for Haplo-HSCT. In the current study, we performed a proof of concept mouse study to test whether induction of allogeneic tolerance between two different parental strains was able to attenuate GVHD in Haplo-HSCT to the F1 mice. We induced alloantigen tolerance in C3H mice (H-2k) using ultraviolet B (UVB) irradiated immature dendritic cells (iDCs) derived from the cultures of Balb/c bone marrow cells. Then, we performed Haplo-HSCT using tolerant C3H mice as donors to F1 mice (C3H × Balb/c). The results demonstrated that this approach markedly reduced GVHD-associated death and significantly prolonged the survival of recipient mice in contrast to the groups with donors (C3H mice) that received infusion of non-UVB-irradiated DCs. Further studies showed that there were enhanced Tregs in the tolerant mice and alloantigen-specific T cell response was skewed to more IL-10-producing T cells, suggesting that these regulatory T cells might have contributed to the attenuation of GVHD. This study suggests that it is a feasible approach to preventing GVHD in Haplo-HSCT in children by pre-induction of alloantigen tolerance between the two parents. This concept may also lead to more opportunities in cell-based immunotherapy for GVHD post Haplo-HSCT

  5. Tolerance induction between two different strains of parental mice prevents graft-versus-host disease in haploidentical hematopoietic stem cell transplantation to F1 mice

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Yixian; Zhang, Lanfang; Wan, Suigui; Sun, Xuejing; Wu, Yongxia [Department of Hematology, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Yu, Xue-Zhong [Department of Microbiology and Immunology, Medical University of South Carolina, Charleston, SC 29425 (United States); Xia, Chang-Qing, E-mail: cqx65@yahoo.com [Department of Hematology, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China)

    2014-04-18

    Highlights: • Injection of UVB-irradiated iDCs induces alloantigen tolerance. • This alloantigen tolerance may be associated regulatory T cell induction. • Tolerant mice serve as bone marrow donors reduces GVHD to their F1 recipients in allo-HSCT. • Tolerance is maintained in F1 recipients for long time post HSCT. - Abstract: Haploidentical hematopoietic stem cell transplantation (Haplo-HSCT) has been employed worldwide in recent years and led to favorable outcome in a group of patients who do not have human leukocyte antigen (HLA)-matched donors. However, the high incidence of severe graft-versus-host disease (GVHD) is a major problem for Haplo-HSCT. In the current study, we performed a proof of concept mouse study to test whether induction of allogeneic tolerance between two different parental strains was able to attenuate GVHD in Haplo-HSCT to the F1 mice. We induced alloantigen tolerance in C3H mice (H-2k) using ultraviolet B (UVB) irradiated immature dendritic cells (iDCs) derived from the cultures of Balb/c bone marrow cells. Then, we performed Haplo-HSCT using tolerant C3H mice as donors to F1 mice (C3H × Balb/c). The results demonstrated that this approach markedly reduced GVHD-associated death and significantly prolonged the survival of recipient mice in contrast to the groups with donors (C3H mice) that received infusion of non-UVB-irradiated DCs. Further studies showed that there were enhanced Tregs in the tolerant mice and alloantigen-specific T cell response was skewed to more IL-10-producing T cells, suggesting that these regulatory T cells might have contributed to the attenuation of GVHD. This study suggests that it is a feasible approach to preventing GVHD in Haplo-HSCT in children by pre-induction of alloantigen tolerance between the two parents. This concept may also lead to more opportunities in cell-based immunotherapy for GVHD post Haplo-HSCT.

  6. Below the poverty line and non-communicable diseases in Kerala: The Epidemiology of Non-communicable Diseases in Rural Areas (ENDIRA) study.

    Science.gov (United States)

    Menon, Jaideep; Vijayakumar, N; Joseph, Joseph K; David, P C; Menon, M N; Mukundan, Shyam; Dorphy, P D; Banerjee, Amitava

    2015-01-01

    India carries the greatest burden of global non-communicable diseases (NCDs). Poverty is strongly associated with NCDs but there are few prevalence studies which have measured poverty in India, particularly in rural settings. In Kerala, India, a population of 113,462 individuals was identified. The "Epidemiology of Non-communicable Diseases in Rural Areas" (ENDIRA) study was conducted via ASHAs (Accredited Social Health Activists). Standardised questionnaires were used in household interviews of individuals ≥18years during 2012 to gather sociodemographic, lifestyle and medical data for this population. The Government of Kerala definition of "the poverty line" was used. The association between below poverty line (BPL) status, NCDs and risk factors was analysed in multivariable regression models. 84,456 adults were included in the analyses (25.4% below the poverty line). The prevalence of NCDs was relatively common: myocardial infarction (MI) 1.4%, stroke 0.3%, respiratory diseases 5.0%, and cancer 1.1%. BPL status was not associated with age (p=0.96) or gender (p=0.26). Compared with those above the poverty line (APL), the BPL group was less likely to have diabetes, hypertension or dyslipidaemia (ppoverty line status. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Watermelon germplasm lines USVL246-FR2 and USVL252-FR2 tolerant to fusarium oxysporum f. sp. niveum race 2

    Science.gov (United States)

    Two improved germplasm lines of wild watermelon (Citrullus lanatus var. citroides) designated USVL246-FR2 and USVL252-FR2 were released in 2012 by the Agricultural Research Service of the U.S. Department of Agriculture (Wechter et al. 2012). These lines are each highly uniform for growth characteri...

  8. Prevalence and predictors of columnar lined esophagus in gastroesophageal reflux disease (GERD) patients undergoing upper endoscopy.

    Science.gov (United States)

    Balasubramanian, Gokulakrishnan; Singh, Mandeep; Gupta, Neil; Gaddam, Srinivas; Giacchino, Maria; Wani, Sachin B; Moloney, Brian; Higbee, April D; Rastogi, Amit; Bansal, Ajay; Sharma, Prateek

    2012-11-01

    Chronic gastroesophageal reflux disease (GERD) is a risk factor for Barrett's esophagus (BE), the most important surrogate marker for the development of esophageal adenocarcinoma (EAC). The need to document the presence of intestinal metaplasia in esophageal biopsies from a columnar lined esophagus (CLE) to diagnose BE is debated. The objective of this study was to prospectively evaluate the prevalence and risk factors of CLE in a large cohort of GERD patients undergoing upper endoscopy. Consecutive patients presenting to the endoscopy unit at a tertiary referral center for their index upper endoscopy for evaluation of GERD symptoms were enrolled in this prospective cohort study. Patients were asked to complete a validated GERD questionnaire that documents the onset of GERD symptoms (heartburn and acid regurgitation) and grades the frequency and severity of symptoms experienced over the past year. Demographic information, body mass index, and use of aspirin/nonsteroidal antiinflammatory drugs were recorded. Endoscopic details including length of CLE, presence and size of hiatal hernia were noted. Patients with CLE (cases) were compared with those without CLE (controls) using Fischer's exact test and t-test. All factors that were statistically significant (PGERD symptoms were prospectively enrolled. On index endoscopy, the prevalence of CLE was 23.3%, whereas of CLE with documented intestinal metaplasia was 14.1%. On univariate analysis, male gender, Caucasian race, heartburn duration of >5 years, presence and size of hiatal hernia were significantly associated with the presence of CLE compared with controls (P5 years (odds ratio (OR): 1.50, 95% confidence interval (CI): 1.07-2.09, P=0.01), Caucasian race (OR: 2.40, 95% CI: 1.42-4.03, P=0.001), and hiatal hernia (OR: 2.07, 95% CI: 1.50-2.87, PGERD patients are diagnosed with this lesion. Enrolling all these patients in surveillance programs would have significant ramifications on health-care resources.

  9. Therapeutic compliance of first line disease-modifying therapies in patients with multiple sclerosis. COMPLIANCE Study.

    Science.gov (United States)

    Saiz, A; Mora, S; Blanco, J

    2015-05-01

    Non-adherence to disease-modifying therapies (DMTs) in multiple sclerosis may be associated with reduced efficacy. We assessed compliance, the reasons for non-compliance, treatment satisfaction, and quality of life (QoL) of patients treated with first-line therapies. A cross-sectional, multicenter study was conducted that included relapsing multiple sclerosis patients. Compliance in the past month was assessed using Morisky-Green test. Seasonal compliance and reasons for non-compliance were assessed by an ad-hoc questionnaire. Treatment satisfaction and QoL were evaluated by means of TSQM and PRIMUS questionnaires. A total of 220 patients were evaluated (91% relapsing-remitting); the mean age was 39.1 years, 70% were female, and the average time under treatment was 5.4 years. Subcutaneous interferon (IFN) β-1b was used in 23% of the patients, intramuscular IFN β-1a in 21%, subcutaneous IFN β-1a in 37%, and with glatiramer acetate in 19%. The overall compliance was 75%, with no significant differences related to the therapy, and 81% did not report any seasonal variation. Compliant patients had significantly lower disability scores and time of diagnosis, and greater satisfaction with treatment and its effectiveness. Discomfort and flu-like symptoms were the most frequent reasons for non-compliance. The satisfaction and QoL were associated with less disability and number of therapeutic switches. The rate of compliance, satisfaction and QoL in multiple sclerosis patients under DMTs is high, especially for those newly diagnosed, less disabled, and with fewer therapeutic switches. Discomfort and flu-like symptoms associated with injected therapies significantly affect adherence. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.

  10. Transient HEXA expression in a transformed human fetal Tay-Sachs disease neuroglial cell line

    Energy Technology Data Exchange (ETDEWEB)

    Fernandes, M.J.; Hechtman, P.; Kaplan, F. [McGill Univ., Quebec (Canada)] [and others

    1994-09-01

    Tay-Sachs disease (TSD) is a severe neurodegenerative disorder characterized by the accumulation of GM{sub 2} ganglioside in the neurons of the central cortex. The recessively inherited disorder results from deficiency of hexosaminidase A (Hex A), a heterodimer of an {alpha} and {beta} subunit encoded by the HEXA and HEXB genes. Expression of HEXA mutations in COS cells has several disadvantages including high endogenous hexosaminidase activity. We report a new transient expression system with very low endogenous Hex A activity. An SV40-transformed fetal TSD neuroglial cell line was assessed for transient expression of the HEXA gene. pCMV{alpha}, a vector incorporating the cytomegalovirus promoter with the human {alpha}-subunit cDNA insert, proved to be the most efficient expression vector. Transfection of 4x10{sup 6} cells with 5-20 {mu}g of plasmid resulted in 100 to 500-fold Hex A activity (4MUGS hydrolysis) relative to mock-transfected cells. Use of pCMV{beta}-Gal as a control for transfection efficiency indicated that 10-20% of cells were transfected. Hex A specific activity increased for at least 72 h post-transfection. This new transient expression system should greatly improve the characterization of mutations in which low levels of HEXA expression result in milder clinical phenotypes and permit studies on enzymatic properties of mutant forms of Hex A. Since the cells used are of CNS origin and synthesize gangliosides, it should also be possible to study, in culture, the metabolic phenotype associated with TSD.

  11. The LifeLines Cohort Study : Prevalence and treatment of cardiovascular disease and risk factors

    NARCIS (Netherlands)

    van der Ende, M. Yldau; Hartman, Minke H. T.; Hagemeijer, Yanick; Meems, Laura M. G.; de Vries, Hendrik Sierd; Stolk, Ronald P.; de Boer, Rudolf A.; Sijtsma, Anna; van der Meer, Peter; Rienstra, Michiel; van der Harst, Pim

    2017-01-01

    Background: The LifeLines Cohort Study is a large three-generation prospective study and Biobank. Recruitment and data collection started in 2006 and follow-up is planned for 30 years. The central aim of LifeLines is to understand healthy ageing in the 21st century. Here, the study design, methods,

  12. Notice of release of iceberg, romaine, and leaf lettuce breeding lines with improved disease resistance

    Science.gov (United States)

    The Agricultural Research Service, U.S. Department of Agriculture announces the release of sixteen breeding lines of lettuce (Lactuca sativa L.). Five (SM13-Il, SM13-I2, SM13-I3, SM13-I4, and SM13-I5) of the six iceberg breeding lines can be used for whole head or salad blend production; the sixth i...

  13. Establishment of induced pluripotent stem cell line (ZZUi010-A from an Alzheimer's disease patient carrying an APP gene mutation

    Directory of Open Access Journals (Sweden)

    Zhilei Wang

    2017-12-01

    Full Text Available Alzheimer's disease (AD is one of the most common neurodegenerative disorders. Previous studies have identified mutations in several genes, such as amyloid precursor protein (APP, presenilin-1 (PSEN1, and presenilin-2 (PSEN2, in patients with early-onset (<65 years familial AD. Recently, a patient with an APP gene mutation was identified; the dermal fibroblasts of the patient were obtained and a line of induced pluripotent stem cells (iPSCs was successfully generated using the Sendai-virus (SeV delivery system. The iPSC line will be useful for further study of the pathomechanism and drug screening for AD.

  14. Mutation breeding for downy mildew resistance in pearl millet. Nucleo-cytoplasmic interactions in disease-resistant lines

    International Nuclear Information System (INIS)

    Murty, B.R.; Thakur, S.R.; Prakash, N.; Mehta, S.L.; Bhakta, S.T.

    1983-01-01

    Under the need to rescue hybrid pearl millet cultivation in India from devastating damage by downy mildew, a mutation induction project was started in 1971 to make the commonly used male sterile parent Tift 23A resistant to the disease. Simultaneously sources of resistance from West Africa were used in crossbreeding by which climatic adaptation and male sterility had to be transferred. A number of mildew-resistant hybrids were developed, both from induced mutation and introduction. The resistant male sterile lines were further examined as to their common features and differences from susceptible lines. A strong evidence for nuclear-cytoplasmic interaction was obtained by biochemical and ultrastructural investigations. (author)

  15. The LifeLines Cohort Study: Prevalence and treatment of cardiovascular disease and risk factors

    OpenAIRE

    van der Ende, M. Yldau; Hartman, Minke H. T.; Hagemeijer, Yanick; Meems, Laura M. G.; de Vries, Hendrik Sierd; Stolk, Ronald P.; de Boer, Rudolf A.; Sijtsma, Anna; van der Meer, Peter; Rienstra, Michiel; van der Harst, Pim

    2017-01-01

    Background: The LifeLines Cohort Study is a large three-generation prospective study and Biobank. Recruitment and data collection started in 2006 and follow-up is planned for 30 years. The central aim of LifeLines is to understand healthy ageing in the 21st century. Here, the study design, methods, baseline and major cardiovascular phenotypes of the LifeLines Cohort Study are presented. Methods and results: Baseline cardiovascular phenotypeswere defined in 9700 juvenile (8-18 years) and 152,1...

  16. Physiological investigation of C4-phosphoenolpyruvate-carboxylase-introduced rice line shows that sucrose metabolism is involved in the improved drought tolerance.

    Science.gov (United States)

    Zhang, Chen; Li, Xia; He, Yafei; Zhang, Jinfei; Yan, Ting; Liu, Xiaolong

    2017-06-01

    We compared the drought tolerance of wild-type (WT) and transgenic rice plants (PC) over-expressing the maize C 4 PEPC gene, which encodes phosphoenolpyruvate carboxylase (PEPC, EC 4.1.1.31) gene, and evaluated the roles of saccharide and sugar-related enzymes in the drought response. Pot-grown seedlings were subjected to real drought conditions outdoors, and the yield components were compared between PC and untransformed wild-type (WT) plants. The stable yield from PC plants was associated with higher net photosynthetic rate under the real drought treatment. The physiological characters of WT and PC seedlings under a simulated drought treatment (25% (w/v) polyethylene glycol-6000 for 3 h; PEG 6000 treatment) were analyzed in detail for the early response of drought. The relative water content was higher in PC than in WT, and PEPC activity and the C 4 -PEPC transcript level in PC were elevated under the simulated drought conditions. The endogenous saccharide responses also differed between PC and WT under simulated drought stress. The higher sugar decomposition rate in PC than in WT under drought analog stress was related to the increased activities of sucrose phosphate synthase, sucrose synthase, acid invertase, and neutral invertase, increased transcript levels of VIN1, CIN1, NIN1, SUT2, SUT4, and SUT5, and increased activities of superoxide dismutase and peroxidase in the leaves. The greater antioxidant defense capacity of PC and its relationship with saccharide metabolism was one of the reasons for the improved drought tolerance. In conclusion, PEPC effectively alleviated oxidative damage and enhanced the drought tolerance in rice plants, which were more related to the increase of the endogenous saccharide decomposition. These findings show that components of C 4 photosynthesis can be used to increase the yield of rice under drought conditions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Extensive characterization of a lentiviral-derived stable cell line expressing rabbit hemorrhagic disease virus VPg protein.

    Science.gov (United States)

    Zhu, Jie; Miao, Qiuhong; Tan, Yonggui; Guo, Huimin; Li, Chuanfeng; Chen, Zongyan; Liu, Guangqing

    2016-11-01

    Rabbit hemorrhagic disease virus (RHDV) is an important member of the caliciviridae family. Currently, no suitable tissue culture system is available for proliferating RHDV, which limits the study of its pathogenesis. To bypass this obstacle, we established a cell line, RK13-VPg, stably expressing the VPg gene with a lentivirus packaging system in this study. In addition, the recently constructed RHDV replicon in our laboratory provided an appropriate model for studying the pathogenesis of RHDV without in vitro RHDV propagation and culture. Using this RHDV replicon and RK13-VPg cell line, we further demonstrated that the presence of VPg protein is essential for efficient translation of an RHDV replicon. Therefore, the RK13-VPg cell line is a powerful tool for studying the replication and translation mechanisms of RHDV. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. On the Front Lines of Rare Disease Research | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... a project focused on finding treatments for this lipid storage disease. Additional NCATS programs and initiatives that support rare diseases research include but are not limited to the following: ...

  19. Effectiveness and tolerability of second-line therapy with vildagliptin versus other oral agents in type 2 diabetes (EDGE): post-hoc subanalysis of the Belgian data.

    Science.gov (United States)

    Hoste, J; Daci, E; Mathieu, C

    2014-06-01

    To assess the efficacy and safety of vildagliptin versus other oral glucose-lowering drugs added to antidiabetic monotherapy in Belgian patients with type 2 diabetes mellitus, in comparison to the global EDGE study results. This is a pre-specified post-hoc subanalysis of the Belgian patient cohort from a worldwide 1-year observational study that compared the effectiveness and tolerability of vildagliptin to other oral antidiabetic agents in type 2 diabetes patients failing monotherapy with oral glucose-lowering agents (EDGE). A total of 1793 Belgian patients were enrolled. Physicians could add any oral antidiabetic drug and patients entered either into the vildagliptin or the comparator cohort. The primary effectiveness and tolerability endpoint was defined as the proportion of patients having a treatment response (HbA1c reduction from baseline to month 12 endpoint >0·3%) without hypoglycemia, weight gain, peripheral oedema, or gastrointestinal side-effects. In the Belgian population, 37·8% of patients in the vildagliptin group and 32·8% in the comparator group had a decrease in HbA1c of >0·3% without the predefined tolerability issues of hypoglycemia, weight gain, oedema or, gastrointestinal complaints (primary endpoint), resulting in an unadjusted odds ratio of 1·24 (95% CI: 0·96-1·61). Mean HbA1c change from baseline was -0·81% in the vildagliptin cohort and -0·75% in the comparator cohort. Overall, vildagliptin was well tolerated with similarly low incidences of total adverse events (14·9% versus 14·5% in the compactor group) and serious adverse events (2·7% versus 2·5% in the comparator group). In this EDGE subgroup of Belgian patients with type 2 diabetes who do not achieve the glycemic targets with monotherapy, a similar trend as in the global EDGE study was observed. Adding vildagliptin as a second oral glucose-lowering agent resulted in lowering HbA1c to <7% without weight gain, hypoglycemia or peripheral oedema in a higher proportion of

  20. The SH-SY5Y cell line in Parkinson's disease research: a systematic review

    OpenAIRE

    Xicoy, H; Wieringa, B; Martens, G.J.

    2017-01-01

    Parkinson?s disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, ar...

  1. Efficacy of Levofloxacin-Based Third-Line Therapy for the Eradication of Helicobacter pylori in Peptic Ulcer Disease.

    Science.gov (United States)

    Lim, Joo Hyun; Kim, Sang Gyun; Song, Ji Hyun; Hwang, Jae Jin; Lee, Dong Ho; Han, Jae Pil; Hong, Su Jin; Kim, Ji Hyun; Jeon, Seong Woo; Kim, Gwang Ha; Shim, Ki-Nam; Shin, Woon Geon; Kim, Tae Ho; Kim, Sun Moon; Chung, Il-Kwon; Kim, Hyun-Soo; Kim, Heung Up; Lee, Joongyub; Kim, Jae Gyu

    2017-03-15

    The resistance rate of Helicobacter pylori is gradually increasing. We aimed to evaluate the efficacy of levofloxacin-based third-line H. pylori eradication in peptic ulcer disease. Between 2002 and 2014, 110 patients in 14 medical centers received levofloxacin-based third-line H. pylori eradication therapy for peptic ulcer disease. Of these, 88 were included in the study; 21 were excluded because of lack of follow-up and one was excluded for poor compliance. Their eradication rates, treatment regimens and durations, and types of peptic ulcers were analyzed. The overall eradiation rate was 71.6%. The adherence rate was 80.0%. All except one received a proton-pump inhibitor, amoxicillin, and levofloxacin. One received a proton-pump inhibitor, amoxicillin, levofloxacin, and clarithromycin, and the eradication was successful. Thirty-one were administered the therapy for 7 days, 25 for 10 days, and 32 for 14 days. No significant differences were observed in the eradication rates between the three groups (7-days, 80.6% vs 10-days, 64.0% vs 14-days, 68.8%, p=0.353). Additionally, no differences were found in the eradiation rates according to the type of peptic ulcer (gastric ulcer, 73.2% vs duodenal/gastroduodenal ulcer, 68.8%, p=0.655). Levofloxacin-based third-line H. pylori eradication showed efficacy similar to that of previously reported first/second-line therapies.

  2. Tolerance to Septoria nodorum in wheat: Evaluation of the infection and selection method and the mutagenesis programme

    International Nuclear Information System (INIS)

    Broennimann, A.; Fossati, A.

    1977-01-01

    In Switzerland, the selection for tolerance in wheat to Septoria nodorum Berk. has been carried out for quite a long time. The selection is based on artificial field infection and selection according to the grain appearance. The relative thousand kernel weight (infected as a percentage of the uninfected control) is used as a reference for tolerance. The advantage and the inconvenience of this method are discussed in the first part of the paper. The second part deals with the use of the mutation technique for increasing tolerance to Septoria nodorum in short forms of wheat. Two ways were suitable: the selection for tolerance in short forms or the shortening of tolerant forms. Since increased tolerance is normally combined with a decrease in yield if the disease is absent, these lines can be used only as parents for tolerance in a breeding programme. (author)

  3. Crafting tolerance

    DEFF Research Database (Denmark)

    Kirchner, Antje; Freitag, Markus; Rapp, Carolin

    2011-01-01

    Ongoing changes in social structures, orientation, and value systems confront us with the growing necessity to address and understand transforming patterns of tolerance as well as specific aspects, such as social tolerance. Based on hierarchical analyses of the latest World Values Survey (2005......–08) and national statistics for 28 countries, we assess both individual and contextual aspects that influence an individual's perception of different social groupings. Using a social tolerance index that captures personal attitudes toward these groupings, we present an institutional theory of social tolerance. Our...

  4. Efficacy and tolerability of rasagiline in daily clinical use--a post-marketing observational study in patients with Parkinson's disease.

    Science.gov (United States)

    Reichmann, H; Jost, W H

    2010-09-01

    The MAO-B inhibitor rasagiline is indicated for the treatment of idiopathic Parkinson's disease (PD), and its use is supported by evidence from large-scale, controlled clinical studies. The post-marketing observational study presented here investigated the efficacy and tolerability of rasagiline treatment (monotherapy or combination therapy) in daily clinical practice. The study included patients with idiopathic PD who received rasagiline (recommended dose 1 mg, once daily) as monotherapy or combination therapy. The treatment and observation period was approximately 4 months. Outcome measures included the change from baseline in the Columbia University Rating Scale (CURS), the Unified PD Rating Scale fluctuation subscale, daily OFF time (patient home diaries) and the PD Questionnaire-39. Adverse drug reactions/adverse events (ADRs/AEs) and the physician's global judgement of tolerability and efficacy were also examined. Overall, 754 patients received rasagiline during the study. Patients treated with rasagiline (monotherapy or combination therapy) showed significant improvements from baseline in symptom severity (including classical motor and non-classical motor/non-motor symptoms) and quality of life (QoL). Patients receiving combination therapy also experienced significant reductions in daily OFF time. Tolerability was rated as good/very good in over 90% of patients. In daily clinical practice, monotherapy or combination therapy with rasagiline is able to improve PD symptoms, reduce OFF time, and improve QoL, whilst demonstrating favourable tolerability. In addition, rasagiline has a simple dosing schedule of one tablet, once daily, with no titration. These results are consistent with the pivotal rasagiline clinical studies (TEMPO, LARGO and PRESTO).

  5. Multiple disease resistance to fungal and oomycete pathogens using a recombinant inbred line population in pepper

    Science.gov (United States)

    Incorporating disease resistance into cultivars is a primary focus of modern breeding programs. Resistance to pathogens is often introgressed from landrace or wild individuals with poor fruit quality into commercial-quality cultivars. Sites of multiple disease resistance (MDR) are regions or “hotspo...

  6. Derivation of chicken induced pluripotent stem cells tolerant to Newcastle disease virus-induced lysis through multiple rounds of infection

    Science.gov (United States)

    Background: Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a devastating disease of poultry and wild birds. ND is prevented by rigorous biocontainment and vaccination. One potential approach to prevent spread of the virus is production of birds that show innate resistance to NDV...

  7. Plant-based vaccines for oral delivery of type 1 diabetes-related autoantigens: Evaluating oral tolerance mechanisms and disease prevention in NOD mice.

    Science.gov (United States)

    Posgai, Amanda L; Wasserfall, Clive H; Kwon, Kwang-Chul; Daniell, Henry; Schatz, Desmond A; Atkinson, Mark A

    2017-02-13

    Autoantigen-specific immunological tolerance represents a central objective for prevention of type 1 diabetes (T1D). Previous studies demonstrated mucosal antigen administration results in expansion of Foxp3 + and LAP + regulatory T cells (Tregs), suggesting oral delivery of self-antigens might represent an effective means for modulating autoimmune disease. Early preclinical experiments using the non-obese diabetic (NOD) mouse model reported mucosal administration of T1D-related autoantigens [proinsulin or glutamic acid decarboxylase 65 (GAD)] delayed T1D onset, but published data are conflicting regarding dose, treatment duration, requirement for combinatorial agents, and extent of efficacy. Recently, dogma was challenged in a report demonstrating oral insulin does not prevent T1D in NOD mice, possibly due to antigen digestion prior to mucosal immune exposure. We used transplastomic plants expressing proinsulin and GAD to protect the autoantigens from degradation in an oral vaccine and tested the optimal combination, dose, and treatment duration for the prevention of T1D in NOD mice. Our data suggest oral autoantigen therapy alone does not effectively influence disease incidence or result in antigen-specific tolerance assessed by IL-10 measurement and Treg frequency. A more aggressive approach involving tolerogenic cytokine administration and/or lymphocyte depletion prior to oral antigen-specific immunotherapy will likely be required to impart durable therapeutic efficacy.

  8. Evaluation of hydric deficit -tolerant promising bean (Phaseolus vulgaris l. linesEvaluation of hydric deficit -tolerant promising bean (Phaseolus vulgaris l. lines/ Avaliação de linhagens promissoras de feijoeiro (Phaseolus vulgaris L. tolerantes ao déficit hídrico

    Directory of Open Access Journals (Sweden)

    Luiz Henrique Ilkiu Vidal

    2008-08-01

    Full Text Available The aim of this study was to evaluate the reaction to hydric deficit of five bean genotypes of the black commercial group and five bean genotypes of the Carioca commercial group. Two experiments had been carried out in Londrina (PR in 2002/2003 wet season. The hydric deficit was obtained during twenty days in the beginning of blooming phase. Mobile shelters constructed in iron had been used and covered with transparent roofing tiles to prevent the rain. During the period of hydric deficit, the soil humidity was determined in both treatments. In the phase of physiological maturation 10 plants of each subparcel were evaluated for number of knot, plant height, number of pods per plant, number of seeds per pod, 100 seed weight, plant yield and total yield. The estimates of the coefficients of genetic variation, coefficient of genotypic determination and B index indicated high genetic variability between the genotypes. The estimates of the coefficients of phenotypic correlation showed the presence of correlated characters indicating the possibility of doing simultaneous election between them. Based on the index of yield reduction and on the total yield of grains without hydric stress (kg /ha genotype LP 99-85 of the black group and genotype LP 99-79 of the Carioca group were identified as tolerant to hydric deficit. The line LP99-79 has been registered for cultivation in the SNRC / MAP with the designation of IPR Siriri.O objetivo deste estudo foi avaliar a reação ao déficit hídrico de cinco genótipos de feijoeiro do grupo comercial preto e cinco do grupo comercial carioca. Foram estabelecidos em Londrina (PR, na safra das águas 2002/2003, dois experimentos independentes, um para cada grupo. O déficit hídrico foi imposto durante vinte dias na fase de início de florescimento, por meio de abrigos móveis de ferro, cobertos com telhas transparentes, para proteger da chuva. Durante o período de déficit hídrico, foi determinada a umidade do

  9. Prevalence of endocrine diseases and abnormal glucose tolerance tests in 340 caucasian premenopausal women with hirsutism as the referral diagnosis

    DEFF Research Database (Denmark)

    Glintborg, Dorte; Henriksen, Jan Erik; Andersen, Marianne

    2004-01-01

    with hirsutism as the referral diagnosis. INTERVENTION(S): Hormone analyses and ACTH tests during cycle days 2-8, 2 hours of oral glucose tolerance test (OGTT), and vaginal ultrasound. MAIN OUTCOME MEASURE(S): End diagnosis, fasting, 30-, 60-, and 120-minute oral glucose-stimulated levels of insulin....... During OGTT, 4.9% (13 of 263) had previously undiagnosed diabetes; no significant difference in diabetes prevalence was found between idiopathic hirsutism and PCOS. For 50.8%, fasting insulin values were in the upper quartile for a reference population. CONCLUSION(S): Initial evaluation of hirsute...

  10. Generation of a human induced pluripotent stem cell line (CSC-42 from a patient with sporadic form of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Ekaterina Savchenko

    2018-03-01

    Full Text Available Skin fibroblasts were collected from a 44-year-old patient with sporadic case of Parkinson's disease (PD. The non-integrating Sendai virus vector encoding OCT3/4, SOX2, c-MYC and KLF4 was used to reprogram fibroblasts into induced pluripotent stem cells (iPSCs. Generated iPSCs had normal karyotypes, expressed common stem cell markers, and were capable of differentiating into all three germ layers. Generated line could be used for PD modeling to understand the mechanisms that influence the disorder.

  11. Optimal surface segmentation using flow lines to quantify airway abnormalities in chronic obstructive pulmonary disease

    DEFF Research Database (Denmark)

    Petersen, Jens; Nielsen, Mads; Lo, Pechin Chien Pau

    2014-01-01

    are not well suited for surfaces with high curvature, we therefore propose to derive columns from properly generated, non-intersecting flow lines. This guarantees solutions that do not self-intersect. The method is applied to segment human airway walls in computed tomography images in three-dimensions. Phantom.......5%, the alternative approach in 11.2%, and in 20.3% no method was favoured. Airway abnormality measurements obtained with the method on 490 scan pairs from a lung cancer screening trial correlate significantly with lung function and are reproducible; repeat scan R(2) of measures of the airway lumen diameter and wall...

  12. Engineering Enhanced Vaccine Cell Lines To Eradicate Vaccine-Preventable Diseases: the Polio End Game

    NARCIS (Netherlands)

    van der Sanden, Sabine M. G.; Wu, Weilin; Dybdahl-Sissoko, Naomi; Weldon, William C.; Brooks, Paula; O'Donnell, Jason; Jones, Les P.; Brown, Cedric; Tompkins, S. Mark; Oberste, M. Steven; Karpilow, Jon; Tripp, Ralph A.

    2016-01-01

    Vaccine manufacturing costs prevent a significant portion of the world's population from accessing protection from vaccine-preventable diseases. To enhance vaccine production at reduced costs, a genome-wide RNA interference (RNAi) screen was performed to identify gene knockdown events that enhanced

  13. A thin line between Meniere’s disease and spontaneous intracranial hypotension syndrome

    Directory of Open Access Journals (Sweden)

    Iva Botica

    2016-02-01

    Full Text Available Aim To point out the similarity of Meniere disease and spontaneous intracranial hypotension and difference of their treatment. Methods A case of a 54-year-old male patient with previously diagnosed Meniere’s disease and newly diagnosed spontaneous intracranial hypotension syndrome is presented. Additional neuroradiological examination, Brain contrast-enhanced MRI and MR myelography were used for diagnosis. Results Due to deterioration of vertigo, hearing loss and tinnitus in the right ear the patient was referred to the additional neuroradiological examination which confirmed the diagnosis of spontaneous intracranial hypotension syndrome. Brain contrast-enhanced MRI showed increased pachymeningeal contrast enhancement, and MR myelography identified the location of CSF leak. The patient was successfully treated conservatively. Conclusion According to our knowledge this is the fifth case report of Meniere’s disease and spontaneous intracranial hypotension coexistence. Both diseases have similar clinical presentation and initial treatment. We suggest procedures of additional examination when the treatment fails and initial diagnosis becomes questionable.

  14. The straight line hypothesis elaborated: case reference obesity, an argument for acidosis, oxidative stress, and disease conglomeration?

    Science.gov (United States)

    Berkemeyer, Shoma

    2010-07-01

    Studies report on the association between obesity and oxidative stress, with and without additional diseases. Macrophages in adipocytes, and hypoxia in adipose tissue have been suggested to explain how obesity can relate to oxidative stress. The straight line hypothesis using the lactic acid trap construct has been put forward to explain how proton imbalance can relate to obesity. Proton imbalance has been also reported to associate with the production of reactive oxygen species by inhibition of mitochondrial energy production. This review brings together existing literature and concepts to explain how obesity can relate to oxidative stress via protons, uniquely for itself or, as often observed, in conglomeration of additional diseases. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Evaluation on reaction of late maturing maize hybrids and lines to Fusarium ear rot.

    Directory of Open Access Journals (Sweden)

    M. Haddadi

    2015-03-01

    Full Text Available Abstract. In order to evaluate and determine resistance rates of different corn genotypes to Fusarium ear rot, 22 inbred lines and 19 late and medium maturity hybrids in 2009 and 17 inbred lines and 14 late and medium maturity hybrids were planted in Qarakheil Agricultural Research Station in 2010. Each line and hybrid were planted separately. For each experiment a randomized complete block design with three replications was used. Plant ears were inoculated by Nail th Punch method at the 10 day after anthesis. When the disease symptoms were observed, evaluation of each line and genotype was done based on percentage and severity of the disease symptom. The result in 2009 showed that 14 hybrids were tolerant. Hybrids of K3640/3 X MO17, K166B X K18, K166B X K19/1 and K3547/4 X MO17 were resistant. One hybrid was susceptible. Pure lines of K18 and K LM77007/7-2-6-3-1-2-1 were resistant. 14 tolerance lines and 6 susceptible lines were shown. In 2010 hybrids of K166B X K18 and K3653/2 X K18 were resistant. The other hybrids were tolerant. Pure lines of K3547/3 and K18 were resistant. Five tolerance lines were also shown.

  16. Use of culture filtrates of Ceratocystis ulmi as a bioassay to screen for disease tolerant Ulmus americana

    Science.gov (United States)

    Paula M. Pijut; Subash C. Domir; R. Daniel Lineberger; Lawrence R. Schreiber

    1990-01-01

    Callus cultures of elm (Ulmus americana L.) derived from Dutch elm disease susceptible, intermediate-resistant, and resistant genotypes were exposed to the culture filtrates of three pathogenic isolates of Ceratocystis ulmi, the causal agent of Dutch elm disease. Callus fresh weights, cell viability, and reactions of stem cuttings...

  17. Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species

    Science.gov (United States)

    To Identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode and fungal disease resistance traits, a series of interspecific cotton (Gossypium spp.) chromosome substitution (CS) lines were used in this study. The CS lines were developed in ...

  18. Om tolerance

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    2007-01-01

    Begrebet tolerance og dets betydninger diskuteres med henblik på en tydeliggørelse af begrebets forbindelse med stat, religion, ytringsfrihed, skeptisk erkendelsesteori, antropologi og pædagogik.......Begrebet tolerance og dets betydninger diskuteres med henblik på en tydeliggørelse af begrebets forbindelse med stat, religion, ytringsfrihed, skeptisk erkendelsesteori, antropologi og pædagogik....

  19. Tolerability and safety of Souvenaid in patients with mild Alzheimer's disease: results of multi-center, 24-week, open-label extension study.

    Science.gov (United States)

    Olde Rikkert, Marcel G M; Verhey, Frans R; Blesa, Rafael; von Arnim, Christine A F; Bongers, Anke; Harrison, John; Sijben, John; Scarpini, Elio; Vandewoude, Maurits F J; Vellas, Bruno; Witkamp, Renger; Kamphuis, Patrick J G H; Scheltens, Philip

    2015-01-01

    The medical food Souvenaid, containing the specific nutrient combination Fortasyn Connect, is designed to improve synapse formation and function in patients with Alzheimer's disease (AD). Two double-blind randomized controlled trials (RCT) with Souvenaid of 12 and 24 week duration (Souvenir I and Souvenir II) showed that memory performance was improved in drug-naïve mild AD patients, whereas no effects on cognition were observed in a 24-week RCT (S-Connect) in mild to moderate AD patients using AD medication. Souvenaid was well-tolerated in all RCTs. In this 24-week open-label extension (OLE) study to the 24-week Souvenir II RCT, long-term safety and intake adherence of the medical food Souvenaid was evaluated. Patients with mild AD (n = 201) received Souvenaid once-daily during the OLE. Main outcome parameters were safety and product intake adherence. The memory domain z-score from a revised neuropsychological test battery was continued as exploratory parameter. Compared to the RCT, a similar (low) incidence and type of adverse events was observed, being mainly (68.3%) of mild intensity. Pooled data (RCT and OLE) showed that 48-week use of Souvenaid was well tolerated with high intake adherence (96.1%). Furthermore, a significant increase in the exploratory memory outcome was observed in both the active-active and control-active groups during Souvenaid intervention. Souvenaid use for up to 48-weeks was well tolerated with a favorable safety profile and high intake adherence. The findings in this OLE study warrant further investigation toward the long-term safety and efficacy of Souvenaid in a well-controlled, double-blind RCT.

  20. Two avirulent, lentogenic strains of Newcastle disease virus are cytotoxic for some human pancreatic tumor lines in vitro.

    Science.gov (United States)

    Walter, Robert J; Attar, Bashar M; Rafiq, Asad; Delimata, Megan; Tejaswi, Sooraj

    2012-09-10

    Pancreatic cancer is the fourth leading cause of cancer death in the U.S. Highly infectious Newcastle disease virus (NDV) strains are known to be very cytotoxic for an array of human tumor cell types in vitro and in vivo but the effects of these and avirulent NDV strains on pancreatic neoplasms are little known. Here, the direct cytolytic effects of the avirulent Hitchner-B1 (B1) and Ulster (U) NDV strains on 7 human pancreatic tumor cell lines and 4 normal human cell lines were studied. Cytotoxicity assays used serially diluted NDV to determine minimum cytotoxic plaque forming unit (PFU) doses. For NDV-B1, normal human cells were killed only by relatively high doses (range: 471-3,724 PFU) whereas NDV-U killed these cells at low PFU (range: 0.32-1.60 PFU). Most pancreatic cancer cell types were killed by much lower NDV-B1 doses (range: 0.40-2.60 PFU) while NDV-U killed Capan-1 and SU.86.86 cultures at very low doses (0.00041 PFU and 0.0034 PFU, respectively). On average, 1,555 times more NDV-B1 was needed to kill normal cells than most pancreatic tumor cells and 558 times more NDV-U to kill the two most sensitive pancreatic cancer lines. These innately-targeted lentogenic viruses may have meaningful potential in treating pancreatic cancer.

  1. Accelerated Senescence and Enhanced Disease Resistance in Hybrid Chlorosis Lines Derived from Interspecific Crosses between Tetraploid Wheat and Aegilops tauschii

    Science.gov (United States)

    Tosa, Yukio; Yoshida, Kentaro; Park, Pyoyun; Takumi, Shigeo

    2015-01-01

    Hybrid chlorosis, a type of hybrid incompatibility, has frequently been reported in inter- and intraspecific crosses of allopolyploid wheat. In a previous study, we reported some types of growth abnormalities such as hybrid necrosis and observed hybrid chlorosis with mild or severe abnormalities in wheat triploids obtained in crosses between tetraploid wheat cultivar Langdon and four Ae. tauschii accessions and in their derived synthetic hexaploids. However, the molecular mechanisms underlying hybrid chlorosis are not well understood. Here, we compared cytology and gene expression in leaves to characterize the abnormal growth in wheat synthetics showing mild and severe chlorosis. In addition, we compared disease resistance to wheat blast fungus. In total 55 and 105 genes related to carbohydrate metabolism and 53 and 89 genes for defense responses were markedly up-regulated in the mild and severe chlorosis lines, respectively. Abnormal chloroplasts formed in the mesophyll cells before the leaves yellowed in the hybrid chlorosis lines. The plants with mild chlorosis showed increased resistance to wheat blast and powdery mildew fungi, although significant differences only in two, third internode length and maturation time, out of the examined agricultural traits were found between the wild type and plants showing mild chlorosis. These observations suggest that senescence might be accelerated in hybrid chlorosis lines of wheat synthetics. Moreover, in wheat synthetics showing mild chlorosis, the negative effects on biomass can be minimized, and they may show substantial fitness under pathogen-polluted conditions. PMID:25806790

  2. Accelerated senescence and enhanced disease resistance in hybrid chlorosis lines derived from interspecific crosses between tetraploid wheat and Aegilops tauschii.

    Directory of Open Access Journals (Sweden)

    Hiroki Nakano

    Full Text Available Hybrid chlorosis, a type of hybrid incompatibility, has frequently been reported in inter- and intraspecific crosses of allopolyploid wheat. In a previous study, we reported some types of growth abnormalities such as hybrid necrosis and observed hybrid chlorosis with mild or severe abnormalities in wheat triploids obtained in crosses between tetraploid wheat cultivar Langdon and four Ae. tauschii accessions and in their derived synthetic hexaploids. However, the molecular mechanisms underlying hybrid chlorosis are not well understood. Here, we compared cytology and gene expression in leaves to characterize the abnormal growth in wheat synthetics showing mild and severe chlorosis. In addition, we compared disease resistance to wheat blast fungus. In total 55 and 105 genes related to carbohydrate metabolism and 53 and 89 genes for defense responses were markedly up-regulated in the mild and severe chlorosis lines, respectively. Abnormal chloroplasts formed in the mesophyll cells before the leaves yellowed in the hybrid chlorosis lines. The plants with mild chlorosis showed increased resistance to wheat blast and powdery mildew fungi, although significant differences only in two, third internode length and maturation time, out of the examined agricultural traits were found between the wild type and plants showing mild chlorosis. These observations suggest that senescence might be accelerated in hybrid chlorosis lines of wheat synthetics. Moreover, in wheat synthetics showing mild chlorosis, the negative effects on biomass can be minimized, and they may show substantial fitness under pathogen-polluted conditions.

  3. Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

    Directory of Open Access Journals (Sweden)

    Yuan-xing Gu

    2014-01-01

    Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

  4. EFFECTIVENESS OF INTERVAL EXERCISE VERSUS CONTINUOUS EXERCISE TO IMPROVE EXERCISE TOLERANCE IN CHRONIC OBSTRUCTIVE PULMONARY DISEASE SUBJECTS

    Directory of Open Access Journals (Sweden)

    G. Swathi

    2015-12-01

    Full Text Available Background: COPD is characterized by chronic airflow limitation and a range of pathological changes in the lung. Chronic inflammation causes structural changes and narrowing of the small airways and destruction of lung parenchyma, leads to the loss of alveolar attachments to the small airways and decreases lung elastic recoil; in turn these changes diminish the expiration and the work of breathing is increased. Scarcity of evidence on continuous and interval exercises is forcing researchers conduct studies on effectiveness of interval exercise with continuous exercise on exercise tolerance in subjects with COPD. Methods: 60 subjects were selected by lottery method. All the subjects were explained about the condition and mode of assessment and written informed consent were obtained from them and divided into 2 groups interval training group and continuous exercise training group and subjects were scheduled to attend exercise session 5 days a week for 4 weeks with exercise duration 20 min’s with cycle ergometer. Outcome measure: six minute walk test and heart rate. Results: On observing the means of post test parameters of experimental group A and experimental group B Independent t-test was done and the P- value is >0.05 .It shows a no significant difference between the two groups. Conclusion: The results had shown that both interval exercise group and continuous exercise group who received four weeks of therapy has improved significantly on pre and post test values within the groups but when compared between these groups there is no statistical significance noted. So this study concluded that there is no significant difference between interval exercise group and continuous exercise group in improving exercise tolerance among COPD subjects.

  5. Target virus log10 reduction values determined for two reclaimed wastewater irrigation scenarios in Japan based on tolerable annual disease burden.

    Science.gov (United States)

    Ito, Toshihiro; Kitajima, Masaaki; Kato, Tsuyoshi; Ishii, Satoshi; Segawa, Takahiro; Okabe, Satoshi; Sano, Daisuke

    2017-11-15

    Multiple-barriers are widely employed for managing microbial risks in water reuse, in which different types of wastewater treatment units (biological treatment, disinfection, etc.) and health protection measures (use of personal protective gear, vegetable washing, etc.) are combined to achieve a performance target value of log 10 reduction (LR) of viruses. The LR virus target value needs to be calculated based on the data obtained from monitoring the viruses of concern and the water reuse scheme in the context of the countries/regions where water reuse is implemented. In this study, we calculated the virus LR target values under two exposure scenarios for reclaimed wastewater irrigation in Japan, using the concentrations of indigenous viruses in untreated wastewater and a defined tolerable annual disease burden (10 -4 or 10 -6 disability-adjusted life years per person per year (DALY pppy )). Three genogroups of norovirus (norovirus genogroup I (NoV GI), geogroup II (NoV GII), and genogroup IV (NoV GIV)) in untreated wastewater were quantified as model viruses using reverse transcription-microfluidic quantitative PCR, and only NoV GII was present in quantifiable concentration. The probabilistic distribution of NoV GII concentration in untreated wastewater was then estimated from its concentration dataset, and used to calculate the LR target values of NoV GII for wastewater treatment. When an accidental ingestion of reclaimed wastewater by Japanese farmers was assumed, the NoV GII LR target values corresponding to the tolerable annual disease burden of 10 -6 DALY pppy were 3.2, 4.4, and 5.7 at 95, 99, and 99.9%tile, respectively. These percentile values, defined as "reliability," represent the cumulative probability of NoV GII concentration distribution in untreated wastewater below the corresponding tolerable annual disease burden after wastewater reclamation. An approximate 1-log 10 difference of LR target values was observed between 10 -4 and 10 -6 DALY pppy

  6. Evaluating the Production of Doubled Haploid Wheat Lines Using Various Methods of Wheat and Maize Crossing to Develop Heat-Tolerant Wheat Varieties

    Directory of Open Access Journals (Sweden)

    Tayebeh BAKHSHI

    2017-02-01

    Full Text Available Abstract. In this study, chromosome elimination method was used to develop doubled haploid wheat lines via crosses with maize. The plant materials used included 11, F1 wheat genotypes and maize genotype BC572. In these crosses, the maize plant was used as the male parent.Three methods of haploid production in wheat comprising conventional (A, detached-tiller culture (B and intermediate (C techniques were used and compared. The traits such as the number of seeds set, the number of embryos obtained and the number of haploid seedlings produced were studied. Comparisons showed that among various methods of storing wheat spikes, method (C was better than other techniques in terms of the percentage of seed production, embryo formation and haploid seedling production. Also, in all three methods, the percentage of seed production, the percentage of embryo formation and the percentage of haploid seedling production were respectively equal to 76.84, 25.22 and 51.89. Among the wheat genotypes in all three methods, genotype DH-133 with 87.28 percent seed set and genotype DH-132 with 32.71 percent embryo formation and 65.08 percent haploid seedling production were the best genotypes. A total of 92 doubled haploid lines were produced. In the field evaluations of 86 doubled haploid lines, traits such as growing season, plant height, lodging, kernel yield and 1000 kernel weight were examined. Finally, 3 lines were selected for adaptation and stability testing under heat stress conditions.Keywords: Wheat, Doubled haploid, Chromosome elimination, Detached-tiller culture Özet. Bu çalışmada, mısır ile çaprazlarla çift katlı haploid buğday hatlarının geliştirilmesi için kromozom eliminasyon yöntemi kullanılmıştır. Kullanılan bitki materyalleri 11, F1 buğday genotipleri ve BC572 mısır genotipini içermektedir. Bu çaprazlarda, mısır bitkisi erkek ebeveyn olarak kullanılmıştır. Geleneksel (A, ayrık-yeke kültürü (B ve ara (C

  7. Insulin hypersecretion together with high luteinizing hormone concentration augments androgen secretion in oral glucose tolerance test in women with polycystic ovarian disease.

    Science.gov (United States)

    Anttila, L; Koskinen, P; Jaatinen, T A; Erkkola, R; Irjala, K; Ruutiainen, K

    1993-08-01

    Female hyperandrogenism is often associated with hyperinsulinaemia and insulin resistance. We evaluated the hormone responses in an oral glucose tolerance test to investigate the interactions of gonadotrophins, insulin, C-peptide and androgens in women with polycystic ovarian disease (PCOD). In 28 patients with ultrasonographically diagnosed PCOD, hyperinsulinaemia and insulin resistance were mainly associated with obesity. Both basal and cumulative sum of insulin to C-peptide ratios were high in obese subjects, suggesting decreasing hepatic removal of insulin caused by obesity. Nevertheless, in some lean PCOD women, despite normal fasting insulin concentrations, insulin hypersecretion existed. The mean concentration of testosterone decreased significantly during the oral glucose tolerance test both in PCOD and control women, and of androstenedione in the PCOD patients only. However, an increase in androgen responses was found in a subgroup of PCOD patients, who had both elevated luteinizing hormone (LH) concentrations and hyperinsulinaemic response to oral glucose. In the remaining PCOD patients an inverse correlation between LH and insulin was found. The patients with hyperinsulinaemia together with LH hypersecretion may represent a subgroup of PCOD with deranged regulation of androgen secretion.

  8. Postchallenge responses of nitrotyrosine and TNF-alpha during 75-g oral glucose tolerance test are associated with the presence of coronary artery diseases in patients with prediabetes

    Directory of Open Access Journals (Sweden)

    Chu Chih-Sheng

    2012-03-01

    Full Text Available Abstract Background Meta-analysis has demonstrated an exponential relationship between 2-hr postchallenge hyperglycemia and coronary artery disease (CAD. Pulsatile hyperglycemia can acutely increase proinflammatory cytokines by oxidative stress. We hypothesized that postchallenge proinflammatory and nitrosative responses after 75 g oral glucose tolerance tests (75 g-OGTT might be associated with CAD in patients without previously recognized type 2 diabetes mellitus (T2DM. Methods Serial changes of plasma glucose (PG, tumor necrosis factor-alpha (TNF-α, interleukin-6 (IL-6 and nitrotyrosine levels were analyzed during 75 g-OGTT in 120 patients (81 male; age 62 ± 11 years before coronary angiography. Patients were classified as normal (NGT; 42%, impaired (IGT; 34% and diabetic (T2DM; 24% glucose tolerance by 75 g-OGTT. Results Postchallenge hyperglycemia elicited TNF-α, IL-6 and nitrotyrosine levels time-dependently, and 2-hr median levels of TNF-α (7.1 versus 6.4 pg/ml; P μmol/l; P P Conclusions These results highlight postchallenge proinflammatory and nitrosative responses by 75 g-OGTT, rather than hyperglycemia per se, are associated with CAD in patients without previous recognized diabetes.

  9. Heterogeneity of high-density lipoprotein particles and insulin output during oral glucose tolerance test in men with coronary artery disease.

    Science.gov (United States)

    Iwanejko, J; Kwaśniak, M; Wybrańska, I; Hartwich, J; Guevara, I; Zdzienicka, A; Kruszelnicka-Kwiatkowska, O; Piwowarska, W; Miszczuk-Jamska, B; Dembińska-Kieć, A

    1996-03-01

    We compared the high-density lipoprotein (HDL) composition and particle heterogeneity in 60 nonobese (normal body mass index, BMI) men suffering from coronary artery disease (CAD) with normolipemia and normoinsulinemia with lower and higher insulin output during the oral glucose tolerance test (silent hyperinsulinemia). The apolipoprotein apoAI, apoAII, and apoE levels were higher in the high insulin response (HI) group than in low insulin response (LI) group. The ratio of apoAI versus total protein and the ratio of apoAI versus total cholesterol were increased in HI compared with LI. The lipid components in HDL were higher in LI than in HI, while for HDL2 they were higher in HI. The fractioning of HDL by gradient gel electrophoresis revealed a different pattern of HDL particles in both groups. The larger particles, HDL2b and HDL2a (mean particle diameters 10.6 and 9.2 nm, respectively), occur more frequently in HI patients (up to 60%) than in LI patients, whereas the smaller particles, HDL3a and HDL3b (mean particle diameters 8.6 and 7.8 nm, respectively), predominate in LI patients. Our results demonstrate that even in the normoglycemic, normocholesterolemic CAD patients, a high insulin output observed during the oral glucose tolerance test may be connected with a different HDL particle pattern, which suggests changes in the reverse cholesterol transport.

  10. SH-SY5Y human neuroblastoma cell line: in vitro cell model of dopaminergic neurons in Parkinson's disease.

    Science.gov (United States)

    Xie, Hong-rong; Hu, Lin-sen; Li, Guo-yi

    2010-04-20

    To evaluate the human neuroblastoma SH-SY5Y cell line as an in vitro model of dopaminergic (DAergic) neurons for Parkinson's disease (PD) research and to determine the effect of differentiation on this cell model. The data of this review were selected from the original reports and reviews related to SH-SY5Y cells published in Chinese and foreign journals (Pubmed 1973 to 2009). After searching the literature, 60 articles were selected to address this review. The SH-SY5Y cell line has become a popular cell model for PD research because this cell line posses many characteristics of DAergic neurons. For example, these cells express tyrosine hydroxylase and dopamine-beta-hydroxylase, as well as the dopamine transporter. Moreover, this cell line can be differentiated into a functionally mature neuronal phenotype in the presence of various agents. Upon differentiation, SH-SY5Y cells stop proliferating and a constant cell number is subsequently maintained. However, different differentiating agents induce different neuronal phenotypes and biochemical changes. For example, retinoic acid induces differentiation toward a cholinergic neuronal phenotype and increases the susceptibility of SH-SY5Y cells to neurotoxins and neuroprotective agents, whereas treatment with retinoic acid followed by phorbol ester 12-O-tetradecanoylphorbol-13-acetate results in a DAergic neuronal phenotype and decreases the susceptibility of cells to neurotoxins and neuroprotective agents. Some differentiating agents also alter kinetics of 1-methyl-4-phenyl-pyridinium (MPP(+)) uptake, making SH-SY5Y cells more similar to primary mesencephalic neurons. Differentiated and undifferentiated SH-SY5Y cells have been widely used as a cell model of DAergic neurons for PD research. Some differentiating agents afford SH-SY5Y cells with more potential for studying neurotoxicity and neuroprotection and are thus more relevant to experimental PD research.

  11. Should MR imaging be used as the first line of investigation in adult congenital heart disease

    International Nuclear Information System (INIS)

    Sivananthan, M.U. Jr.; Rees, M.R.; Verma, S.P.; Gundroo, G.M.; Ridgway, J.; Bann, K. Jr.

    1991-01-01

    This paper investigates the adequacy of MR imaging in the display of anatomy and flow in adult congenital heart disease. Seventeen adult patients with congenital heart disease were studied with a 1-T Siemens Magnatom imager. Gated spin-echo images in three orthogonal as well as selected oblique planes and gradient cine angiographic images were obtained. The results were compared with the results of echocardiography and conventional angiography. There were 9 patients with coarctation of the aorta, 3 of which were postoperative studies. MR images were adequate in the postoperative cases, and the need for angiography was avoided. Seven additional lesions (2 atrial septal defects (ASD), 2 ventricular septal defects (VSD), and 3 bicuspid aortic valves) were demonstrated that were not demonstrated with echocardiography. Four postoperative Blalock shunts were evaluated, which could not be catheterized with echocardiography (2 occlusions, 2 stenoses), and additional flow and anatomic information of the pulmonary vasculature was obtained. In the other 5 cases, 5 additional lesions were demonstrated compared with echocardiography

  12. Effects of acarbose on cardiovascular and diabetes outcomes in patients with coronary heart disease and impaired glucose tolerance (ACE): a randomised, double-blind, placebo-controlled trial.

    Science.gov (United States)

    Holman, Rury R; Coleman, Ruth L; Chan, Juliana C N; Chiasson, Jean-Louis; Feng, Huimei; Ge, Junbo; Gerstein, Hertzel C; Gray, Richard; Huo, Yong; Lang, Zhihui; McMurray, John J; Rydén, Lars; Schröder, Stefan; Sun, Yihong; Theodorakis, Michael J; Tendera, Michal; Tucker, Lynne; Tuomilehto, Jaakko; Wei, Yidong; Yang, Wenying; Wang, Duolao; Hu, Dayi; Pan, Changyu

    2017-11-01

    The effect of the α-glucosidase inhibitor acarbose on cardiovascular outcomes in patients with coronary heart disease and impaired glucose tolerance is unknown. We aimed to assess whether acarbose could reduce the frequency of cardiovascular events in Chinese patients with established coronary heart disease and impaired glucose tolerance, and whether the incidence of type 2 diabetes could be reduced. The Acarbose Cardiovascular Evaluation (ACE) trial was a randomised, double-blind, placebo-controlled, phase 4 trial, with patients recruited from 176 hospital outpatient clinics in China. Chinese patients with coronary heart disease and impaired glucose tolerance were randomly assigned (1:1), in blocks by site, by a centralised computer system to receive oral acarbose (50 mg three times a day) or matched placebo, which was added to standardised cardiovascular secondary prevention therapy. All study staff and patients were masked to treatment group allocation. The primary outcome was a five-point composite of cardiovascular death, non-fatal myocardial infarction, non-fatal stroke, hospital admission for unstable angina, and hospital admission for heart failure, analysed in the intention-to-treat population (all participants randomly assigned to treatment who provided written informed consent). The secondary outcomes were a three-point composite outcome (cardiovascular death, non-fatal myocardial infarction, and non-fatal stroke), death from any cause, cardiovascular death, fatal or non-fatal myocardial infarction, fatal or non-fatal stroke, hospital admission for unstable angina, hospital admission for heart failure, development of diabetes, and development of impaired renal function. The safety population comprised all patients who received at least one dose of study medication. This trial is registered with ClinicalTrials.gov, number NCT00829660, and the International Standard Randomised Controlled Trial Number registry, number ISRCTN91899513. Between March 20, 2009

  13. Fecundity compensation and tolerance to a sterilizing pathogen in Daphnia.

    Science.gov (United States)

    Vale, P F; Little, T J

    2012-09-01

    Hosts are armed with several lines of defence in the battle against parasites: they may prevent the establishment of infection, reduce parasite growth once infected or persevere through mechanisms that reduce the damage caused by infection, called tolerance. Studies on tolerance in animals have focused on mortality, and sterility tolerance has not been investigated experimentally. Here, we tested for genetic variation in the multiple steps of defence when the invertebrate Daphnia magna is infected with the sterilizing bacterial pathogen Pasteuria ramosa: anti-infection resistance, anti-growth resistance and the ability to tolerate sterilization once infected. When exposed to nine doses of a genetically diverse pathogen inoculum, six host genotypes varied in their average susceptibility to infection and in their parasite loads once infected. How host fecundity changed with increasing parasite loads did not vary between genotypes, indicating that there was no genetic variation for this measure of fecundity tolerance. However, genotypes differed in their level of fecundity compensation under infection, and we discuss how, by increasing host fitness without targeting parasite densities, fecundity compensation is consistent with the functional definition of tolerance. Such infection-induced life-history shifts are not traditionally considered to be part of the immune response, but may crucially reduce harm (in terms of fitness loss) caused by disease, and are a distinct source of selection on pathogens. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  14. Diallel crosses among maize lines with emphasis on resistance to foliar diseases

    Directory of Open Access Journals (Sweden)

    Maria Elisa Ayres Guidetti Zagatto Paterniani

    2000-06-01

    Full Text Available Ten elite maize (Zea mays L. lines were crossed in a complete diallel scheme and the single-cross hybrids obtained were assessed at four experimental stations of the Agronomic Institute of Campinas, in São Paulo State, Brazil. The experiments were set up in a randomized complete block design with three replications, including four commercial checks. The experimental plots consisted of two 5-m rows spaced at 0.9 m, with a total of 50 plants. The traits assessed included: days to mid-tassel pollen shed (DPS, plant height (PH, ear height (EH, grain yield, corrected for a 50-plant stand and 14% moisture (GY corr., and resistance to Phaeosphaeria maydis and Puccinia polysora. General and specific combining ability effects (GCA and SCA were determined. There was extensive genetic variability among hybrids with the best hybrids (HS 04 x 10 and HS 10 x 11 not differing from the commercial checks. The lines with the greatest potential for hybrid synthesis included: L 10, L 11 and L 13, because they had higher GCA for yield, moderate resistance to P. maydis and reduced EH. The greatest contribution to reduction of the Phaeosphaeria stain was obtained with L 5. The magnitude of the GCA relative to the total variation indicated that additive effects predominated for resistance to P. maydis and P. polysora. Significant SCA (P Cruzaram-se dez linhagens-elite de milho em esquema dialélico completo e os híbridos simples obtidos foram avaliados em quatro Núcleos Experimentais do Instituto Agronômico de Campinas, SP, Brasil. Os ensaios foram instalados sob delineamento de blocos casualizados com três repetições, incluindo quatro testemunhas comerciais. As parcelas consistiram em duas linhas de 5 m espaçadas por 0,90 m, contendo 50 plantas. Avaliaram-se os caracteres: dias para o florescimento masculino (DPS, altura da planta (PH e da espiga (EH, produtividade de grãos corrigida para estande ideal de 50 plantas e 14% de umidade (GY corr. e resistência a

  15. Trace metals in fluids lining the respiratory system of patients with idiopathic pulmonary fibrosis and diffuse lung diseases.

    Science.gov (United States)

    Bargagli, Elena; Lavorini, Federico; Pistolesi, Massimo; Rosi, Elisabetta; Prasse, Antje; Rota, Emilia; Voltolini, Luca

    2017-07-01

    Idiopathic pulmonary fibrosis (IPF) is an interstitial lung disease with a poor prognosis and an undefined etiopathogenesis. Oxidative stress contributes to alveolar injury and fibrosis development and, because transition metals are essential to the functioning of most proteins involved in redox reactions, a better knowledge of metal concentrations and metabolism in the respiratory system of IPF patients may provide a valuable complementary approach to prevent and manage a disease which is often misdiagnosed or diagnosed in later stages. The present review summarizes and discusses literature data on the elemental composition of bronchoalveolar lavage (BAL), induced sputum and exhaled breath condensate (EBC) from patients affected by IPF and healthy subjects. Available data are scanty and the lack of consistent methods for the collection and analysis of lung and airways lining fluids makes it difficult to compare the results of different studies. However, the elemental composition of BAL samples from IPF patients seems to have a specific profile that can be distinguished from that of patients with other interstitial lung diseases (ILD) or control subjects. Suggestions are given towards standard sampling and analytical procedures of BAL samples, in the aim to assess typical element concentration patterns and their potential role as biomarkers of IPF. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Comparative performance of fetal goat tongue cell line ZZ-R 127 and fetal porcine kidney cell line LFBK-αvβ6 for Foot-and-mouth disease virus isolation.

    Science.gov (United States)

    Fukai, Katsuhiko; Morioka, Kazuki; Yamada, Manabu; Nishi, Tatsuya; Yoshida, Kazuo; Kitano, Rie; Yamazoe, Reiko; Kanno, Toru

    2015-07-01

    The fetal goat tongue cell line ZZ-R 127 and the fetal porcine kidney cell line LFBK-α(v)β(6) have been reported to have high sensitivity to various Foot-and-mouth disease virus (FMDV) strains. The suitability of ZZ-R 127 cells for FMDV isolation not only from epithelial suspensions but also from other clinical samples has already been confirmed in a previous study. However, to our knowledge, the suitability of LFBK-α(v)β(6) cells has not been evaluated using clinical samples other than epithelial materials. In addition, both cell lines have never been compared, in terms of use for FMDV isolation, under the same conditions. Therefore, in the current study, the virus isolation rates of both cell lines were compared using clinical samples collected from animals infected experimentally with FMDV. Viruses were successfully isolated from clinical samples other than epithelial suspensions for both cell lines. The virus isolation rates for the 2 cell lines were not significantly different. The Cohen kappa coefficients between the virus isolation results for both cell lines were significantly high. Taken together, these results confirmed the suitability of LFBK-α(v)β(6) cells for FMDV isolation from clinical samples other than epithelial suspensions. The levels of susceptibility of both cell lines to FMDV isolation were also confirmed to be almost the same. © 2015 The Author(s).

  17. Evaluation of drought tolerance in different growth stages of maize ...

    African Journals Online (AJOL)

    Jane

    2011-10-12

    Oct 12, 2011 ... index; STI: stress tolerance index. condition. MO17 was a tolerant inbred line based on TOL and its low quantity indicates tolerant inbred lines (Table 4). MO17 was low yielding under all conditions. It seems that. TOL had succeeded in selecting genotypes with high yield under stress, but had failed to select ...

  18. The SQ House Dust Mite SLIT-Tablet Is Well Tolerated in Patients with House Dust Mite Respiratory Allergic Disease

    DEFF Research Database (Denmark)

    Emminger, Waltraud; Hernández, María Dolores; Cardona, Victòria

    2017-01-01

    BACKGROUND: The SQ house dust mite (HDM) SLIT-tablet (ALK, Denmark) addresses the underlying cause of HDM respiratory allergic disease, and a clinical effect has been demonstrated for both HDM allergic rhinitis and allergic asthma. Here, we present pooled safety data from an adult population with...

  19. Challenge inoculations to test for Dutch elm disease tolerance: a summary of methods used by various researchers

    Science.gov (United States)

    Linda M. Haugen; Garrett L. Beier; Susan E. Bentz; Raymond P. Guries; James M. Slavicek

    2017-01-01

    A variety of methods have been used by different research groups to "challenge" inoculate American elms (Ulmus americana) with the purpose of determining whether some clones may be resistant to the Dutch elm disease fungus. The methods used by seven research groups are described, along with observations on complications and benefits...

  20. Quantitative sensory testing and pain tolerance in patients with mild to moderate Alzheimer disease compared to healthy control subjects

    DEFF Research Database (Denmark)

    Jensen-Dahm, Christina; Werner, Mads U; Dahl, Jørgen B

    2014-01-01

    Patients with Alzheimer disease (AD) report pain less frequently than their cognitively intact peers. It has been hypothesized that pain processing is altered in AD. The aim of this study was to investigate agreement and reliability of 3 pain sensitivity tests and to examine pain threshold...

  1. Challenge inoculations to test for Dutch elm disease tolerance: a summary of Methods used by various researchers

    Science.gov (United States)

    A variety of methods have been used by different research groups to “challenge” inoculate American elms (Ulmus americana) with the purpose of determining whether some clones may be resistant to the Dutch elm disease fungus. The methods used by seven research groups are described, along with observat...

  2. Treatment Paradigms for Retinal and Macular Diseases Using 3-D Retina Cultures Derived From Human Reporter Pluripotent Stem Cell Lines.

    Science.gov (United States)

    Kaewkhaw, Rossukon; Swaroop, Manju; Homma, Kohei; Nakamura, Jutaro; Brooks, Matthew; Kaya, Koray Dogan; Chaitankar, Vijender; Michael, Sam; Tawa, Gregory; Zou, Jizhong; Rao, Mahendra; Zheng, Wei; Cogliati, Tiziana; Swaroop, Anand

    2016-04-01

    We discuss the use of pluripotent stem cell lines carrying fluorescent reporters driven by retinal promoters to derive three-dimensional (3-D) retina in culture and how this system can be exploited for elucidating human retinal biology, creating disease models in a dish, and designing targeted drug screens for retinal and macular degeneration. Furthermore, we realize that stem cell investigations are labor-intensive and require extensive resources. To expedite scientific discovery by sharing of resources and to avoid duplication of efforts, we propose the formation of a Retinal Stem Cell Consortium. In the field of vision, such collaborative approaches have been enormously successful in elucidating genetic susceptibility associated with age-related macular degeneration.

  3. Cost-effectiveness-analysis: radioiodine or antithyroid drugs as first-line therapy of hyperthyroidism due to Graves' disease

    International Nuclear Information System (INIS)

    Dietlein, M.; Moka, D.; Dederichs, B.; Schicha, H.; Hunsche, E.; Lauterbach, K.W.

    1999-01-01

    Aim: As first-line therapy of hyperthyroidism caused by Graves' disease antithyroid drugs are favoured in Europe, while radioiodine therapy is favoured in the USA. Radioiodine therapy has become more economic in Germany since the new recommendations by the Federal German Radiation Protection Committee (SSK) for patient discharge guidelines. Method: Sensitivity analyses took into account the long-term relapse rate of conservative or radioiodine therapy, use of diagnostic tests, level of health insurance, drops in productivity and a discount factor. Costing models included the costs of follow-up care over 30 years. The costs of the hospitalisation for radioiodine therapy were calculated for 300 patients, discharged with 250 MBq I-131 residual activity. Result: Antithyroid drugs were considered cost-effective when they achieved relapse rate of 50% or less, a cut in the number of tests needed and reduced working hours. Failure to meet any one of these conditions makes primary radioiodine therapy more cost-effective in 1593 of 1944 calculated costing models. Repeated conservative therapies will increase clearly the overall costs. Conclusion: Radioiodine is a cost-effective, first-line therapy in patients with a special risk of relapse after primary conservative therapy (goitre, younger patient, persistent elevated TSH-receptor-antibodies or Tc-uptake). (orig.) [de

  4. Effects of Newcastle Disease Virus Strains AF2240 and V4-UPM on Cytolysis and Apoptosis of Leukemia Cell Lines

    Science.gov (United States)

    Alabsi, Aied M.; Bakar, Siti Aishah Abu; Ali, Rola; Omar, Abdul Rahman; Bejo, Mohd Hair; Ideris, Aini; Ali, Abdul Manaf

    2011-01-01

    Newcastle disease virus (NDV) is used as an antineoplastic agent in clinical tumor therapy. It has prompted much interest as an anticancer agent because it can replicate up to 10,000 times better in human cancer cells than in most normal cells. This study was carried out to determine the oncolytic potential of NDV strain AF2240 and V4-UPM on WEHI-3B leukemia cell line. Results from MTT cytotoxicity assay showed that the CD50 values for both strains were 2 and 8 HAU for AF2240 and V4-UPM, respectively. In addition, bromodeoxyuridine (BrdU) and trypan blue dye exclusion assays showed inhibition in cell proliferation after different periods. Increase in the cellular level of caspase-3 and detection of DNA laddering using agarose gel electrophoresis on treated cells with NDV confirmed that the mode of cell death was apoptosis. In addition, flow-cytometry analysis of cellular DNA content showed that the virus caused an increase in the sub-G1 region (apoptosis peaks). In conclusion, NDV strains AF2240 and V4-UPM caused cytolytic effects against WEHI-3B leukemic cell line. PMID:22272097

  5. Combined rasagiline and antidepressant use in Parkinson disease in the ADAGIO study: effects on nonmotor symptoms and tolerability.

    Science.gov (United States)

    Smith, Kara M; Eyal, Eli; Weintraub, Daniel

    2015-01-01

    Depression, cognitive impairment, and other nonmotor symptoms (NMSs) are common early in Parkinson disease (PD) and may be in part due to disease-related dopamine deficiency. Many patients with PD are treated with antidepressants for NMSs, and the effect of the combination of PD medications that enhance dopamine neurotransmission and antidepressants on NMSs has not been studied. We report the effects of the addition of a monoamine oxidase B inhibitor, rasagiline, to antidepressant treatment in PD. To evaluate the effect of rasagiline on depression, cognition, and other PD NMSs in patients taking an antidepressant in the Attenuation of Disease Progression With Azilect Given Once Daily (ADAGIO) study. The ADAGIO study was a double-blind, placebo-controlled, delayed-start trial of rasagiline in de novo PD. In this exploratory post hoc analysis, we analyzed patients taking an antidepressant during the 36-week phase 1 period, in which patients were randomized to rasagiline (1 or 2 mg/d) or placebo. We evaluated the change in NMSs in patients taking an antidepressant and rasagiline compared with those taking placebo. The NMSs were assessed by Movement Disorder Society-sponsored revision of the Unified Parkinson's Disease Rating Scale Nonmotor Experiences of Daily Living, the original Unified Parkinson's Disease Rating Scale, and the Parkinson Fatigue Scale. A total of 191 of the 1174 patients (16.3%) were treated with antidepressants during phase 1 and provided efficacy data. Depression and cognition scores revealed significantly less worsening in the rasagiline group compared with the placebo group (differences in Movement Disorder Society-sponsored revision of the Unified Parkinson's Disease Rating Scale item-adjusted means [SEs], -0.19 [0.10], P = .048, and -0.20 [0.05], P rasagiline group compared with placebo. There was a nonsignificant trend toward less worsening in apathy and no significant between-group differences in anxiety or sleep. The effect on

  6. Towards Tolerance

    NARCIS (Netherlands)

    Lisette Kuyper; Jurjen Iedema; Saskia Keuzenkamp

    2013-01-01

    Across Europe, public attitudes towards lesbian, gay and bisexual (LGB) individuals range from broad tolerance to widespread rejection. Attitudes towards homosexuality are more than mere individual opinions, but form part of the social and political structures which foster or hinder the equality

  7. Intolerant tolerance.

    Science.gov (United States)

    Khushf, G

    1994-04-01

    The Hyde Amendment and Roman Catholic attempts to put restrictions on Title X funding have been criticized for being intolerant. However, such criticism fails to appreciate that there are two competing notions of tolerance, one focusing on the limits of state force and accepting pluralism as unavoidable, and the other focusing on the limits of knowledge and advancing pluralism as a good. These two types of tolerance, illustrated in the writings of John Locke and J.S. Mill, each involve an intolerance. In a pluralistic context where the free exercise of religion is respected, John Locke's account of tolerance is preferable. However, it (in a reconstructed form) leads to a minimal state. Positive entitlements to benefits like artificial contraception or nontherapeutic abortions can legitimately be resisted, because an intolerance has already been shown with respect to those that consider the benefit immoral, since their resources have been coopted by taxation to advance an end that is contrary to their own. There is a sliding scale from tolerance (viewed as forbearance) to the affirmation of communal integrity, and this scale maps on to the continuum from negative to positive rights.

  8. Ethnic differences in cross-sectional associations between impaired glucose regulation, identified by oral glucose tolerance test or HbA1c values, and cardiovascular disease in a cohort of European and South Asian origin.

    Science.gov (United States)

    Eastwood, S V; Tillin, T; Mayet, J; Shibata, D K; Wright, A; Heasman, J; Beauchamp, N; Forouhi, N G; Hughes, A D; Chaturvedi, N

    2016-03-01

    We contrasted impaired glucose regulation (prediabetes) prevalence, defined according to oral glucose tolerance test or HbA1c values, and studied cross-sectional associations between prediabetes and subclinical/clinical cardiovascular disease (CVD) in a cohort of European and South Asian origin. For 682 European and 520 South Asian men and women, aged 58-85 years, glycaemic status was determined by oral glucose tolerance test or HbA1c thresholds. Questionnaires, record review, coronary artery calcification scores and cerebral magnetic resonance imaging established clinical plus subclinical coronary heart and cerebrovascular disease. Prediabetes was more prevalent in South Asian participants when defined by HbA1c rather than by oral glucose tolerance test criteria. Accounting for age, sex, smoking, systolic blood pressure, triglycerides and waist-hip ratio, prediabetes was associated with coronary heart disease and cerebrovascular disease in European participants, most obviously when defined by HbA1c rather than by oral glucose tolerance test [odds ratios for HbA1c -defined prediabetes 1.60 (95% CI 1.07, 2.39) for coronary heart disease and 1.57 (95% CI 1.00, 2.51) for cerebrovascular disease]. By contrast, non-significant associations were present between oral glucose tolerance test-defined prediabetes only and coronary heart disease [odds ratio 1.41 (95% CI 0.84, 2.36)] and HbA1c -defined prediabetes only and cerebrovascular disease [odds ratio 1.39 (95% CI 0.69, 2.78)] in South Asian participants. Prediabetes defined by HbA1c or oral glucose tolerance test criteria was associated with cardiovascular disease (defined as coronary heart and/or cerebrovascular disease) in Europeans [odds ratio 1.95 (95% CI 1.31, 2.91) for HbA1c prediabetes criteria] but not in South Asian participants [odds ratio 1.00 (95% CI 0.62, 2.66); ethnicity interaction P = 0.04]. Prediabetes appeared to be less associated with cardiovascular disease in the South Asian than in the European

  9. Comprehensive gene expression analysis of the NAC gene family under normal growth conditions, hormone treatment, and drought stress conditions in rice using near-isogenic lines (NILs) generated from crossing Aday Selection (drought tolerant) and IR64.

    Science.gov (United States)

    Nuruzzaman, Mohammed; Sharoni, Akhter Most; Satoh, Kouji; Moumeni, Ali; Venuprasad, Ramiah; Serraj, Rachid; Kumar, Arvind; Leung, Hei; Attia, Kotb; Kikuchi, Shoshi

    2012-05-01

    The NAC (NAM, ATAF1/2 and CUC2) genes are plant-specific transcriptional factors known to play diverse roles in various plant developmental processes. We describe the rice (Oryza sativa) OsNAC genes expression profiles (GEPs) under normal and water-deficit treatments (WDTs). The GEPs of the OsNAC genes were analyzed in 25 tissues covering the entire life cycle of Minghui 63. High expression levels of 17 genes were demonstrated in certain tissues under normal conditions suggesting that these genes may play important roles in specific organs. We determined that 16 genes were differentially expressed under at least 1 phytohormone (NAA, GA3, KT, SA, ABA, and JA) treatment. To investigate the GEPs in the root, leaf, and panicle of three rice genotypes [e.g., 2 near-isogenic lines (NILs) and IR64], we used two NILs from a common genetic combination backcross developed by Aday Selection and IR64. WDTs were applied using the fraction of transpirable soil water at severe, mild, and control conditions. Transcriptomic analysis using a 44K oligoarray from Agilent was performed on all the tissue samples. We identified common and specific genes in all tissues from the two NILs under both WDTs, and the majority of the OsNAC genes that were activated were in the drought-tolerant IR77298-14-1-2-B-10 line compared with the drought-susceptible IR77298-14-1-2-B-13 or IR64. In IR77298-14-1-2-B-10, seventeen genes were very specific in their expression levels. Approximately 70 % of the genes from subgroups SNAC and NAM/CUC3 were activated in the leaf, but 37 % genes from subgroup SND were inactivated in the root compared with the control under severe stress conditions. These results provide a useful reference for the cloning of candidate genes from the specific subgroup for further functional analysis.

  10. Poor Safety and Tolerability Hamper Reaching a Potentially Therapeutic Dose in the Use of Thalidomide for Alzheimer's Disease: Results from a Double-Blind, Placebo-Controlled Trial.

    Science.gov (United States)

    Decourt, Boris; Drumm-Gurnee, Denise; Wilson, Jeffrey; Jacobson, Sandra; Belden, Christine; Sirrel, Sherye; Ahmadi, Michael; Shill, Holly; Powell, Jessica; Walker, Aaron; Gonzales, Amanda; Macias, Mimi; Sabbagh, Marwan N

    2017-01-01

    To date there is no cure for Alzheimer's disease (AD). After amyloid beta immunotherapies have failed to meet primary endpoints of slowing cognitive decline in AD subjects, the inhibition of the beta-secretase BACE1 appears as a promising therapeutic approach. Pre-clinical data obtained in APP23 mice suggested that the anti-cancer drug thalidomide decreases brainBACE1 and Aβ levels. This prompted us to develop an NIH-supported Phase IIa clinical trial to test the potential of thalidomide for AD. We hypothesized that thalidomide can decrease or stabilize brain amyloid deposits, which would result in slower cognitive decline in drug- versus placebo-treated subjects. This was a 24-week, randomized, double-blind, placebo-controlled, parallel group study with escalating dose regimen of thalidomide with a target dose of 400mg daily in patients with mild to moderate AD. The primary outcome measures were tolerability and cognitive performance assessed by a battery of tests. A total of 185 subjects have been pre-screened, out of which25 were randomized. Mean age of the sample at baseline was 73.64 (±7.20) years; mean education was 14.24 (±2.3) years; mean MMSE score was 21.00 (±5.32); and mean GDS score was 2.76 (±2.28).Among the 25 participants, 14 (56%) terminated early due to adverse events, dramatically decreasing the power of the study. In addition, those who completed the study (44%) never reached the estimated therapeutic dose of 400 mg/day thalidomide because of reported adverse events. The cognitive data showed no difference between the treated and placebo groups at the end of the trial. This study demonstrates AD patients have poor tolerability for thalidomide, and are unable to reach a therapeutic dose felt to be sufficient to have effects on BACE1. Because of poor tolerability, this study failed to demonstrate a beneficial effect on cognition. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. Cardiac Diastolic Evaluation in Pregnant Women with Abnormal Glucose Tolerance: An Opportunity to Detect the Early and Subclinical Alterations and Prevent Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    B. Pintaudi

    2013-01-01

    Full Text Available Objectives of this study were to assess diastolic function in pregnant women with abnormal glucose tolerance (AGT, compared with normal glucose tolerance (NGT women, and to evaluate the insulin resistance status and its association with Doppler-echocardiographic indexes. Echocardiograms of 108 consecutive Caucasian women with singleton pregnancies were performed. Insulin resistance status was estimated by the homeostasis model assessment of insulin resistance (HOMA-IR and the quantitative insulin sensitivity check index (QUICKI. All the studied women showed normal diastolic patterns. Patients with AGT (50.9%, as compared with NGT women, had higher HOMA-IR (1.70±1.30 versus 1.01±0.81, P=0.003, lower QUICKI (0.36±0.005 versus 0.40±0.06, P=0.004, higher lateral mitral annulus late diastolic velocity (13.6±4.9 versus 11.9±4.9, P=0.03, and higher A-wave velocity, the wave responsible for the active atrial contraction component (75.2±14.2 versus 67.7±16.2, P=0.01. At multivariate regression analysis HOMA-IR was the only parameter associated with A-wave velocity. In conclusion, women with AGT had an increased subclinical diastolic active participation, which is associated with higher levels of insulin resistance. For the increased risk of deterioration of cardiac diastolic function, earlier and more seriously than normal pregnancy, AGT women may have a careful followup to detect the early signs of cardiac alteration and to prevent cardiovascular diseases.

  12. Effects of carotenoid sources on growth performance, blood parameters, disease resistance and stress tolerance in black tiger shrimp (Penaeus monodon Fabricius

    Directory of Open Access Journals (Sweden)

    Supamattaya, K.

    2005-02-01

    Full Text Available Two feeding trial were conducted to determine the effects of various sources of carotenoid on growth performance, disease resistance, blood parameters, stress tolerance and pigmentation in juvenile black tiger shrimp (Penaeus monodon. Trial I was performed in small shrimp (1 g average body weight. The shrimp were fed with control diet without carotenoid (diet 1 while diets 2 to 6 contained 50 mg/kg astaxanthin (Lucanthin Pink®, 125 mg/kg β-carotene (Lucarotin®, 200 mg/kg β-carotene (Lucarotin®, 125 mg/kg Betatene® extracted from Dunaliella and 3% dried Spirulina respectively. There was an improvement in color in all groups of shrimp fed caroteniod supplemented diets, but no significant differences in weight gain or survival among the shrimps fed each test diet (p>0.05. Resistance to white spot syndrome virus (WSSV infection and stress tolerance (salinity stress, were not significantly different among treatments. Trial II was performed in juvenile shrimp (10 g average body weight fed test diets containing 100 ppm astaxanthin (Lucanthin pink®, 125 mg/kg β-carotene (Lucarotin®, 250 mg/kg β-carotene (Lucarotin®, 250 mg/kg Betatene® and 3% dried Spirulina compared with those fed control diet without carotenoid. At the end of 6 weeks feeding period, shrimp fed control diet as well as astaxanthin and dried Spirulina supplemented diets had higher levels of total hemocyte counts than those of all β-carotene supplemented diets feeding group. However, phenoloxidase activity and clearance of pathogenic vibrio from the hemolymphwere not significantly different among the treatments (p>0.05. Astaxanthin levels were highest in the shrimp fed all carotenoid-supplemented diets. In conclusion, a natural carotenoid i.e. dried Spirulina and carotenoid extracted from Dunaliella which have a lower production cost than analytical carotenoid showed beneficial effects on shrimp feed supplement.

  13. Royal jelly promotes DAF-16-mediated proteostasis to tolerate β-amyloid toxicity in C. elegans model of Alzheimer's disease.

    Science.gov (United States)

    Wang, Xiaoxia; Cao, Min; Dong, Yuqing

    2016-08-23

    Numerous studies have demonstrated that dietary intervention may promote health and help prevent Alzheimer's disease (AD). We recently reported that bee products of royal jelly (RJ) and enzyme-treated royal jelly (eRJ) were potent to promote healthy aging in C. elegans. Here, we examined whether RJ/eRJ consumption may benefit to mitigate the AD symptom in the disease model of C. elegans. Our results showed that RJ/eRJ supplementation significantly delayed the body paralysis in AD worms, suggesting the β-amyloid (Aβ) toxicity attenuation effects of RJ/eRJ. Genetic analyses suggested that RJ/eRJ-mediated alleviation of Aβ toxicity in AD worms required DAF-16, rather than HSF-1 and SKN-1, in an insulin/IGF signaling dependent manner. Moreover, RJ/eRJ modulated the transactivity of DAF-16 and dramatically improved the protein solubility in aged worms. Given protein solubility is a hallmark of healthy proteostasis, our findings demonstrated that RJ/eRJ supplementation improved proteostasis, and this promotion depended on the transactivity of DAF-16. Collectively, the present study not only elucidated the possible anti-AD mechanism of RJ/eRJ, but also provided evidence from a practical point of view to shed light on the extensive correlation of proteostasis and the prevention of neurodegenerative disorders.

  14. Symptom-limited exercise testing causes sustained diastolic dysfunction in patients with coronary disease and low effort tolerance.

    Science.gov (United States)

    Fragasso, G; Benti, R; Sciammarella, M; Rossetti, E; Savi, A; Gerundini, P; Chierchia, S L

    1991-05-01

    Exercise stress testing is routinely used for the noninvasive assessment of coronary artery disease and is considered a safe procedure. However, the provocation of severe ischemia might potentially cause delayed recovery of myocardial function. To investigate the possibility that maximal exercise testing could induce prolonged impairment of left ventricular function, 15 patients with angiographically proved coronary disease and 9 age-matched control subjects with atypical chest pain and normal coronary arteries were studied. Radionuclide ventriculography was performed at rest, at peak exercise, during recovery and 2 and 7 days after exercise. Ejection fraction, peak filling and peak emptying rates and left ventricular wall motion were analyzed. All control subjects had a normal exercise test at maximal work loads and improved left ventricular function on exercise. Patients developed 1 mm ST depression at 217 +/- 161 s at a work load of 70 +/- 30 W and a rate-pressure product of 18,530 +/- 4,465 mm Hg x beats/min. Although exercise was discontinued when angina or equivalent symptoms occurred, in all patients diagnostic ST depression (greater than or equal to 1 mm) developed much earlier than symptoms. Predictably, at peak exercise patients showed a decrease in ejection fraction and peak emptying and filling rates. Ejection fraction and peak emptying rate normalized within the recovery period, whereas peak filling rate remained depressed throughout recovery (p less than 0.002) and was still reduced 2 days after exercise (p less than 0.02). In conclusion, in patients with severe impairement of coronary flow reserve, maximal exercise may cause sustained impairement of diastolic function.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Derivation, Characterization, and Neural Differentiation of Integration-Free Induced Pluripotent Stem Cell Lines from Parkinson's Disease Patients Carrying SNCA, LRRK2, PARK2, and GBA Mutations

    DEFF Research Database (Denmark)

    Momcilovic, Olga; Sivapatham, Renuka; Oron, Tal Ronnen

    2016-01-01

    We report generation of induced pluripotent stem cell (iPSC) lines from ten Parkinson's disease (PD) patients carrying SNCA, PARK2, LRRK2, and GBA mutations, and one age-matched control. After validation of pluripotency, long-term genome stability, and integration-free reprogramming, eight...... not be sufficient to determine the cause or mechanism of the disease, and highlights the need to use more focused strategies for large-scale data analysis........ We further examined gene expression in a stress model (MPTP-induced dopaminergic neuronal death) using two clones from the SNCA triplication line, and detected changes in genes associated with mitophagy. Our data suggested that even a well-characterized line of a monogenic disease may...

  16. Salt Tolerance

    OpenAIRE

    Xiong, Liming; Zhu, Jian-Kang

    2002-01-01

    Studying salt stress is an important means to the understanding of plant ion homeostasis and osmo-balance. Salt stress research also benefits agriculture because soil salinity significantly limits plant productivity on agricultural lands. Decades of physiological and molecular studies have generated a large body of literature regarding potential salt tolerance determinants. Recent advances in applying molecular genetic analysis and genomics tools in the model plant Arabidopsis thaliana are sh...

  17. Profile of liver enzymes in non-alcoholic fatty liver disease in patients with impaired glucose tolerance and newly detected untreated type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Debmalya Sanyal

    2015-01-01

    Full Text Available Context: The perception of non-alcoholic fatty liver disease (NAFLD as an uncommon and benign condition is rapidly changing. Approximately, 70% type 2 diabetes mellitus (T2DM patients have a fatty liver, which may follow an aggressive course with necroinflammation and fibrosis. Aims: To assess the profile of liver enzymes in subjects with impaired glucose tolerance (IGT, new onset treatment naive T2DM and normal glucose tolerance (NGT with and without NAFLD. Settings and Design: Cross-sectional clinic-based study. Subjects and Methods: 152 IGT and 158 recently detected T2DM subjects aged between 30 and 69 years, along with 160 age and gender matched controls with NGT. An ultrasonography scan of the upper abdomen was done in all patients in order to examine presence of fatty liver. Anthropometry, lipid profile, liver enzymes were also analyzed in all patients. Statistical Analysis Used: Unpaired t-test, Chi-square/Fisher Exact test (for categorical variables, Pearson/Spearmen correlation test to find significant difference, association and correlation between two or more groups respectively. Results: NAFLD was significantly associated with higher alanine aminotransferase (ALT and gamma-glutamyl transferase (GGT but not ALP levels in IGT and T2DM patients. ALT, GGT significant correlated with waist circumference, body mass index, fasting insulin, homeostatic model assessment- insulin resistance, fasting blood glucose, high density lipoprotein cholesterol, triglyceride. 57% of NAFLD patients had normal ALT between 25 and 40 U/L, 53% of NAFLD subjects had normal GGT between 15 and 30 U/L. ALT 40 U/L and GGT > 30 U/L had highest positive predictivity for presence of NAFLD in our study sample. Conclusions: Mild elevations of liver enzymes in the upper normal range are associated with features of metabolic syndrome and NAFLD even in IGT and recently detected T2DM patients. Novel cut-offs for liver enzymes are warranted in order to prevent unnecessary

  18. Atorvastatin 10 mg plus ezetimibe 10mg compared with atorvastatin 20 mg: impact on the lipid profile in Japanese patients with abnormal glucose tolerance and coronary artery disease.

    Science.gov (United States)

    Uemura, Yusuke; Watarai, Masato; Ishii, Hideki; Koyasu, Masayoshi; Takemoto, Kenji; Yoshikawa, Daiji; Shibata, Rei; Matsubara, Tatsuaki; Murohara, Toyoaki

    2012-01-01

    Oxidized low-density lipoprotein (LDL) cholesterol is a sensitive lipid marker for predicting atherosclerosis. Ezetimibe and statins are reported to decrease both LDL cholesterol and oxidized LDL cholesterol. This prospective randomized open-label crossover study compared combination therapy with atorvastatin plus ezetimibe versus high-dose atorvastatin monotherapy. Changes in serum lipids, including malondialdehyde-modified LDL (MDA-LDL) as a representative form of oxidized LDL cholesterol, and glucose metabolism were assessed. The subjects were 39 Japanese patients with coronary artery disease and type 2 diabetes or impaired glucose tolerance who were taking 10 mg/day of atorvastatin (30 men and 9 women with a mean age of 67.8 years). They were randomized to a group that first received add-on ezetimibe (10 mg/day) or a group that first received atorvastatin monotherapy at a higher dose of 20 mg/day. Both treatments were given for 12 weeks each in a crossover fashion. Add-on ezetimibe significantly decreased MDA-LDL (109.0 ± 31.9 mg/dl to 87.7 ± 29.4 mg/dl, p=0.0009), while up-titration of atorvastatin did not. The decrease with add-on ezetimibe was significantly greater than with up-titration of atorvastatin (p=0.0006). Total cholesterol and LDL cholesterol were significantly decreased by both treatments, but the percent reduction with add-on ezetimibe was significantly greater (pHigh-density lipoprotein cholesterol was significantly increased by both treatments and there was no significant difference between them. The apolipoprotein B/apolipoprotein A-I ratio and remnant-like particle cholesterol were only significantly decreased by add-on ezetimibe. Both treatments caused similar elevation of hemoglobin A(1c). In Japanese patients with type 2 diabetes or impaired glucose tolerance and coronary artery disease, adding ezetimibe (10 mg/day) to atorvastatin (10 mg/day) significantly improved the lipid profile compared with atorvastatin monotherapy at 20 mg

  19. Exercise tolerance in mitral stenosis and chronic obstructive pulmonary disease. Evaluation by anaerobic threshold and radionuclide ventriculography

    Energy Technology Data Exchange (ETDEWEB)

    Uenami, Atsushi; Mizuno, Toshikazu; Chiba, Hiroshi; Ohno, Masanori; Wakino, Kouichi; Sawada, Yoshihiro; Ohno, Joichi; Kume, Kiyoshi

    1986-06-01

    Serial radionuclide ventriculography was performed using a newly developed ''real-time'' system, and left ventricular ejection fraction (LVEF), right ventricular ejection fraction (RVEF), stroke volume (SV), and cardiac output (CO) were measured during graded supine exercise in five patients with mitral stenosis (MS), in five patients with chronic obstructive pulmonary disease (COPD) and in five healthy subjects. Simultaneous pulmonary gas exchange analysis permitted determining the anaerobic threshold, which is the point during incremental exercise when lactate begins to accumulate in the blood. LVEF at the anaerobic threshold was not significantly changed in any patient groups and in healthy subjects, but RVEF at the anaerobic threshold was lower in COPD and MS patients as compared with healthy subjects. In MS, SV during exercise was reduced at the anaerobic threshold, but not in COPD or in healthy subjects. In conclusion, reduced working capacity is related to decreased RVEF in both COPD and MS, but the inhibited increase in CO during exercise is also important for the working capacity in MS.

  20. Peripartum Antibiotics Promote Gut Dysbiosis, Loss of Immune Tolerance, and Inflammatory Bowel Disease in Genetically Prone Offspring.

    Science.gov (United States)

    Miyoshi, Jun; Bobe, Alexandria M; Miyoshi, Sawako; Huang, Yong; Hubert, Nathaniel; Delmont, Tom O; Eren, A Murat; Leone, Vanessa; Chang, Eugene B

    2017-07-11

    Factors affecting the developing neonatal gut microbiome and immune networks may increase the risk of developing complex immune disorders such as inflammatory bowel diseases (IBD). In particular, peripartum antibiotics have been suggested as risk factors for human IBD, although direct evidence is lacking. Therefore, we examined the temporal impact of the commonly used antibiotic cefoperazone on both maternal and offspring microbiota when administered to dams during the peripartum period in the IL-10-deficient murine colitis model. By rigorously controlling for cage, gender, generational, and murine pathobiont confounders, we observed that offspring from cefoperazone-exposed dams develop a persistent gut dysbiosis into adulthood associated with skewing of the host immune system and increased susceptibility to spontaneous and chemically dextran sodium sulfate (DSS)-induced colitis. Thus, early life exposure to antibiotic-induced maternal dysbiosis during a critical developmental window for gut microbial assemblage and immune programming elicits a lasting impact of increased IBD risk on genetically susceptible offspring. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Essential Amino Acids and Exercise Tolerance in Elderly Muscle-Depleted Subjects with Chronic Diseases: A Rehabilitation without Rehabilitation?

    Directory of Open Access Journals (Sweden)

    Roberto Aquilani

    2014-01-01

    Full Text Available Exercise intolerance remains problematic in subjects with chronic heart failure (CHF and/or chronic obstructive pulmonary disease (COPD. Recent studies show that supplemented essential amino acids (EAAs may exert beneficial effects on CHF/COPD physical capacity. The results from 3 investigations (2 conducted on CHF and 1 on COPD subjects served as the basis for this paper. The 3 studies consistently showed that elderly CHF and COPD improved exercise intolerance after 1–3 months of EAA supplementation (8 g/d. In CHF exercise capacity increased 18.7% to 23% (watts; bicycle test, and 12% to 22% (meters in 6 min walking test. Moreover, patients reduced their resting plasma lactate levels (by 25% and improved tissue insulin sensitivity by 16% (HOMA index. COPD subjects enjoyed similar benefits as CHF ones. They increased physical autonomy by 78.6% steps/day and decreased resting plasma lactate concentrations by 23%. EAA mechanisms explaining improved exercise intolerance could be increases in muscle aerobic metabolism, mass and function, and improvement of tissue insulin sensitivity (the latter only for the CHF population. These mechanisms could be accounted for by EAA’s intrinsic physiological activity which increases myofibrils and mitochondria genesis in skeletal muscle and myocardium and glucose control. Supplemented EAAs can improve the physical autonomy of subjects with CHF/COPD.

  2. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer’s disease model cell line

    International Nuclear Information System (INIS)

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck

    2011-01-01

    Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.

  3. Disease-related mortality exceeds treatment-related mortality in patients with chronic myeloid leukemia on second-line or later therapy.

    Science.gov (United States)

    Pearson, Edward; McGarry, Lisa; Gala, Smeet; Nieset, Christopher; Nanavaty, Merena; Mwamburi, Mkaya; Levy, Yair

    2016-04-01

    Treatment of newly-diagnosed patients with chronic-phase chronic myeloid leukemia (CP-CML) with tyrosine kinase inhibitors (TKIs) results in near-normal life expectancy. However, CP-CML patients resistant to initial TKIs face a poorer prognosis and significantly higher CML-related mortality. We conducted a systematic literature review to evaluate the specific causes of deaths (diseases progression versus drug-related) in CP-CML patients receiving second- or third-line therapy. We identified eight studies based on our criteria that reported causes of death. Overall, 5% of second-line and 10% of third-line patients died during the study follow-up period. For second-line, (7 studies, n=1926), mortality was attributed to disease progression for 41% of deaths, 2% to treatment-related causes, 3% were treatment-unrelated, and 50% were unspecified adverse events (AEs), not likely related to study drug. In third-line, (2 studies, n=144), 71% deaths were attributed to disease progression, 7% treatment-related AEs, 14% treatment-unrelated and 7% unspecified AEs. Annual death rates for second- and third-line therapy were significantly higher than for general population in similar age group. Our findings suggest death attributed to disease progression is approximately 10 times that due to treatment-related AEs in patients with CP-CML receiving second- or third-line therapy. Therefore, the potential benefits of effective treatment for these patients with the currently available TKIs outweigh the risks of treatment-induced AEs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Bursal transcriptome profiling of different inbred chicken lines reveals key differentially expressed genes at 3 days post-infection with very virulent infectious bursal disease virus.

    Science.gov (United States)

    Farhanah, Mohd Isa; Yasmin, Abd Rahaman; Mat Isa, Nurulfiza; Hair-Bejo, Mohd; Ideris, Aini; Powers, Claire; Oladapo, Omobolanle; Nair, Venugopal; Khoo, Jia-Shiun; Ghazali, Ahmad-Kamal; Yee, Wai-Yan; Omar, Abdul Rahman

    2018-01-01

    Infectious bursal disease is a highly contagious disease in the poultry industry and causes immunosuppression in chickens. Genome-wide regulations of immune response genes of inbred chickens with different genetic backgrounds, following very virulent infectious bursal disease virus (vvIBDV) infection are poorly characterized. Therefore, this study aims to analyse the bursal tissue transcriptome of six inbred chicken lines 6, 7, 15, N, O and P following infection with vvIBDV strain UK661 using strand-specific next-generation sequencing, by highlighting important genes and pathways involved in the infected chicken during peak infection at 3 days post-infection. All infected chickens succumbed to the infection without major variations among the different lines. However, based on the viral loads and bursal lesion scoring, lines P and 6 can be considered as the most susceptible lines, while lines 15 and N were regarded as the least affected lines. Transcriptome profiling of the bursa identified 4588 genes to be differentially expressed, with 2985 upregulated and 1642 downregulated genes, in which these genes were commonly or uniquely detected in all or several infected lines. Genes that were upregulated are primarily pro-inflammatory cytokines, chemokines and IFN-related. Various genes that are associated with B-cell functions and genes related to apoptosis were downregulated, together with the genes involved in p53 signalling. In conclusion, bursal transcriptome profiles of different inbred lines showed differential expressions of pro-inflammatory cytokines and chemokines, Th1 cytokines, JAK-STAT signalling genes, MAPK signalling genes, and their related pathways following vvIBDV infection.

  5. In vitro selection of induced mutants to salt-tolerance: Inducible gene regulation for salt tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Winicov, I [Department of Microbiology and Biochemistry, Univ. of Nevada-Reno, Reno, NV (United States)

    1997-07-01

    A selection protocol to obtain salt tolerant calli, followed by regeneration and progeny-test of the regenerated plants for salt tolerance in rice was investigated. Callus cultures were initiated from salt-sensitive US elite rice lines and cv. `Pokkali`. Salt-tolerant cell lines were selected from these by a single step selection procedure. The selected salt-tolerant lines grew well on medium with {+-} 0.5% or 1% NaCl, while the parent lines occasionally survived, but did not grow at these salt concentrations. Plants were regenerated from these cell lines through different passages on medium containing salt. Seed was collected from the regenerated plants and salt tolerance of R2 seedlings was compared with those regenerated without salt selection. Salt-tolerance was measured by survival and productive growth of newly germinated seedlings in Hoagland solution with 0.3% and 0.5% NaCl for 4 weeks. Heritable improvement in salt tolerance was obtained in R2 seedlings from one plant regenerated after 5 months selection. Survival and growth of these seedlings was equivalent to that from `Pokkali` seedlings. These results show that cellular tolerance can provide salt-tolerance in rice plants. (author). 6 refs, 2 tabs.

  6. In vitro selection of induced mutants to salt-tolerance: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Winicov, I.

    1997-01-01

    A selection protocol to obtain salt tolerant calli, followed by regeneration and progeny-test of the regenerated plants for salt tolerance in rice was investigated. Callus cultures were initiated from salt-sensitive US elite rice lines and cv. 'Pokkali'. Salt-tolerant cell lines were selected from these by a single step selection procedure. The selected salt-tolerant lines grew well on medium with ± 0.5% or 1% NaCl, while the parent lines occasionally survived, but did not grow at these salt concentrations. Plants were regenerated from these cell lines through different passages on medium containing salt. Seed was collected from the regenerated plants and salt tolerance of R2 seedlings was compared with those regenerated without salt selection. Salt-tolerance was measured by survival and productive growth of newly germinated seedlings in Hoagland solution with 0.3% and 0.5% NaCl for 4 weeks. Heritable improvement in salt tolerance was obtained in R2 seedlings from one plant regenerated after 5 months selection. Survival and growth of these seedlings was equivalent to that from 'Pokkali' seedlings. These results show that cellular tolerance can provide salt-tolerance in rice plants. (author). 6 refs, 2 tabs

  7. Tolerance and safety of pharmacologic coronary vasodilation with adenosine in association with thallium-201 scintigraphy in patients with suspected coronary artery disease

    International Nuclear Information System (INIS)

    Abreu, A.; Mahmarian, J.J.; Nishimura, S.; Boyce, T.M.; Verani, M.S.

    1991-01-01

    Adenosine thallium-201 myocardial scintigraphy is a promising test for coronary artery disease detection, but its safety has not been reported in large patient cohorts. Accordingly, the tolerance and safety profile of adenosine infusion were analyzed in 607 patients (351 men, 256 women, mean age 63 ± 11 years) undergoing this test either because of suspected coronary artery disease (Group I, n = 482) or for risk stratification early (5.2 ± 2.8 days) after myocardial infarction (Group II, n = 125). Adenosine increased the heart rate from 74.5 ± 14.0 to 91.8 ± 15.9 beats/min (p less than 0.001) and decreased systolic blood pressure from 137.8 ± 26.8 to 120.7 ± 26.1 mm Hg (p less than 0.001). Side effects were frequent and similar in both groups. Flushing occurred in 35%, chest pain in 34%, headache in 21% and dyspnea in 19% of patients. Only 35.6% of Group I patients with chest pain during adenosine infusion had concomitant transient perfusion abnormalities, compared with 60.7% of Group II patients (p less than 0.05). First- and second-degree AV block occurred in 9.6% and 3.6% of patients, respectively, and ischemic ST changes in 12.5% of cases. Concomitance of chest pain and ischemic ST depression was uncommon (6%) but, when present, predicted perfusion abnormalities in 73% of patients. Most side effects ceased rapidly after stopping the adenosine infusion. The side effects were severe in only 1.6% of patients and in only six patients (1%) was it necessary to discontinue the infusion. No serious adverse reactions such as acute myocardial infarction or death occurred

  8. Infectious Tolerance

    OpenAIRE

    Jonuleit, Helmut; Schmitt, Edgar; Kakirman, Hacer; Stassen, Michael; Knop, Jürgen; Enk, Alexander H.

    2002-01-01

    Regulatory CD4+CD25+ T cells (Treg) are mandatory for maintaining immunologic self-tolerance. We demonstrate that the cell-cell contact–mediated suppression of conventional CD4+ T cells by human CD25+ Treg cells is fixation resistant, independent from membrane-bound TGF-β but requires activation and protein synthesis of CD25+ Treg cells. Coactivation of CD25+ Treg cells with Treg cell–depleted CD4+ T cells results in anergized CD4+ T cells that in turn inhibit the activation of conventional, ...

  9. Acrolein Exposure Blocks Down-Regulation of Cytokines and IgE Antibody in a Mucosal Tolerance Model but does not Alter Phenotypic Markers of Allergic Lung Disease

    Science.gov (United States)

    Acrolein (ACR) is a highly reactive upper airway toxicant that humans are exposed in a variety of environmental situations. Here we examined the effect of ACR exposure on development of immune tolerance in mice. To induce tolerance, female BALB/C mice were intranasally inoculate...

  10. Infectious Tolerance

    Science.gov (United States)

    Jonuleit, Helmut; Schmitt, Edgar; Kakirman, Hacer; Stassen, Michael; Knop, Jürgen; Enk, Alexander H.

    2002-01-01

    Regulatory CD4+CD25+ T cells (Treg) are mandatory for maintaining immunologic self-tolerance. We demonstrate that the cell-cell contact–mediated suppression of conventional CD4+ T cells by human CD25+ Treg cells is fixation resistant, independent from membrane-bound TGF-β but requires activation and protein synthesis of CD25+ Treg cells. Coactivation of CD25+ Treg cells with Treg cell–depleted CD4+ T cells results in anergized CD4+ T cells that in turn inhibit the activation of conventional, freshly isolated CD4+ T helper (Th) cells. This infectious suppressive activity, transferred from CD25+ Treg cells via cell contact, is cell contact–independent and partially mediated by soluble transforming growth factor (TGF)-β. The induction of suppressive properties in conventional CD4+ Th cells represents a mechanism underlying the phenomenon of infectious tolerance. This explains previously published conflicting data on the role of TGF-β in CD25+ Treg cell–induced immunosuppression. PMID:12119350

  11. Anakinra as first-line disease-modifying therapy in systemic juvenile idiopathic arthritis: report of forty-six patients from an international multicenter series

    NARCIS (Netherlands)

    Nigrovic, Peter A.; Mannion, Melissa; Prince, Femke H. M.; Zeft, Andrew; Rabinovich, C. Egla; van Rossum, Marion A. J.; Cortis, Elisabetta; Pardeo, Manuela; Miettunen, Paivi M.; Janow, Ginger; Birmingham, James; Eggebeen, Aaron; Janssen, Erin; Shulman, Andrew I.; Son, Mary Beth; Hong, Sandy; Jones, Karla; Ilowite, Norman T.; Cron, Randy Q.; Higgins, Gloria C.

    2011-01-01

    To examine the safety and efficacy of the interleukin-1 (IL-1) receptor antagonist anakinra as first-line therapy for systemic juvenile idiopathic arthritis (JIA). Patients with systemic JIA receiving anakinra as part of initial disease-modifying antirheumatic drug (DMARD) therapy were identified

  12. Resistance of common bean breeding lines to Phaeoisariopsis griseola isolates from Honduras

    Science.gov (United States)

    Angular leaf spot (ALS) disease caused by Phaeoisariopsis griseola Sacc. Ferraris, is currently one of the most important factors limiting bean productivity in Central America. The development of breeding lines which combine resistance to ALS and Bean Golden Yellow Mosaic Virus (BGYMV) and tolerance...

  13. Seleção de linhagens com tolerância ao calor em germoplasma de tomateiro coletado na região Norte do Brasil Selection of heat tolerant tomato inbred lines from landraces adapted for cultivation in the North Region of Brazil

    Directory of Open Access Journals (Sweden)

    Leonardo de B. Giordano

    2005-03-01

    Full Text Available As altas temperaturas nas regiões tropicais e equatoriais induzem uma série de distúrbios morfológicos e/ou fisiológicos em estruturas florais do tomateiro, resultando em menor produtividade devido a maiores taxas de abortamento e má formação de frutos. Neste trabalho foram avaliadas linhagens de tomateiro oriundas de duas populações que vêm sendo cultivadas em Roraima, região Norte do Brasil. Doze linhagens foram obtidas após um ciclo prévio de seleção (em Brasília-DF em condições de temperatura elevada. A avaliação destas doze linhagens e duas cultivares testemunhas ('Viradoro' e 'Santa Clara' foi conduzida em casa de vegetação com temperaturas média das mínimas de 15ºC e média das máximas de 46,2ºC. Foram observadas diferenças significativas para número de frutos abortados, número de frutos maduros, peso de frutos maduros, teores de sólidos solúveis, firmeza e coloração de frutos. As linhagens (como um grupo apresentaram melhor desempenho do que as testemunhas 'Viradoro' e 'Santa Clara' para os parâmetros número de frutos abortados, peso, número e coloração de frutos maduros. A metodologia adotada no presente trabalho, permite a identificação de genótipos superiores adaptados ao cultivo em regiões tropicais e equatoriais com elevadas temperaturas.Heat tolerance is a major trait for tomato breeding programs targeted for lowland wet climates in equatorial and tropical areas of the world. High temperatures might cause several disturbances to morphological and physiological characteristics of the tomato flowers leading to yield constraints due to reduction in fruit setting. In the present work, an experiment was conducted to evaluate tomato breeding lines, derived from two tomato landrace populations cultivated by farmers in Roraima State (North Region of Brazil. Twelve inbred lines were obtained from these populations after one cycle of selection in a plastic house with high temperatures. These 12

  14. Generation of induced pluripotent stem cell line, CSSi004-A (2962, from a patient diagnosed with Huntington's disease at the presymptomatic stage

    Directory of Open Access Journals (Sweden)

    Eris Bidollari

    2018-04-01

    Full Text Available Huntington's disease (HD is an incurable, autosomal dominant, hereditary neurodegenerative disorder that typically manifests itself in midlife. This pathology is linked to the deregulation of multiple, as yet unknown, cellular processes starting before HD onset. A human iPS cell line was generated from skin fibroblasts of a subject at the presymptomatic life stage, carrying a polyglutamine expansion in HTT gene codifying Huntingtin protein. The iPSC line contained the expected CAG expansion, expressed the expected pluripotency markers, displayed in vivo differentiation potential to the three germ layers and had a normal karyotype.

  15. Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species.

    Science.gov (United States)

    Ulloa, M; Wang, C; Saha, S; Hutmacher, R B; Stelly, D M; Jenkins, J N; Burke, J; Roberts, P A

    2016-04-01

    Chromosome substitution (CS) lines in plants are a powerful genetic resource for analyzing the contribution of chromosome segments to phenotypic variance. In this study, a series of interspecific cotton (Gossypium spp.) CS lines were used to identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode or fungal disease resistance traits. The CS lines were developed in the G. hirsutum L. TM-1 background with chromosome or chromosome segment substitutions from G. barbadense L. Pima 3-79 or G. tomentosum. Root-knot nematode (Meloidogyne incognita) and fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) (races 1 and 4) resistance alleles and quantitative trait loci (QTL) previously placed on cotton chromosomes using SSR markers in two interspecific recombinant inbred line populations were chosen for testing. Phenotypic responses of increased resistance or susceptibility in controlled inoculation and infested field assays confirmed the resistance QTLs, based on substitution with the positive or negative allele for resistance. Lines CS-B22Lo, CS-B04, and CS-B18 showed high resistance to nematode root-galling, confirming QTLs on chromosomes 4 and 22 (long arm) with resistance alleles from Pima 3-79. Line CS-B16 had less fusarium race 1-induced vascular root staining and higher percent survival than the TM-1 parent, confirming a major resistance QTL on chromosome 16. Lines CS-B(17-11) and CS-B17 had high fusarium race 4 vascular symptoms and low survival due to susceptible alleles introgressed from Pima 3-79, confirming the localization on chromosome 17 of an identified QTL with resistance alleles from TM1 and other resistant lines. Analyses validated regions on chromosomes 11, 16, and 17 harboring nematode and fusarium wilt resistance genes and demonstrated the value of CS lines as both a germplasm resource for breeding programs and as a powerful genetic analysis tool for determining QTL effects for disease

  16. Seeking an optimal renal replacement therapy for the chronic kidney disease epidemic: the case for on-line hemodiafiltration.

    Science.gov (United States)

    Gatti, Emanuele; Ronco, Claudio

    2011-01-01

    The prevalence of chronic kidney disease (CKD) can be expected to increase dramatically in the foreseeable future, with suggestions that it has already reached epidemic proportions. The inadequate supply of donor organs, aggravated by an aging patient population, necessitates provision of sustainable dialysis treatment modalities. These treatment modalities must not only be of established clinical efficacy and effectiveness, but must simultaneously circumvent any potential treatment disparities due to geographical, social or other concurring factors. Home therapies might represent a partial solution to the complex issue of seeking optimal strategies to cope with the CKD epidemic. However, self-care renal replacement therapy (RRT), such as peritoneal dialysis (PD) and home therapies, can only be applied to a limited portion of the CKD population. Consequently, in preparation for coping with this CKD epidemic, specific large-scale plans need to be made that involve optimization of treatments already in use for the majority of the population requiring RRT, e.g. hemodialysis (HD). Extracorporeal chronic HD relies heavily on technology for its clinical success. Like the choice of the treatment modality and the complete medical approach to CKD patient care, the particular selection of the various components of the extracorporeal circuit has a significant impact on the well-being and survival of the patients. We present a medical-technological assessment of how best to treat vast numbers of dialysis patients under the financial restraints that are predicted to become even more severe as CKD entrenches itself as a more 'permanent epidemic'. A treatment modality is proposed that optimally addresses--and resolves--the debilitating effects of uremia, as well as of key clinical conditions closely linked to it. This treatment modality successfully tackles the issues of patient well-being, efficacy, effectiveness, safety and patient-nursing staff convenience--all in relation to

  17. Repressive Tolerance

    DEFF Research Database (Denmark)

    Pedersen, Morten Jarlbæk

    2017-01-01

    Consultation of organised interests and others when drafting laws is often seen as an important source of both input and output legitimacy. But whereas the input side of the equation stems from the very process of listening to societal actors, output legitimacy can only be strengthened if consult......Consultation of organised interests and others when drafting laws is often seen as an important source of both input and output legitimacy. But whereas the input side of the equation stems from the very process of listening to societal actors, output legitimacy can only be strengthened...... a substantial effect on the substance of laws – shows that there is a great difference in the amenability of different branches of government but that, in general, authorities do not listen much despite a very strong consultation institution and tradition. A suggestion for an explanation could be pointing...... to an administrative culture of repressive tolerance of organised interests: authorities listen but only reacts in a very limited sense. This bears in it the risk of jeopardising the knowledge transfer from societal actors to administrative ditto thus harming the consultation institutions’ potential for strengthening...

  18. Normal inhibition of DNA synthesis following γ-irradiation of radiosensitive cell lines from patients with Down's syndrome and Alzheimer's disease

    International Nuclear Information System (INIS)

    Lavin, M.F.; Le poidevin, P.; Chen, P.C.; Bates, P.

    1989-01-01

    Inhibition of DNA synthesis was studied in γ-iradiated lymphoblastoid cells from patients with Alzheimer's disease and Down's syndrome. A normal biphasic pattern of inhibition was observed over a dose range of 0-4 krad of γ-rays in all of the cell lines 3 out of 4 Down's and all the Alzheimer's cell lines were shown to be hypersensitive to ionizing radiation based on induced chromosomal aberrations. Increased G2 phase delay, comparable to that occurring in ataxia-telangiectasia cells, was observed for some of the cell lines, after exposure to γ-rays. Contrary to other data in the literature these results demonstrate that radioresistand DNA synthesis is not an intrinsic feature of all disorders characterized by radiosensitivitey. (author).; 25 refs.; 2 figs.; 1 tab

  19. Evaluation of drought tolerance in different growth stages of maize ...

    African Journals Online (AJOL)

    In order to find the best drought tolerant inbred lines, experiment was performed at the Agricultural College of Islamic Azad University, Shoushtar Branch, Iran during ... Data analysis revealed that the MP, GMP and STI indices were the more accurate criteria for selection of drought tolerant and high yielding inbred lines.

  20. Effectiveness and tolerability of second-line treatment with vildagliptin versus other oral drugs for type 2 diabetes in a real-world setting in the Middle East: results from the EDGE study.

    Science.gov (United States)

    Saab, Charles; Al-Saber, Feryal A; Haddad, Jihad; Jallo, Mahir Khalil; Steitieh, Habib; Bader, Giovanni; Ibrahim, Mohamed

    2015-01-01

    Type 2 diabetes mellitus (T2DM) is a chronic progressive disease that requires treatment intensification with antihyperglycemic agents due to progressive deterioration of β-cell function. A large observational study of 45,868 patients with T2DM across 27 countries (EDGE) assessed the effectiveness and safety of vildagliptin as add-on to other oral antidiabetic drugs (OADs) versus other comparator OAD combinations. Here, we present results from the Middle East countries (Bahrain, Jordan, Kuwait, Lebanon, Oman, Palestine, and the United Arab Emirates). Patients inadequately controlled with OAD monotherapy were eligible after the add-on treatment was chosen by the physician based on clinical judgment and patient need. Patients were assigned to either vildagliptin or comparator OADs (sulfonylureas, thiazolidinediones, glinides, α-glucosidase inhibitors, or metformin, except incretin-based therapies) based on the add-on therapy. The primary endpoint was the proportion of patients achieving a glycated hemoglobin (HbA1c) reduction of >0.3% without peripheral edema, hypoglycemia, discontinuation due to a gastrointestinal event, or weight gain≥5%. One of the secondary endpoints was the proportion of patients achieving HbA1cvildagliptin and 2,267 received other OADs. Overall, the mean (±standard deviation) age at baseline was 52.1±10.2 years, mean HbA1c was 8.5%±1.3%, and mean T2DM duration was 4.2±4.0 years. The proportion of patients achieving the primary (76.1% versus 61.6%, Pvildagliptin than with the comparator OADs. The unadjusted odds ratios for the primary and secondary endpoints were 1.98 (95% confidence interval 1.75-2.25) and 2.8 (95% confidence interval 2.5-3.2), respectively, in favor of vildagliptin. Vildagliptin achieved a numerically greater reduction in HbA1c (1.7%) from baseline versus comparator OADs (1.4%). The overall incidence of adverse events was comparable between studied cohorts. In real life, treatment with vildagliptin was associated with

  1. Safety and tolerability of adenosine stress myocardial perfusion scintigraphy in the evaluation of coronary artery disease in the elderly patients - A case control study

    International Nuclear Information System (INIS)

    Gnanasegaran, G.; Malcolm, M.; Rossiter, A.; McCool, D.; Hilson, A.J.W.; Buscombe, J.R.

    2006-01-01

    Elderly patients referred for evaluation of chest pain are often unable to undertake adequate exercise for exercise stress testing. The aim of this retrospective study was to analyze haemodynamic effects and assess the safety of adenosine stress myocardial perfusion scintigraphy (MPS) in the elderly. Records of 380 Patients (Age range=30-93 years) were reviewed. These were divided into two groups, Group-A with 190 patients who were above 65 years of age and Group-B with 190 patients who were equal or below the age of 65 years, and who had undergone adenosine stress MPS. The two groups were matched for major risk factors and clinical presentations. Symptoms (flushing, headache, chest pain, dyspnoea, neck pain) were recorded throughout the adenosine infusion. Baseline blood pressure, heart rate and ECG were recorded and monitored throughout the study. A total of 167 out of 380 patients (44%) had side effects, 86 of them belonged to Group-A and 81 of them belonged to Group-B. Flushing occurred in 33% of patients in Group-A and 43% of patients in Group-B. Seventeen percent of patients in Group-A had chest pain, while this was encountered in 27% of patients in Group-B. Dyspnoea was recorded in 32% of patients from Group-A, while it was encountered in 21% of patients belonging to Group-B. Neck pain was experienced by 8.4% in Group-A and 15% in Group-B. All of these findings were statistically significant (p<0.05). Several other side effects were also encountered which included headache (Group-A: 14% and Group-B: 21%), abdominal discomfort (Group-A: 19% and Group-B: 23%), Nausea and/or vomiting (Group-A: 4.7% and Group-B: 7.3%). ECG changes were noted in both groups (Group-A: 14% and Group-B: 12%). None of these were found to be statistically significant. Based on this retrospective study, the authors concluded that Adenosine stress MPS is a safe method for the evaluation of coronary artery disease (CAD) in elderly patients and is well tolerated. Most side effects were

  2. Two parvoviruses that cause different diseases in mink have different transcription patterns: Transcription analysis of mink enteritis virus and Aleutian mink disease parvovirus the same cell line

    DEFF Research Database (Denmark)

    Storgaard, T.; Oleksiewicz, M.; Bloom, M.E.

    1997-01-01

    The two parvoviruses of mink cause very different diseases, Mink enteritis virus (MEV) is associated with rapid, high-level viral replication and acute disease, In contrast, infection with Aleutian mink disease parvovirus (ADV) is associated with persistent, low-level viral replication and chronic...

  3. Relation of N-Terminal Pro-B-Type Natriuretic Peptide and Left Ventricular Diastolic Function to Exercise Tolerance in Patients With Significant Valvular Heart Disease and Normal Left Ventricular Systolic Function.

    Science.gov (United States)

    Hwang, Ji-Won; Park, Sung-Ji; Cho, Eun Jeong; Kim, Eun Kyoung; Lee, Ga Yeon; Chang, Sung-A; Choi, Jin-Oh; Lee, Sang-Chol; Park, Seung Woo

    2017-06-01

    An association between N-terminal prohormone brain natriuretic peptide (NT-proBNP) and exercise tolerance in patients with valvular heart disease (VHD) has been suggested; however, there are few data available regarding this relation. The aim of this study is to evaluate the correlation between exercise tolerance and NT-proBNP in patients with asymptomatic or mildly symptomatic significant VHD and normal left ventricular ejection fraction (LV EF). A total of 96 patients with asymptomatic or mildly symptomatic VHD and normal LV EF (≥50%) underwent cardiopulmonary exercise echocardiography. NT-proBNP levels were determined at baseline and after exercise in 3 hours. Patients were divided in 2 groups based on lower (left atrial volume index before exercise, right ventricular systolic pressure before exercise, E velocity after exercise, and E/e' ratio after exercise varied significantly. In addition, peak VO 2 was inversely related to NT-proBNP before (r = -0.352, p left atrial volume index, E/e' ratio, and right ventricular systolic pressure before and after exercise. NT-proBNP after exercise was also directly related to the same parameters. NT-proBNP levels both before and after exercise were higher in the group with lower exercise tolerance. In conclusion, through the correlation among exercise tolerance, NT-proBNP, and parameters of diastolic dysfunction, we demonstrated that diastolic dysfunction and NT-proBNP could predict exercise tolerance in patients with significant VHD and normal LV EF. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Tolerance of some Potato Mutants Induced with Gamma Irradiation to Drought in Vitro

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Al-Ayyoubi, Z.

    2007-01-01

    An in vitro selection program was conducted in order to improve potato (Solanum tuberosum,L.) tolerance to drought. Potato mutant plants were obtained through a previously conducted mutation breeding program on three potato cultivars (Draga, Spunta, and Diamant) aimed to improve potato tolerance to salinity and resistance to late blight disease. In order to apply selection pressure, growth media (MS based) were prepared with the addition of 1%, 2%, 3% concentrations of Poly Ethylene Glycol (PEG). As a result, three mutants were selected that were tolerant to water stress (i.e. drought tolerant), two of them were derived from the cultivar Draga and one came from Spunta. Physiological growth parameters (plant length, leaf number, branch number, roots number, leaf area, stomata number, and chlorophyll concentration content) were determined on the growing plantlets. The selected mutants were distinguished based on some characteristics which being associated with in their tolerance to drought. Such as an increases in leaf number, root number, and a decrease in stomata number. However a reduction in chlorophyll content was observed as compared with the control. This is considered a negative parameter which may result in a decrease in number and size of tubers. Thus it is important to continue selection for higher chlorophyll content. Also, these mutant lines will need further selection in the field for plants with larger tubers before they can be considered as certified lines.

  5. Tolerance of some potato mutants induced with gamma irradiation to drought in vitro

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Ayyoubi, Z.

    2006-04-01

    An in vitro selection program was conducted in order to improve potato (Solanum tuberosum) tolerance to drought. Potato mutant plants were obtained through a previously conducted mutation breeding program on three potato cultivars (Draga, Spunta, and Diamant) aimed at improving potato tolerance to salinity and resistance to late blight disease. In order to apply selection pressure, growth media (MS based) were prepared with the addition of 1%, 2%, 3% concentrations of Poly Ethylene Glycol (PEG). As a result, three mutants were selected that were tolerant to water stress (i.e. drought tolerant) two of which came from the cultivar Draga and one from Spunta. Physiological growth parameters (plant length, leaf number, branch number, roots number, leaf area, stomata number, and chlorophyll concentration content) were taken on the growing plantlets. The selected mutants were distinguished with some characteristics which can help in their tolerance to drought. Some of these characteristics were an increase in leaf number, root number, and a decrease in stomata number. However a reduction in chlorophyll content was observed as compared with the control. These mutant lines will need further selection in the field for plants with larger tubers before they can be considered as certified lines. (author)

  6. Guide-line of the radio-iodine (131I) therapy in Graves' disease and thyroid cancer

    International Nuclear Information System (INIS)

    Mori, Yutaka; Ikekubo, Katsuji

    2005-01-01

    Radio-iodine ( 131 I) therapy has been using in Graves' disease and well differentiated thyroid cancer. The rules of control in the discharge from radio-isotope hospital were notified in 1999 in Japan. Guideline of the 131 I therapy in Graves' disease and thyroid cancer were prepared by sub-group of Japanese Society of Nuclear Medicine. (author)

  7. Vinorelbine as first-line or second-line therapy for advanced breast cancer

    DEFF Research Database (Denmark)

    Langkjer, Sven T; Ejlertsen, Bent; Mouridsen, Henning

    2008-01-01

    INTRODUCTION: This study was conducted to establish the maximum tolerated dose (MTD) of intravenous vinorelbine and on the determined dose to assess efficacy and safety in patients with metastatic breast cancer previously treated with epirubicin. PATIENTS AND METHODS: Patients had histologically...... proven breast cancer and had received a prior epirubicin based regimen either adjuvant or as first line therapy for advanced disease. Vinorelbine was administered intravenously day 1 and 8 in a 3 weeks' schedule. Subsequently 48 additional patients were treated at one dose-level below MTD. RESULTS: Fifty...

  8. Effectiveness and tolerability of second-line treatment with vildagliptin versus other oral drugs for type 2 diabetes in a real-world setting in the Middle East: results from the EDGE study

    Directory of Open Access Journals (Sweden)

    Saab C

    2015-02-01

    Full Text Available Charles Saab,1 Feryal A Al-Saber,2 Jihad Haddad,3 Mahir Khalil Jallo,4 Habib Steitieh,5 Giovanni Bader,6 Mohamed Ibrahim,7 1Department of Endocrinology and Metabolism, Sacre Coeur University Hospital, Baabda, Lebanon; 2Endocrine Department, Bahrain Defence Force Hospital, Rifaa, Bahrain; 3Division of Endocrinology Department of Internal Medicine, Prince Hamaza Hospital, Amman, Jordan; 4Department of Internal Medicine, Gulf Medical University, Ajman, United Arab Emirates; 5New Mowasat Hospital, Safat, Kuwait; 6Novartis Pharma AG, Basel, Switzerland; 7Novartis Pharma Services AG, Dubai, United Arab Emirates Background: Type 2 diabetes mellitus (T2DM is a chronic progressive disease that requires treatment intensification with antihyperglycemic agents due to progressive deterioration of β-cell function. A large observational study of 45,868 patients with T2DM across 27 countries (EDGE assessed the effectiveness and safety of vildagliptin as add-on to other oral antidiabetic drugs (OADs versus other comparator OAD combinations. Here, we present results from the Middle East countries (Bahrain, Jordan, Kuwait, Lebanon, Oman, Palestine, and the United Arab Emirates. Methods: Patients inadequately controlled with OAD monotherapy were eligible after the add-on treatment was chosen by the physician based on clinical judgment and patient need. Patients were assigned to either vildagliptin or comparator OADs (sulfonylureas, thiazolidinediones, glinides, α-glucosidase inhibitors, or metformin, except incretin-based therapies based on the add-on therapy. The primary endpoint was the proportion of patients achieving a glycated hemoglobin (HbA1c reduction of >0.3% without peripheral edema, hypoglycemia, discontinuation due to a gastrointestinal event, or weight gain ≥5%. One of the secondary endpoints was the proportion of patients achieving HbA1c <7% without hypoglycemia or weight gain. Change in HbA1c from baseline to study endpoint and safety were also

  9. Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Xiaohui eLi

    2015-06-01

    Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.

  10. Establishment of induced pluripotent stem cell (iPSC line from a 75-year old patient with late onset Alzheimer's disease (LOAD

    Directory of Open Access Journals (Sweden)

    Zsuzsanna Táncos

    2016-07-01

    Full Text Available Peripheral blood mononuclear cells (PBMCs were collected from a clinically characterised 75-year old woman with late onset Alzheimer's disease (LOAD. The PMBCs were reprogrammed with the human OSKM transcription factors using the Sendai-virus delivery system. The transgene-free iPSC showed pluripotency verified by immunocytochemistry for pluripotency markers and differentiated spontaneously towards the 3 germ layers in vitro. Furthermore, the iPSC line showed normal karyotype. Our model might offer a good platform to further study the pathomechanism of sporadic AD, to identify early biomarkers and also for drug testing and gene therapy studies.

  11. Teaching Tolerance? Associational Diversity and Tolerance Formation

    DEFF Research Database (Denmark)

    Rapp, Carolin; Freitag, Markus

    2015-01-01

    , a closer look is taken at how associational diversity relates to the formation of tolerance and the importance of associations as schools of tolerance are evaluated. The main theoretical argument follows contact theory, wherein regular and enduring contact in diverse settings reduces prejudice and thereby...

  12. Breaking Immunological Tolerance through OX40 (CD134

    Directory of Open Access Journals (Sweden)

    Pratima Bansal-Pakala

    2001-01-01

    Full Text Available Immunological tolerance represents a mechanism by which cells of the host remain protected from the immune system. Breaking of immunological tolerance can result in a variety of autoimmune diseases such as rheumatoid arthritis, diabetes, and multiple sclerosis. The reasons for tolerance breaking down and autoimmune processes arising are largely unknown but of obvious interest for therapeutic intervention of these diseases. Although reversal of the tolerant state is generally unwanted, there are instances where this may be of benefit to the host. In particular, one way a cancerous cell escapes being targeted by the immune system is through tolerance mechanisms that in effect turn off the reactivity of T lymphocytes that can respond to tumor-associated peptides. Thus tolerance represents a major obstacle in developing effective immunotherapy against tumors. The molecules that are involved in regulating immunological tolerance are then of interest as they may be great targets for positively or negatively manipulating the tolerance process.

  13. Generation of Xeroderma Pigmentosum-A Patient-Derived Induced Pluripotent Stem Cell Line for Use As Future Disease Model.

    Science.gov (United States)

    Ohnishi, Hiroe; Kawasaki, Takashi; Deguchi, Tomonori; Yuba, Shunsuke

    2015-08-01

    Xeroderma pigmentosum group A (XP-A) is a genetic disorder in which there is an abnormality in nucleotide excision repair that causes hypersensitivity to sunlight and multiple skin cancers. The development of central and peripheral neurological disorders not correlated to ultraviolet light exposure is associated with XP-A. The genes responsible for XP-A have been identified and a XPA knockout mouse has been generated. These knockout mice exhibit cutaneous symptoms, but they do not show neurological disorders. The mechanism of pathogenesis of neurological disorders is still unclear and therapeutic methods have not been established. Therefore, we generated XP-A patient-derived human induced pluripotent stem cells (XPA-iPSCs) to produce in vitro models of neurological disorders. We obtained iPSC lines from fibroblasts of two patients carrying different mutations. Drugs screened using XPA-iPSC lines can be helpful for treating XP-A patients in Japan. Additionally, we revealed that these iPSCs have the potential to differentiate into neural lineage cells, including dopaminergic neurons, which decrease in XP-A patients. Our results indicate that expression of the normal XPA gene without mutations is not required for generation of iPSCs and differentiation of iPSCs into neural lineage cells. XPA-iPSCs may become useful models that clarify our understanding of neurological pathogenesis and help to establish therapeutic methods.

  14. AGRICULTURAL REVOLUTION IN THE LINE OF HUMAN EVOLUTION IS THE ONSET OF NUTRITIONAL METABOLIC DISEASES, EPIDEMIC OF CANCER AND THE INFECTIOUS DISEASES

    OpenAIRE

    Soroush Niknamian

    2017-01-01

    This study goes deeply through the nutrition of the first primate and analyses the nutrition in the line of human evolution. Simply dividing the shifts in the nutrition through the human evolution, it is obvious that some elements in the diet are more important than the others. Since the beginning of the Neolithic, the ratio of plant-to-animal foods in the diet has sharply increased from an average of probably 65% to 35% during Paleolithic times to as high as 90% to 10% since the advent of ag...

  15. AGRICULTURAL REVOLUTION IN THE LINE OF HUMAN EVOLUTION IS THE ONSET OF NUTRITIONAL METABOLIC DISEASES, EPIDEMIC OF CANCER AND THE INFECTIOUS DISEASES - Somayeh Zaminpira - Sorush Niknamian

    OpenAIRE

    Somayeh Zaminpira; Sorush Niknamian

    2017-01-01

    This study goes deeply through the nutrition of the first primate and analyses the nutrition in the line of human evolution. Simply dividing the shifts in the nutrition through the human evolution, it is obvious that some elements in the diet are more important than the others. Since the beginning of the Neolithic, the ratio of plant-to-animal foods in the diet has sharply increased from an average of probably 65% to 35% during Paleolithic times to as high as 90% to 10% since the advent of ag...

  16. Lactose tolerance tests

    Science.gov (United States)

    Hydrogen breath test for lactose tolerance ... Two common methods include: Lactose tolerance blood test Hydrogen breath test The hydrogen breath test is the preferred method. It measures the amount of hydrogen ...

  17. Overexpression of GRß in colonic mucosal cell line partly reflects altered gene expression in colonic mucosa of patients with inflammatory bowel disease.

    Science.gov (United States)

    Nagy, Zsolt; Acs, Bence; Butz, Henriett; Feldman, Karolina; Marta, Alexa; Szabo, Peter M; Baghy, Kornelia; Pazmany, Tamas; Racz, Karoly; Liko, Istvan; Patocs, Attila

    2016-01-01

    The glucocorticoid receptor (GR) plays a crucial role in inflammatory responses. GR has several isoforms, of which the most deeply studied are the GRα and GRß. Recently it has been suggested that in addition to its negative dominant effect on GRα, the GRß may have a GRα-independent transcriptional activity. The GRß isoform was found to be frequently overexpressed in various autoimmune diseases, including inflammatory bowel disease (IBD). In this study, we wished to test whether the gene expression profile found in a GRß overexpressing intestinal cell line (Caco-2GRß) might mimic the gene expression alterations found in patients with IBD. Whole genome microarray analysis was performed in both normal and GRß overexpressing Caco-2 cell lines with and without dexamethasone treatment. IBD-related genes were identified from a meta-analysis of 245 microarrays available in online microarray deposits performed on intestinal mucosa samples from patients with IBD and healthy individuals. The differentially expressed genes were further studied using in silico pathway analysis. Overexpression of GRß altered a large proportion of genes that were not regulated by dexamethasone suggesting that GRß may have a GRα-independent role in the regulation of gene expression. About 10% of genes differentially expressed in colonic mucosa samples from IBD patients compared to normal subjects were also detected in Caco-2 GRß intestinal cell line. Common genes are involved in cell adhesion and cell proliferation. Overexpression of GRß in intestinal cells may affect appropriate mucosal repair and intact barrier function. The proposed novel role of GRß in intestinal epithelium warrants further studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. What is Fault Tolerant Control

    DEFF Research Database (Denmark)

    Blanke, Mogens; Frei, C. W.; Kraus, K.

    2000-01-01

    Faults in automated processes will often cause undesired reactions and shut-down of a controlled plant, and the consequences could be damage to the plant, to personnel or the environment. Fault-tolerant control is the synonym for a set of recent techniques that were developed to increase plant...... availability and reduce the risk of safety hazards. Its aim is to prevent that simple faults develop into serious failure. Fault-tolerant control merges several disciplines to achieve this goal, including on-line fault diagnosis, automatic condition assessment and calculation of remedial actions when a fault...... is detected. The envelope of the possible remedial actions is wide. This paper introduces tools to analyze and explore structure and other fundamental properties of an automated system such that any redundancy in the process can be fully utilized to enhance safety and a availability....

  19. Tolerance of monocytes and macrophages in response to bacterial endotoxin

    Directory of Open Access Journals (Sweden)

    Ewelina Wiśnik

    2017-03-01

    Full Text Available Monocytes belong to myeloid effector cells, which constitute the first line of defense against pathogens, also called the nonspecific immune system and play an important role in the maintenance of tissue homeostasis. In response to stimulation, monocytes differentiate into macrophages capable of microorganism phagocytosis and secrete factors that play a key role in the regulation of immune responses. However excessive exposure of monocytes/macrophages to the lipopolysaccharide (LPS of Gram negative bacteria leads to the acquisition of immune tolerance by these cells. Such state results from disruption of different biological processes, for example intracellular signaling pathways and is accompanied by a number of disease states (immune, inflammatory or neoplastic conditions. Regulation of monocytes/macrophages activity is controlled by miRNAs, which are involved in the modulation of immune tolerance acquired by these cells. Moreover, the tolerance to endotoxin is conditioned by the posttranscriptional processes and posttranslational epigenetic modifications leading to the impairment of normal immune response for example by alterations in the expression of many genes encoding immune signaling mediators. The aim of this paper is to provide an overview existing knowledge on the modulation of activity of monocytes/macrophages in response to bacterial endotoxin and impaired immune responses.

  20. Evaluation of some varieties and breeding lines of tomato (Lycopersison sp) against tomato yellow leaf curl disease in the Greater Accra Region (Ghana)

    International Nuclear Information System (INIS)

    Kusi-Adjei, R.

    2011-01-01

    A series of experiments were conducted to evaluate ten (10) tomato varieties and breeding lines against tomato yellow leaf curl virus disease in Ghana. The research was undertaken at the research farm of the Biotechnology and Nuclear Agriculture Research Institute of the Ghana Atomic Energy Commission. Ten tomato varieties and breeding lines were evaluated in the field under natural whitefly inoculation in insect-proof cages. The field trial was done in the dry season from October, 2010 to February, 2011 and wet season from March, 2011 to July, 2011. Plants in the fields and in the cage exhibited varied symptoms such as leaf curling, leaf yellowing and reduced leaf sizes. Assessment of disease incidence and symptom severity using a four point scale (0-4) showed that, in the field there was higher disease incidence in the dry season as compared to the wet season. This was attributed to the higher number of whiteflies in the dry season as demonstrated through a whitefly population survey conducted in the field. Differences among means for disease incidence and whitefly surveys on the ten tomato varieties and breeding lines were statistically significant (p≤ 0.05). Wild Tomato (Solanum pimpinellifollium) and two hybrids, Wosowoso x Wild Tomato and Cherry Red x Wild Tomato exhibited signs of resistance in the field and did not show any symptoms of TYLCV disease symptoms. All the commercial varieties were highly susceptible and showed severe symptoms. Evaluation of fruit yield in the field revealed that the commercial variety Tomato Advanta had the heaviest fruit weight (42 g/ fruit) whilst Wosowoso had the highest total fruit yield (5.74 t/ha) in the wet season. Wild Tomato and the hybrids produced higher number of fruits compared to the commercial varieties. There were highly significant differences in the means of number of fruits, fruit weight (g) and total fruit yield (t/ha) among the ten tomato varieties and breeding lines in both the wet and dry seasons

  1. Recognition and Toleration

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2010-01-01

    Recognition and toleration are ways of relating to the diversity characteristic of multicultural societies. The article concerns the possible meanings of toleration and recognition, and the conflict that is often claimed to exist between these two approaches to diversity. Different forms...... or interpretations of recognition and toleration are considered, confusing and problematic uses of the terms are noted, and the compatibility of toleration and recognition is discussed. The article argues that there is a range of legitimate and importantly different conceptions of both toleration and recognition...

  2. Fault Tolerant Feedback Control

    DEFF Research Database (Denmark)

    Stoustrup, Jakob; Niemann, H.

    2001-01-01

    An architecture for fault tolerant feedback controllers based on the Youla parameterization is suggested. It is shown that the Youla parameterization will give a residual vector directly in connection with the fault diagnosis part of the fault tolerant feedback controller. It turns out...... that there is a separation be-tween the feedback controller and the fault tolerant part. The closed loop feedback properties are handled by the nominal feedback controller and the fault tolerant part is handled by the design of the Youla parameter. The design of the fault tolerant part will not affect the design...... of the nominal feedback con-troller....

  3. Assessing tolerance for wildlife: Clarifying relations between concepts and measures

    Science.gov (United States)

    Bruskotter, Jeremy T.; Singh, Ajay; Fulton, David C.; Slagle, Kristina

    2015-01-01

    Two parallel lines of inquiry, tolerance for and acceptance of wildlife populations, have arisen in the applied literature on wildlife conservation to assess probability of successfully establishing or increasing populations of controversial species. Neither of these lines is well grounded in social science theory, and diverse measures have been employed to assess tolerance, which inhibits comparability across studies. We empirically tested behavioral measures of tolerance against self-reports of previous policy-relevant behavior and behavioral intentions. Both composite behavioral measures were strongly correlated (r > .70) with two attitudinal measures of tolerance commonly employed in the literature. The strong correlation between attitudinal and behavioral measures suggests existing attitudinal measures represent valid, parsimonious measures of tolerance that may be useful when behavioral measures are too cumbersome or misreporting of behavior is anticipated. Our results demonstrate how behavioral measures of tolerance provide additional, useful information beyond general attitudinal measures.

  4. The political limit of tolerance O limite político da tolerância

    Directory of Open Access Journals (Sweden)

    Joseph Yvon Thériault

    2008-06-01

    Full Text Available In the contemporary discussions about democracy modifications, tolerance has been frequently evoked in order to express the way by which the democracies respond to the new demands of plurality recognition. While drawing the general lines of the connection between tolerance and democracy, the present article intends to deepen the comprehension of tolerance’s places and limits inside the democracy. After that, the text should evaluate the reach of the contemporary use of tolerance. Keywords: Democracy. Tolerance. Political theory. National Identity. Nas discussões contemporâneas sobre as transformações da democracia, a tolerância é com freqüência evocada para expressar o modo pelo qual as democracias respondem às novas exigências de reconhecimento da pluralidade. Ao esboçar as linhas gerais da relação entre tolerância e democracia, o presente artigo pretende aprofundar a compreensão do lugar e dos limites da tolerância na democracia. Em um segundo momento, tratará de avaliar o alcance do uso contemporâneo da tolerância. Palavras-chave: Democracia. Tolerância. Teoria Política. Identidade Nacional.

  5. Partial restoration of mutant enzyme homeostasis in three distinct lysosomal storage disease cell lines by altering calcium homeostasis.

    Directory of Open Access Journals (Sweden)

    Ting-Wei Mu

    2008-02-01

    Full Text Available A lysosomal storage disease (LSD results from deficient lysosomal enzyme activity, thus the substrate of the mutant enzyme accumulates in the lysosome, leading to pathology. In many but not all LSDs, the clinically most important mutations compromise the cellular folding of the enzyme, subjecting it to endoplasmic reticulum-associated degradation instead of proper folding and lysosomal trafficking. A small molecule that restores partial mutant enzyme folding, trafficking, and activity would be highly desirable, particularly if one molecule could ameliorate multiple distinct LSDs by virtue of its mechanism of action. Inhibition of L-type Ca2+ channels, using either diltiazem or verapamil-both US Food and Drug Administration-approved hypertension drugs-partially restores N370S and L444P glucocerebrosidase homeostasis in Gaucher patient-derived fibroblasts; the latter mutation is associated with refractory neuropathic disease. Diltiazem structure-activity studies suggest that it is its Ca2+ channel blocker activity that enhances the capacity of the endoplasmic reticulum to fold misfolding-prone proteins, likely by modest up-regulation of a subset of molecular chaperones, including BiP and Hsp40. Importantly, diltiazem and verapamil also partially restore mutant enzyme homeostasis in two other distinct LSDs involving enzymes essential for glycoprotein and heparan sulfate degradation, namely alpha-mannosidosis and type IIIA mucopolysaccharidosis, respectively. Manipulation of calcium homeostasis may represent a general strategy to restore protein homeostasis in multiple LSDs. However, further efforts are required to demonstrate clinical utility and safety.

  6. Identification of phenylbutyrate-generated metabolites in Huntington disease patients using parallel liquid chromatography/electrochemical array/mass spectrometry and off-line tandem mass spectrometry.

    Science.gov (United States)

    Ebbel, Erika N; Leymarie, Nancy; Schiavo, Susan; Sharma, Swati; Gevorkian, Sona; Hersch, Steven; Matson, Wayne R; Costello, Catherine E

    2010-04-15

    Oral sodium phenylbutyrate (SPB) is currently under investigation as a histone deacetylation (HDAC) inhibitor in Huntington disease (HD). Ongoing studies indicate that symptoms related to HD genetic abnormalities decrease with SPB therapy. In a recently reported safety and tolerability study of SPB in HD, we analyzed overall chromatographic patterns from a method that employs gradient liquid chromatography with series electrochemical array, ultraviolet (UV), and fluorescence (LCECA/UV/F) for measuring SPB and its metabolite phenylacetate (PA). We found that plasma and urine from SPB-treated patients yielded individual-specific patterns of approximately 20 metabolites that may provide a means for the selection of subjects for extended trials of SPB. The structural identification of these metabolites is of critical importance because their characterization will facilitate understanding the mechanisms of drug action and possible side effects. We have now developed an iterative process with LCECA, parallel LCECA/LCMS, and high-performance tandem MS for metabolite characterization. Here we report the details of this method and its use for identification of 10 plasma and urinary metabolites in treated subjects, including indole species in urine that are not themselves metabolites of SPB. Thus, this approach contributes to understanding metabolic pathways that differ among HD patients being treated with SPB. Copyright 2010 Elsevier Inc. All rights reserved.

  7. Compounds that correct F508del-CFTR trafficking can also correct other protein trafficking diseases: an in vitro study using cell lines

    Directory of Open Access Journals (Sweden)

    Sampson Heidi M

    2013-01-01

    Full Text Available Abstract Background Many genetic diseases are due to defects in protein trafficking where the mutant protein is recognized by the quality control systems, retained in the endoplasmic reticulum (ER, and degraded by the proteasome. In many cases, the mutant protein retains function if it can be trafficked to its proper cellular location. We have identified structurally diverse correctors that restore the trafficking and function of the most common mutation causing cystic fibrosis, F508del-CFTR. Most of these correctors do not act directly as ligands of CFTR, but indirectly on other pathways to promote folding and correction. We hypothesize that these proteostasis regulators may also correct other protein trafficking diseases. Methods To test our hypothesis, we used stable cell lines or transient transfection to express 2 well-studied trafficking disease mutations in each of 3 different proteins: the arginine-vasopressin receptor 2 (AVPR2, also known as V2R, the human ether-a-go-go-related gene (KCNH2, also known as hERG, and finally the sulfonylurea receptor 1 (ABCC8, also known as SUR1. We treated cells expressing these mutant proteins with 9 structurally diverse F508del-CFTR correctors that function through different cellular mechanisms and assessed whether correction occurred via immunoblotting and functional assays. Results were deemed significantly different from controls by a one-way ANOVA (p  Results Here we show that F508del-CFTR correctors RDR1, KM60 and KM57 also correct some mutant alleles of other protein trafficking diseases. We also show that one corrector, the cardiac glycoside ouabain, was found to alter the glycosylation of all mutant alleles tested. Conclusions Correctors of F508del-CFTR trafficking might have broader applications to other protein trafficking diseases.

  8. Mechanical tolerance stackup and analysis

    CERN Document Server

    Fischer, Bryan R

    2004-01-01

    BackgroundDimensioning and TolerancingTolerance Format and Decimal PlacesConverting Plus/Minus Dimensions and Tolerances into Equal Bilaterally Toleranced DimensionsVariation and Sources of VariationTolerance AnalysisWorst-case Tolerance StackupsStatistical Tolerance StackupsGeometric Dimensioning and Tolerancing (GD&T)Converting Plus/Minus Tolerancing to Positional Tolerancing and Projected Tolerance ZonesDiametral and Radial Tolerance StackupsSpecifying Material Condition Modifiers and Their Effect on Tolerance Stackups The Tolerance Stackup SketchThe Tolerance Stackup Report FormTolerance S

  9. Tolerance and chimerism.

    Science.gov (United States)

    Kolb, Hans-Jochem; Guenther, Wolfgang; Gyurkocza, Boglarka; Hoetzl, Florian; Simoes, Belinda; Falk, Christine; Schleuning, Michael; Ledderose, Georg

    2003-05-15

    Stem-cell transplantation from human leukocyte antigen (HLA)-haploidentical family members carries a high risk of rejection and graft-versus-host disease (GVHD) if donor and recipient differ by more than one HLA antigen. The authors have developed treatment protocols from studies in dog leukocyte antigen-haploidentical dogs that prevent rejection and modify GVHD to the extent that patients with aggressive hematologic neoplasia can be treated with success. Principal improvements have been achieved in the use of cyclophosphamide and total-body irradiation for conditioning and T-cell depletion for prevention of GVHD. More recently, the combination of marrow and CD6-depleted mobilized donor blood cells (MDBC) has been introduced for HLA-haploidentical transplantation on the basis that CD6-depleted MDBC contain immunoregulatory cells besides stem cells and natural killer cells. Clinical results are reported on 36 patients with high-risk hematologic neoplasia. The results encourage the use of HLA-haploidentical stem-cell transplantation at an earlier stage of the disease. This method could also be of use for tolerance induction in organ transplantation.

  10. Network topologies and dynamics leading to endotoxin tolerance and priming in innate immune cells.

    Directory of Open Access Journals (Sweden)

    Yan Fu

    Full Text Available The innate immune system, acting as the first line of host defense, senses and adapts to foreign challenges through complex intracellular and intercellular signaling networks. Endotoxin tolerance and priming elicited by macrophages are classic examples of the complex adaptation of innate immune cells. Upon repetitive exposures to different doses of bacterial endotoxin (lipopolysaccharide or other stimulants, macrophages show either suppressed or augmented inflammatory responses compared to a single exposure to the stimulant. Endotoxin tolerance and priming are critically involved in both immune homeostasis and the pathogenesis of diverse inflammatory diseases. However, the underlying molecular mechanisms are not well understood. By means of a computational search through the parameter space of a coarse-grained three-node network with a two-stage Metropolis sampling approach, we enumerated all the network topologies that can generate priming or tolerance. We discovered three major mechanisms for priming (pathway synergy, suppressor deactivation, activator induction and one for tolerance (inhibitor persistence. These results not only explain existing experimental observations, but also reveal intriguing test scenarios for future experimental studies to clarify mechanisms of endotoxin priming and tolerance.

  11. Reduced plasma levels of glucagon-like peptide-1 in elderly men are associated with impaired glucose tolerance but not with coronary heart disease

    DEFF Research Database (Denmark)

    Nathanson, D; Zethelius, B; Berne, C

    2009-01-01

    stimulated GLP-1 levels and: (1) cardiovascular risk factors (blood pressure, lipids, urinary albumin, waist circumference and insulin sensitivity index [M/I] assessed by euglycaemic-hyperinsulinaemic clamp); and (2) impaired glucose tolerance (IGT) and type 2 diabetes mellitus. RESULTS: During the follow......AIMS/HYPOTHESIS: Besides the insulinotropic effects of glucagon-like peptide-1 (GLP-1) mimetics, their effects on endothelial dysfunction and myocardial ischaemia are of interest. No previous study has investigated associations between plasma levels of GLP-1 and CHD. METHODS: We investigated...... longitudinal relationships of fasting GLP-1 with the dynamic GLP-1 response after OGTT (difference between 60 min OGTT-stimulated and fasting GLP-1 levels [DeltaGLP-1]) and CHD in a population-based cohort of 71-year-old men. In the same cohort, we also cross-sectionally investigated the association between...

  12. Heparin-bonded, expanded polytetrafluoroethylene-lined stent graft in the treatment of femoropopliteal artery disease: 1-year results of the VIPER (Viabahn Endoprosthesis with Heparin Bioactive Surface in the Treatment of Superficial Femoral Artery Obstructive Disease) trial.

    Science.gov (United States)

    Saxon, Richard R; Chervu, Arun; Jones, Paul A; Bajwa, Tanvir K; Gable, Dennis R; Soukas, Peter A; Begg, Richard J; Adams, John G; Ansel, Gary M; Schneider, Darren B; Eichler, Charles M; Rush, Michael J

    2013-02-01

    To evaluate the performance of a heparin-bonded, expanded polytetrafluoroethylene (ePTFE)-lined nitinol endoprosthesis in the treatment of long-segment occlusive disease of the femoropopliteal artery (FPA) and to identify factors associated with loss of patency. In a single-arm, prospective, 11-center study (VIPER [Gore Viabahn Endoprosthesis with Heparin Bioactive Surface in the Treatment of Superficial Femoral Artery Obstructive Disease] trial), 119 limbs (113 patients; 69 men; mean age, 67 y), including 88 with Rutherford category 3-5 disease and 72 with Inter-Society Consensus for the Management of Peripheral Arterial Disease (TASC II) C or D lesions of the FPA, underwent stent graft implantation. The mean lesion length was 19 cm; 56% of lesions were occlusions. Follow-up evaluations included color duplex ultrasonography in all patients, with patency defined as a peak systolic velocity ratio20% was 70% (P = .047). Primary patency was not significantly affected by device diameter (5 vs 6 vs 7 mm) or lesion length (≤20 cm vs>20 cm). The 30-day major adverse event rate was 0.8%. The heparin-bonded, ePTFE/nitinol stent graft provided clinical improvement and a primary patency rate of 73% at 1 year in the treatment of long-segment FPA disease. Careful sizing of the device relative to vessel landing zones is essential for achieving optimal outcomes. Copyright © 2013 SIR. Published by Elsevier Inc. All rights reserved.

  13. My Retina Tracker™: An On-line International Registry for People Affected with Inherited Orphan Retinal Degenerative Diseases and their Genetic Relatives - A New Resource.

    Science.gov (United States)

    Fisher, Joan K; Bromley, Russell L; Mansfield, Brian C

    2016-01-01

    My Retina Tracker™ is a new on-line registry for people affected with inherited orphan retinal degenerative diseases, and their unaffected, genetic relatives. Created and supported by the Foundation Fighting Blindness, it is an international resource designed to capture the disease from the perspective of the registry participant and their retinal health care providers. The registry operates under an Institutional Review Board (IRB)-approved protocol and allows sharing of de-identified data with participants, researchers and clinicians. All participants sign an informed consent that includes selecting which data they wish to share. There is no minimum age of participation. Guardians must sign on behalf of minors, and children between the ages of 12 to 17 also sign an informed assent. Participants may compare their disease to others in the registry using graphical interpretations of the aggregate registry data. Researchers and clinicians have two levels of access. The first provides an interface to interrogate all data fields registrants have agreed to share based on their answers in the IRB informed consent. The second provides a route to contact people in the registry who may be eligible for studies or trials, through the Foundation.

  14. Relative disease susceptibility and clostridial toxin antibody responses in three commercial broiler lines co-infected with Clostridium perfringens and Eimeria maxima using an experimental model of necrotic enteritis

    Science.gov (United States)

    Necrotic enteritis is an enteric disease of poultry resulting from infection by Clostridium perfringens with co-infection by Eimeria spp. constituting a major risk factor for disease pathogenesis. This study compared three commercial broiler chicken lines using an experimental model of necrotic ente...

  15. Inheritance and Heritability of Heat Tolerance in Several Sorghum ...

    African Journals Online (AJOL)

    Four sorghum parental lines, RTx430, BTx3197, RTx7000, and B35 and their F1 and reciprocals, and F2 progenies were evaluated during their reproductive phases to access the genetic basis of heat tolerance. Heat tolerance was measured under field and greenhouse conditions at College Station, Texas during 1990.

  16. Review of tolerances at the Final Focus Test Beam

    International Nuclear Information System (INIS)

    Bulos, F.; Burke, D.; Helm, R.; Irwin, J.; Roy, G.; Yamamoto, N.

    1991-01-01

    The authors review the tolerances associated with the Final Focus Test Beam (FFTB). The authors have computed the acceptability window of the input beam for orbit jitter, emittance beta functions mismatch, incoming dispersion and coupling; tolerances on magnet alignment, strength and multipole content; and the initial tuneability capture of the line

  17. Review of tolerances at the Final Focus Test Beam

    International Nuclear Information System (INIS)

    Bulos, F.; Burke, D.; Helm, R.; Irwin, J.; Roy, G.; Yamamoto, N.

    1991-05-01

    We review the tolerances associated with the Final Focus Test Beam (FFTB). We have computed the acceptability window of the input beam for orbit jitter, emittance beta functions mismatch, incoming dispersion and coupling; tolerances on magnet alignment, strength and multipole content; and the initial tuneability capture of the line. 2 refs., 1 fig

  18. Inheritance of photochemical air pollution tolerance in petunias

    Energy Technology Data Exchange (ETDEWEB)

    Hanson, G.P.; Addis, D.H.; Thorne, L.

    1976-12-01

    Seven commercial inbred lines of pink flowered multiflora petunia (Petunia hybrida Vilm.) which differed widely in degrees of tolerance to photochemical oxidants were crossed in all possible combinations to yield a complete diallel cross. Sibling representatives of all 49 possible hybrids were then separately subjected to ozone (O/sub 3/), peroxyacetyl nitrate (PAN), and ambient oxidants at Arcadia, California. The seedlings were scored for tolerance to each pollutant and the inheritance of tolerance to each pollutant was studied. At the ambient levels of photochemical oxidants encountered, PAN more severely injured the petunias than did the O/sub 3/ component. Hybrids tolerant to one oxidant were not necessarily tolerant to the other. The genes which contributed photochemical oxidant tolerance in petunia acted primarily in an additive manner with some indication of partial dominance for tolerance. Gene interaction was evident in the expression of petunia sensitivity to PAN.

  19. A 24-Week, Randomized, Controlled Study to Evaluate the Tolerability, Safety and Efficacy of 2 Different Titration Schemes of the Rivastigmine Patch in Japanese Patients with Mild to Moderate Alzheimer's Disease

    Directory of Open Access Journals (Sweden)

    Yu Nakamura

    2015-09-01

    Full Text Available Aim: To investigate whether 1-step titration of the rivastigmine patch (initiated at 5 cm2 and titrated to 10 cm2 after 4 weeks is well tolerated in Japanese patients with Alzheimer's disease (AD as compared to 3-step titration (initiated at 2.5 cm2 and titrated by 2.5 cm2 every 4 weeks to 10 cm2. Methods: A 24-week, multicenter, randomized, double-blind study was conducted in Japan between July 2012 and May 2014. Patients with mild to moderate AD aged 50-85 years were randomized 1:1 to 1-step or 3-step titration of the rivastigmine once-daily patch. The primary endpoint was the proportion of patients with adverse events leading to discontinuation. Results: Of 216 patients randomized, 215 (1-step, n = 107; 3-step, n = 108 were included in the safety analysis. The primary endpoint outcome was 15.0% in the 1-step group and 18.5% in the 3-step group. The observed treatment difference was −3.6% (95% confidence interval: −17.0, 9.6, falling within the prespecified acceptance range. Conclusion: The tolerability of two different titration schemes was similar in Japanese patients with AD.

  20. Instruments for oral disease-intervention strategies : recombinant Lactobacillus casei expressing tetanus toxin fragment C for vaccination or myelin proteins for oral tolerance induction in multiple sclerosis

    NARCIS (Netherlands)

    Maassen, C.B.M.; Laman, J.D.; Heijne den Bak-Glashouwer, M.J.; Tielen, F.J.; Holten-Neelen, J.C.P.A. van; Hoogteijling, L.; Antonissen, C.; Leer, R.J.; Pouwels, P.H.; Boersma, W.J.A.; Shaw, D.M.

    1999-01-01

    Lactobacillus strains possess properties that make them attractive candidates as vehicles for oral administration of therapeutics. In this report we describe the construction and analysis of recombinant Lactobacillus casei applicable in oral vaccination against an infectious disease (tetanus) and in

  1. LONG-TERM BENEFITS OF REHABILITATION AT HOME ON QUALITY-OF-LIFE AND EXERCISE TOLERANCE IN PATIENTS WITH CHRONIC OBSTRUCTIVE PULMONARY-DISEASE

    NARCIS (Netherlands)

    WIJKSTRA, PJ; TENVERGERT, EM; VANALTENA, R; OTTEN, [No Value; KRAAN, J; POSTMA, DS; KOETER, GH

    Background - Pulmonary rehabilitation has been shown to have short term subjective and objective benefits for patients with chronic obstructive pulmonary disease (COPD). However, appropriately controlled studies have not previously been performed, nor have the benefits of different types of

  2. Cloning of fusion protein gene of Newcastle disease virus into a baculovirus derived bacmid shuttle vector, in order to express it in insect cell line

    Directory of Open Access Journals (Sweden)

    Hashemzadeh MS

    2015-05-01

    Full Text Available Abstract Background: Newcastle disease virus (NDV is one of the major pathogens in poultry and vaccination is intended to control the disease, as an effective solution, yet. Fusion protein (F on surface of NDV, has a fundamental role in virus pathogenicity and can induce protective immunity, alone. With this background, here our aim was to construct a baculovirus derived recombinant bacmid shuttle vector (encoding F-protein in order to express it in insect cell line. Materials and Methods: In this experimental study, at first complete F gene from avirulent strain La Sota of NDV was amplified by RT-PCR to produce F cDNA. The amplicon was cloned into T/A cloning vector and afterwards into pFastBac Dual donor plasmid. After the verification of cloning process by two methods, PCR and enzymatic digestion analysis, the accuracy of F gene sequence was confirmed by sequencing. Finally, F-containing recombinant bacmid was subsequently generated in DH10Bac cell and the construct production was confirmed by a special PCR panel, using F specific primers and M13 universal primers. Results: Analysis of confirmatory tests showed that the recombinant bacmid, expressing of F-protein gene in correct sequence and framework, has been constructed successfully. Conclusion: The product of this F-containing recombinant bacmid, in addition to its independent application in the induction of protective immunity, can be used with the other individual recombinant baculoviruses, expressing HN and NP genes to produce NDV-VLPs in insect cell line.

  3. In vitro mutation breeding for salinity tolerance in Citrus

    International Nuclear Information System (INIS)

    Deng Zhanao; Zhang Wencai; Wan Shuyan

    1989-01-01

    Full text: Mutation breeding began in the 1970's, concentrating on early ripening and high quality spontaneous mutants, subsequently on the induction of seedless mutants by gamma radiation and other mutagens. Extremely early cultivars 'Guoqing 1 to 5' have been obtained from bud mutations in satsuma mandarin and are grown commercially. Other desirable mutants have been found in progenies from gamma ray treated budwood. Recently we introduced plant tissue and cell culture techniques hoping to avoid chimerism and diplontic selection and to obtain solid mutants in a shorter time, resistant to salt, herbicides, low temperature and diseases. I. Methods for cell and protoplast culture. Ovules from fruitlets 1-6 weeks after flowering, cultured in MT supplemented with IAA 0.1 mg/I and KT 1.0 mg/l, gradually produce callus from nucelli. After several passages, habituated callus lines are obtained, which grow very well in MT medium without any growth substances. These callus lines, regardless of the species and cultivars are white, friable, composed of cell clumps of various size and highly embryogenic. When transferred to MT medium containing 2% glycerol and caseinhydrolysat 400 mg/l, they become green and form numerous green globular embryoids within one month. Most of the embryoids derive from single cells. The embryoids could develop roots and shoots forming large numbers of plantlets in a fresh medium. Habituated callus lines have been established in 5 cultivars. Their high embryogenic capacity of single cell origin provides good material for mutation induction. For obtaining protoplasts, the habituated calluses were transferred into liquid MT medium and cultured for two passages on a shaker, then they were macerated with enzyme solution containing 0.3%-0.5% pectinase, 0.3%-0.5% cellulase, MT macroelements and 0.7 M mannitol, at 5.7 pH. After incubation at 25 deg. C for 12-16 hrs., a large number of viable protoplasts could be collected. They were resuspended to a

  4. Safety and tolerability of the novel non-steroidal mineralocorticoid receptor antagonist BAY 94-8862 in patients with chronic heart failure and mild or moderate chronic kidney disease

    DEFF Research Database (Denmark)

    Pitt, Bertram; Kober, Lars; Ponikowski, Piotr

    2013-01-01

    Mineralocorticoid receptor antagonists (MRAs) improve outcomes in patients with heart failure and reduced left ventricular ejection fraction (HFrEF), but their use is limited by hyperkalaemia and/or worsening renal function (WRF). BAY 94-8862 is a highly selective and strongly potent non-steroida......Mineralocorticoid receptor antagonists (MRAs) improve outcomes in patients with heart failure and reduced left ventricular ejection fraction (HFrEF), but their use is limited by hyperkalaemia and/or worsening renal function (WRF). BAY 94-8862 is a highly selective and strongly potent non......-steroidal MRA. We investigated its safety and tolerability in patients with HFrEF associated with mild or moderate chronic kidney disease (CKD)....

  5. Toleration out of respect?

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2013-01-01

    Under conditions of pluralism different cultures, interests or values can come into conflict, which raises the problem of how to secure peaceful co-existence. The idea of toleration historically emerged as an answer to this problem. Recently Rainer Forst has argued that toleration should not just...... be based on a modus vivendi designed to secure peaceful co-existence, but should be based on moral reasons. Forst therefore advances what he calls the ‘respect conception’ of toleration as an in itself morally desirable type of relationship, which is furthermore the only conception of toleration...... that avoids various so-called ‘paradoxes of toleration’. The paper first examines whether Forst’s respect conception can be applied descriptively to distinguish between actual patterns of behaviour and classify different acts of toleration. Then the focus is shifted to toleration out of respect as a normative...

  6. Tolerance in Drosophila

    OpenAIRE

    Atkinson, Nigel S.

    2009-01-01

    The set of genes that underlie ethanol tolerance (inducible resistance) are likely to overlap with the set of genes responsible for ethanol addiction. Whereas addiction is difficult to recognize in simple model systems, behavioral tolerance is readily identifiable and can be induced in large populations of animals. Thus, tolerance lends itself to analysis in model systems with powerful genetics. Drosophila melanogaster has been used by a variety of laboratories for the identification of genes...

  7. A 24-Week, Randomized, Double-Blind, Placebo-Controlled Study to Evaluate the Efficacy, Safety and Tolerability of the Rivastigmine Patch in Japanese Patients with Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Yu Nakamura

    2011-06-01

    Full Text Available Background: As of 2010, the rivastigmine patch was licensed for the treatment of Alzheimer’s disease (AD in 64 countries. Methods: This 24-week, multicenter, randomized, double-blind, placebo-controlled study evaluated the efficacy, safety and tolerability of the 5-cm2 (9-mg loading dose; 4.6 mg/24 h delivery rate and 10-cm2 (18-mg loading dose; 9.5 mg/24 h delivery rate rivastigmine patch in Japanese patients with AD. Results: In the primary analysis population (intent-to-treat last observation carried forward at week 24, delayed deterioration was seen with the 10-cm2 patch versus placebo on the Japanese version of the Alzheimer’s Disease Assessment Scale-cognitive subscale (ADAS-J cog; p = 0.005 and the Japanese version of the Clinician’s Interview-Based Impression of Change plus Caregiver Input (CIBIC plus-J; p = 0.067. Participants receiving the rivastigmine patch showed numerically less decline versus placebo at week 24 on the CIBIC plus-J, although this did not reach statistical significance. Statistical significance for the CIBIC plus-J was met following adjustment for body weight and baseline Mini-Mental State Examination score as dynamic allocation factors (p = 0.042 and on the Disability Assessment for Dementia (DAD; p = 0.024 and Mental Function Impairment (MENFIS; p = 0.016 subscales. Serious adverse events were rare and were consistent with the known safety profile of the rivastigmine patch. Conclusion: The rivastigmine patch has a favorable efficacy and tolerability profile in Japanese patients with AD.

  8. The safety, tolerability, and efficacy of once-daily memantine (28 mg): a multinational, randomized, double-blind, placebo-controlled trial in patients with moderate-to-severe Alzheimer's disease taking cholinesterase inhibitors.

    Science.gov (United States)

    Grossberg, George T; Manes, Facundo; Allegri, Ricardo F; Gutiérrez-Robledo, Luis Miguel; Gloger, Sergio; Xie, Lei; Jia, X Daniel; Pejović, Vojislav; Miller, Michael L; Perhach, James L; Graham, Stephen M

    2013-06-01

    Immediate-release memantine (10 mg, twice daily) is approved in the USA for moderate-to-severe Alzheimer's disease (AD). This study evaluated the efficacy, safety, and tolerability of a higher-dose, once-daily, extended-release formulation in patients with moderate-to-severe AD concurrently taking cholinesterase inhibitors. In this 24-week, double-blind, multinational study (NCT00322153), outpatients with AD (Mini-Mental State Examination scores of 3-14) were randomized to receive once-daily, 28-mg, extended-release memantine or placebo. Co-primary efficacy parameters were the baseline-to-endpoint score change on the Severe Impairment Battery (SIB) and the endpoint score on the Clinician's Interview-Based Impression of Change Plus Caregiver Input (CIBIC-Plus). The secondary efficacy parameter was the baseline-to-endpoint score change on the 19-item Alzheimer's Disease Cooperative Study-Activities of Daily Living (ADCS-ADL19); additional parameters included the baseline-to-endpoint score changes on the Neuropsychiatric Inventory (NPI) and verbal fluency test. Data were analyzed using a two-way analysis of covariance model, except for CIBIC-Plus (Cochran-Mantel-Haenszel test). Safety and tolerability were assessed through adverse events and physical and laboratory examinations. A total of 677 patients were randomized to receive extended-release memantine (n = 342) or placebo (n = 335); completion rates were 79.8 and 81.2 %, respectively. At endpoint (week 24, last observation carried forward), memantine-treated patients significantly outperformed placebo-treated patients on the SIB (least squares mean difference [95 % CI] 2.6 [1.0, 4.2]; p = 0.001), CIBIC-Plus (p = 0.008), NPI (p = 0.005), and verbal fluency test (p = 0.004); the effect did not achieve significance on ADCS-ADL19 (p = 0.177). Adverse events with a frequency of ≥5.0 % that were more prevalent in the memantine group were headache (5.6 vs. 5.1 %) and diarrhea (5.0 vs. 3.9

  9. Tolerability and Safety of Souvenaid in Patients with Mild Alzheimer's Disease: Results of Multi-Center, 24-Week, Open-Label Extension Study

    NARCIS (Netherlands)

    Rikkert, M.G.M.O.; Verhey, F.R.J.; Blesa, R.; von Arnim, C.A.F.; Bongers, A.; Harrison, J.; Sijben, J.; Scarpini, E.; Vandewoude, M.F.J.; Vellas, B.; Witkamp, R.; Kamphuis, P.J.G.H.; Scheltens, P.

    2015-01-01

    Background: The medical food Souvenaid, containing the specific nutrient combination Fortasyn Connect, is designed to improve synapse formation and function in patients with Alzheimer's disease (AD). Two double-blind randomized controlled trials (RCT) with Souvenaid of 12 and 24 week duration

  10. Tolerability and safety of souvenaid in patients with mild Alzheimer's disease: results of multi-center, 24-week, open-label extension study

    NARCIS (Netherlands)

    Olde Rikkert, M.G.M.; Verhey, F.R.J.; Blesa, R.; Arnim, C.A. von; Bongers, A.; Harrison, J.; Sijben, J.; Scarpini, E.; Vandewoude, M.F.; Vellas, B.; Witkamp, R.; Kamphuis, P.J.; Scheltens, P.

    2015-01-01

    BACKGROUND: The medical food Souvenaid, containing the specific nutrient combination Fortasyn Connect, is designed to improve synapse formation and function in patients with Alzheimer's disease (AD). Two double-blind randomized controlled trials (RCT) with Souvenaid of 12 and 24 week duration

  11. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  12. Compromise and Toleration

    DEFF Research Database (Denmark)

    Rostbøll, Christian F.

    Political compromise is akin to toleration, since both consist of an "agreement to disagree." Compromise and toleration also share a predicament of being regarded as ambiguous virtues that require of us to accept something we actually regard as wrong. However, we misunderstand the nature, justifi...... in compromise are more stringent than those for being tolerated. Still, the limits of compromise cannot be drawn to narrowly if it is to remain its value as a form of agreement that respects and embodies the differences of opinion in society.......Political compromise is akin to toleration, since both consist of an "agreement to disagree." Compromise and toleration also share a predicament of being regarded as ambiguous virtues that require of us to accept something we actually regard as wrong. However, we misunderstand the nature......, justification, and limits of compromise if we see it merely as a matter of toleration. While toleration is mainly a matter of accepting citizens' equal right to co-existence as subjects to law, political compromise includes the parties in making law – it makes them co-authors of law. Toleration entails...

  13. Tolerances in micro manufacturing

    DEFF Research Database (Denmark)

    Hansen, Hans Nørgaard; Zhang, Yang; Islam, Aminul

    This paper describes a method for analysis of tolerances in micro manufacturing. It proposes a mapping oftolerances to dimensions and compares this with current available international standards. The analysisdocuments that tolerances are not scaled down as the absolute dimension. In practice...

  14. Fault tolerant computing systems

    International Nuclear Information System (INIS)

    Randell, B.

    1981-01-01

    Fault tolerance involves the provision of strategies for error detection damage assessment, fault treatment and error recovery. A survey is given of the different sorts of strategies used in highly reliable computing systems, together with an outline of recent research on the problems of providing fault tolerance in parallel and distributed computing systems. (orig.)

  15. Toleration out of respect?

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2014-01-01

    be based on a modus vivendi designed to secure peaceful co-existence, but should be based on moral reasons. Forst therefore advances what he calls the ‘respect conception’ of toleration as an in itself morally desirable type of relationship, which is furthermore the only conception of toleration...

  16. Recognition and Toleration

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2010-01-01

    Recognition and toleration are ways of relating to the diversity characteristic of multicultural societies. The article concerns the possible meanings of toleration and recognition, and the conflict that is often claimed to exist between these two approaches to diversity. Different forms or inter...

  17. Comparison of efficacy and tolerance between combination therapy and monotherapy as first-line chemotherapy in elderly patients with advanced gastric cancer: Study protocol for a randomized controlled trial.

    Science.gov (United States)

    Lee, Keun-Wook; Zang, Dae Young; Ryu, Min-Hee; Kim, Ki Hyang; Kim, Mi-Jung; Han, Hye Sook; Koh, Sung Ae; Park, Jin Hyun; Kim, Jin Won; Nam, Byung-Ho; Choi, In Sil

    2017-12-01

    The combination of a fluoropyrimidine [5-fluorouracil (5-FU), capecitabine, or S-1] with a platinum analog (cisplatin or oxaliplatin) is the most widely accepted first-line chemotherapy regimen for metastatic or recurrent advanced gastric cancer (AGC), based on the results of clinical trials. However, there is little evidence to guide chemotherapy for elderly patients with AGC because of under-representation of this age group in clinical trials. Thus, the aim of this study is to determine the optimal chemotherapy regimen for elderly patients with AGC by comparing the efficacies and safeties of combination therapy versus monotherapy as first-line chemotherapy. This study is a randomized, controlled, multicenter, phase III trial. A total of 246 elderly patients (≥70 years old) with metastatic or recurrent AGC who have not received previous palliative chemotherapy will be randomly allocated to a combination therapy group or a monotherapy group. Patients randomized to the combination therapy group will receive fluoropyrimidine plus platinum combination chemotherapy (capecitabine/cisplatin, S-1/cisplatin, capecitabine/oxaliplatin, or 5-FU/oxaliplatin), and those randomized to the monotherapy group will receive fluoropyrimidine monotherapy (capecitabine, S-1, or 5-FU). The primary outcome is the overall survival of patients in each treatment group. The secondary outcomes include progression-free survival, response rate, quality of life, and safety. We are conducting this pragmatic trial to determine whether elderly patients with AGC will obtain the same benefit from chemotherapy as younger patients. We expect that this study will help guide decision-making for the optimal treatment of elderly patients with AGC.

  18. Remember Tolerance Differently

    DEFF Research Database (Denmark)

    Tønder, Lars

    2012-01-01

    This essay questions the linear conception of history which often accompanies the way contemporary democratic theory tends to disavow tolerance's discontinuities and remainders. In the spirit of Foucault's genealogy of descent, the idea is to develop a new sense of tolerance's history, not by inv......This essay questions the linear conception of history which often accompanies the way contemporary democratic theory tends to disavow tolerance's discontinuities and remainders. In the spirit of Foucault's genealogy of descent, the idea is to develop a new sense of tolerance's history......, not by invoking a critique external to contemporary democratic theory, but by witnessing the history of tolerance paraliptically, with an eye to what it obscures and yet presupposes....

  19. Removing celiac disease-related gluten proteins from bread wheat while retaining technological properties: a study with Chinese Spring deletion lines.

    Science.gov (United States)

    van den Broeck, Hetty C; van Herpen, Teun W J M; Schuit, Cees; Salentijn, Elma M J; Dekking, Liesbeth; Bosch, Dirk; Hamer, Rob J; Smulders, Marinus J M; Gilissen, Ludovicus J W J; van der Meer, Ingrid M

    2009-04-07

    Gluten proteins can induce celiac disease (CD) in genetically susceptible individuals. In CD patients gluten-derived peptides are presented to the immune system, which leads to a CD4+ T-cell mediated immune response and inflammation of the small intestine. However, not all gluten proteins contain T-cell stimulatory epitopes. Gluten proteins are encoded by multigene loci present on chromosomes 1 and 6 of the three different genomes of hexaploid bread wheat (Triticum aestivum) (AABBDD). The effects of deleting individual gluten loci on both the level of T-cell stimulatory epitopes in the gluten proteome and the technological properties of the flour were analyzed using a set of deletion lines of Triticum aestivum cv. Chinese Spring. The reduction of T-cell stimulatory epitopes was analyzed using monoclonal antibodies that recognize T-cell epitopes present in gluten proteins. The deletion lines were technologically tested with respect to dough mixing properties and dough rheology. The results show that removing the alpha-gliadin locus from the short arm of chromosome 6 of the D-genome (6DS) resulted in a significant decrease in the presence of T-cell stimulatory epitopes but also in a significant loss of technological properties. However, removing the omega-gliadin, gamma-gliadin, and LMW-GS loci from the short arm of chromosome 1 of the D-genome (1DS) removed T-cell stimulatory epitopes from the proteome while maintaining technological properties. The consequences of these data are discussed with regard to reducing the load of T-cell stimulatory epitopes in wheat, and to contributing to the design of CD-safe wheat varieties.

  20. Removing celiac disease-related gluten proteins from bread wheat while retaining technological properties: a study with Chinese Spring deletion lines

    Directory of Open Access Journals (Sweden)

    Bosch Dirk

    2009-04-01

    Full Text Available Abstract Background Gluten proteins can induce celiac disease (CD in genetically susceptible individuals. In CD patients gluten-derived peptides are presented to the immune system, which leads to a CD4+ T-cell mediated immune response and inflammation of the small intestine. However, not all gluten proteins contain T-cell stimulatory epitopes. Gluten proteins are encoded by multigene loci present on chromosomes 1 and 6 of the three different genomes of hexaploid bread wheat (Triticum aestivum (AABBDD. Results The effects of deleting individual gluten loci on both the level of T-cell stimulatory epitopes in the gluten proteome and the technological properties of the flour were analyzed using a set of deletion lines of Triticum aestivum cv. Chinese Spring. The reduction of T-cell stimulatory epitopes was analyzed using monoclonal antibodies that recognize T-cell epitopes present in gluten proteins. The deletion lines were technologically tested with respect to dough mixing properties and dough rheology. The results show that removing the α-gliadin locus from the short arm of chromosome 6 of the D-genome (6DS resulted in a significant decrease in the presence of T-cell stimulatory epitopes but also in a significant loss of technological properties. However, removing the ω-gliadin, γ-gliadin, and LMW-GS loci from the short arm of chromosome 1 of the D-genome (1DS removed T-cell stimulatory epitopes from the proteome while maintaining technological properties. Conclusion The consequences of these data are discussed with regard to reducing the load of T-cell stimulatory epitopes in wheat, and to contributing to the design of CD-safe wheat varieties.

  1. The Role of Heat Tolerance Testing in Recovery and Return to Duty

    Science.gov (United States)

    2008-10-01

    CV diseases Hyperthyroidism Pheochromocytoma Infectious diseases Diabetes mellitus Psychiatric illness Parkinsonism Congenital abnormalities: CF...environments. To assess the heat tolerance status of prior heat stroke patient. Heat tolerance test (HTT) “HTT was effective in evaluating the heat tolerance

  2. Benefits of use, and tolerance of, medium-chain triglyceride medical food in the management of Japanese patients with Alzheimer’s disease: a prospective, open-label pilot study

    Directory of Open Access Journals (Sweden)

    Ohnuma T

    2016-01-01

    Full Text Available Tohru Ohnuma, Aiko Toda, Ayako Kimoto, Yuto Takebayashi, Ryoko Higashiyama, Yuko Tagata, Masanobu Ito, Tsuneyoshi Ota, Nobuto Shibata, Heii Arai Department of Psychiatry, Juntendo University Alzheimer’s Disease Project, Faculty of Medicine, Juntendo University, Tokyo, Japan Objectives: This is the first clinical trial of this type in Japan, designed to analyze two important aspects of Alzheimer’s disease (AD management using medium-chain triglycerides. Axona was administered for 3 months (40 g of powder containing 20 g of caprylic triglycerides. We used an indurating, four-step dose-titration method (from 10 to 40 g per day for 7 days before the trial, and examined the tolerance and adverse effects of this intervention. We also investigated its effect on cognitive function in mild-to-moderate AD patients.Patients and methods: This was a clinical intervention in 22 Japanese patients with sporadic AD at a mild-to-moderate stage (ten females, 12 males, mean age (± standard deviation 63.9 (±8.5 years, Mini-Mental State Examination (MMSE score, 10–25, seven patients were ApoE4-positive. During Axona administration, we examined changes in cognitive function by obtaining MMSE and AD assessment-scale scores. Intolerance and serum ketone concentrations were also examined.Results: The tolerance of Axona was good, without severe gastrointestinal adverse effects. Axona did not improve cognitive function in our sample of AD patients, even in those patients without the ApoE4 allele. However, some ApoE4-negative patients with baseline MMSE score ≥14 showed improvement in their cognitive functions.Conclusion: The modified dose-titration method, starting with a low dose of Axona, decreased gastrointestinal adverse effects in Japanese patients. Axona might be effective for some relatively mildly affected patients with AD (with cognitive function MMSE score of ≥14 and lacking the ApoE4 allele. Keywords: Alzheimer’s disease, medium-chain triglycerides

  3. Seasonal incidence of lameness and risk factors associated with thin soles, white line disease, ulcers, and sole punctures in dairy cattle.

    Science.gov (United States)

    Sanders, A H; Shearer, J K; De Vries, A

    2009-07-01

    Lameness is a multifactorial condition with many causes. In this study, cow lifetime records were used to quantify the incidence of specific lameness-causing lesions and investigate factors associated with those lesions. Of primary interest were the effects of seasonality and the effects of thin soles (TS). Thin sole-induced toe ulcers (TSTU) occurring adjacent to the white line in the apical portion of the weight-bearing surface were distinguished from white line disease (WLD) occurring in the region of the abaxial heel sole junction. Sole (SU), heel (HU), and toe (TU) ulcers; TS; sole punctures (SP); leg injuries (INJ); and other (OTH) lesions (e.g., infectious diseases, laminitis, unclassified hemorrhage) were also considered. Data were collected from May 2004 through October 2007 and included records for 4,915 cows of which 1,861 had at least one recorded lameness event. Of these, 20% were TSTU, 20% OTH, 16% SU, 13% TS, 10% WLD, 8% HU, 6% INJ, 4% SP, and 2% TU. Annual incidence risk for lameness was 49.1%. Overall incidence rate for lameness was 1.41/1,000 cow-days, and rates for all lesions were highest in the summer. As parity increased, so did incidence rates for TS, SU, WLD, HU, and INJ. For TS, TSTU, and WLD, incidence rates were lowest in early lactation (16 to 60 DIM), whereas for SU, HU, TU, incidence rates were highest in mid lactation (61 to 150 DIM). Cox proportional hazard models for TS, TSTU, WLD, SU, HU, TU, and SP included age and year of first calving and milk production capacity. Prior/concurrent lameness events, season, parity, and stage of lactation were included as time-dependent effects. Prior/concurrent TS increased the hazard for all other lesions, particularly TSTU, and HU. Having any other prior claw lesion also increased the hazard for all lesions. Hazard was highest in summer for all lesions except TU. Stage of lactation was a significant effect in hazard of TSTU, which was lowest in mid lactation (61 to 150 DIM).

  4. Efeitos da suplementação oral de L-carnitina associada ao treinamento físico na tolerância ao exercício de pacientes com doença pulmonar obstrutiva crônica Influence of oral L-carnitine supplementation combined with physical training on exercise tolerance in patients with chronic obstructive pulmonary disease

    Directory of Open Access Journals (Sweden)

    Audrey Borghi Silva

    2003-12-01

    Full Text Available INTRODUÇÃO: Pacientes portadores de doença pulmonar obstrutiva crônica apresentam redução da tolerância ao exercício físico, principalmente devido à limitação ventilatória. A L-carnitina tem sido utilizada com o objetivo de melhorar a capacidade aeróbia de pacientes com doenças crônicas, porém não existem estudos em pacientes portadores de doença pulmonar obstrutiva crônica. OBJETIVO: Avaliar a influência da suplementação de L-carnitina, associada ao treinamento físico por seis semanas, três vezes por semana em pacientes portadores de doença pulmonar obstrutiva crônica. MÉTODO: A amostra foi constituída de 30 pacientes portadores de doença pulmonar obstrutiva crônica (69 ± 7 anos com volume expiratório forçado no primeiro segundo BACKGROUND: Patients with chronic obstructive pulmonary disease usually present intolerance to physical exertion due to ventilatory limitation. L-carnitine has been used to enhance aerobic capacity in patients with chronic diseases, but no study seems to be available for this patient population. OBJECTIVE: To evaluate the influence of L-carnitine supplementation (2 g/day in chronic obstructive pulmonary disease patients undergoing physical training three times a week for six weeks. METHOD: Patients (mean age 69 ± 7 years, n = 30 with stable chronic obstructive pulmonary disease and < 65% of predicted forced expiratory volume in 1 second (FEV1 were separated into three groups of 10 patients each. Group 1 (G1, n = 10 received physical training and L-carnitine (2 g/day, group 2 (G2, n = 10 received physical training and placebo, and group 3 (G3, n = 10 received only L-carnitine (2 g/day. Spirometry and a 6-minute walking distance test were performed before and after intervention. Plasma levels of free carnitine were measured at the beginning and end of the study. RESULTS: A significant increase in walking distance was found only in G1 and G2 (421 ± 100 to 508 ± 80.7 and 496 ± 78.7 to

  5. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  6. A Multirelational Account of Toleration

    DEFF Research Database (Denmark)

    Ferretti, Maria Paola; Lægaard, Sune

    2013-01-01

    Toleration classically denotes a relation between two agents that is characterised by three components: objection, power, and acceptance overriding the objection. Against recent claims that classical toleration is not applicable in liberal democracies and that toleration must therefore either be ...

  7. The Effect of Adding Comorbidities to Current Centers for Disease Control and Prevention Central-Line-Associated Bloodstream Infection Risk-Adjustment Methodology.

    Science.gov (United States)

    Jackson, Sarah S; Leekha, Surbhi; Magder, Laurence S; Pineles, Lisa; Anderson, Deverick J; Trick, William E; Woeltje, Keith F; Kaye, Keith S; Stafford, Kristen; Thom, Kerri; Lowe, Timothy J; Harris, Anthony D

    2017-09-01

    BACKGROUND Risk adjustment is needed to fairly compare central-line-associated bloodstream infection (CLABSI) rates between hospitals. Until 2017, the Centers for Disease Control and Prevention (CDC) methodology adjusted CLABSI rates only by type of intensive care unit (ICU). The 2017 CDC models also adjust for hospital size and medical school affiliation. We hypothesized that risk adjustment would be improved by including patient demographics and comorbidities from electronically available hospital discharge codes. METHODS Using a cohort design across 22 hospitals, we analyzed data from ICU patients admitted between January 2012 and December 2013. Demographics and International Classification of Diseases, Ninth Edition, Clinical Modification (ICD-9-CM) discharge codes were obtained for each patient, and CLABSIs were identified by trained infection preventionists. Models adjusting only for ICU type and for ICU type plus patient case mix were built and compared using discrimination and standardized infection ratio (SIR). Hospitals were ranked by SIR for each model to examine and compare the changes in rank. RESULTS Overall, 85,849 ICU patients were analyzed and 162 (0.2%) developed CLABSI. The significant variables added to the ICU model were coagulopathy, paralysis, renal failure, malnutrition, and age. The C statistics were 0.55 (95% CI, 0.51-0.59) for the ICU-type model and 0.64 (95% CI, 0.60-0.69) for the ICU-type plus patient case-mix model. When the hospitals were ranked by adjusted SIRs, 10 hospitals (45%) changed rank when comorbidity was added to the ICU-type model. CONCLUSIONS Our risk-adjustment model for CLABSI using electronically available comorbidities demonstrated better discrimination than did the CDC model. The CDC should strongly consider comorbidity-based risk adjustment to more accurately compare CLABSI rates across hospitals. Infect Control Hosp Epidemiol 2017;38:1019-1024.

  8. Functional analysis of variant lysosomal acid glycosidases of Anderson-Fabry and Pompe disease in a human embryonic kidney epithelial cell line (HEK 293 T).

    Science.gov (United States)

    Ebrahim, Hatim Y; Baker, Robert J; Mehta, Atul B; Hughes, Derralynn A

    2012-03-01

    The functional significance of missense mutations in genes encoding acid glycosidases of lysosomal storage disorders (LSDs) is not always clear. Here we describe a method of investigating functional properties of variant enzymes in vitro using a human embryonic kidney epithelial cell line. Site-directed mutagenesis was performed on the parental plasmids containing cDNA encoding for alpha-galactosidase A (α-Gal A) and acid maltase (α-Glu) to prepare plasmids encoding relevant point mutations. Mutant plasmids were transfected into HEK 293 T cells, and transient over-expression of variant enzymes was measured after 3 days. We have illustrated the method by examining enzymatic activities of four unknown α-Gal A and one α-Glu variants identified in our patients with Anderson-Fabry disease and Pompe diseases respectively. Comparison with control variants known to be either pathogenic or non-pathogenic together with over-expression of wild-type enzyme allowed determination of the pathogenicity of the mutation. One leader sequence novel variant of α-Gal A (p.A15T) was shown not to significantly reduce enzyme activity, whereas three other novel α-Gal A variants (p.D93Y, p.L372P and p.T410I) were shown to be pathogenic as they resulted in significant reduction of enzyme activity. A novel α-Glu variant (p.L72R) was shown to be pathogenic as this significantly reduced enzyme activity. Certain acid glycosidase variants that have been described in association with late-onset LSDs and which are known to have variable residual plasma and leukocyte enzyme activity in patients appear to show intermediate to low enzyme activity (p.N215S and p.Q279E α-Gal A respectively) in the over-expression system.

  9. Comparative transcriptome proifling of two maize near-isogenic lines differing in the allelic state for bacterial brown spot disease resistance

    Institute of Scientific and Technical Information of China (English)

    WU Xiao-jun; Xu Li; ZHAO Pan-feng; LI Na; WU Lei; HE Yan; WANG Shou-cai

    2015-01-01

    The bacterial brown spot disease (BBS), caused primarily by Pseudomonas syringae pv. syringae van Hal (Pss), reduces plant vigor, yield and quality in maize. To reveal the nature of the defense mechanisms and identify genes involved in the effective host resistance, the dynamic changes of defense transcriptome triggered by the infection of Pss were investigated and compared between two maize near-isogenic lines (NILs). We found that Pss infection resulted in a sophisticated tran-scriptional reprogramming of several biological processes and the resistant NIL employed much faster defense responses than the susceptible NIL. Numerous genes encoding essential components of plant basal resistance would be able to be activated in the susceptible NIL, such as PEN1, PEN2, PEN3, and EDR1, however, in a basic manner, such resistance might not be sufifcient for suppressing Pss pathogenesis. In addition, the expressions of a large number of PTI-, ETI-, PR-, and WRKY-related genes were pronouncedly activated in the resistant NIL, suggesting that maize employ a multitude of defense pathways to defend Pss infection. Six R-gene homologs were identiifed to have signiifcantly higher expression levels in the resistant NIL at early time point, indicating that a robust surveil ance system (gene-to-gene model) might operate in maize during Pss attacks, and these homolog genes are likely to be potential candidate resistance genes involved in BBS disease resistance. Furthermore, a holistic group of novel pathogen-responsive genes were deifned, providing the repertoire of candidate genes for further functional characterization and identiifcation of their regulation patterns during pathogen infection.

  10. State, religion and toleration

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    2009-01-01

    Contribution to Religion and State - From separation to cooperation? Legal-philosophical reflections for a de-secularized world. (IVR Cracow Special Workshop). Eds. Bart. C. Labuschagne & Ari M. Solon. Abstract: Toleration is indeed a complex phenomenon. A discussion of the concept will have...... to underline not only the broadmindedness and liberty of individuals or of groups, but also the relevant distinctions and arguments in political philosophy, epistemology, philosophy of religion and philosophical anthropology and their connection with educational issues. Through a discussion of these relations......, the essay argues three theses: (1) Toleration is not reducible to an ethics of spiritual freedom. (2) Toleration is not neutral to fanatism. (3) Toleration involves esteem for the person....

  11. A Theory of Tolerance

    OpenAIRE

    Corneo, Giacomo; Jeanne, Olivier

    2006-01-01

    We develop an economic theory of tolerance where styles of behaviour are invested with symbolic value. Value systems are endogenous and taught by parents to their children. In conjunction with actual behaviour, value systems determine the esteem enjoyed by individuals. Intolerant individuals have all symbolic value invested in a single style of behaviour, whereas tolerant people have diversified values. The proposed model identifies a link between the unpredictability of children's lifestyles...

  12. Susceptibility and tolerance of rice crop to salt threat: Physiological and metabolic inspections.

    Directory of Open Access Journals (Sweden)

    Nyuk Ling Ma

    Full Text Available Salinity threat is estimated to reduce global rice production by 50%. Comprehensive analysis of the physiological and metabolite changes in rice plants from salinity stress (i.e. tolerant versus susceptible plants is important to combat higher salinity conditions. In this study, we screened a total of 92 genotypes and selected the most salinity tolerant line (SS1-14 and most susceptible line (SS2-18 to conduct comparative physiological and metabolome inspections. We demonstrated that the tolerant line managed to maintain their water and chlorophyll content with lower incidence of sodium ion accumulation. We also examined the antioxidant activities of these lines: production of ascorbate peroxidase (APX and catalase (CAT were significantly higher in the sensitive line while superoxide dismutase (SOD was higher in the tolerant line. Partial least squares discriminant analysis (PLS-DA score plots show significantly different response for both lines after the exposure to salinity stress. In the tolerant line, there was an upregulation of non-polar metabolites and production of sucrose, GABA and acetic acid, suggesting an important role in salinity adaptation. In contrast, glutamine and putrescine were noticeably high in the susceptible rice. Coordination of different strategies in tolerant and susceptible lines show that they responded differently after exposure to salt stress. These findings can assist crop development in terms of developing tolerance mechanisms for rice crops.

  13. The Cost-effectiveness of Sequences of Biological Disease-modifying Antirheumatic Drug Treatment in England for Patients with Rheumatoid Arthritis Who Can Tolerate Methotrexate.

    Science.gov (United States)

    Stevenson, Matt D; Wailoo, Allan J; Tosh, Jonathan C; Hernandez-Alava, Monica; Gibson, Laura A; Stevens, John W; Archer, Rachel J; Simpson, Emma L; Hock, Emma S; Young, Adam; Scott, David L

    2017-07-01

    To ascertain whether strategies of treatment with a biological disease-modifying antirheumatic drug (bDMARD) are cost-effective in an English setting. Results are presented for those patients with moderate to severe rheumatoid arthritis (RA) and those with severe RA. An economic model to assess the cost-effectiveness of 7 bDMARD was developed. A systematic literature review and network metaanalysis was undertaken to establish relative clinical effectiveness. The results were used to populate the model, together with estimates of Health Assessment Questionnaire (HAQ) score following European League Against Rheumatism response; annual costs, and utility, per HAQ band; trajectory of HAQ for patients taking bDMARD; and trajectory of HAQ for patients using nonbiologic therapy (NBT). Results were presented as those associated with the strategy with the median cost-effectiveness. Supplementary analyses were undertaken assessing the change in cost-effectiveness when only patients with the most severe prognoses taking NBT were provided with bDMARD treatment. The costs per quality-adjusted life-year (QALY) values were compared with reported thresholds from the UK National Institute for Health and Care Excellence of £20,000 to £30,000 (US$24,700 to US$37,000). In the primary analyses, the cost per QALY of a bDMARD strategy was £41,600 for patients with severe RA and £51,100 for those with moderate to severe RA. Under the supplementary analyses, the cost per QALY fell to £25,300 for those with severe RA and to £28,500 for those with moderate to severe RA. The cost-effectiveness of bDMARD in RA in England is questionable and only meets current accepted levels in subsets of patients with the worst prognoses.

  14. Colonização micorrízica arbuscular e tolerância ao mal-do-Panamá em mudas de banana-maçã Colonisation of arbuscular mycorrhiza and tolerance to Panama disease in seedlings of the maçã banana

    Directory of Open Access Journals (Sweden)

    Deusiane Batista Sampaio

    2012-09-01

    Full Text Available O objetivo desse trabalho foi avaliar o efeito da colonização micorrízica arbuscular na tolerância da bananeira, cv. Maçã, ao mal-do-Panamá, sob diferentes fontes de nutrientes. Utilizou-se um delineamento inteiramente casualizado com fatorial 2 x 4 [2 densidades de esporos de FMA nativos (D1 - 3.500 esporos kg-1 solo e D2 - 7.000 esporos kg-1 solo e 4 diferentes concentrações de fontes de nutrientes - três de solução nutritiva (SN 40%, SN 70% e SN 100% e uma de biofertilizante 100% (B4] com três repetições. Após o plantio inoculou-se Fusarium oxysporum f.sp. cubense e posteriormente avaliou-se matéria seca da parte aérea (MSPA, o teor de fósforo foliar (P, a colonização micorrízica, o pH do solo e o índice de severidade da doença (ID. As diferentes fontes de nutrientes influenciaram a matéria seca da parte aérea, o teor de fósforo, a colonização micorrízica e o índice de severidade da doença, porém não influenciaram o pH da solução do solo. O biofertilizante não atendeu à demanda nutricional das plantas, as quais se mostraram pouco desenvolvidas. Porém proporcionou intensa colonização micorrízica e menor índice de severidade da fusariose, o qual aumentou com a adubação mineral.The aim of this study was to evaluate the effect of the colonization of arbuscular mycorrhiza on the tolerance to Panama disease of the banana plant cv. maçã under different sources of nutrients. A completely randomized design was employed, having a 2 x 4 factorial [2 densities of native FMA spores (D1 - 3,500 spores kg-1 soil and D2 - 7000 spores kg-1 soil and four different concentrations of nutrient sources - three of a nutrient solution (SN 40%, SN 70% and SN 100% and a 100% solution of bio-fertiliser (B4], with three replications. After planting, the seedlings were inoculated with Fusarium oxysporum f.sp. cubense, and later the shoot dry matter, leaf phosphorus content, mycorrhizal colonization, soil pH and disease

  15. Breaking Tolerance to Thyroid Antigens: Changing Concepts in Thyroid Autoimmunity

    Science.gov (United States)

    Rapoport, Basil

    2014-01-01

    Thyroid autoimmunity involves loss of tolerance to thyroid proteins in genetically susceptible individuals in association with environmental factors. In central tolerance, intrathymic autoantigen presentation deletes immature T cells with high affinity for autoantigen-derived peptides. Regulatory T cells provide an alternative mechanism to silence autoimmune T cells in the periphery. The TSH receptor (TSHR), thyroid peroxidase (TPO), and thyroglobulin (Tg) have unusual properties (“immunogenicity”) that contribute to breaking tolerance, including size, abundance, membrane association, glycosylation, and polymorphisms. Insight into loss of tolerance to thyroid proteins comes from spontaneous and induced animal models: 1) intrathymic expression controls self-tolerance to the TSHR, not TPO or Tg; 2) regulatory T cells are not involved in TSHR self-tolerance and instead control the balance between Graves' disease and thyroiditis; 3) breaking TSHR tolerance involves contributions from major histocompatibility complex molecules (humans and induced mouse models), TSHR polymorphism(s) (humans), and alternative splicing (mice); 4) loss of tolerance to Tg before TPO indicates that greater Tg immunogenicity vs TPO dominates central tolerance expectations; 5) tolerance is induced by thyroid autoantigen administration before autoimmunity is established; 6) interferon-α therapy for hepatitis C infection enhances thyroid autoimmunity in patients with intact immunity; Graves' disease developing after T-cell depletion reflects reconstitution autoimmunity; and 7) most environmental factors (including excess iodine) “reveal,” but do not induce, thyroid autoimmunity. Micro-organisms likely exert their effects via bystander stimulation. Finally, no single mechanism explains the loss of tolerance to thyroid proteins. The goal of inducing self-tolerance to prevent autoimmune thyroid disease will require accurate prediction of at-risk individuals together with an antigen

  16. Modification of tolerance of oats to crown rust induced by chemical mutagens

    International Nuclear Information System (INIS)

    Simons, M.D.; Browning, J.A.; Frey, K.J.

    1983-01-01

    Seeds of crown rust (Puccinia coronata) susceptible cultivated oats (Avena sativa) were treated with the mutagenic chemical ethyl methanesulphonate (EMS), and pure lines derived from these treated seeds were tested in later generations for the relative amount of reduction in yield and seed weight caused by crown rust infection. In the absence of crown rust, the yield of most of the treated lines was greatly reduced. The overall means of the treated lines for both yield and seed weight response to infection were significantly lower than the control, but 10 lines significantly exceeded the control for yield response and 15 exceeded it for seed weight response. Recurrent EMS treatment of once-treated lines rated as tolerant resulted in groups of lines that were more tolerant, on the average, than groups of lines from recurrently treated lines rated as susceptible. A few of the recurrently treated individual lines derived from tolerant parents had a higher degree of tolerance than their parental lines. EMS treatment of diploid (A. strigosa) and tetraploid (A. abyssinica) oats resulted in groups of lines showing significant genetic variance for response to crown rust, indicating that treatment had induced real genetic change. A few diploid lines were a little more tolerant than their control, but none of the tetraploid lines showed any consistent improvement. (author)

  17. Over-Expression of the Pikh Gene with a CaMV 35S Promoter Leads to Improved Blast Disease (Magnaporthe oryzae) Tolerance in Rice

    Science.gov (United States)

    Azizi, Parisa; Rafii, Mohd Y.; Abdullah, Siti N. A.; Hanafi, Mohamed M.; Maziah, M.; Sahebi, Mahbod; Ashkani, Sadegh; Taheri, Sima; Jahromi, Mohammad F.

    2016-01-01

    Magnaporthe oryzae is a rice blast fungus and plant pathogen that causes a serious rice disease and, therefore, poses a threat to the world's second most important food security crop. Plant transformation technology has become an adaptable system for cultivar improvement and to functionally analyze genes in plants. The objective of this study was to determine the effects (through over-expressing and using the CaMV 35S promoter) of Pikh on MR219 resistance because it is a rice variety that is susceptible to the blast fungus pathotype P7.2. Thus, a full DNA and coding DNA sequence (CDS) of the Pikh gene, 3172 bp, and 1206 bp in length, were obtained through amplifying the gDNA and cDNA template from a PH9-resistant rice variety using a specific primer. Agrobacterium-mediated transformation technology was also used to introduce the Pikh gene into the MR219 callus. Subsequently, transgenic plants were evaluated from the DNA to protein stages using polymerase chain reaction (PCR), semi-quantitative RT-PCR, real-time quantitative PCR and high performance liquid chromatography (HPLC). Transgenic plants were also compared with a control using a real-time quantification technique (to quantify the pathogen population), and transgenic and control plants were challenged with the local most virulent M. oryzae pathotype, P7.2. Based on the results, the Pikh gene encodes a hydrophilic protein with 18 sheets, 4 helixes, and 21 coils. This protein contains 401 amino acids, among which the amino acid sequence from 1 to 376 is a non-cytoplasmic region, that from 377 to 397 is a transmembrane region, and that from 398 to 401 is a cytoplasmic region with no identified disordered regions. The Pikh gene was up-regulated in the transgenic plants compared with the control plants. The quantity of the amino acid leucine in the transgenic rice plants increased significantly from 17.131 in the wild-type to 47.865 mg g−1 in transgenic plants. The M. oryzae population was constant at 31, 48

  18. Over-Expression of the Pikh Gene with a CaMV 35S Promoter Leads to Improved Blast Disease (Magnaporthe oryzae) Tolerance in Rice.

    Science.gov (United States)

    Azizi, Parisa; Rafii, Mohd Y; Abdullah, Siti N A; Hanafi, Mohamed M; Maziah, M; Sahebi, Mahbod; Ashkani, Sadegh; Taheri, Sima; Jahromi, Mohammad F

    2016-01-01

    Magnaporthe oryzae is a rice blast fungus and plant pathogen that causes a serious rice disease and, therefore, poses a threat to the world's second most important food security crop. Plant transformation technology has become an adaptable system for cultivar improvement and to functionally analyze genes in plants. The objective of this study was to determine the effects (through over-expressing and using the CaMV 35S promoter) of Pikh on MR219 resistance because it is a rice variety that is susceptible to the blast fungus pathotype P7.2. Thus, a full DNA and coding DNA sequence (CDS) of the Pikh gene, 3172 bp, and 1206 bp in length, were obtained through amplifying the gDNA and cDNA template from a PH9-resistant rice variety using a specific primer. Agrobacterium-mediated transformation technology was also used to introduce the Pikh gene into the MR219 callus. Subsequently, transgenic plants were evaluated from the DNA to protein stages using polymerase chain reaction (PCR), semi-quantitative RT-PCR, real-time quantitative PCR and high performance liquid chromatography (HPLC). Transgenic plants were also compared with a control using a real-time quantification technique (to quantify the pathogen population), and transgenic and control plants were challenged with the local most virulent M. oryzae pathotype, P7.2. Based on the results, the Pikh gene encodes a hydrophilic protein with 18 sheets, 4 helixes, and 21 coils. This protein contains 401 amino acids, among which the amino acid sequence from 1 to 376 is a non-cytoplasmic region, that from 377 to 397 is a transmembrane region, and that from 398 to 401 is a cytoplasmic region with no identified disordered regions. The Pikh gene was up-regulated in the transgenic plants compared with the control plants. The quantity of the amino acid leucine in the transgenic rice plants increased significantly from 17.131 in the wild-type to 47.865 mg g(-1) in transgenic plants. The M. oryzae population was constant at 31, 48

  19. Salt tolerance in wheat - an overview. (abstract)

    International Nuclear Information System (INIS)

    Ashraf, M.

    2005-01-01

    Considerable efforts have been made during the past few years to overcome the problem of salinity through the development of salt tolerant lines of important crop species using screening, breeding and molecular biology techniques. In view of considerable importance of spring wheat as a major staple food crop of many countries, plant scientists have directed there attention to identify and develop salt tolerant genotypes that can be of direct use on salt-affected soils. Although considerable progress in understanding individual phenomenon and genes involved in plant response to salinity stress has been made over the past few years, underlying physiological mechanisms producing salt tolerant plants is still unclear. It has been suggested that salt tolerance of plants could be improved by defining genes or characters. Twenty years ago, it was suggested that genes located on the D genome of bread wheat confer salinity tolerance to hexaploid wheat by reducing Na/sup +/ accumulation in the leaf tissue and increasing discrimination in favour of K/sup +/. However, recently, low Na/sup +/ accumulation and high K/sup +/Na/sup +/ discrimination, of similar magnitude to bread wheat, in several selections of durum wheat has been observed, supporting the notion that salt tolerance is controlled by multiple genes, which are distributed throughout the entire set of chromosomes. In addition, various physiological selection criteria such as compatible osmolytes (glycinebetaine, proline, trehalose, mannitol etc.), antioxidants, carbon discrimination, high K/sup +//Na/sup +/ ratio etc. have been discussed. Although tolerance to salinity is known to have a multigenic inheritance, mediated by a large number of genes, knowledge of heritability and the genetic mode of salinity tolerance is still lacking because few studies have yet been conducted in these areas. Indeed, genetic information is lagging behind the physiological information. Modern methods such as recombinant DNA technology

  20. High Line

    DEFF Research Database (Denmark)

    Kiib, Hans

    2015-01-01

    At just over 10 meters above street level, the High Line extends three kilometers through three districts of Southwestern Manhattan in New York. It consists of simple steel construction, and previously served as an elevated rail line connection between Penn Station on 34th Street and the many....... The High Line project has been carried out as part of an open conversion strategy. The result is a remarkable urban architectural project, which works as a catalyst for the urban development of Western Manhattan. The greater project includes the restoration and reuse of many old industrial buildings...

  1. Value of Tropheryma whipplei quantitative polymerase chain reaction assay for the diagnosis of Whipple disease: usefulness of saliva and stool specimens for first-line screening.

    Science.gov (United States)

    Fenollar, Florence; Laouira, Sonia; Lepidi, Hubert; Rolain, Jean-Marc; Raoult, Didier

    2008-09-01

    Whipple disease (WD) is a chronic infectious disease caused by Tropheryma whipplei. WD DNA has been found in stool and saliva specimens from patients and asymptomatic carriers. A total of 4418 samples that were sent to our center for determination of WD were tested by a T. whipplei-specific quantitative polymerase chain reaction (PCR) based on repetitive sequences. Definite WD was diagnosed in 71 patients, including 55 patients with classic WD (defined by positive results of periodic acid-Schiff staining and/or specific immunohistochemistry of small-bowel biopsy specimens) and 16 patients with localized WD (including patients with endocarditis, neurologic infection, and uveitis). Of the persons without WD, 2.3% had stool specimens positive for T. whipplei by PCR and 0.2% had saliva specimens positive for T. whipplei by PCR. Diagnosis of WD was likely in patients with positive results of both PCR of saliva specimens and PCR of stool specimens (positive predictive value, 95.2%). When the bacterial load was >10(4) colony-forming units per g of stool, the positive predictive value was 100%. A negative result of PCR of a saliva or stool specimen had a negative predictive value of 99.2% for classic WD. For localized WD, positive results of both PCR of saliva specimens and PCR of stool specimens had a sensitivity of 58% (compared with 94% for classic WD). The positive predictive value of testing of blood, cerebrospinal fluid, and urine specimens was 100% for each, and the positive predictive value for testing of duodenal biopsy specimens was 97.5%. T. whipplei-specific quantitative PCR of saliva and stool specimens should be performed as first-line noninvasive screening for WD. When the results for both types of specimens are positive, diagnosis of classic WD should be highly suspected, especially if a high bacterial load is detected. Because PCR of saliva and stool specimens lacks sensitivity for determination of localized WD, invasive samples should be tested on the

  2. Effect of selective T cell depletion of host and/or donor bone marrow on lymphopoietic repopulation, tolerance, and graft-vs-host disease in mixed allogeneic chimeras (B10 + B10.D2----B10)

    International Nuclear Information System (INIS)

    Ildstad, S.T.; Wren, S.M.; Bluestone, J.A.; Barbieri, S.A.; Stephany, D.; Sachs, D.H.

    1986-01-01

    Reconstitution of lethally irradiated mice with a mixture of T cell-depleted syngeneic plus T cell-depleted allogeneic bone marrow (B10 + B10.D2----B10) leads to the induction of mixed lymphopoietic chimerism, excellent survivals, specific in vivo transplantation tolerance to subsequent donor strain skin grafts, and specific in vitro unresponsiveness to allogeneic donor lymphoid elements as assessed by mixed lymphocyte reaction (MLR) proliferative and cell-mediated lympholysis (CML) cytotoxicity assays. When B10 recipient mice received mixed marrow inocula in which the syngeneic component had not been T cell depleted, whether or not the allogeneic donor marrow was treated, they repopulated exclusively with host-type cells, promptly rejected donor-type skin allografts, and were reactive in vitro to the allogeneic donor by CML and MLR assays. In contrast, T cell depletion of the syngeneic component of the mixed marrow inocula resulted in specific acceptance of allogeneic donor strain skin grafts. Such animals were specifically unreactive to allogeneic donor lymphoid elements in vitro by CML and MLR, but were reactive to third party. When both the syngeneic and allogeneic marrow were T cell depleted, variable percentages of host- and donor-type lymphoid elements were detected in the mixed reconstituted host. When only the syngeneic bone marrow was T cell depleted, animals repopulated exclusively with donor-type cells. Although these animals had detectable in vitro anti-host (B10) reactivity by CML and MLR and reconstituted as fully allogeneic chimeras, they exhibited excellent survival and had no in vivo evidence for graft-vs-host disease. Experiments in which untreated donor spleen cells were added to the inocula in this last group suggest that the presence of T cell-depleted syngeneic bone marrow cells diminishes graft-vs-host disease and the mortality from it

  3. Induced mutations for tolerance of oats to crown rust

    International Nuclear Information System (INIS)

    Simons, M.D.; Frey, K.J.

    1977-01-01

    Seeds of three oat (Avena sativa and A. abyssinica) strains were treated with ethyl methanesulphonate (EMS), and crown rust (caused by Puccinia coronata var. avenae) tolerance ratios of M 5 -derived lines were compared with untreated checks. Tolerance ratios of mutant lines tended to be distributed in both plus and minus directions. No mutant oat line had a significant increase in grain yield, but many showed significantly depressed yields. With C.I. 6665, only five of 130 mutagen-derived lines were not significantly below the check for grain yield; one of these had significantly improved tolerance. Re-treatment of selected strains from a previous EMS treatment (original cultivar was Clintland-60) gave one M 5 -derived oat line (of 100 tested) that was equal to Clintland-60 in grain yield and sustained no damage from crown rust (i.e. it had a tolerance ratio of 100). EMS treatment of the highly susceptible tetraploid C.I. 2110 resulted in both significantly increased and reduced tolerance. (author)

  4. World lines.

    OpenAIRE

    Waser Jürgen; Fuchs Raphael; Ribicic Hrvoje; Schindler Benjamin; Blöschl Günther; Gröller Eduard

    2010-01-01

    In this paper we present World Lines as a novel interactive visualization that provides complete control over multiple heterogeneous simulation runs. In many application areas decisions can only be made by exploring alternative scenarios. The goal of the suggested approach is to support users in this decision making process. In this setting the data domain is extended to a set of alternative worlds where only one outcome will actually happen. World Lines integrate simulation visualization and...

  5. Generation of a gene-corrected isogenic control hiPSC line derived from a familial Alzheimer's disease patient carrying a L150P mutation in presenilin 1

    DEFF Research Database (Denmark)

    Poon, Anna Fong-Yee; Schmid, Benjamin; Pires, Carlota

    2016-01-01

    a familial AD patient carrying a L150P point mutation in PSEN1. Here we used CRISPR/Cas9 gene editing to correct for the single base pair mutation. This gene-corrected line, L150P-GC-hiPSC, serves as an isogenic control to the mutant line for future investigation of mechanisms and cellular phenotypes altered...

  6. Escaping the tolerance trap

    International Nuclear Information System (INIS)

    Hammoudeh, S.; Madan, V.

    1994-01-01

    In order to examine the implications of the weakening of OPEC's responsiveness in adjusting its production levels, this paper explicitly incorporates rigidity in the quantity adjustment mechanism, thereby extending previous research which assumed smooth quantity adjustments. The rigidity is manifested in a tolerance range for the discrepancy between the declared target price and that of the market. This environment gives rise to a 'tolerance trap' which impedes the convergence process and inevitably brings the market to a standstill before its reaches the targeted price and revenue objectives. OPEC's reaction to the standstill has important implications for the achievement of the target-based equilibrium and for the potential collapse of the market price. This paper examines OPEC's policy options in the tolerance trap and reveals that the optional policy in order to break this impasse and move closer to the equilibrium point is gradually to reduce output and not to flood the market. (Author)

  7. Exploring new alleles for frost tolerance in winter rye.

    Science.gov (United States)

    Erath, Wiltrud; Bauer, Eva; Fowler, D Brian; Gordillo, Andres; Korzun, Viktor; Ponomareva, Mira; Schmidt, Malthe; Schmiedchen, Brigitta; Wilde, Peer; Schön, Chris-Carolin

    2017-10-01

    Rye genetic resources provide a valuable source of new alleles for the improvement of frost tolerance in rye breeding programs. Frost tolerance is a must-have trait for winter cereal production in northern and continental cropping areas. Genetic resources should harbor promising alleles for the improvement of frost tolerance of winter rye elite lines. For frost tolerance breeding, the identification of quantitative trait loci (QTL) and the choice of optimum genome-based selection methods are essential. We identified genomic regions involved in frost tolerance of winter rye by QTL mapping in a biparental population derived from a highly frost tolerant selection from the Canadian cultivar Puma and the European elite line Lo157. Lines per se and their testcrosses were phenotyped in a controlled freeze test and in multi-location field trials in Russia and Canada. Three QTL on chromosomes 4R, 5R, and 7R were consistently detected across environments. The QTL on 5R is congruent with the genomic region harboring the Frost resistance locus 2 (Fr-2) in Triticeae. The Puma allele at the Fr-R2 locus was found to significantly increase frost tolerance. A comparison of predictive ability obtained from the QTL-based model with different whole-genome prediction models revealed that besides a few large, also small QTL effects contribute to the genomic variance of frost tolerance in rye. Genomic prediction models assigning a high weight to the Fr-R2 locus allow increasing the selection intensity for frost tolerance by genome-based pre-selection of promising candidates.

  8. Fault tolerant linear actuator

    Science.gov (United States)

    Tesar, Delbert

    2004-09-14

    In varying embodiments, the fault tolerant linear actuator of the present invention is a new and improved linear actuator with fault tolerance and positional control that may incorporate velocity summing, force summing, or a combination of the two. In one embodiment, the invention offers a velocity summing arrangement with a differential gear between two prime movers driving a cage, which then drives a linear spindle screw transmission. Other embodiments feature two prime movers driving separate linear spindle screw transmissions, one internal and one external, in a totally concentric and compact integrated module.

  9. Inequality, Tolerance, and Growth

    DEFF Research Database (Denmark)

    Bjørnskov, Christian

    This paper argues for the importance of individuals' tolerance of inequality for economic growth. By using the political ideology of governments as a measure of revealed tolerance of inequality, the paper shows that controlling for ideology improves the accuracy with which the effects of inequality...... are measured. Results show that inequality reduces growth but more so in societies where people perceive it as being relatively unfair. Further results indicate that legal quality and social trust are likely transmission channels for the effects of inequality....

  10. Inequality, Tolerance, and Growth

    DEFF Research Database (Denmark)

    Bjørnskov, Christian

    2004-01-01

    This paper argues for the importance of individuals' tolerance of inequality for economic growth. By using the political ideology of governments as a measure of revealed tolerance of inequality, the paper shows that controlling for ideology improves the accuracy with which the effects of inequality...... are measured. Results show that inequality reduces growth but more so in societies where people perceive it as being relatively unfair. Further results indicate that legal quality and social trust are likely transmission channels for the effects of inequality....

  11. An updated systematic review and meta-analysis on the efficacy and tolerability of dipeptidyl peptidase-4 inhibitors in patients with type 2 diabetes with moderate to severe chronic kidney disease

    Directory of Open Access Journals (Sweden)

    Devada Singh-Franco

    2016-07-01

    Full Text Available Objective: This updated meta-analysis determines the effect of dipeptidyl peptidase-4 inhibitors on glycemic and tolerability outcomes in patients with type 2 diabetes mellitus and chronic kidney disease with glomerular filtration rate of ⩽60 mL/min or on dialysis. Methods: In all, 14 citations were identified from multiple databases. Qualitative assessments and quantitative analyses were performed. Results: There were 2261 participants, 49–79 years of age, 49% men and 44% Caucasians. In seven placebo-comparator studies, reduction in hemoglobin A1c at weeks 12–24 was 0.55% (95% confidence interval: −0.68 to −0.43, P < 0.00001. In three sulfonylurea-comparator studies, dipeptidyl peptidase-4 inhibitors did not significantly reduce hemoglobin A1c at weeks 52–54 (−0.15% (95% confidence interval: −0.32 to 0.02. In one sitagliptin versus albiglutide study, albiglutide significantly reduced hemoglobin A1c in patients with moderate renal impairment (−0.51%. A similar reduction in hemoglobin A1c was seen with sitagliptin versus vildagliptin (−0.56% vs −0.54%. Compared with placebo or sulfonylurea, dipeptidyl peptidase-4 inhibitors did not significantly reduce hemoglobin A1c after 12 and 54 weeks in patients on dialysis. Hypoglycemia was reported by ~30% of patients in both dipeptidyl peptidase-4 inhibitors and placebo groups over 24–52 weeks. While hypoglycemia was more common with a sulfonylurea at 52–54 weeks (risk ratio: 0.46 (95% confidence interval: 0.18 to 1.18, there was significant heterogeneity (I2 = 87%. Limitations included high drop-out rate from most studies and small number of active-comparator studies. Conclusions: Dipeptidyl peptidase-4 inhibitors in patients with chronic kidney disease caused a modest reduction in hemoglobin A1c versus placebo, but not when compared with sulfonylureas or albiglutide, or when used in patients on dialysis. Additional active-comparator studies are needed to

  12. A new screening method for Ganoderma philippii tolerance in ...

    African Journals Online (AJOL)

    Red root rot disease caused by Ganoderma philippii is one of the most economically important diseases of tropical Acacia species. Research on field control of the disease has to date focused on inoculum reduction, silviculture practices and application of biological control agents. Incorporation of tolerant genotypes, a key ...

  13. Killer B Lymphocytes and their Fas Ligand Positive Exosomes as Inducers of Immune Tolerance

    Directory of Open Access Journals (Sweden)

    Steven Karl Lundy

    2015-03-01

    Full Text Available Induction of immune tolerance is a key process by which the immune system is educated to modulate reactions against benign stimuli such as self-antigens and commensal microbes. Understanding and harnessing the natural mechanisms of immune tolerance may become an increasingly useful strategy for treating many types of allergic and autoimmune diseases, as well as for improving the acceptance of solid organ transplants. Our laboratory and others have been interested in the natural ability of some B lymphocytes to express the death-inducing molecule Fas ligand (FasL, and their ability to kill T helper (TH lymphocytes. We have recently shown that experimental transformation of human B cells by a non-replicative variant of Epstein-Barr virus (EBV consistently resulted in high expression of functional FasL protein. The production and release of FasL+ exosomes that co-expressed MHC Class II molecules and had the capacity to kill antigen-specific TH cells was also observed. Several lines of evidence indicate that FasL+ B cells and FasL+MHCII+ exosomes have important roles in natural immune tolerance and have a great deal of therapeutic potential. Taken together, these findings suggest that EBV-immortalized human B lymphoblastoid cell lines could be used as cellular factories for FasL+ exosomes, which would be employed to therapeutically establish and/or regain immune tolerance toward specific antigens. The goals of this review are to summarize current knowledge of the roles of FasL+ B cells and exosomes in immune regulation, and to suggest methods of manipulating killer B cells and FasL+ exosomes for clinical purposes.

  14. AACE/ACE Disease State Clinical Review: Medical Management of Cushing Disease.

    Science.gov (United States)

    Hamrahian, Amir H; Yuen, Kevin C J; Hoffman, Andrew R

    2014-07-01

    To review available medical therapies for patients with Cushing disease and to provide a roadmap for their use in clinical practice. PubMed searches were performed to identify all of the available published data on medical management of Cushing disease. Medical therapy is usually not the first-line treatment for patients with Cushing disease but may be used to improve clinical manifestations of Cushing disease in patients who are not suitable candidates for surgery, following unsuccessful surgery or recurrence, or as a "bridge therapy" in those who have undergone radiotherapy. Medical therapy may also be used in preoperative preparation of patients with severe disease. Current available medical options for patients with Cushing disease include centrally acting agents, steroidogenesis inhibitors, and a glucocorticoid receptor antagonists. At present, there are no head-to-head studies comparing the efficacy, tolerability, and safety of different U.S. Food and Drug Administration (FDA)- and non-FDA-approved drugs in patients with Cushing disease. With the initiation of new studies and the completion of ongoing clinical trials, the number of FDA-approved drugs for medical treatment of Cushing disease is expected to increase. Medical therapy has an important adjunctive role in the management of patients with Cushing disease. The decision to initiate medical treatment depends on many factors, including patient characteristics and preference. Long-term studies are needed to better define the clinical efficacy, safety, and tolerability of medical treatment of Cushing disease, including the role of combination therapies.

  15. Genome interrogation for novel salinity tolerant Arabidopsis mutants.

    Science.gov (United States)

    van Tol, Niels; Pinas, Johan; Schat, Henk; Hooykaas, Paul J J; van der Zaal, Bert J

    2016-12-01

    Soil salinity is becoming an increasingly large problem in agriculture. In this study, we have investigated whether a capacity to withstand salinity can be induced in the salinity sensitive plant species Arabidopsis thaliana, and whether it can be maintained in subsequent generations. To this end, we have used zinc finger artificial transcription factor (ZF-ATFs) mediated genome interrogation. Already within a relatively small collection Arabidopsis lines expressing ZF-ATFs, we found 41 lines that were tolerant to 100 mM NaCl. Furthermore, ZF-ATF encoding gene constructs rescued from the most strongly salinity tolerant lines were indeed found to act as dominant and heritable agents for salinity tolerance. Altogether, our data provide evidence that a silent capacity to withstand normally lethal levels of salinity exists in Arabidopsis and can be evoked relatively easily by in trans acting transcription factors like ZF-ATFs. © 2016 John Wiley & Sons Ltd.

  16. Reirradiation tolerance of the rat heart

    International Nuclear Information System (INIS)

    Wondergem, Jan; Ravels, Frank J.M. van; Reijnart, Ivonne W.C.; Strootman, Erwin G.

    1996-01-01

    Purpose: To investigate the influence of reirradiation on the tolerance of the heart after a previous irradiation treatment. Methods and Materials: Female Wistar rats were locally irradiated to the thorax. Development of cardiac function loss was studied with the ex vivo working rat heart preparation. To compare the retreatment experiments, initial, and reirradiation doses were expressed as the percentage of the extrapolated tolerance dose (ETD). Results: Local heart irradiation with a single dose led to a dose-dependent and progressive decrease in cardiac function. The progressive nature of irradiation-induced heart disease is shown to affect the outcome of the retreatment, depending on both the time interval between subsequent doses and the size of the initial dose. The present data demonstrate that hearts are capable of repairing a large part of the initial dose of 10 Gy within the first 24 h. However, once biological damage as a result of the first treatment is fixed, the heart does not show any long-term recovery. At intervals up to 6 months between an initial treatment with 10 Gy and subsequent reirradiation, the reirradiation tolerance dose slightly decreased from 74% of the ETD ref (at 24-h interval) to 68% of the ETD ref (at 6-month interval). Between 6 and 9 months, reirradiation tolerance dose dropped more even to 43% of the ETD ref . Treatment of the heart with an initial dose of 17.5 Gy, instead of 10 Gy, 6 months prior to reirradiation, also led to a further decrease of the reirradiation tolerance dose ( ref ). Conclusions: The outcome of the present study shows a decreased tolerance of the heart to reirradiation at long time intervals (interval > 6 months). This has clinical implications for the estimation of reirradiation tolerance in patients whose mediastinum has to be reirradiated a long time after a first irradiation course

  17. Newly Identified Wild Rice Accessions Conferring High Salt Tolerance Might Use a Tissue Tolerance Mechanism in Leaf

    Science.gov (United States)

    Prusty, Manas R.; Kim, Sung-Ryul; Vinarao, Ricky; Entila, Frederickson; Egdane, James; Diaz, Maria G. Q.; Jena, Kshirod K.

    2018-01-01

    Cultivated rice (Oryza sativa L.) is very sensitive to salt stress. So far a few rice landraces have been identified as a source of salt tolerance and utilized in rice improvement. These tolerant lines primarily use Na+ exclusion mechanism in root which removes Na+ from the xylem stream by membrane Na+ and K+ transporters, and resulted in low Na+ accumulation in shoot. Identification of a new donor source conferring high salt tolerance is imperative. Wild relatives of rice having wide genetic diversity are regarded as a potential source for crop improvement. However, they have been less exploited against salt stress. Here, we simultaneously evaluated all 22 wild Oryza species along with the cultivated tolerant lines including Pokkali, Nona Bokra, and FL478, and sensitive check varieties under high salinity (240 mM NaCl). Based on the visual salt injury score, three species (O. alta, O. latifolia, and O. coarctata) and four species (O. rhizomatis, O. eichingeri, O. minuta, and O. grandiglumis) showed higher and similar level of tolerance compared to the tolerant checks, respectively. All three CCDD genome species exhibited salt tolerance, suggesting that the CCDD genome might possess the common genetic factors for salt tolerance. Physiological and biochemical experiments were conducted using the newly isolated tolerant species together with checks under 180 mM NaCl. Interestingly, all wild species showed high Na+ concentration in shoot and low concentration in root unlike the tolerant checks. In addition, the wild-tolerant accessions showed a tendency of a high tissue tolerance in leaf, low malondialdehyde level in shoot, and high retention of chlorophyll in the young leaves. These results suggest that the wild species employ tissue tolerance mechanism to manage salt stress. Gene expression analyses of the key salt tolerance-related genes suggested that high Na+ in leaf of wild species might be affected by OsHKT1;4-mediated Na+ exclusion in leaf and the following Na

  18. Intraspecific competition facilitates the evolution of tolerance to insect damage in the perennial plant Solanum carolinense.

    Science.gov (United States)

    McNutt, David W; Halpern, Stacey L; Barrows, Kahaili; Underwood, Nora

    2012-12-01

    Tolerance to herbivory (the degree to which plants maintain fitness after damage) is a key component of plant defense, so understanding how natural selection and evolutionary constraints act on tolerance traits is important to general theories of plant-herbivore interactions. These factors may be affected by plant competition, which often interacts with damage to influence trait expression and fitness. However, few studies have manipulated competitor density to examine the evolutionary effects of competition on tolerance. In this study, we tested whether intraspecific competition affects four aspects of the evolution of tolerance to herbivory in the perennial plant Solanum carolinense: phenotypic expression, expression of genetic variation, the adaptive value of tolerance, and costs of tolerance. We manipulated insect damage and intraspecific competition for clonal lines of S. carolinense in a greenhouse experiment, and measured tolerance in terms of sexual and asexual fitness components. Compared to plants growing at low density, plants growing at high density had greater expression of and genetic variation in tolerance, and experienced greater fitness benefits from tolerance when damaged. Tolerance was not costly for plants growing at either density, and only plants growing at low density benefited from tolerance when undamaged, perhaps due to greater intrinsic growth rates of more tolerant genotypes. These results suggest that competition is likely to facilitate the evolution of tolerance in S. carolinense, and perhaps in other plants that regularly experience competition, while spatio-temporal variation in density may maintain genetic variation in tolerance.

  19. Morgan line and its relationship with distraction index, angle of inclination and degenerative joint disease in the diagnosis of canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    F.G. Miranda

    2016-08-01

    Full Text Available ABSTRACT We evaluated 160 hip joint radiographs of 40 dogs of different large breeds (25 females and 15 males from the metropolitan area of Belo Horizonte, Minas Gerais, Brazil. The radiographs of each dog were obtained at two different stages: stage 1 (mean 7.23 months and stage 2 (mean 14.25. The conventional radiographic method (CRM and the radiographic distraction method (RDM were used, carried out in both stages. CRM measured the Norberg angle (NA, the angle of inclination (AI and evaluated the presence of degenerative joint disease (DJD. The MRD was performed to establish the distraction index (DI. The aims were to evaluate the presence of the Morgan line and other signs of DJD and correlate them with the degree of canine hip dysplasia (CHD and also check if the DI greater than 0.3 (first stage was associated with the presence of ML (second stage. It was found that DI, AI and changes of femoral neck and the formation of osteophytes were associated with the presence of ML. It was observed that if the DI is greater than 0.3 at the first stage, the chance of a positive outcome of ML in the second stage increases by 7.2 times. Thus, 49 joints showed DI > 0.3 at the first stage, in which 31 (63.3 % presented ML at the second stage. Of the 31 animals that showed DI ≤ 0.3 at first, six (19.4% had LM at the second stage. There has been a significant association between the presence of ML and the degree of CHD. The more severe the CHD, the higher the percentage of positive ML results. Thus, among the 24 (60 % animals that showed ML, 11 (45.83 % were classified as severe dysplastics, 5 (20.83% as moderate and 8 (33.33 % as mild. None of the animals classified as normal or borderline presented ML. Among the 8 animals classified as mild dysplastics, 5 showed only ML as DJD.

  20. Silver linings.

    Science.gov (United States)

    Bultas, Margaret W; Pohlman, Shawn

    2014-01-01

    The purpose of this interpretive phenomenological study was to gain a better understanding of the experiences of 11 mothers of preschool children with autism spectrum disorder (ASD). Mothers were interviewed three times over a 6 week period. Interviews were analyzed using interpretive methods. This manuscript highlights one particular theme-a positive perspective mothers described as the "silver lining." This "silver lining" represents optimism despite the adversities associated with parenting a child with ASD. A deeper understanding of this side of mothering children with ASD may help health care providers improve rapport, communication, and result in more authentic family centered care. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Development of drought tolerant sorghum lines using molecular

    African Journals Online (AJOL)

    Student

    2015-11-18

    Nov 18, 2015 ... occurs during the later stages of grain filling (Rosenow et al., 1996). When affected ... under conditions of limited water. However, since it is an .... capillary electrophoresis on an ABI 3730 automatic DNA sequencer. (Applied ...

  2. DISEASES

    DEFF Research Database (Denmark)

    Pletscher-Frankild, Sune; Pallejà, Albert; Tsafou, Kalliopi

    2015-01-01

    Text mining is a flexible technology that can be applied to numerous different tasks in biology and medicine. We present a system for extracting disease-gene associations from biomedical abstracts. The system consists of a highly efficient dictionary-based tagger for named entity recognition...... of human genes and diseases, which we combine with a scoring scheme that takes into account co-occurrences both within and between sentences. We show that this approach is able to extract half of all manually curated associations with a false positive rate of only 0.16%. Nonetheless, text mining should...... not stand alone, but be combined with other types of evidence. For this reason, we have developed the DISEASES resource, which integrates the results from text mining with manually curated disease-gene associations, cancer mutation data, and genome-wide association studies from existing databases...

  3. Toleration, Groups, and Multiculturalism

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2014-01-01

    have the ability to interfere with the group’s activities, an object of dislike or disapproval, an agent enjoying non-interference or a moral patient. This means that 'toleration of groups' can mean quite different things depending on the exact meaning of 'group' in relation to each component...

  4. Fault Tolerant Control Systems

    DEFF Research Database (Denmark)

    Bøgh, S. A.

    This thesis considered the development of fault tolerant control systems. The focus was on the category of automated processes that do not necessarily comprise a high number of identical sensors and actuators to maintain safe operation, but still have a potential for improving immunity to component...

  5. Toleration and its enemies

    DEFF Research Database (Denmark)

    Jarvad, Ib Martin

    2010-01-01

    After a presentation of the development of freedom of expression in Danish constitutional law, to freedom of the press in European human rights law - the Jersild case- to a right to mock and ridicule other faiths in recent Danish practice, the essay of Locke on toleration is examined, its...

  6. A little toleration, please

    Science.gov (United States)

    McKnight, C.

    2000-01-01

    Value pluralism does not imply relativism or subjectivism about values. What it does is allow respect for an at least limited toleration of values with which one may profoundly disagree. Thus a doctor can respect the autonomy of a patient whose values he does not share. Key Words: Pluralism • multiculturalism • relativism • subjectivism • patient autonomy PMID:11129842

  7. Diabetic Eye Disease

    Science.gov (United States)

    ... Disease, & Other Dental Problems Diabetes & Sexual & Urologic Problems Diabetic Eye Disease What is diabetic eye disease? Diabetic eye disease is a group ... eye diseases that can threaten your sight are Diabetic retinopathy The retina is the inner lining at ...

  8. Deconstructing tolerance with clobazam

    Science.gov (United States)

    Wechsler, Robert T.; Sankar, Raman; Montouris, Georgia D.; White, H. Steve; Cloyd, James C.; Kane, Mary Clare; Peng, Guangbin; Tworek, David M.; Shen, Vivienne; Isojarvi, Jouko

    2016-01-01

    Objective: To evaluate potential development of tolerance to adjunctive clobazam in patients with Lennox-Gastaut syndrome. Methods: Eligible patients enrolled in open-label extension study OV-1004, which continued until clobazam was commercially available in the United States or for a maximum of 2 years outside the United States. Enrolled patients started at 0.5 mg·kg−1·d−1 clobazam, not to exceed 40 mg/d. After 48 hours, dosages could be adjusted up to 2.0 mg·kg−1·d−1 (maximum 80 mg/d) on the basis of efficacy and tolerability. Post hoc analyses evaluated mean dosages and drop-seizure rates for the first 2 years of the open-label extension based on responder categories and baseline seizure quartiles in OV-1012. Individual patient listings were reviewed for dosage increases ≥40% and increasing seizure rates. Results: Data from 200 patients were included. For patients free of drop seizures, there was no notable change in dosage over 24 months. For responder groups still exhibiting drop seizures, dosages were increased. Weekly drop-seizure rates for 100% and ≥75% responders demonstrated a consistent response over time. Few patients had a dosage increase ≥40% associated with an increase in seizure rates. Conclusions: Two-year findings suggest that the majority of patients do not develop tolerance to the antiseizure actions of clobazam. Observed dosage increases may reflect best efforts to achieve seizure freedom. It is possible that the clinical development of tolerance to clobazam has been overstated. ClinicalTrials.gov identifier: NCT00518713 and NCT01160770. Classification of evidence: This study provides Class III evidence that the majority of patients do not develop tolerance to clobazam over 2 years of treatment. PMID:27683846

  9. Multiple repair pathways mediate cellular tolerance to resveratrol-induced DNA damage.

    Science.gov (United States)

    Liu, Ying; Wu, Xiaohua; Hu, Xiaoqing; Chen, Ziyuan; Liu, Hao; Takeda, Shunichi; Qing, Yong

    2017-08-01

    Resveratrol (RSV) has been reported to exert health benefits for the prevention and treatment of many diseases, including cancer. The anticancer mechanisms of RSV seem to be complex and may be associated with genotoxic potential. To better understand the genotoxic mechanisms, we used wild-type (WT) and a panel of isogenic DNA-repair deficient DT40 cell lines to identify the DNA damage effects and molecular mechanisms of cellular tolerance to RSV. Our results showed that RSV induced significant formation of γ-H2AX foci and chromosome aberrations (CAs) in WT cells, suggesting direct DNA damage effects. Comparing the survival of WT with isogenic DNA-repair deficient DT40 cell lines demonstrated that single strand break repair (SSBR) deficient cell lines of Parp1 -/- , base excision repair (BER) deficient cell lines of Polβ -/- , homologous recombination (HR) mutants of Brca1 -/- and Brca2 -/- and translesion DNA synthesis (TLS) mutants of Rev3 -/- and Rad18 -/- were more sensitive to RSV. The sensitivities of cells were associated with enhanced DNA damage comparing the accumulation of γ-H2AX foci and number of CAs of isogenic DNA-repair deficient DT40 cell lines with WT cells. These results clearly demonstrated that RSV-induced DNA damage in DT40 cells, and multiple repair pathways including BER, SSBR, HR and TLS, play critical roles in response to RSV- induced genotoxicity. Copyright © 2017. Published by Elsevier Ltd.

  10. New coeliac disease treatments and their complications.

    Science.gov (United States)

    Vaquero, Luis; Rodríguez-Martín, Laura; León, Francisco; Jorquera, Francisco; Vivas, Santiago

    2018-03-01

    The only accepted treatment for coeliac disease is strict adherence to a gluten-free diet. This type of diet may give rise to reduced patient quality of life with economic and social repercussions. For this reason, dietary transgressions are common and may elicit intestinal damage. Several treatments aimed at different pathogenic targets of coeliac disease have been developed in recent years: modification of gluten to produce non-immunogenic gluten, endoluminal therapies to degrade gluten in the intestinal lumen, increased gluten tolerance, modulation of intestinal permeability and regulation of the adaptive immune response. This review evaluates these coeliac disease treatment lines that are being researched and the treatments that aim to control disease complications like refractory coeliac disease. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.

  11. Stress-tolerant mutants induced by heavy-ion beams

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Tomoko; Yoshida, Shigeo [Institute of Physical and Chemical Research, Wako, Saitama (Japan); Bae, Chang-Hyu [Sunchon National University, Sunchon (Korea); Ozaki, Takuo [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Wang, Jing Ming [Akita Prefectural Univ. (Japan)

    2000-07-01

    Comparative study was made on mutagenesis in tobacco embryo induced by exposure to EMS (ethyl methane-sulfonate) ion beams during the fertilization cycle. Tobacco embryo cells immediately after pollination were exposed to heavy ion beam and the sensitivity to the irradiation was assessed in each developmental stage and compared with the effects of EMS, a chemical mutagen. Morphologically abnormality such as chlorophyll deficiency was used as a marker. A total of 17 salt-tolerant plants were selected from 3447 M{sub 1} seeds. A cell line showed salt resistance. The cell growth and chlorophyll content were each two times higher than that of WT cells in the medium containing 154 mM NaCl. Seven strains of M{sub 3} progeny of 17 salt-tolerant plants, showed strong resistance, but no salt tolerant progeny were obtained from Xanthi or Ne-ion irradiation. This shows that the sensitivity of plant embryo to this irradiation technique may vary among species. When exposed to {sup 14}N ion beam for 24-108 hours after pollination, various morphological mutants appeared at 18% in M{sub 1} progeny and herbicide tolerant and salt tolerant mutants were obtained. A strong Co-tolerant strain was obtained in two of 17 salt-tolerant strains and a total of 46 tolerant strains (0.2%) were obtained from 22,272 grains of M{sub 1} seeds. In these tolerant strains, the absorption of Co was slightly decreased, but those of Mg and Mn were increased. Mutants induced with ion-beam irradiation have potential not only for practical use in the breeding of stress-tolerant plants but also for gene analysis that will surely facilitate the molecular understanding of the tolerance mechanisms. (M.N.)

  12. Stress-tolerant mutants induced by heavy-ion beams

    International Nuclear Information System (INIS)

    Abe, Tomoko; Yoshida, Shigeo; Bae, Chang-Hyu; Ozaki, Takuo

    2000-01-01

    Comparative study was made on mutagenesis in tobacco embryo induced by exposure to EMS (ethyl methane-sulfonate) ion beams during the fertilization cycle. Tobacco embryo cells immediately after pollination were exposed to heavy ion beam and the sensitivity to the irradiation was assessed in each developmental stage and compared with the effects of EMS, a chemical mutagen. Morphologically abnormality such as chlorophyll deficiency was used as a marker. A total of 17 salt-tolerant plants were selected from 3447 M 1 seeds. A cell line showed salt resistance. The cell growth and chlorophyll content were each two times higher than that of WT cells in the medium containing 154 mM NaCl. Seven strains of M 3 progeny of 17 salt-tolerant plants, showed strong resistance, but no salt tolerant progeny were obtained from Xanthi or Ne-ion irradiation. This shows that the sensitivity of plant embryo to this irradiation technique may vary among species. When exposed to 14 N ion beam for 24-108 hours after pollination, various morphological mutants appeared at 18% in M 1 progeny and herbicide tolerant and salt tolerant mutants were obtained. A strong Co-tolerant strain was obtained in two of 17 salt-tolerant strains and a total of 46 tolerant strains (0.2%) were obtained from 22,272 grains of M 1 seeds. In these tolerant strains, the absorption of Co was slightly decreased, but those of Mg and Mn were increased. Mutants induced with ion-beam irradiation have potential not only for practical use in the breeding of stress-tolerant plants but also for gene analysis that will surely facilitate the molecular understanding of the tolerance mechanisms. (M.N.)

  13. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  14. Heat tolerance in wheat

    DEFF Research Database (Denmark)

    Sharma, Dew Kumari

    As a consequence of global climate change, heat stress together with other abiotic stresses will remain an important determinant of future food security. Wheat (Triticum aestivum L.) is the third most important crop of the world feeding one third of the world population. Being a crop of temperate...... climate, wheat is sensitive to heat stress. We need to understand how our crops will perform in these changing climatic conditions and how we can develop varieties, which are more tolerant. The PhD study focussed on understanding heat tolerance in wheat with a combined approach of plant physiology...... and quantitative genetics in particular, plant phenotyping based quantitative trait loci (QTL) discovery for a physiological trait under heat stress. Chlorophyll a fluorescence trait, Fv/Fm was used as a phenotyping tool, as it reflects the effect of heat stress on maximum photochemical efficiency of photosystem...

  15. Identification of multiple ear-colonizing insect and disease resistance in CIMMYT maize inbred lines with varying levels of silk maysin.

    Science.gov (United States)

    Ni, Xinzhi; Krakowsky, Matthew D; Buntin, G David; Rector, Brian G; Guo, Baozhu; Snook, Maurice E

    2008-08-01

    Ninety four corn inbred lines selected from International Center for the Improvement of Maize and Wheat (CIMMYT) in Mexico were evaluated for levels of silk maysin in 2001 and 2002. Damage by major ear-feeding insects [i.e., corn earworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae); maize weevil, Sitophilus zeamais (Motschulsky) (Coleoptera: Curculionidae); brown stink bug, Euschistus servus (Say); southern green stink bugs, Nezara viridula (L.) (Heteroptera: Pentatomidae)], and common smut [Ustilago maydis DC (Corda)] infection on these inbred lines were evaluated in 2005 and 2006 under subtropical conditions at Tifton, GA. Ten inbred lines possessing good agronomic traits were also resistant to the corn earworm. The correlation between ear-feeding insect damage or smut infection and three phenotypic traits (silk maysin level, husk extension, and husk tightness of corn ears) was also examined. Corn earworm and stink bug damage was negatively correlated to husk extension, but not to either silk maysin levels or husk tightness. In combination with the best agronomic trait ratings that show the least corn earworm and stink bug damage, lowest smut infection rate, and good insect-resistant phenotypic traits (i.e., high maysin and good husk coverage and husk tightness), 10 best inbred lines (CML90, CML92, CML94, CML99, CML104, CML108, CML114, CML128, CML137, and CML373) were identified from the 94 lines examined. These selected inbred lines will be used for further examination of their resistance mechanisms and development of new corn germplasm that confers multiple ear-colonizing pest resistance.

  16. Socially-Tolerable Discrimination

    OpenAIRE

    Amegashie, J. Atsu

    2008-01-01

    History is replete with overt discrimination on the basis of race, gender, age, citizenship, ethnicity, marital status, academic performance, health status, volume of market transactions, religion, sexual orientation, etc. However, these forms of discrimination are not equally tolerable. For example, discrimination based on immutable or prohibitively unalterable characteristics such as race, gender, or ethnicity is much less acceptable. Why? I develop a simple rent-seeking model of conflict w...

  17. [Prospective, monocentric, uncontrolled study of efficacy, tolerance and adherence of cyclosporin 0.1 % for severe dry eye syndrome].

    Science.gov (United States)

    Boujnah, Y; Mouchel, R; El-Chehab, H; Dot, C; Burillon, C; Kocaba, V

    2018-02-01

    To evaluate the efficacy, tolerability and treatment adherence of Ikervis ® (Santen, SAS) (ciclosporine 0.1 %) for first line therapy or following treatment with Restasis ® (Allergan, Inc.) (ciclosporine 0.05 %) for severe dry eye syndrome. A prospective, monocentric, uncontrolled study was conducted between January 2012 and March 2015 on 110 eyes of 55 patients with severe dry eye on first line therapy or previously treated with Restasis ® who required the introduction of Ikervis ® . Patients' quality of life was assessed before and after treatment was started using a standardized questionnaire (Ocular Surface Disease Index © [OSDI]), clinical efficacy was quantified at the slit lamp, by measurement of the Break Up time Test (BUT) and the Oxford classification. Tolerability and adherence to treatment were measured using a simple questionnaire. A total of 72 eyes of 37 patients were included. Etiologies of dry eye syndrome were dominated by Sjögren syndrome (32 %) and severe ocular surface conditions (48 %). The mean age was 57.7 years (±17.45) and mean follow-up was 458 days (±292). The mean BUT increased by 2.043seconds [1.522-2.563] (Pdry eye. Its indications tend to evolve towards less severe dry eye. However, the tolerability profile remains poor, and an improvement in this would be desirable. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Genome-Wide Association Mapping of Barley Yellow Dwarf Virus Tolerance in Spring Oat (Avena sativa L..

    Directory of Open Access Journals (Sweden)

    Bradley J Foresman

    Full Text Available Barley yellow dwarf viruses (BYDVs are responsible for the disease barley yellow dwarf (BYD and affect many cereals including oat (Avena sativa L.. Until recently, the molecular marker technology in oat has not allowed for many marker-trait association studies to determine the genetic mechanisms for tolerance. A genome-wide association study (GWAS was performed on 428 spring oat lines using a recently developed high-density oat single nucleotide polymorphism (SNP array as well as a SNP-based consensus map. Marker-trait associations were performed using a Q-K mixed model approach to control for population structure and relatedness. Six significant SNP-trait associations representing two QTL were found on chromosomes 3C (Mrg17 and 18D (Mrg04. This is the first report of BYDV tolerance QTL on chromosome 3C (Mrg17 and 18D (Mrg04. Haplotypes using the two QTL were evaluated and distinct classes for tolerance were identified based on the number of favorable alleles. A large number of lines carrying both favorable alleles were observed in the panel.

  19. Pink-line syndrome

    Digital Repository Service at National Institute of Oceanography (India)

    Ravindran J.; Raghukumar, C.; Manikandan, B.

    , a physiological crisis in the scleractinian coral Porites lutea. Marine biology 149: 347-356 7. Ravindran J, Raghukumar C (2006a) Histological observations on the scleractinian coral Porites lutea affected by pink-line syndrome. Current science... handbook: guidelines for assessment and monitoring. Currie Communications, Melbourne, Australia, 94p+App 10. Vargas-Angel B, Wheeler B (2009) Coral health and disease assessment in the US Pacific territories and affiliated states. Proc. 11th Coral Reef...

  20. Severe necrotic dermatitis in the combs of line 6-3 chickens is associated with Marek's disease virus-induced immunosuppression

    Science.gov (United States)

    Marek’s disease (MD), a lymphoproliferative disorder of domestic chickens is characterized by bursal–thymic atrophy and rapid onset of T-cell lymphomas that infiltrate lymphoid tissues, visceral organs, and peripheral nerves. Marek’s disease virus (MDV), the etiological agent of MD, is a highly cel...

  1. Mechanism of oral tolerance induction to therapeutic proteins.

    Science.gov (United States)

    Wang, Xiaomei; Sherman, Alexandra; Liao, Gongxian; Leong, Kam W; Daniell, Henry; Terhorst, Cox; Herzog, Roland W

    2013-06-15

    Oral tolerance is defined as the specific suppression of humoral and/or cellular immune responses to an antigen by administration of the same antigen through the oral route. Due to its absence of toxicity, easy administration, and antigen specificity, oral tolerance is a very attractive approach to prevent unwanted immune responses that cause a variety of diseases or that complicate treatment of a disease. Many researchers have induced oral tolerance to efficiently treat autoimmune and inflammatory diseases in different animal models. However, clinical trials yielded limited success. Thus, understanding the mechanisms of oral tolerance induction to therapeutic proteins is critical for paving the way for clinical development of oral tolerance protocols. This review will summarize progress on understanding the major underlying tolerance mechanisms and contributors, including antigen presenting cells, regulatory T cells, cytokines, and signaling pathways. Potential applications, examples for therapeutic proteins and disease targets, and recent developments in delivery methods are discussed. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Generation of an induced pluripotent stem cell line, IBMS-iPSC-014-05, from a female autosomal dominant polycystic kidney disease patient carrying a common mutation of R803X in PKD2

    Directory of Open Access Journals (Sweden)

    Ming-Ching Ho

    2017-12-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is one of the most commonly inherited forms of polycystic kidney disease, and is characterized by the growth of numerous cysts in both kidneys. Here we generated an induced pluripotent stem cell (iPSC line from the peripheral blood mononuclear cells (PBMCs of a 63-year-old female ADPKD patient carrying an R803X mutation in the PKD2 gene using the Sendai-virus delivery system. Downstream characterization of these iPSCs showed that they possessed normal karyotyping, were free of genomic integration, retained the disease-causing PKD2 mutation, expressed pluripotency markers and could differentiate into three germ layers.

  3. Efficient induction of Wheat-agropyron cristatum 6P translocation lines and GISH detection.

    Directory of Open Access Journals (Sweden)

    Liqiang Song

    Full Text Available The narrow genetic background restricts wheat yield and quality improvement. The wild relatives of wheat are the huge gene pools for wheat improvement and can broaden its genetic basis. Production of wheat-alien translocation lines can transfer alien genes to wheat. So it is important to develop an efficient method to induce wheat-alien chromosome translocation. Agropyroncristatum (P genome carries many potential genes beneficial to disease resistance, stress tolerance and high yield. Chromosome 6P possesses the desirable genes exhibiting good agronomic traits, such as high grain number per spike, powdery mildew resistance and stress tolerance. In this study, the wheat-A. cristatum disomic addition was used as bridge material to produce wheat-A. cristatum translocation lines induced by (60Co-γirradiation. The results of genomic in situ hybridization showed that 216 plants contained alien chromosome translocation among 571 self-pollinated progenies. The frequency of translocation was 37.83%, much higher than previous reports. Moreover, various alien translocation types were identified. The analysis of M2 showed that 62.5% of intergeneric translocation lines grew normally without losing the translocated chromosomes. The paper reported a high efficient technical method for inducing alien translocation between wheat and Agropyroncristatum. Additionally, these translocation lines will be valuable for not only basic research on genetic balance, interaction and expression of different chromosome segments of wheat and alien species, but also wheat breeding programs to utilize superior agronomic traits and good compensation effect from alien chromosomes.

  4. [Qualitative and quantitative evaluation of an internal medicine assistance line dedicated to the diagnosis and treatment of diseases for general practice].

    Science.gov (United States)

    Castillo, J-M; Agard, C; Artifoni, M; Brisseau, J-M; Connault, J; Durant, C; Espitia, O; Masseau, A; Neel, A; Perrin, F; Pistorius, M-A; Planchon, B; Ponge, T; Hamidou, M; Pottier, P

    2016-05-01

    Clinical reasoning and treatment challenges within the scope of general practice led to the development of an internal medicine assistance line provided by Nantes University Hospital. The primary outcome of this study was to describe callers' profile, their requests and answers provided. A prospective, cross-sectional, observational, descriptive study was undertaken. For each call were identified the calling physician, her/his specialty and work setting, the call's object and adequacy, the answer provided, the time needed to connect with the assistance line, the time devoted by the internal medicine physician to provide an answer to the request, and whether the assistance line prevented a visit to the emergency room. Each calling physician was then called back to obtain demographic and professional characteristics, and data relating to the call and to the assistance line. Sixty-three days were analyzed and 276 calls identified. The 237 identified calling physicians were mainly females (54%, n=93), with a mean age of 46 years, graduated from Nantes University (65%, n=86), practicing ambulatory general medicine (69%, n=164) in Loire-Atlantique department area (82%, n=176) for a mean duration of 15 years. Calls were mostly associated with diagnostic challenges (61%, n=166) concerning clinical issues (57%, n=155). A sole telephone advice was the main type of answer provided (56%, n=147) and a visit to the emergency room was prevented for 17% of calls. The assistance line activity is adequate with its missions and seems to facilitate patients' healthcare delivery advocating for the development of similar structures in other units. Improvements relating to the information, availability and physicians' training should be considered. Copyright © 2015 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  5. production lines

    Directory of Open Access Journals (Sweden)

    Jingshan Li

    2000-01-01

    Full Text Available In this work, serial production lines with finished goods buffers operating in the pull regime are considered. The machines are assumed to obey Bernoulli reliability model. The problem of satisfying customers demand is addressed. The level of demand satisfaction is quantified by the due-time performance (DTP, which is defined as the probability to ship to the customer a required number of parts during a fixed time interval. Within this scenario, the definitions of DTP bottlenecks are introduced and a method for their identification is developed.

  6. In Vitro Differentiation and Propagation of Urothelium from Pluripotent Stem Cell Lines.

    Science.gov (United States)

    Osborn, Stephanie L; Kurzrock, Eric A

    2018-01-01

    Bioengineering of bladder tissue, particularly for those patients who have advanced bladder disease, requires a source of urothelium that is healthy, capable of significant proliferation in vitro and immunologically tolerated upon transplant. As pluripotent stem cells have the potential to fulfill such criteria, they provide a critical cell source from which urothelium might be derived in vitro and used clinically. Herein, we describe the in vitro differentiation of urothelium from the H9 human embryonic stem cell (hESC) line through the definitive endoderm (DE) phase via selective culture techniques. The protocol can be used to derive urothelium from other hESCs or human-induced pluripotent stem cells.

  7. Adherence to Treatment, Safety, Tolerance, and Effectiveness of Perindopril/Amlodipine Fixed-Dose Combination in Greek Patients with Hypertension and Stable Coronary Artery Disease: A Pan-Hellenic Prospective Observational Study of Daily Clinical Practice.

    Science.gov (United States)

    Liakos, Charalampos I; Papadopoulos, Dimitrios P; Kotsis, Vasilios T

    2017-10-01

    Initiation of antihypertensive therapy with a two-drug fixed-dose combination (FDC) in a single tablet may be recommended in patients at high risk of cardiovascular events to improve adherence and effectiveness. Preferred combinations include an angiotensin-converting enzyme inhibitor with a dihydropyridine calcium antagonist. This study assessed adherence to and the safety, tolerance, and effectiveness of the perindopril/amlodipine FDC in Greek patients with hypertension and stable coronary artery disease (CAD) over a 4-month period. A total of 1907 patients with hypertension and CAD (59.1% males) who had recently (≤2 weeks) commenced treatment with the perindopril/amlodipine FDC (5/5, 5/10, 10/5, or 10/10 mg) were studied at baseline and at 1 and 4 months. Adherence to treatment was assessed with the Morisky Medication-taking Adherence Scale (MMAS). Seven patients (0.4%) did not attend the scheduled visits. In total, 1607 (84.6%) patients received a constant treatment dose throughout the study. High adherence (MMAS score = 0) was reported by 1592 (83.6%), 1628 (85.7%), and 1477 (77.7%) patients at the second and the third visit and at both visits, respectively. Adverse reactions were reported by only 13 (0.7%) patients, were all minor, and did not result in treatment discontinuation. Office blood pressure (BP) was significantly decreased at the third visit (130.8 ± 8.4/78.2 ± 6.4 mmHg) compared with baseline (156.5 ± 15.0/89.9 ± 9.6 mmHg; p < 0.001), regardless of previous antihypertensive treatment. Patients with grade 1, 2, and 3 hypertension at baseline showed a reduction in BP of 19.3/9.4, 31.5/13.5, and 47.8/22.2 mmHg, respectively (p < 0.001). Uncontrolled hypertension (≥140/90 mmHg) was notably reduced from 90.3% at baseline to 18.5% at the third visit. The perindopril/amlodipine FDC is characterized by high adherence and effectiveness, regardless of previous treatment. Degree of BP reduction was related to baseline BP levels

  8. Targeting phenotypically tolerant Mycobacterium tuberculosis

    Science.gov (United States)

    Gold, Ben; Nathan, Carl

    2016-01-01

    While the immune system is credited with averting tuberculosis in billions of individuals exposed to Mycobacterium tuberculosis, the immune system is also culpable for tempering the ability of antibiotics to deliver swift and durable cure of disease. In individuals afflicted with tuberculosis, host immunity produces diverse microenvironmental niches that support suboptimal growth, or complete growth arrest, of M. tuberculosis. The physiological state of nonreplication in bacteria is associated with phenotypic drug tolerance. Many of these host microenvironments, when modeled in vitro by carbon starvation, complete nutrient starvation, stationary phase, acidic pH, reactive nitrogen intermediates, hypoxia, biofilms, and withholding streptomycin from the streptomycin-addicted strain SS18b, render M. tuberculosis profoundly tolerant to many of the antibiotics that are given to tuberculosis patients in a clinical setting. Targeting nonreplicating persisters is anticipated to reduce the duration of antibiotic treatment and rate of post-treatment relapse. Some promising drugs to treat tuberculosis, such as rifampicin and bedaquiline, only kill nonreplicating M. tuberculosis in vitro at concentrations far greater than their minimal inhibitory concentrations against replicating bacilli. There is an urgent demand to identify which of the currently used antibiotics, and which of the molecules in academic and corporate screening collections, have potent bactericidal action on nonreplicating M. tuberculosis. With this goal, we review methods of high throughput screening to target nonreplicating M. tuberculosis and methods to progress candidate molecules. A classification based on structures and putative targets of molecules that have been reported to kill nonreplicating M. tuberculosis revealed a rich diversity in pharmacophores. However, few of these compounds were tested under conditions that would exclude the impact of adsorbed compound acting during the recovery phase of

  9. On the Breeding of Bivoltine Breeds of the Silkworm, Bombyx mori L. (Lepidoptera: Bombycidae, Tolerant to High Temperature and High Humidity Conditions of the Tropics

    Directory of Open Access Journals (Sweden)

    Harjeet Singh

    2010-01-01

    Full Text Available The hot climatic conditions of tropics prevailing particularly in summer are contributing to the poor performance of the bivoltine breeds and the most important aspect is that many quantitative characters such as viability and cocoon traits decline sharply when temperature is high. Hence, in a tropical country like India, it is very essential to develop bivoltine breeds/hybrids which can withstand the high temperature stress conditions. This has resulted in the development of CSR18 × CSR19, compatible hybrid for rearing throughout the year by utilizing Japanese thermotolerant hybrids as breeding resource material. Though, the introduction of CSR18 × CSR19 in the field during summer months had considerable impact, the productivity level and returns realized do not match that of other productive CSR hybrids. Therefore, the acceptance level of this hybrid with the farmers was not up to the expected level. This has necessitated the development of a temperature tolerant hybrid with better productivity traits than CSR18 × CSR19. Though, it was a difficult task to break the negative correlation associated with survival and productivity traits, attempts on this line had resulted in the development of CSR46 × CSR47, a temperature tolerant bivoltine hybrid with better productivity traits than CSR18 × CSR19. However, though, these hybrids are tolerant to high temperature environments, they are not tolerant to many of the silkworm diseases. Keeping this in view, an attempt is made to develop silkworm hybrids tolerant to high temperature environments.

  10. Low cadmium (LCD), a novel gene related to cadmium tolerance and accumulation in rice

    OpenAIRE

    Shimo, Hugo; Ishimaru, Yasuhiro; An, Gynheung; Yamakawa, Takashi; Nakanishi, Hiromi; Nishizawa, Naoko K.

    2011-01-01

    The contamination of food crops by cadmium (Cd) is a major concern in food production because it can reduce crop yields and threaten human health. In this study, knockout rice plants (Oryza sativa) tagged with the gene trap vector pGA2707 were screened for Cd tolerance, and the tolerant line lcd was obtained. The lcd mutant showed tolerance to Cd on agar plates and in hydroponic culture during early plant development. Metal concentration measurements in hydroponically grown plants revealed si...

  11. Line facilities outline

    International Nuclear Information System (INIS)

    1998-08-01

    This book deals with line facilities. The contents of this book are outline line of wire telecommunication ; development of line, classification of section of line and theory of transmission of line, cable line ; structure of line, line of cable in town, line out of town, domestic cable and other lines, Optical communication ; line of optical cable, transmission method, measurement of optical communication and cable of the sea bottom, Equipment of telecommunication line ; telecommunication line facilities and telecommunication of public works, construction of cable line and maintenance and Regulation of line equipment ; regulation on technique, construction and maintenance.

  12. Exploration of wild relatives of tomato for enhanced stress tolerance

    NARCIS (Netherlands)

    Junming Li,

    2010-01-01

    Among the different abiotic and biotic stresses, Botrytis cinerea, Phytophthora infestans and high salt concentrations are world-wide the most destructive. Several wild relatives of tomato were identified as source for tolerance to these stresses. Three introgression line (IL) populations derived

  13. Fault Tolerant Computer Architecture

    CERN Document Server

    Sorin, Daniel

    2009-01-01

    For many years, most computer architects have pursued one primary goal: performance. Architects have translated the ever-increasing abundance of ever-faster transistors provided by Moore's law into remarkable increases in performance. Recently, however, the bounty provided by Moore's law has been accompanied by several challenges that have arisen as devices have become smaller, including a decrease in dependability due to physical faults. In this book, we focus on the dependability challenge and the fault tolerance solutions that architects are developing to overcome it. The two main purposes

  14. Toleration, Synthesis or Replacement?

    DEFF Research Database (Denmark)

    Holtermann, Jakob v. H.; Madsen, Mikael Rask

    2016-01-01

    , in order to answer is not yet another partisan suggestion, but rather an attempt at making intelligible both the oppositions and the possibilities of synthesis between normative and empirical approaches to law. Based on our assessment and rational reconstruction of current arguments and positions, we...... therefore outline a taxonomy consisting of the following three basic, ideal-types in terms of the epistemological understanding of the interface of law and empirical studies: toleration, synthesis and replacement. This tripartite model proves useful with a view to teasing out and better articulating...

  15. A selective sweep in a microsporidian parasite Nosema-tolerant honeybee population, Apis mellifera

    DEFF Research Database (Denmark)

    Huang, Q.; Lattorff, H. M. G.; Kryger, P.

    2014-01-01

    Nosema is a microsporidian parasite of the honeybee, which infects the epithelial cells of the gut. In Denmark, honeybee colonies have been selectively bred for the absence of Nosema over decades, resulting in a breeding line that is tolerant toward Nosema infections. As the tolerance toward the ...

  16. An Endotoxin Tolerance Signature Predicts Sepsis and Organ Dysfunction at Initial Clinical Presentation

    Directory of Open Access Journals (Sweden)

    Olga M. Pena

    2014-11-01

    Interpretation: Our data support an updated model of sepsis pathogenesis in which endotoxin tolerance-mediated immune dysfunction (cellular reprogramming is present throughout the clinical course of disease and related to disease severity. Thus endotoxin tolerance might offer new insights guiding the development of new therapies and diagnostics for early sepsis.

  17. Lymphoblast-derived integration-free iPSC line AD-TREM2-1 from a 67 year-old Alzheimer's disease patient expressing the TREM2 p.R47H variant

    Directory of Open Access Journals (Sweden)

    Soraia Martins

    2018-05-01

    Full Text Available Human lymphoblast cells from a male diagnosed with Alzheimer's disease (AD expressing the TREM2 p.R47H variant were used to generate integration-free induced pluripotent stem cells (iPSCs by over-expressing episomal-based plasmids harbouring OCT4, SOX2, NANOG, LIN28, c-MYC and L-MYC. AD-TREM2–1 was defined as pluripotent based on (i expression of pluripotency-associated markers (ii embryoid body-based differentiation into cell types representative of the three germ layers and (iii the similarity between the transcriptome of the iPSC line and the human embryonic stem cell line H1 with a Pearson correlation of 0.947.

  18. Image-based phenotyping for non-destructive screening of different salinity tolerance traits in rice

    KAUST Repository

    Hairmansis, Aris; Berger, Bettina; Tester, Mark A.; Roy, Stuart

    2014-01-01

    Soil salinity is an abiotic stress wide spread in rice producing areas, limiting both plant growth and yield. The development of salt-tolerant rice requires efficient and high-throughput screening techniques to identify promising lines

  19. BCL9L Dysfunction Impairs Caspase-2 Expression Permitting Aneuploidy Tolerance in Colorectal Cancer

    DEFF Research Database (Denmark)

    López-García, Carlos; Sansregret, Laurent; Domingo, Enric

    2016-01-01

    Chromosomal instability (CIN) contributes to cancer evolution, intratumor heterogeneity, and drug resistance. CIN is driven by chromosome segregation errors and a tolerance phenotype that permits the propagation of aneuploid genomes. Through genomic analysis of colorectal cancers and cell lines, ...

  20. AFLP marker linked to water-stress-tolerant bulks in barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    A. Altinkut

    2003-01-01

    Full Text Available The amplified fragment length polymorphism (AFLP assay is an efficient method for the identification of molecular markers, useful in the improvement of numerous crop species. Bulked Segregant Analysis (BSA was used to identify AFLP markers associated with water-stress tolerance in barley, as this would permit rapid selection of water-stress tolerant genotypes in breeding programs. AFLP markers linked to water-stress tolerance was identified in two DNA pools (tolerant and sensitive, which were established using selected F2 individuals resulting from a cross between water-stress-tolerant and sensitive barley parental genotypes, based on their paraquat (PQ tolerance, leaf size, and relative water content (RWC. All these three traits were previously shown to be associated with water-stress tolerance in segregating F2 progeny of the barley cross used in a previous study. AFLP analysis was then performed on these DNA pools, using 40 primer pairs to detect AFLP fragments that are present/absent, respectively, in the two pools and their parental lines. One separate AFLP fragment, which was present in the tolerant parent and in the tolerant bulk, but absent in the sensitive parent and in the sensitive bulk, was identified. Polymorphism of the AFLP marker was tested among tolerant and sensitive F2 individuals. The presence of this marker that is associated with water-stress tolerance will greatly enhance selection for paraquat and water-stress tolerant genotypes in future breeding programs.

  1. Parallel Lines

    Directory of Open Access Journals (Sweden)

    James G. Worner

    2017-05-01

    Full Text Available James Worner is an Australian-based writer and scholar currently pursuing a PhD at the University of Technology Sydney. His research seeks to expose masculinities lost in the shadow of Australia’s Anzac hegemony while exploring new opportunities for contemporary historiography. He is the recipient of the Doctoral Scholarship in Historical Consciousness at the university’s Australian Centre of Public History and will be hosted by the University of Bologna during 2017 on a doctoral research writing scholarship.   ‘Parallel Lines’ is one of a collection of stories, The Shapes of Us, exploring liminal spaces of modern life: class, gender, sexuality, race, religion and education. It looks at lives, like lines, that do not meet but which travel in proximity, simultaneously attracted and repelled. James’ short stories have been published in various journals and anthologies.

  2. Ethnopoly promotes tolerance

    CERN Document Server

    CERN Bulletin

    2010-01-01

    On Friday 23 April, 225 primary school children from the eight schools in Meyrin-Cointrin and their accompanying adults took part in a big game of Ethnopoly. Private individuals, associations, administrations, shopkeepers and CERN all opened their doors to them to talk about their countries, their customs and what they are doing to promote tolerance and integration.   The CERN stand set up at ForumMeyrin for the Ethnopoly game. Scurrying from one place to another, the 10 and 11 year olds were made aware of the rich cultural diversity of their commune, which is home to 130 different nationalities. Physicists and engineers from CERN took up residence in the Forum Meyrin for the day in order to talk to the children about the advantages of international collaboration, a subject dear to the Organization's heart. They welcomed around fifty children in the course of the day, conveying to them a message of tolerance: despite their differences, the 10,000 scientists and other members of the CERN...

  3. Tolerance of Septoria nodorum Berk. in wheat: inheritance and potential in breeding

    International Nuclear Information System (INIS)

    Fossati, A.; Broennimann, A.

    1976-01-01

    Investigations in the genetics of tolerance towards Septoria nodorum Berk. in wheat showed that this tolerance is inherited polygenically and mainly additively. This has to be considered when breeding for tolerance. Crosses should be carried out between parents of the highest possible tolerance. Breeding for tolerance is carried out in two different manners: Conventional breeding and with the use of mutation techniques. The conventional breeding program can be divided into three steps: The choice of the parents, the selection in the narrow sense (F 2 - F 5 ) and the evaluation of the tolerant lines (F 6 till about F 9 ). When producing mutants with tolerance towards Septoria nodorum, another cultivar is treated every year in order to enlarge the genetical basis for selection. 7 cultivars have been treated since 1967. Some tolerant lines could be selected from most of the cultivars used for this treatment. The efficiency of the mutation and selection techniques used is discussed in the case of the cultivar Fermo. Besides the real improvement of tolerance the selection was accompanied in general also by an increase in plant height and grain size. But some tolerant mutants were also found which did not show these side effects. Furthermore, some mutants were selected in which the progress of infection is slowed down. (author)

  4. Selection individual on mutant genotype of soybean (Glycine maxl.merrill) in m5 generation based on resistance of stem rot disease Athelia rolfsii (curzi)

    Science.gov (United States)

    Rahmah, M.; Hanafiah, D. S.; Siregar, L. A. M.; Safni, I.

    2018-02-01

    This study was aimed to obtain selected individuals on soybean plant Glycine max L. (Merrill) in M5 generation based on high production character and tolerance of stem rot disease Athelia rolfsii (Curzi). This research was conducted in Plant Disease Laboratory and experimental field Faculty of Agriculture Universitas Sumatera Utara Medan, Indonesia. This research was conducted from December 2016 to June 2017. The treatments were 15 mutant lines genotypes and Anjasmoro variety. The results showed that some lines mutant genotypes can gave the good agronomic appearance character than Anjasmoro variety on inoculation treatment of stem rot disease. Selection performed on population M5 producesselected individuals with tolerance of stem rot disease from 100 and 200 Gy population.

  5. Fault-tolerant computing systems

    International Nuclear Information System (INIS)

    Dal Cin, M.; Hohl, W.

    1991-01-01

    Tests, Diagnosis and Fault Treatment were chosen as the guiding themes of the conference. However, the scope of the conference included reliability, availability, safety and security issues in software and hardware systems as well. The sessions were organized for the conference which was completed by an industrial presentation: Keynote Address, Reconfiguration and Recover, System Level Diagnosis, Voting and Agreement, Testing, Fault-Tolerant Circuits, Array Testing, Modelling, Applied Fault Tolerance, Fault-Tolerant Arrays and Systems, Interconnection Networks, Fault-Tolerant Software. One paper has been indexed separately in the database. (orig./HP)

  6. Commercialization of radiation tolerant camera

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yong Bum; Choi, Young Soo; Kim, Sun Ku; Lee, Jong Min; Cha, Bung Hun; Lee, Nam Ho; Byun, Eiy Gyo; Yoo, Seun Wook; Choi, Bum Ki; Yoon, Sung Up; Kim, Hyun Gun; Sin, Jeong Hun; So, Suk Il

    1999-12-01

    In this project, radiation tolerant camera which tolerates 10{sup 6} - 10{sup 8} rad total dose is developed. In order to develop radiation tolerant camera, radiation effect of camera components was examined and evaluated, and camera configuration was studied. By the result of evaluation, the components were decided and design was performed. Vidicon tube was selected to use by image sensor and non-browning optics and camera driving circuit were applied. The controller needed for CCTV camera system, lens, light, pan/tilt controller, was designed by the concept of remote control. And two type of radiation tolerant camera were fabricated consider to use in underwater environment or normal environment. (author)

  7. Commercialization of radiation tolerant camera

    International Nuclear Information System (INIS)

    Lee, Yong Bum; Choi, Young Soo; Kim, Sun Ku; Lee, Jong Min; Cha, Bung Hun; Lee, Nam Ho; Byun, Eiy Gyo; Yoo, Seun Wook; Choi, Bum Ki; Yoon, Sung Up; Kim, Hyun Gun; Sin, Jeong Hun; So, Suk Il

    1999-12-01

    In this project, radiation tolerant camera which tolerates 10 6 - 10 8 rad total dose is developed. In order to develop radiation tolerant camera, radiation effect of camera components was examined and evaluated, and camera configuration was studied. By the result of evaluation, the components were decided and design was performed. Vidicon tube was selected to use by image sensor and non-browning optics and camera driving circuit were applied. The controller needed for CCTV camera system, lens, light, pan/tilt controller, was designed by the concept of remote control. And two type of radiation tolerant camera were fabricated consider to use in underwater environment or normal environment. (author)

  8. Removing celiac disease-related gluten proteins from bread wheat while retaining technological properties: a study with Chinese spring deletion lines

    NARCIS (Netherlands)

    van den Broeck, H.C.; van Herpen, T.W.J.M.; Schuit, C.; Salentijn, E.M.J.; Dekking, L.; Bosch, D.|info:eu-repo/dai/nl/073731374; Hamer, R.J.; Smulders, M.J.M.; Gilissen, L.J.W.J.; van der Meer, I.M.

    2009-01-01

    Background: Gluten proteins can induce celiac disease (CD) in genetically susceptible individuals. In CD patients gluten-derived peptides are presented to the immune system, which leads to a CD4+ T-cell mediated immune response and inflammation of the small intestine. However, not all gluten

  9. A Consideration of Resistance and Tolerance for Ruminant Nematode Infections

    Directory of Open Access Journals (Sweden)

    Steve eBishop

    2012-12-01

    Full Text Available Debates on the relative merits of resistance (the ability of the host to control the parasite lifecycle and tolerance (the net impact of infection on host performance are often lively and unhindered by data or evidence. Resistance generally shows continuous, heritable variation but data are sparser for tolerance, the utility of which will depend upon the disease prevalence. Prevalence is a function of group mean resistance and infection pressure, which itself is influenced by mean resistance. Tolerance will have most value for endemic diseases with a high prevalence, but will be of little value for low prevalence diseases. The conditionality of tolerance on infection status, and hence resistance, makes it difficult to estimate independently of resistance.Tolerance is potentially tractable for nematode infections, as the prevalence of infection is ca. 100% in animals grazing infected pasture, and infection level can be quantified by faecal egg count (FEC. Whilst individual animal phenotypes for tolerance are difficult to estimate, breeding values are estimable if related animals graze pastures of different contamination levels. Selection for resistance, i.e. FEC, provides both direct and indirect benefits from ever decreased pasture contamination and hence decreased infectious challenge. Modelling and experimental studies have shown that such reductions in pasture contamination may lead to substantially increased performance.It is proposed that selection goals addressing nematode infections should include both resistance and performance under challenging conditions. However, there may be benefits from exploiting large datasets in which sires are used across cohorts differing in infection level, to further explore tolerance. This may help to customise breeding objectives, with tolerance given greater weight in heavily parasitized environments.

  10. VT Digital Line Graph Miscellaneous Transmission Lines

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) This datalayer is comprised of Miscellaineous Transmission Lines. Digital line graph (DLG) data are digital representations of cartographic...

  11. Salt Tolerance in Soybean

    Institute of Scientific and Technical Information of China (English)

    Tsui-Hung Phang; Guihua Shao; Hon-Ming Lam

    2008-01-01

    Soybean is an Important cash crop and its productivity is significantly hampered by salt stress. High salt Imposes negative impacts on growth, nodulation, agronomy traits, seed quality and quantity, and thus reduces the yield of soybean. To cope with salt stress, soybean has developed several tolerance mechanisms, including: (I) maintenance of ion homeostasis; (ii) adjustment in response to osmotic stress; (iii) restoration of osmotic balance; and (iv) other metabolic and structural adaptations. The regulatory network for abiotic stress responses in higher plants has been studied extensively in model plants such as Arabidopsis thaliana. Some homologous components involved in salt stress responses have been identified in soybean. In this review, we tried to integrate the relevant works on soybean and proposes a working model to descdbe Its salt stress responses at the molecular level.

  12. Delay tolerant networks

    CERN Document Server

    Gao, Longxiang; Luan, Tom H

    2015-01-01

    This brief presents emerging and promising communication methods for network reliability via delay tolerant networks (DTNs). Different from traditional networks, DTNs possess unique features, such as long latency and unstable network topology. As a result, DTNs can be widely applied to critical applications, such as space communications, disaster rescue, and battlefield communications. The brief provides a complete investigation of DTNs and their current applications, from an overview to the latest development in the area. The core issue of data forward in DTNs is tackled, including the importance of social characteristics, which is an essential feature if the mobile devices are used for human communication. Security and privacy issues in DTNs are discussed, and future work is also discussed.

  13. Isolation of mutations affecting the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh.

    Science.gov (United States)

    Warren, G; McKown, R; Marin, A L; Teutonico, R

    1996-08-01

    We screened for mutations deleterious to the freezing tolerance of Arabidopsis thaliana (L.) Heynh. ecotype Columbia. Tolerance was assayed by the vigor and regrowth of intact plants after cold acclimation and freezing. From a chemically mutagenized population, we obtained 13 lines of mutants with highly penetrant phenotypes. In 5 of these, freezing sensitivity was attributable to chilling injury sustained during cold acclimation, but in the remaining 8 lines, the absence of injury prior to freezing suggested that they were affected specifically in the development of freezing tolerance. In backcrosses, freezing sensitivity from each line segregated as a single nuclear mutation. Complementation tests indicated that the 8 lines contained mutations in 7 different genes. The mutants' freezing sensitivity was also detectable in the leakage of electrolytes from frozen leaves. However, 1 mutant line that displayed a strong phenotype at the whole-plant level showed a relatively weak phenotype by the electrolyte leakage assay.

  14. Compounds that correct F508del-CFTR trafficking can also correct other protein trafficking diseases: an in vitro study using cell lines

    OpenAIRE

    Sampson Heidi M; Lam Hung; Chen Pei-Chun; Zhang Donglei; Mottillo Cristina; Mirza Myriam; Qasim Karim; Shrier Alvin; Shyng Show-Ling; Hanrahan John W; Thomas David Y

    2013-01-01

    Abstract Background Many genetic diseases are due to defects in protein trafficking where the mutant protein is recognized by the quality control systems, retained in the endoplasmic reticulum (ER), and degraded by the proteasome. In many cases, the mutant protein retains function if it can be trafficked to its proper cellular location. We have identified structurally diverse correctors that restore the trafficking and function of the most common mutation causing cystic fibrosis, F508del-CFTR...

  15. Ellipsoid clustering machine: a front line to aid in disease diagnosis - DOI: 10.3395/reciis.v1i2.Sup.101en

    Directory of Open Access Journals (Sweden)

    Paulo Costa Carvalho

    2007-12-01

    Full Text Available This study presents a new machine learning strategy to address the disease diagnosis classification problem that comprises an unknown number of disease classes. This is exemplified by a software called Ellipsoid Clustering Machine (ECM that identifies conserved regions in mass spectrometry proteomic profiles obtained from control subjects and uses these to estimate classification boundaries based on sample variance. The software can also be used for visual inspection of data reproducibility. ECM was evaluated using mass spectrometry protein profiles obtained from serum of Hodgkin’s disease patients (HD and control subjects. According to the leave-one-out cross validation, ECM completely separated both groups based only on the information derived from four selected mass spectral peaks. Classification details and a 3D graphical model showing the separation between the control subject cluster and HD patients is also presented. The software is available on the project website together with online interactive models of the dataset and an animation demonstrating the method.

  16. Treatment of Alzheimer disease.

    Science.gov (United States)

    Winslow, Bradford T; Onysko, Mary K; Stob, Christian M; Hazlewood, Kathleen A

    2011-06-15

    Alzheimer disease is the most common form of dementia, affecting nearly one-half [corrected] of Americans older than 85 years. It is characterized by progressive memory loss and cognitive decline. Amyloid plaque accumulation, neurofibrillary tau tangles, and depletion of acetylcholine are among the pathologic manifestations of Alzheimer disease. Although there are no proven modalities for preventing Alzheimer disease, hypertension treatment, omega-3 fatty acid supplementation, physical activity, and cognitive engagement demonstrate modest potential. Acetylcholinesterase inhibitors are first-line medications for the treatment of Alzheimer disease, and are associated with mild improvements in cognitive function, behavior, and activities of daily living; however, the clinical relevance of these effects is unclear. The most common adverse effects of acetylcholinesterase inhibitors are nausea, vomiting, diarrhea, dizziness, confusion, and cardiac arrhythmias. Short-term use of the N-methyl-D-aspartate receptor antagonist memantine can modestly improve measures of cognition, behavior, and activities of daily living in patients with moderate to severe Alzheimer disease. Memantine can also be used in combination with acetylcholinesterase inhibitors. Memantine is generally well tolerated, but whether its benefits produce clinically meaningful improvement is controversial. Although N-methyl-D-aspartate receptor antagonists and acetylcholinesterase inhibitors can slow the progression of Alzheimer disease, no pharmacologic agents can reverse the progression. Atypical antipsychotics can improve some behavioral symptoms, but have been associated with increased mortality rates in older patients with dementia. There is conflicting evidence about the benefit of selegiline, testosterone, and ginkgo for the treatment of Alzheimer disease. There is no evidence supporting the beneficial effects of vitamin E, estrogen, or nonsteroidal anti-inflammatory drug therapy.

  17. Variation in shoot tolerance mechanisms not related to ion toxicity in barley

    KAUST Repository

    Tilbrook, Joanne

    2017-09-27

    Soil salinity can severely reduce crop growth and yield. Many studies have investigated salinity tolerance mechanisms in cereals using phenotypes that are relatively easy to measure. The majority of these studies measured the accumulation of shoot Na+ and the effect this has on plant growth. However, plant growth is reduced immediately after exposure to NaCl before Na+ accumulates to toxic concentrations in the shoot. In this study, nondestructive and destructive measurements are used to evaluate the responses of 24 predominately Australian barley (Hordeum vulgare L.) lines at 0, 150 and 250mMNaCl. Considerable variation for shoot tolerance mechanisms not related to ion toxicity (shoot ion-independent tolerance) was found, withsome lines being able to maintain substantial growth rates under salt stress, whereas others stopped growing. Hordeum vulgare spp. spontaneum accessions and barley landraces predominantly had the best shoot ion independent tolerance, although two commercial cultivars, Fathom and Skiff, also had high tolerance. The tolerance of cv. Fathom may be caused by a recent introgression from H. vulgare L. spp. spontaneum. This study shows that the most salt-tolerant barley lines are those that contain both shoot ion-independent tolerance and the ability to exclude Na+ from the shoot (and thus maintain high K+: Na+ ratios).

  18. Variation in shoot tolerance mechanisms not related to ion toxicity in barley

    KAUST Repository

    Tilbrook, Joanne; Schilling, Rhiannon K.; Berger, Bettina; Garcia, Alexandre F.; Trittermann, Christine; Coventry, Stewart; Rabie, Huwaida; Brien, Chris; Nguyen, Martin; Tester, Mark A.; Roy, Stuart J.

    2017-01-01

    Soil salinity can severely reduce crop growth and yield. Many studies have investigated salinity tolerance mechanisms in cereals using phenotypes that are relatively easy to measure. The majority of these studies measured the accumulation of shoot Na+ and the effect this has on plant growth. However, plant growth is reduced immediately after exposure to NaCl before Na+ accumulates to toxic concentrations in the shoot. In this study, nondestructive and destructive measurements are used to evaluate the responses of 24 predominately Australian barley (Hordeum vulgare L.) lines at 0, 150 and 250mMNaCl. Considerable variation for shoot tolerance mechanisms not related to ion toxicity (shoot ion-independent tolerance) was found, withsome lines being able to maintain substantial growth rates under salt stress, whereas others stopped growing. Hordeum vulgare spp. spontaneum accessions and barley landraces predominantly had the best shoot ion independent tolerance, although two commercial cultivars, Fathom and Skiff, also had high tolerance. The tolerance of cv. Fathom may be caused by a recent introgression from H. vulgare L. spp. spontaneum. This study shows that the most salt-tolerant barley lines are those that contain both shoot ion-independent tolerance and the ability to exclude Na+ from the shoot (and thus maintain high K+: Na+ ratios).

  19. 131I-BSP liver function test by BSP tolerance

    International Nuclear Information System (INIS)

    Kanda, Koichi

    1974-01-01

    131 I-BSP liver function test after BSP intravenous tolerance was discussed, assuming that the reason why measurements of 131 I-BSP retention rate at 30 minutes and 131 I-BSP disappearance rate in blood showed respectable overlapping between normal group and group with slight liver disorders as compared with BSP test and the reason why differential diagnosis was difficult were due to underestimate of tolerance volume of 131 I-BSP. 131 I-BSP was observed with time as to 70 persons with normal liver function and 257 cases of liver diseases, using 5, 3 and 2 mg of non-radioactive BSP tolerance volume per kilogram of body weight. 131 I-BSP retention rate at 30 minutes and 131 I-BSP disappearance rate in blood are possible to separate overlapping over control in each measurement value at 3-5 mg/kg of tolerance, and in comparison of 3 mg and 5 mg, the latter showed a little excellent result. So, it was decided that tolerance of 3 mg/kg was a proper dose, considering tolerance to liver cells. 131 I-BSP retention rate at 30 minutes was a little excellent in accuracy and disappearance rate in blood after BSP tolerance is simple and profitable for practical use because collection of blood was only one time and measurement could be made with whole blood. As mentioned above, this method is seemed to be useful to practice of liver function test. (Kanao, N.)

  20. Reversal of oxycodone and hydrocodone tolerance by diazepam.

    Science.gov (United States)

    Gonek, Maciej; Akbarali, Hamid I; Henderson, Graeme; Dewey, William L

    2017-11-01

    The Centers for Disease Control has declared opioid abuse to be an epidemic. Overdose deaths are largely assumed to be the result of excessive opioid consumption. In many of these cases, however, opioid abusers are often polydrug abusers. Benzodiazepines are one of the most commonly co-abused substances and pose a significant risk to opioid users. In 2016, the FDA required boxed warnings - the FDA's strongest warning - for prescription opioid analgesics and benzodiazepines about the serious risks associated with using these medications at the same time. The point of our studies was to evaluate the interactions between these two classes of drugs. We investigated whether diazepam adds to the depressant effects of opioids or do they alter the levels of tolerance to opioids. In the present study, we have found that the antinociceptive tolerance that developed to repeated administration of oxycodone was reversed by an acute dose of diazepam. Antinociceptive tolerance to hydrocodone was also reversed by acute injection of diazepam; however, a fourfold higher dose of diazepam was required when compared to reversal of oxycodone-induced tolerance. These doses of diazepam did not potentiate the acute antinociceptive effect of either opioid. The same dose of diazepam that reversed oxycodone antinociceptive tolerance also reversed oxycodone locomotor tolerance while having no potentiating effects. These studies show that diazepam does not potentiate the acute effect of prescription opioids but reverses the tolerance developed after chronic administration of the drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Shaping tolerant attitudes towards immigrants

    DEFF Research Database (Denmark)

    Rapp, Carolin

    2017-01-01

    This article contributes to the ongoing discussion on how tolerance may be fostered in Western European countries and to the question of how contextual factors such as welfare state expenditures may contribute to this formation. Tolerance is understood as a basic democratic principle that helps c...

  2. Legal Quality, Inequality, and Tolerance

    DEFF Research Database (Denmark)

    Bjørnskov, Christian

    Previous findings suggest that income inequality leads to lower legal quality. This paper argues that voters' tolerance of inequality exerts an additional influence. Empirical findings suggest that inequality leads to lower legal quality due to its effect on trust while the tolerance of inequality...

  3. Legal Quality, Inequality, and Tolerance

    DEFF Research Database (Denmark)

    Bjørnskov, Christian

    2004-01-01

    Previous findings suggest that income inequality leads to lower legal quality. This paper argues that voters' tolerance of inequality exerts an additional influence. Empirical findings suggest that inequality leads to lower legal quality due to its effect on trust while the tolerance of inequality...

  4. Tolerance Issue in Kazakh Culture

    Science.gov (United States)

    Aubakirova, Saltanat S.; Ismagambetova, Zukhra N.; Karabayeva, Aliya G.; Rysbekova, Shamshiya S.; Mirzabekova, Alma Sh.

    2016-01-01

    In this article the authors reveal the basic cultural mechanisms that influence the formation of the tolerance strategy in Kazakh and Kazakhstan society, show its basic directions, as well as its importance for the modern Kazakhstan society and the formation of intercultural communication with foreign countries. Tolerance is a necessary element of…

  5. Tolerance-Based Feature Transforms

    NARCIS (Netherlands)

    Reniers, Dennie; Telea, Alexandru

    2007-01-01

    Tolerance-based feature transforms (TFTs) assign to each pixel in an image not only the nearest feature pixels on the boundary (origins), but all origins from the minimum distance up to a user-defined tolerance. In this paper, we compare four simple-to-implement methods for computing TFTs on binary

  6. Development of salt tolerant plants through genetic engineering (abstract)

    International Nuclear Information System (INIS)

    Mukhtar, Z.; Khan, S.A.; Zafar, Y.

    2005-01-01

    Salinity stress is one of the most serious factors limiting the productivity of agricultural crops. Genetic engineering provides a useful tool for tailoring plants with enhanced salt tolerance characteristics. Many organisms have evolved mechanisms to survive and grow under such extreme environments. These organisms provide us with a useful source of genes which can be used to improve salt tolerance in plants. The present study aims at identification and cloning of useful halo tolerance conferring genes from fungi and plants and to develop salt tolerant transgenic plants. Here we describe the cloning and use of HSR1 gene (a yeast transcription factor known to confer salt tolerance) and Na/sup +//H/sup +/ antiporter gene AtNHX1 (3016 bp) from Arabidopsis thaliana, and transformation of tobacco with HSR1 and AtNHX1 genes through Agrobacterium method. A number of transgenic tobacco plants were regenerated from leaf explants transformed with Agrobacterium tumefaciens (LBA4404) having HSR1 and AtNHX1 genes by leaf disc method. The putative transgenic plants were analyzed by PCR and dot blot analysis. Screening of these transgenic plants at different salinity levels is in progress which will help identify the suitable plant lines and thus the promising genes which can be further exploited to engineer salt tolerant crop plants. (author)

  7. Genetic study on salt tolerance involving mutants of barley

    International Nuclear Information System (INIS)

    Patil, S.S.; Sharma, R.P.

    1990-01-01

    Full text: Cultivar 'R-16' was subjected to mutagenesis through gamma irradiation, EMS and their combination treatments. M 6 lines differing in salt tolerance were utilised along with untreated control to generate 8x3 diallel crosses. The magnitude of combining ability variances indicated a relatively prominent role of SCA variance (non additive). The values of GCA effects indicate high breeding value of the mutant M-3 for salt tolerance based on measuring shoot length and root length of 10 day old seedlings. (author)

  8. Interactive animation of fault-tolerant parallel algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Apgar, S.W.

    1992-02-01

    Animation of algorithms makes understanding them intuitively easier. This paper describes the software tool Raft (Robust Animator of Fault Tolerant Algorithms). The Raft system allows the user to animate a number of parallel algorithms which achieve fault tolerant execution. In particular, we use it to illustrate the key Write-All problem. It has an extensive user-interface which allows a choice of the number of processors, the number of elements in the Write-All array, and the adversary to control the processor failures. The novelty of the system is that the interface allows the user to create new on-line adversaries as the algorithm executes.

  9. The U-line line balancing problem

    NARCIS (Netherlands)

    Miltenburg, G.J.; Wijngaard, J.

    1994-01-01

    The traditional line balancing (LB) problem considers a production line in which stations are arranged consecutively in a line. A balance is determined by grouping tasks into stations while moving forward (or backward) through a precedence network. Recently many production lines are being arranged

  10. Wheat multiple synthetic derivatives: a new source for heat stress tolerance adaptive traits

    Science.gov (United States)

    Elbashir, Awad Ahmed Elawad; Gorafi, Yasir Serag Alnor; Tahir, Izzat Sidahmed Ali; Kim, June-Sik; Tsujimoto, Hisashi

    2017-01-01

    Heat stress is detrimental to wheat (Triticum aestivum L.) productivity. In this study, we aimed to select heat-tolerant plants from a multiple synthetic derivatives (MSD) population and evaluate their agronomic and physiological traits. We selected six tolerant plants from the population with the background of the cultivar ‘Norin 61’ (N61) and established six MNH (MSD population of N61 selected as heat stress-tolerant) lines. We grew these lines with N61 in the field and growth chamber. In the field, we used optimum and late sowings to ensure plant exposure to heat. In the growth chamber, in addition to N61, we used the heat-tolerant cultivars ‘Gelenson’ and ‘Bacanora’. We confirmed that MNH2 and MNH5 lines acquired heat tolerance. These lines had higher photosynthesis and stomata conductance and exhibited no reduction in grain yield and biomass under heat stress compared to N61. We noticed that N61 had relatively good adaptability to heat stress. Our results indicate that the MSD population includes the diversity of Aegilops tauschii and is a promising resource to uncover useful quantitative traits derived from this wild species. Selected lines could be useful for heat stress tolerance breeding. PMID:28744178

  11. Hemodiafiltración en línea pre-dilucional, frente a post-dilucional: estudio comparativo de eficacia dialítica y tolerancia hemodinámica Pre-dilution versus post-dilution on-line haemodiafiltration: a comparative study of dialytic efficacy and haemodynamic tolerance

    Directory of Open Access Journals (Sweden)

    Raquel Menezo Viadero

    2012-06-01

    -dilucional en relación a los parámetros estudiados siempre que no se tenga en cuenta la problemática de los accesos vasculares. Con dicha técnica logramos mejores resultados de KT precisando la mitad de volumen de sustitución, con el consiguiente ahorro de agua ultrapura. La hemodiafiltración pre-dilucional puede ser una alternativa para aquellos pacientes que no se consiga un flujo arterial alto.On-line haemodiafiltration is a dialysis technique which combines the advantages of high-flow haemodialysis (diffusive transport and haemofiltration (convective transport. This technique allows different alternatives depending on how the reinfusion liquid is added: pre-dilution (before the dialyser and post-dilution (after the dialyser, each of them having advantages and disadvantages. The object of this study was to compare different dialytic and haemodynamic parameters in the pre- and post-dilution haemodiafiltration modes. A transversal prospective study was conducted of a population in dialysis already being treated with on-line haemodiafiltration, using each of the modes (pre- and post-dilution with them for 4 weeks. The following values were recorded: systolic and diastolic arterial pressure and cardiac frequency pre- and post-session, blood flow, venous pressure, volume of blood dialysed and replacement volume. Dialysis dosage was measured by means of ionic dialysance. 26 patients were studied: 30% women and 70% men, with an average age of 61±13 years. The average time under renal replacement treatment was 117±124.45 months, and the average time in haemodialysis was 50±54.38 months. The haemodynamic parameters showed no significant differences between the two modes studied (pre- and post-dilution. A statistically significant higher value for KT was obtained for the post-dilution haemodiafiltration technique, requiring half the replacement volume of the pre-dilution mode. Conclusions: The on-line haemodiafiltration technique is tolerated well in both infusion modes. With

  12. Pathogens and Disease Play Havoc on the Host Epiproteome—The “First Line of Response” Role for Proteomic Changes Influenced by Disorder

    Directory of Open Access Journals (Sweden)

    Erik H. A. Rikkerink

    2018-03-01

    Full Text Available Organisms face stress from multiple sources simultaneously and require mechanisms to respond to these scenarios if they are to survive in the long term. This overview focuses on a series of key points that illustrate how disorder and post-translational changes can combine to play a critical role in orchestrating the response of organisms to the stress of a changing environment. Increasingly, protein complexes are thought of as dynamic multi-component molecular machines able to adapt through compositional, conformational and/or post-translational modifications to control their largely metabolic outputs. These metabolites then feed into cellular physiological homeostasis or the production of secondary metabolites with novel anti-microbial properties. The control of adaptations to stress operates at multiple levels including the proteome and the dynamic nature of proteomic changes suggests a parallel with the equally dynamic epigenetic changes at the level of nucleic acids. Given their properties, I propose that some disordered protein platforms specifically enable organisms to sense and react rapidly as the first line of response to change. Using examples from the highly dynamic host-pathogen and host-stress response, I illustrate by example how disordered proteins are key to fulfilling the need for multiple levels of integration of response at different time scales to create robust control points.

  13. Induction of drought tolerant mutants of rice

    International Nuclear Information System (INIS)

    El-Hissewy, A.A.; Abd Allah, A.

    2001-01-01

    The ultimate goal of crop breeding is to develop varieties with a high yield potential and desirable agronomic characteristics. In Egypt, the most important qualities sought by breeders have been high yield potential, resistance to major diseases and insects, and improved grain and eating quality. However, breeding efforts should concentrate on varieties with the potential to minimize yield losses under unfavorable conditions such as drought, and to maximize yields when conditions are favorable. Rice (Oryza sativa L.) in Egypt is completely irrigated and a significant portion of the rice cultivated area is subject to water deficit resulting from an inadequate or insufficient irrigation supply. Drought tolerance is a complex trait in that it results from the interaction of histological and physiological characters of plant with environmental factors, both above-ground and under-ground. Accordingly, root characters are closely related to drought tolerance. Little attention has been paid in Egyptian breeding programs to root characters and their relation to shoot characters. Furthermore, induced mutations are considered as one of the most important methods to induce useful mutants, especially with improved root characters, to overcome the drought problem. The present investigation aimed to study the effect of different doses of gamma rays on several characters of three Egyptian rice varieties, i.e. 'Giza 171', 'Giza 175' and 'Giza 176' and to induce one or more mutants possessing drought tolerance

  14. Screening and selection of tomato genotypes/cultivars for drought tolerance using multivariate analysis

    International Nuclear Information System (INIS)

    Shamim, F.; Waheed, A.; Saqlan, S.M.; Athar, H.U.R.

    2014-01-01

    Drought is one of the most important abiotic stresses reducing crop growth and yield of tomato. Development of water stress tolerant cultivars through screening and selection is one important strategy to overcome this problem. In the present study, seeds of 120 local and exotic lines of tomato were allowed to germinate at varying levels of polyethylene glycol (PEG8000) induced water stress (PEG8000 0, 2.5%, 5.0% and 7.5%) for two weeks. Increasing PEG concentrations in the growth medium (water stress) caused a consistent decrease in seed germination percentage and seedling growth of all tomato cultivars. Moreover, a significant amount of genetic variability was found in all attributes of 120 genotypes of tomato. All lines/cultivars of tomato were ranked on the basis of relative water stress tolerance using 13 morphometric traits and categorized in four groups (tolerant, moderately tolerant, moderately sensitive, and sensitive) through multivariate analysis. Of 120 lines, 18, 25, 29 and 48 lines were ranked as tolerant, moderately tolerant, moderately sensitive and sensitive respectively. The germination percentage or speeds of germination were not found as effective indicator of genotypic differences for water stress at the seedling stage. Moreover, degree of water stress tolerance at the germination and seedling growth stage did not maintain in all tomato lines. Thus, it is not certain whether such variation is detectable at the later vegetative or reproductive growth stages. This needs to be further investigated. Overall, lines 19905, 19906, LA0716, and LA0722 were found to be water stress tolerant at least at early growth stages. (author)

  15. Vinorelbine as first-line or second-line therapy for advanced breast cancer: a Phase I-II trial by the Danish Breast Cancer Co-operative Group

    DEFF Research Database (Denmark)

    Langkjer, S.T.; Ejlertsen, B.; Mouridsen, H.

    2008-01-01

    INTRODUCTION: This study was conducted to establish the maximum tolerated dose (MTD) of intravenous vinorelbine and on the determined dose to assess efficacy and safety in patients with metastatic breast cancer previously treated with epirubicin. PATIENTS AND METHODS: Patients had histologically...... proven breast cancer and had received a prior epirubicin based regimen either adjuvant or as first line therapy for advanced disease. Vinorelbine was administered intravenously day 1 and 8 in a 3 weeks' schedule. Subsequently 48 additional patients were treated at one dose-level below MTD. RESULTS: Fifty...

  16. The innominate line

    International Nuclear Information System (INIS)

    Whelan, M.A.; Myung, K.H.; Bergeron, R.T.

    1984-01-01

    The innominate line continues to be of value in evaluating the integrity of the sphenoid bone since plain skull radiographs remain a primary screening tool for metastatic disease, seizure disorder and headache. The detection of lesions involving the sphenoid bone can be difficult. The accuracy of the radionulcide scan is reduced because of confusion caused by uptake in the adjacent nasal and sinus mucosa. On computed tomography, the sections through the base of the skull and orbit can contain many artifictual densities caused by a combination of bone, soft tissue and sinus air interfaces. In addition, routine settings of window width and level on CT scan are designed to best demonstrate the soft tissues, and bony lesions can easily be missed. Thus, disruption of the ''integrity'' of this line on plain films, particularly the Caldwell projection, can be a sensitive first indicator of disease involving the sphenoid bone. Such a determination on plain film leads to more accurate CT scanning, in that attention will be given to the skull base and scans will be imaged with both soft tissue and bone windows. (orig./MG)

  17. Mechanical tolerance stackup and analysis

    CERN Document Server

    Fischer, Bryan R

    2011-01-01

    Use Tolerance Analysis Techniques to Avoid Design, Quality, and Manufacturing Problems Before They Happen Often overlooked and misunderstood, tolerance analysis is a critical part of improving products and their design processes. Because all manufactured products are subject to variation, it is crucial that designers predict and understand how these changes can affect form, fit, and function of parts and assemblies--and then communicate their findings effectively. Written by one of the developers of ASME Y14.5 and other geometric dimension and tolerancing (GD&T) standards, Mechanical Tolerance

  18. Advanced cloud fault tolerance system

    Science.gov (United States)

    Sumangali, K.; Benny, Niketa

    2017-11-01

    Cloud computing has become a prevalent on-demand service on the internet to store, manage and process data. A pitfall that accompanies cloud computing is the failures that can be encountered in the cloud. To overcome these failures, we require a fault tolerance mechanism to abstract faults from users. We have proposed a fault tolerant architecture, which is a combination of proactive and reactive fault tolerance. This architecture essentially increases the reliability and the availability of the cloud. In the future, we would like to compare evaluations of our proposed architecture with existing architectures and further improve it.

  19. Selection of gamma-ray induced salt tolerant rice mutants by in vitro mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Sub; Chun, Jae Beom; Lee, Kyung Jun; Kim, Jin Baek; Kim, Sang Hoon; Yun, Song Jong; Kang, Si Yong [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-06-15

    The present study had been performed to select the salt tolerant rice mutant lines through an in vivo and in vitro mutagenesis with a gamma-ray. The physiological responses such as MDA and chlorophyll of the selected salt mutant lines were investigated under salt stress. For the selection of the salt tolerant rice mutants by in vitro mutagenesis with gamma-ray, we conducted a second selection procedure with 1,500 mutant lines induced from the original cv. Dongan (wild-type, WT): Ist, selection under a nutrient solution with 171 mM NaCI: 2nd, selection under in vitro conditions. Based on a growth comparison of the entries, out of mutant lines, the putative 2 salt tolerant rice mutant lines, ST-495 and ST-532, were selected. The 2 ST-lines had a lower malonaldehyde (MDA) contents than wild-type (WT) during salt stress. The survival rate of the WT, ST-495 and ST-532 were 36.6%, 70% and 50% in 171 mM NaCI, respectively. The chlorophyll and carotenoid contents were decreased more in a WT plant than the two selected mutant lines. These rice mutant lines will be released for cultivation at the reclaimed land and used as a control plot for genetic research about salt tolerance.

  20. Selection of gamma-ray induced salt tolerant rice mutants by in vitro mutagenesis

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Chun, Jae Beom; Lee, Kyung Jun; Kim, Jin Baek; Kim, Sang Hoon; Yun, Song Jong; Kang, Si Yong

    2010-01-01

    The present study had been performed to select the salt tolerant rice mutant lines through an in vivo and in vitro mutagenesis with a gamma-ray. The physiological responses such as MDA and chlorophyll of the selected salt mutant lines were investigated under salt stress. For the selection of the salt tolerant rice mutants by in vitro mutagenesis with gamma-ray, we conducted a second selection procedure with 1,500 mutant lines induced from the original cv. Dongan (wild-type, WT): Ist, selection under a nutrient solution with 171 mM NaCI: 2nd, selection under in vitro conditions. Based on a growth comparison of the entries, out of mutant lines, the putative 2 salt tolerant rice mutant lines, ST-495 and ST-532, were selected. The 2 ST-lines had a lower malonaldehyde (MDA) contents than wild-type (WT) during salt stress. The survival rate of the WT, ST-495 and ST-532 were 36.6%, 70% and 50% in 171 mM NaCI, respectively. The chlorophyll and carotenoid contents were decreased more in a WT plant than the two selected mutant lines. These rice mutant lines will be released for cultivation at the reclaimed land and used as a control plot for genetic research about salt tolerance

  1. Tolerance to and cross tolerance between ethanol and nicotine.

    Science.gov (United States)

    Collins, A C; Burch, J B; de Fiebre, C M; Marks, M J

    1988-02-01

    Female DBA mice were subjected to one of four treatments: ethanol-containing or control diets, nicotine (0.2, 1.0, 5.0 mg/kg/hr) infusion or saline infusion. After removal from the liquid diets or cessation of infusion, the animals were challenged with an acute dose of ethanol or nicotine. Chronic ethanol-fed mice were tolerant to the effects of ethanol on body temperature and open field activity and were cross tolerant to the effects of nicotine on body temperature and heart rate. Nicotine infused animals were tolerant to the effects of nicotine on body temperature and rotarod performance and were cross tolerant to the effects of ethanol on body temperature. Ethanol-induced sleep time was decreased in chronic ethanol- but not chronic nicotine-treated mice. Chronic drug treatment did not alter the elimination rate of either drug. Chronic ethanol treatment did not alter the number or affinity of brain nicotinic receptors whereas chronic nicotine treatment elicited an increase in the number of [3H]-nicotine binding sites. Tolerance and cross tolerance between ethanol and nicotine is discussed in terms of potential effects on desensitization of brain nicotinic receptors.

  2. Características da laranjeira 'Valência' sobre clones e híbridos de porta-enxertos tolerantes à tristeza Characteristics of 'Valencia' sweet orange onto clones and hybrid rootstocks tolerant to the tristeza disease

    Directory of Open Access Journals (Sweden)

    Rita Bordignon

    2003-01-01

    ção precoce e elevadosºBrix e ratio desse genitor, tratando-se de determinantes genéticos independentes. Trifoliata induziu altos valores de ratio do suco e, todos os seus grupos de híbridos foram superiores à Sunki e ao Cravo. Quanto à produção, verificou-se a superioridade do Cravo em relação à Sunki e esta em relação ao Trifoliata, enquanto nos híbridos constatou-se ampla variabilidade genética, sendo 228 significativamente mais produtivos que o Trifoliata, 100 superiores à Sunki e 47 ao Cravo. Os resultados evidenciaram alto potencial de seleção desses híbridos.Variability and selection potential of 396 hybrids of Rangpur lime 'Limeira', (Citrus limonia (C, Sunki mandarin (C. sunki (S, Sour orange 'São Paulo'(C. aurantium (A and Trifoliate orange 'Davis A'(Poncirus trifoliata (T tolerant to the tristeza disease were studied, comparatively to the genitors Rangpur lime, Sunki and Trifoliate orange. Hybrids TxA, TxS, SxT, CxS, SxC, CxA and SxA were investigated as to yield of first three crops, productivity and several vegetative and industrial characteristics of Valencia sweet orange onto them. Rangpur lime, Trifoliate orange and T x S, S x T, T x A, C x A hybrids initiated yielding before Sunki and S x C, C x S, S x A hybrids. This result indicates a dominance of the precocious yield of Trifoliate even in the hybrids with Sunki and conversely, the opposite trend of Sunki and its hybrids, except in the combination with Trifoliate orange. Yield per canopy area induced by Trifoliate orange was low, contrasting with Rangpur lime, Sunki mandarin and T x S, S x T hybrids. It was observed a close relationship between the diameter of scions, the diameter of rootstocks right after transplant to the field and the same parameters in the subsequent years. Height, canopy, rootstock and scion trunk diameters were highly correlated and useful for composing an index vigor. Trifoliate orange and Sunki mandarin are the most divergent genitors regarding vigor, and the

  3. Accident tolerant fuel analysis

    International Nuclear Information System (INIS)

    2014-01-01

    Safety is central to the design, licensing, operation, and economics of Nuclear Power Plants (NPPs). Consequently, the ability to better characterize and quantify safety margin holds the key to improved decision making about light water reactor design, operation, and plant life extension. A systematic approach to characterization of safety margins and the subsequent margins management options represents a vital input to the licensee and regulatory analysis and decision making that will be involved. The purpose of the Risk Informed Safety Margin Characterization (RISMC) Pathway research and development (R&D) is to support plant decisions for risk-informed margins management by improving economics and reliability, and sustaining safety, of current NPPs. Goals of the RISMC Pathway are twofold: (1) Develop and demonstrate a risk-assessment method coupled to safety margin quantification that can be used by NPP decision makers as part of their margin recovery strategies. (2) Create an advanced ''RISMC toolkit'' that enables more accurate representation of NPP safety margin. In order to carry out the R&D needed for the Pathway, the Idaho National Laboratory is performing a series of case studies that will explore methods- and tools-development issues, in addition to being of current interest in their own right. One such study is a comparative analysis of safety margins of plants using different fuel cladding types: specifically, a comparison between current-technology Zircaloy cladding and a notional ''accident-tolerant'' (e.g., SiC-based) cladding. The present report begins the process of applying capabilities that are still under development to the problem of assessing new fuel designs. The approach and lessons learned from this case study will be included in future Technical Basis Guides produced by the RISMC Pathway. These guides will be the mechanism for developing the specifications for RISMC tools and for defining how plant

  4. Aberrant Smad3 phosphoisoforms in cyst-lining epithelial cells in the cpk mouse, a model of autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Hama, Taketsugu; Nakanishi, Koichi; Sato, Masashi; Mukaiyama, Hironobu; Togawa, Hiroko; Shima, Yuko; Miyajima, Masayasu; Nozu, Kandai; Nagao, Shizuko; Takahashi, Hisahide; Sako, Mayumi; Iijima, Kazumoto; Yoshikawa, Norishige; Suzuki, Hiroyuki

    2017-12-01

    Cystic epithelia acquire mesenchymal-like features in polycystic kidney disease (PKD). In this phenotypic alteration, it is well known that transforming growth factor (TGF)-β/Smad3 signaling is involved; however, there is emerging new data on Smad3 phosphoisoforms: Smad3 phosphorylated at linker regions (pSmad3L), COOH-terminal regions (pSmad3C), and both (pSmad3L/C). pSmad3L/C has a pathological role in colorectal cancer. Mesenchymal phenotype-specific cell responses in the TGF-β/Smad3 pathway are implicated in carcinomas. In this study, we confirmed mesenchymal features and examined Smad3 phosphoisoforms in the cpk mouse, a model of autosomal recessive PKD. Kidney sections were stained with antibodies against mesenchymal markers and domain-specific phospho-Smad3. TGF-β, pSmad3L, pSmad3C, JNK, cyclin-dependent kinase (CDK) 4, and c-Myc were evaluated by Western blotting. Cophosphorylation of pSmad3L/C was assessed by immunoprecipitation. α-Smooth muscle actin, which indicates mesenchymal features, was expressed higher in cpk mice. pSmad3L expression was increased in cpk mice and was predominantly localized in the nuclei of tubular epithelial cells in cysts; however, pSmad3C was equally expressed in both cpk and control mice. Levels of pSmad3L, JNK, CDK4, and c-Myc protein in nuclei were significantly higher in cpk mice than in controls. Immunoprecipitation showed that Smad3 was cophosphorylated (pSmad3L/C) in cpk mice. Smad3 knockout/ cpk double-mutant mice revealed amelioration of cpk abnormalities. These findings suggest that upregulating c-Myc through the JNK/CDK4-dependent pSmad3L pathway may be key to the pathophysiology in cpk mice. In conclusion, a qualitative rather than a quantitative abnormality of the TGF-β/Smad3 pathway is involved in PKD and may be a target for disease-specific intervention. Copyright © 2017 the American Physiological Society.

  5. TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

    Science.gov (United States)

    Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

    2013-11-18

    Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

  6. Tolerability of sibutramine during a 6-week treatment period in high-risk patients with cardiovascular disease and/or diabetes: a preliminary analysis of the Sibutramine Cardiovascular Outcomes (SCOUT) Trial.

    Science.gov (United States)

    Maggioni, Aldo P; Caterson, Ian; Coutinho, Walmir; Finer, Nick; Gaal, Luc Van; Sharma, Arya M; Torp-Pedersen, Christian; Bacher, Peter; Shepherd, Gillian; Sun, Rui; James, Philip

    2008-11-01

    Uncertainties about the cardiovascular safety of sibutramine led to the SCOUT trial that is investigating sibutramine plus weight management in high-risk, overweight/obese patients. A 6-week lead-in period during which all patients received sibutramine permitted an initial assessment of tolerability. A total of 10,742 patients received sibutramine and 3.1% of these discontinued due to an adverse event; issues affecting more than 10 patients were drug intolerance, headache, insomnia, nausea, dry mouth, and constipation-, tachycardia-, and hypertension-related events. Serious adverse events, most commonly associated with the System Organ Class, Cardiac disorders, were reported by 2.7% of patients; however, the majority was not considered sibutramine-related. Adverse events relating to high blood pressure and/or pulse rate, whether reported as adverse events leading to discontinuation, or serious adverse events were reported by less than 0.2% of patients. No serious or individual events leading to discontinuation occurred in more than 25 patients. There were 15 (0.1%) deaths; 10 were attributed to a cardiovascular cause. Discontinuations for adverse events were lower than anticipated. Serious adverse events generally reflected sibutramine's known pharmacology or were related to cardiac disorders already present in this high-risk population. When compared with epidemiological data, overall mortality rate was low and sibutramine was well tolerated in this mainly off-label population. No new safety issues were detected.

  7. Association and linkage analysis of aluminum tolerance genes in maize.

    Directory of Open Access Journals (Sweden)

    Allison M Krill

    Full Text Available BACKGROUND: Aluminum (Al toxicity is a major worldwide constraint to crop productivity on acidic soils. Al becomes soluble at low pH, inhibiting root growth and severely reducing yields. Maize is an important staple food and commodity crop in acidic soil regions, especially in South America and Africa where these soils are very common. Al exclusion and intracellular tolerance have been suggested as two important mechanisms for Al tolerance in maize, but little is known about the underlying genetics. METHODOLOGY: An association panel of 282 diverse maize inbred lines and three F2 linkage populations with approximately 200 individuals each were used to study genetic variation in this complex trait. Al tolerance was measured as net root growth in nutrient solution under Al stress, which exhibited a wide range of variation between lines. Comparative and physiological genomics-based approaches were used to select 21 candidate genes for evaluation by association analysis. CONCLUSIONS: Six candidate genes had significant results from association analysis, but only four were confirmed by linkage analysis as putatively contributing to Al tolerance: Zea mays AltSB like (ZmASL, Zea mays aluminum-activated malate transporter2 (ALMT2, S-adenosyl-L-homocysteinase (SAHH, and Malic Enzyme (ME. These four candidate genes are high priority subjects for follow-up biochemical and physiological studies on the mechanisms of Al tolerance in maize. Immediately, elite haplotype-specific molecular markers can be developed for these four genes and used for efficient marker-assisted selection of superior alleles in Al tolerance maize breeding programs.

  8. Rabbit model for human EBV-associated hemophagocytic syndrome (HPS): sequential autopsy analysis and characterization of IL-2-dependent cell lines established from herpesvirus papio-induced fatal rabbit lymphoproliferative diseases with HPS.

    Science.gov (United States)

    Hayashi, Kazuhiko; Jin, Zaishun; Onoda, Sachiyo; Joko, Hiromasa; Teramoto, Norihiro; Ohara, Nobuya; Oda, Wakako; Tanaka, Takehiro; Liu, Yi-Xuan; Koirala, Tirtha Raj; Oka, Takashi; Kondo, Eisaku; Yoshino, Tadashi; Takahashi, Kiyoshi; Akagi, Tadaatsu

    2003-05-01

    Epstein-Barr virus-associated hemophagocytic syndrome (EBV-AHS) is often associated with fatal infectious mononucleosis or T-cell lymphoproliferative diseases (LPD). To elucidate the true nature of fatal LPD observed in Herpesvirus papio (HVP)-induced rabbit hemophagocytosis, reactive or neoplastic, we analyzed sequential development of HVP-induced rabbit LPD and their cell lines. All of the seven Japanese White rabbits inoculated intravenously with HVP died of fatal LPD 18 to 27 days after inoculation. LPD was also accompanied by hemophagocytic syndrome (HPS) in five of these seven rabbits. Sequential autopsy revealed splenomegaly and swollen lymph nodes, often accompanied by bleeding, which developed in the last week. Atypical lymphoid cells infiltrated many organs with a "starry sky" pattern, frequently involving the spleen, lymph nodes, and liver. HVP-small RNA-1 expression in these lymphoid cells was clearly demonstrated by a newly developed in situ hybridization (ISH) system. HVP-ISH of immunomagnetically purified lymphoid cells from spleen or lymph nodes revealed HVP-EBER1+ cells in each CD4+, CD8+, or CD79a+ fraction. Hemophagocytic histiocytosis was observed in the lymph nodes, spleen, bone marrow, and thymus. HVP-DNA was detected in the tissues and peripheral blood from the infected rabbits by PCR or Southern blot analysis. Clonality analysis of HVP-induced LPD by Southern blotting with TCR gene probe revealed polyclonal bands, suggesting polyclonal proliferation. Six IL-2-dependent rabbit T-cell lines were established from transplanted scid mouse tumors from LPD. These showed latency type I/II HVP infection and had normal karyotypes except for one line, and three of them showed tumorigenicity in nude mice. These data suggest that HVP-induced fatal LPD in rabbits is reactive polyclonally in nature.

  9. TEMPERATURE TOLERANCES AND OSMOREGULATION IN ...

    African Journals Online (AJOL)

    The salinity and temperature tolerances of some burrowiq bivalves which oc:eur ... Along most of the estuary the salinity normally remains close to that of seawater (35'/.) ...... grapsoid crabs, Hemigrapsus nudus and Hemigrapsus oregonensis.

  10. TOLERANCE OF Abelmoschus esculentus (L

    African Journals Online (AJOL)

    Cletus

    Key word: - Tolerance, diesel oil, polluted soil, Abelmoschus esculentus. INTRODUCTION ... errors -of the mean values were calculated for the replicate readings and data .... African Schools and Colleges, 2nd Ed. University Press Limited ...

  11. Antibiotic tolerance and microbial biofilms

    DEFF Research Database (Denmark)

    Folkesson, Anders

    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We study the dynamics of antibiotic action within hydrodynamic flow chamber biofilms of Escherichia coli and Pseudomonas aeruginosa using isogenic mutants and fluorescent gene...... expression reporters and we address the question of how biofilm organization affects antibiotic susceptibility. The dynamics of microbial killing is monitored by viable count determination, and confocal laser microscopy. Our work shows that the apparent increased antibiotic tolerance is due to the formation...... of antibiotic tolerant subpopulations within the biofilm. The formation of these subpopulations is highly variable and dependent on the antibiotic used, the biofilm structural organization and the induction of specific tolerance mechanisms....

  12. Diagnosis and Fault-Tolerant Control for Thruster-Assisted Position Mooring System

    DEFF Research Database (Denmark)

    Nguyen, Trong Dong; Blanke, Mogens; Sørensen, Asgeir

    2007-01-01

    Development of fault-tolerant control systems is crucial to maintain safe operation of o®shore installations. The objective of this paper is to develop a fault- tolerant control for thruster-assisted position mooring (PM) system with faults occurring in the mooring lines. Faults in line......'s pretension or line breaks will degrade the performance of the positioning of the vessel. Faults will be detected and isolated through a fault diagnosis procedure. When faults are detected, they can be accommodated through the control action in which only parameter of the controlled plant has to be updated...... to cope with the faulty condition. Simulations will be carried out to verify the advantages of the fault-tolerant control strategy for the PM system....

  13. Cytokine regulation of immune tolerance

    OpenAIRE

    Wu, Jie; Xie, Aini; Chen, Wenhao

    2014-01-01

    The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...

  14. Women’s G Tolerance

    Science.gov (United States)

    1986-08-01

    for the groups matched by age (70 pairs), weight sickness, uncomfortable feelings of distension in arms (26 pairs), and act~vity status (84 pairs...mass-spring-damper) s ,stem Straining G tolerance, being dpendent on skeletal having a resonant frequency above about I Hz. As muscular strength and...of the women’s G tolerance stud\\ scclic variations in muscular strength and endurance. was below 0.1 Hz (11), the production of any significant

  15. Fault-tolerant rotary actuator

    Science.gov (United States)

    Tesar, Delbert

    2006-10-17

    A fault-tolerant actuator module, in a single containment shell, containing two actuator subsystems that are either asymmetrically or symmetrically laid out is provided. Fault tolerance in the actuators of the present invention is achieved by the employment of dual sets of equal resources. Dual resources are integrated into single modules, with each having the external appearance and functionality of a single set of resources.

  16. Behavioral Tolerance to Anticholinergic Agents

    Science.gov (United States)

    1986-11-20

    Medicine , 47, 137-141. 7. Kurtz, P.J. (1977) Behavioral and biochemical effects of the carbamate insecticide, mobam. Pharmacology Biochemistry & Behavior...tolerance to marihuana in rats. Pharmacology Biochemistry and Behavior, 1, 73-76. 43 40. Olson, J. and Carder, B. (1974) Behavioral tolerance to... marihuana as a function of amount of prior training. Pharmacology Biochemistry and Behavior, 2, 243-247. 41. Sidman, M. (1960) Tactics of Scientific

  17. Array Comparative Genomic Hybridization as the First-line Investigation for Neonates with Congenital Heart Disease: Experience in a Single Tertiary Center.

    Science.gov (United States)

    Choi, Bo Geum; Hwang, Su Kyung; Kwon, Jung Eun; Kim, Yeo Hyang

    2018-03-01

    The purpose of the present study was to investigate the advantages and disadvantages of verifying genetic abnormalities using array comparative genomic hybridization (a-CGH) immediately after diagnosis of congenital heart disease (CHD). Among neonates under the age of 28 days who underwent echocardiography from January 1, 2014 to April 30, 2016, neonates whose chromosomal and genomic abnormalities were tested using a-CGH in cases of an abnormal finding on echocardiography were enrolled. Of the 166 patients diagnosed with CHD, 81 underwent a-CGH and 11 patients (11/81, 13.5%) had abnormal findings on a-CGH. 22q11.2 deletion syndrome was the most common (4/11, 36.4%). On the first a-CGH, 4 patients were negative (4/81, 5%). Three of them were finally diagnosed with Williams syndrome using fluorescent in situ hybridization (FISH), 1 patient was diagnosed with Noonan syndrome through exome sequencing. All of them exhibited diffuse pulmonary artery branch hypoplasia, as well as increased velocity of blood flow, on repeated echocardiography. Five patients started rehabilitation therapy at mean 6 months old age in outpatient clinics and epilepsy was diagnosed in 2 patients. Parents of 2 patients (22q11.2 deletion syndrome and Patau syndrome) refused treatment due to the anticipated prognosis. Screening tests for genetic abnormalities using a-CGH in neonates with CHD has the advantage of early diagnosis of genetic abnormality during the neonatal period in which there is no obvious symptom of genetic abnormality. However, there are disadvantages that some genetic abnormalities cannot be identified on a-CGH. Copyright © 2018. The Korean Society of Cardiology.

  18. Cost-Effectiveness of First-Line Sevelamer and Lanthanum versus Calcium-Based Binders for Hyperphosphatemia of Chronic Kidney Disease.

    Science.gov (United States)

    Habbous, Steven; Przech, Sebastian; Martin, Janet; Garg, Amit X; Sarma, Sisira

    2018-03-01

    Phosphate binders are used to treat hyperphosphatemia among patients with chronic kidney disease (CKD). To conduct an economic evaluation comparing calcium-free binders sevelamer and lanthanum with calcium-based binders for patients with CKD. Effectiveness data were obtained from a recent meta-analysis of randomized trials. Effectiveness was measured as life-years gained and translated to quality-adjusted life-years (QALYs) using utility weights from the literature. A Markov model consisting of non-dialysis-dependent (NDD)-CKD, dialysis-dependent (DD)-CKD, and death was developed to estimate the incremental costs and effects of sevelamer and lanthanum versus those of calcium-based binders. A lifetime horizon was used and both costs and effects were discounted at 1.5%. All costs are presented in 2015 Canadian dollars from the Canadian public payer perspective. Results of probabilistic sensitivity analysis were presented using cost-effectiveness acceptability curves. Sensitivity analyses were conducted for risk pooling methods, omission of dialysis costs, and persistence of drug effects on mortality. Sevelamer resulted in an incremental cost-effectiveness ratio of $106,522/QALY for NDD-CKD and $133,847/QALY for DD-CKD cohorts. Excluding dialysis costs, sevelamer was cost-effective in the NDD-CKD cohort ($5,847/QALY) and the DD-CKD cohort ($11,178/QALY). Lanthanum was dominated regardless of whether dialysis costs were included. Existing evidence does not clearly support the cost-effectiveness of non-calcium-containing phosphate binders (sevelamer and lanthanum) relative to calcium-containing phosphate binders in DD-CKD patients. Our study suggests that sevelamer may be cost-effective before dialysis onset. Because of the remaining uncertainty in several clinically relevant outcomes over time in DD-CKD and NDD-CKD patients, further research is encouraged. Copyright © 2018 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier

  19. Genetic architecture of winter hardiness and frost tolerance in triticale.

    Directory of Open Access Journals (Sweden)

    Wenxin Liu

    Full Text Available Abiotic stress experienced by autumn-sown crops during winter is of great economic importance as it can have a severe negative impact on yield. In this study, we investigated the genetic architecture of winter hardiness and frost tolerance in triticale. To this end, we used a large mapping population of 647 DH lines phenotyped for both traits in combination with genome-wide marker data. Employing multiple-line cross QTL mapping, we identified nine main effect QTL for winter hardiness and frost tolerance of which six were overlapping between both traits. Three major QTL were identified on chromosomes 5A, 1B and 5R. In addition, an epistasis scan revealed the contribution of epistasis to the genetic architecture of winter hardiness and frost tolerance in triticale. Taken together, our results show that winter hardiness and frost tolerance are complex traits that can be improved by phenotypic selection, but also that genomic approaches hold potential for a knowledge-based improvement of these important traits in elite triticale germplasm.

  20. Abnormal glucose tolerance and lipid abnormalities in Indian ...

    African Journals Online (AJOL)

    Glucose tolerance and lipid levels in a random sample of 103 Indian patients (96 males and 7 females) with coronary artery disease (CAD) aged between 20 and 55 years were compared with those in a healthy Indian control group matched as regards age and sex. Previous episodes of myocardial infarction were taken as ...

  1. American Elm clones of importance in DED tolerance studies

    Science.gov (United States)

    We present the background and characteristics of American elm clones that are commercially available or of interest in research on Dutch elm disease (DED) tolerance in the United States. The characteristics of interest include origin, ploidy level, whether available in nursery trade, evidence of DED...

  2. Ischemic Tolerance of the Brain and Spinal Cord: A Review.

    Science.gov (United States)

    Yunoki, Masatoshi; Kanda, Takahiro; Suzuki, Kenta; Uneda, Atsuhito; Hirashita, Koji; Yoshino, Kimihiro

    2017-11-15

    Ischemic tolerance is an endogenous neuroprotective phenomenon induced by sublethal ischemia. Ischemic preconditioning (IPC), the first discovered form of ischemic tolerance, is widely seen in many species and in various organs including the brain and the spinal cord. Ischemic tolerance of the spinal cord is less familiar among neurosurgeons, although it has been reported from the viewpoint of preventing ischemic spinal cord injury during aortic surgery. It is important for neurosurgeons to have opportunities to see patients with spinal cord ischemia, and to understand ischemic tolerance of the spinal cord as well as the brain. IPC has a strong neuroprotective effect in animal models of ischemia; however, clinical application of IPC for ischemic brain and spinal diseases is difficult because they cannot be predicted. In addition, one drawback of preconditioning stimuli is that they are also capable of producing injury with only minor changes to their intensity or duration. Numerous methods to induce ischemic tolerance have been discovered that vary in their timing and the site at which short-term ischemia occurs. These methods include ischemic postconditioning (IPoC), remote ischemic preconditioning (RIPC), remote ischemic perconditioning (RIPerC) and remote ischemic postconditioning (RIPoC), which has had a great impact on clinical approaches to treatment of ischemic brain and spinal cord injury. Especially RIPerC and RIPoC to induce spinal cord tolerance are considered clinically useful, however the evidence supporting these methods is currently insufficient; further experimental or clinical research in this area is thus necessary.

  3. Ifosfamide, mesna and epirubicin as second-line chemotherapy in advanced breast cancer.

    Science.gov (United States)

    Kiraz, S; Baltali, E; Güler, N; Barista, I; Benekli, M; Celik, I; Güllü, I H; Kars, A; Tekuzman, G; Firat, D

    1996-08-01

    The ifosfamide, mesna and epirubicin (IMEpi) combination is administered to 16 patients having advanced metastatic breast carcinoma as second-line chemotherapy. We observed complete response in 6%, partial response in 44% (total overall response rate of 50%), stable disease in 12% and progressive disease in the remaining 38% of the patients. The median remission duration in responders was calculated to be 9.6 months. IMEpi regimen had a tolerable toxicity profile including alopecia, nausea and vomiting, microscopic hematuria, leukopenia and neurotoxicity in which serious complications necessitating discontinuation of the chemotherapy were not encountered. It might be concluded that IMEpi chemotherapy combination is an effective alternative among schedules in the management of patients with stage IV breast carcinoma without serious side effects.

  4. Prediction of Glucose Tolerance without an Oral Glucose Tolerance Test

    Directory of Open Access Journals (Sweden)

    Rohit Babbar

    2018-03-01

    Full Text Available IntroductionImpaired glucose tolerance (IGT is diagnosed by a standardized oral glucose tolerance test (OGTT. However, the OGTT is laborious, and when not performed, glucose tolerance cannot be determined from fasting samples retrospectively. We tested if glucose tolerance status is reasonably predictable from a combination of demographic, anthropometric, and laboratory data assessed at one time point in a fasting state.MethodsGiven a set of 22 variables selected upon clinical feasibility such as sex, age, height, weight, waist circumference, blood pressure, fasting glucose, HbA1c, hemoglobin, mean corpuscular volume, serum potassium, fasting levels of insulin, C-peptide, triglyceride, non-esterified fatty acids (NEFA, proinsulin, prolactin, cholesterol, low-density lipoprotein, HDL, uric acid, liver transaminases, and ferritin, we used supervised machine learning to estimate glucose tolerance status in 2,337 participants of the TUEF study who were recruited before 2012. We tested the performance of 10 different machine learning classifiers on data from 929 participants in the test set who were recruited after 2012. In addition, reproducibility of IGT was analyzed in 78 participants who had 2 repeated OGTTs within 1 year.ResultsThe most accurate prediction of IGT was reached with the recursive partitioning method (accuracy = 0.78. For all classifiers, mean accuracy was 0.73 ± 0.04. The most important model variable was fasting glucose in all models. Using mean variable importance across all models, fasting glucose was followed by NEFA, triglycerides, HbA1c, and C-peptide. The accuracy of predicting IGT from a previous OGTT was 0.77.ConclusionMachine learning methods yield moderate accuracy in predicting glucose tolerance from a wide set of clinical and laboratory variables. A substitution of OGTT does not currently seem to be feasible. An important constraint could be the limited reproducibility of glucose tolerance status during a

  5. Screening Pakistani cotton for drought tolerance

    International Nuclear Information System (INIS)

    Soomro, M.H.; Markhand, G.S.

    2011-01-01

    The drought is one of the biggest abiotic stresses for crop production in arid and semi-arid agriculture. Thus it is a challenge for plant scientists to screen and develop the drought tolerant cotton lines. In this study, 31 cotton genotypes/cultivars were evaluated under two irrigation regimes i. e., seven irrigations (Control) and two irrigations (Stress), using split plot design with four replications. The crop growth, yield and some physiological parameters were studied. There were high inter-varietal differences for all the parameters under control as well as drought stress. Although all the varieties for all parameters were significantly affected by drought but however, CRIS-9, MARVI, CRIS-134, CRIS-126, CRIS-337, CRIS-355 and CRIS-377 maintained highest performance for all the parameters studied under high drought conditions. (author)

  6. A Concept for fault tolerant controllers

    DEFF Research Database (Denmark)

    Niemann, Hans Henrik; Poulsen, Niels Kjølstad

    2009-01-01

    This paper describe a concept for fault tolerant controllers (FTC) based on the YJBK (after Youla, Jabr, Bongiorno and Kucera) parameterization. This controller architecture will allow to change the controller on-line in the case of faults in the system. In the described FTC concept, a safe mode...... controller is applied as the basic feedback controller. A controller for normal operation with high performance is obtained by including certain YJBK parameters (transfer functions) in the controller. This will allow a fast switch from normal operation to safe mode operation in case of critical faults...... in the system. The described FTC architecture allow the different feedback controllers to apply different sets of sensors and actuators....

  7. A novel two-step method for screening shade tolerant mutant plants via dwarfism

    Science.gov (United States)

    When subjected to shade, plants undergo rapid shoot elongation, which often makes them more prone to disease and mechanical damage. It has been reported that, in turfgrass, induced dwarfism can enhance shade tolerance. Here, we describe a two-step procedure for isolating shade tolerant mutants of ...

  8. PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation.

    Science.gov (United States)

    Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra

    2015-01-01

    Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

  9. Front-line intraperitoneal versus intravenous chemotherapy in stage III-IV epithelial ovarian, tubal, and peritoneal cancer with minimal residual disease: a competing risk analysis.

    Science.gov (United States)

    Chang, Yen-Hou; Li, Wai-Hou; Chang, Yi; Peng, Chia-Wen; Cheng, Ching-Hsuan; Chang, Wei-Pin; Chuang, Chi-Mu

    2016-03-17

    In the analysis of survival data for cancer patients, the problem of competing risks is often ignored. Competing risks have been recognized as a special case of time-to-event analysis. The conventional techniques for time-to-event analysis applied in the presence of competing risks often give biased or uninterpretable results. Using a prospectively collected administrative health care database in a single institution, we identified patients diagnosed with stage III or IV primary epithelial ovarian, tubal, and peritoneal cancers with minimal residual disease after primary cytoreductive surgery between 1995 and 2012. Here, we sought to evaluate whether intraperitoneal chemotherapy outperforms intravenous chemotherapy in the presence of competing risks. Unadjusted and multivariable subdistribution hazards models were applied to this database with two types of competing risks (cancer-specific mortality and other-cause mortality) coded to measure the relative effects of intraperitoneal chemotherapy. A total of 1263 patients were recruited as the initial cohort. After propensity score matching, 381 patients in each arm entered into final competing risk analysis. Cumulative incidence estimates for cancer-specific mortality were statistically significantly lower (p = 0.017, Gray test) in patients receiving intraperitoneal chemotherapy (5-year estimates, 34.5%; 95% confidence interval [CI], 29.5-39.6%, and 10-year estimates, 60.7%; 95% CI, 52.2-68.0%) versus intravenous chemotherapy (5-year estimates, 41.3%; 95% CI, 36.2-46.3%, and 10-year estimates, 67.5%, 95% CI, 61.6-72.7%). In subdistribution hazards analysis, for cancer-specific mortality, intraperitoneal chemotherapy outperforms intravenous chemotherapy (Subdistribution hazard ratio, 0.82; 95% CI, 0.70-0.96) after correcting other covariates. In conclusion, results from this comparative effectiveness study provide supportive evidence for previous published randomized trials that intraperitoneal chemotherapy

  10. Line Generalization and AutoCAD Map

    Directory of Open Access Journals (Sweden)

    Nada Vučetić

    2001-01-01

    Full Text Available The paper offers the results of original research made on the application of AutoCAD Map in line generalisation. The differences and similarities have been found out between the Douglas-Peucker method and the method of line simplification that is incorporated in AutoCAD Map. There have been also the inaccuracies found out in AutoCAD Map manual relating to the issues of buffer width and tolerance, and the line width before and after simplification. The paper gives recommendations about pseudo nodes dissolving. It has been noticed that AutoCAD Map simplification method is not independent of the order of points. The application of the method is illustrated by an example of coastal line of Istria.

  11. Polyamines Function in Stress Tolerance: From Synthesis to Regulation

    Directory of Open Access Journals (Sweden)

    Ji-Hong eLiu

    2015-10-01

    Full Text Available Plants are challenged by a variety of biotic or abiotic stresses, which can affect their growth and development, productivity and geographic distribution. In order to survive adverse environmental conditions, plants have evolved various adaptive strategies, among which is the accumulation of metabolites that play protective roles. A well-established example of the metabolites that are involved in stress responses, or stress tolerance, is the low-molecular-weight aliphatic polyamines, including putrescine,spermidine and spermine. The critical role of polyamines in stress tolerance is suggested by several lines of evidence: firstly, the transcript levels of polyamine biosynthetic genes, as well as the activities of the corresponding enzymes, are induced by stresses; secondly, elevation of endogenous polyamine levels by exogenous supply of polyamines, or overexpression of polyamine biosynthetic genes, results in enhanced stress tolerance; and thirdly, a reduction of endogenous polyamines is accompanied by compromised stress tolerance. A number of studies have demonstrated that polyamines function in stress tolerance largely by modulating the homeostasis of reactive oxygen species (ROS due to their direct, or indirect, roles in regulating antioxidant systems or suppressing ROS production. The transcriptional regulation of polyamine synthesis by transcription factors is also reviewed here. Meanwhile, future perspectives on polyamine research are also suggested.

  12. Proteomic Techniques and Management of Flooding Tolerance in Soybean.

    Science.gov (United States)

    Komatsu, Setsuko; Tougou, Makoto; Nanjo, Yohei

    2015-09-04

    Climate change is considered a major threat to world agriculture and food security. To improve the agricultural productivity and sustainability, the development of high-yielding stress-tolerant, and climate-resilient crops is essential. Of the abiotic stresses, flooding stress is a very serious hazard because it markedly reduces plant growth and grain yield. Proteomic analyses indicate that the effects of flooding stress are not limited to oxygen deprivation but include many other factors. Although many flooding response mechanisms have been reported, flooding tolerance mechanisms have not been fully clarified for soybean. There were limitations in soybean materials, such as mutants and varieties, while they were abundant in rice and Arabidopsis. In this review, plant proteomic technologies are introduced and flooding tolerance mechanisms of soybeans are summarized to assist in the improvement of flooding tolerance in soybeans. This work will expedite transgenic or marker-assisted genetic enhancement studies in crops for developing high-yielding stress-tolerant lines or varieties under abiotic stress.

  13. Tolerability of sibutramine during a 6-week treatment period in high-risk patients with cardiovascular disease and/or diabetes: a preliminary analysis of the Sibutramine Cardiovascular Outcomes (SCOUT) Trial

    DEFF Research Database (Denmark)

    Maggioni, A.P.; Caterson, I.; Coutinho, W.

    2008-01-01

    Uncertainties about the cardiovascular safety of sibutramine led to the SCOUT trial that is investigating sibutramine plus weight management in high-risk, overweight/obese patients. A 6-week lead-in period during which all patients received sibutramine permitted an initial assessment...... of tolerability. A total of 10,742 patients received sibutramine and 3.1% of these discontinued due to an adverse event; issues affecting more than 10 patients were drug intolerance, headache, insomnia, nausea, dry mouth, and constipation-, tachycardia-, and hypertension-related events. Serious adverse events......, most commonly associated with the System Organ Class, Cardiac disorders, were reported by 2.7% of patients; however, the majority was not considered sibutramine-related. Adverse events relating to high blood pressure and/or pulse rate, whether reported as adverse events leading to discontinuation...

  14. GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5.

    Science.gov (United States)

    Guo, Ying-Hui; Yu, Yue-Ping; Wang, Dong; Wu, Chang-Ai; Yang, Guo-Dong; Huang, Jin-Guang; Zheng, Cheng-Chao

    2009-01-01

    * Zinc finger proteins are a superfamily involved in many aspects of plant growth and development. However, CCCH-type zinc finger proteins involved in plant stress tolerance are poorly understood. * A cDNA clone designated Gossypium hirsutum zinc finger protein 1 (GhZFP1), which encodes a novel CCCH-type zinc finger protein, was isolated from a salt-induced cotton (G. hirsutum) cDNA library using differential hybridization screening and further studied in transgenic tobacco Nicotiana tabacum cv. NC89. Using yeast two-hybrid screening (Y2H), proteins GZIRD21A (GhZFP1 interacting and responsive to dehydration protein 21A) and GZIPR5 (GhZFP1 interacting and pathogenesis-related protein 5), which interacted with GhZFP1, were isolated. * GhZFP1 contains two typical zinc finger motifs (Cx8Cx5Cx3H and Cx5Cx4Cx3H), a putative nuclear export sequence (NES) and a potential nuclear localization signal (NLS). Transient expression analysis using a GhZFP1::GFP fusion gene in onion epidermal cells indicated a nuclear localization for GhZFP1. RNA blot analysis showed that the GhZFP1 transcript was induced by salt (NaCl), drought and salicylic acid (SA). The regions in GhZFP1 that interact with GZIRD21A and GZIPR5 were identified using truncation mutations. * Overexpression of GhZFP1 in transgenic tobacco enhanced tolerance to salt stress and resistance to Rhizoctonia solani. Therefore, it appears that GhZFP1 might be involved as an important regulator in plant responses to abiotic and biotic stresses.

  15. Strigolactones positively regulate chilling tolerance in pea and in Arabidopsis.

    Science.gov (United States)

    Cooper, James W; Hu, Yan; Beyyoudh, Leila; Yildiz Dasgan, H; Kunert, Karl; Beveridge, Christine A; Foyer, Christine H

    2018-01-17

    Strigolactones (SL) fulfil important roles in plant development and stress tolerance. Here we characterised the role of SL in the dark chilling tolerance of pea and Arabidopsis by analysis of mutants that are defective in either SL synthesis or signalling. Pea mutants (rms3, rms4, rms5) had significantly greater shoot branching with higher leaf chlorophyll a/b ratios and carotenoid contents than the wild type. Exposure to dark chilling significantly decreased shoot fresh weights but increased leaf numbers in all lines. However, dark chilling treatments decreased biomass (dry weight) accumulation only in rms3 and rms5 shoots. Unlike the wild type plants, chilling-induced inhibition of photosynthetic carbon assimilation was observed in the rms lines and also in max3-9, max4-1, max2-1 mutants that are defective in SL synthesis or signalling. When grown on agar plates the max mutant rosettes accumulated less biomass than the wild type. The synthetic SL, GR24 decreased leaf area in the wild type, max3-9 and max4-1 mutants but not in max2-1 in the absence of stress. Moreover, a chilling-induced decrease in leaf area was observed in all the lines in the presence of GR24. We conclude that SL plays an important role in the control of dark chilling tolerance. This article is protected by copyright. All rights reserved.

  16. A Fault-Tolerant HPC Scheduler Extension for Large and Operational Ensemble Data Assimilation:Application to the Red Sea

    KAUST Repository

    Toye, Habib; Kortas, Samuel; Zhan, Peng; Hoteit, Ibrahim

    2018-01-01

    the submission, monitoring and dynamic steering of workflow of dependent jobs in a fault-tolerant environment, we describe the assimilation system implementation and discuss in detail its coupling strategies. Within Decimate, only a few additional lines of Python

  17. 75 FR 29908 - Prothioconazole; Pesticide Tolerances

    Science.gov (United States)

    2010-05-28

    .... The straw numerical value (5 ppm) is matched between the U.S. and Codex. The tolerance definition for... lower (0.07 ppm) than the recommended U.S. group tolerance. The 0.07 ppm value is the current U.S. tolerance value for wheat, but will be replaced by the cereal grain group tolerance. Canada does not...

  18. 78 FR 40027 - Novaluron; Pesticide Tolerances

    Science.gov (United States)

    2013-07-03

    ...). This regulation additionally deletes the time- limited tolerance for strawberry, as that tolerance..., pears, potatoes, strawberries, and tomatoes and utilized estimates for PCT for recently registered uses... deletes the time-limited tolerance for strawberry, as that tolerance expired on December 31, 2011. VI...

  19. Soybean Salt Tolerance 1 (GmST1) Reduces ROS Production, Enhances ABA Sensitivity, and Abiotic Stress Tolerance in Arabidopsis thaliana.

    Science.gov (United States)

    Ren, Shuxin; Lyle, Chimera; Jiang, Guo-Liang; Penumala, Abhishek

    2016-01-01

    Abiotic stresses, including high soil salinity, significantly reduce crop production worldwide. Salt tolerance in plants is a complex trait and is regulated by multiple mechanisms. Understanding the mechanisms and dissecting the components on their regulatory pathways will provide new insights, leading to novel strategies for the improvement of salt tolerance in agricultural and economic crops of importance. Here we report that soybean salt tolerance 1, named GmST1, exhibited strong tolerance to salt stress in the Arabidopsis transgenic lines. The GmST1-overexpressed Arabidopsis also increased sensitivity to ABA and decreased production of reactive oxygen species under salt stress. In addition, GmST1 significantly improved drought tolerance in Arabidopsis transgenic lines. GmST1 belongs to a 3-prime part of Glyma.03g171600 gene in the current version of soybean genome sequence annotation. However, comparative reverse transcription-polymerase chain reaction analysis around Glyma.03g171600 genomic region confirmed that GmST1 might serve as an intact gene in soybean leaf tissues. Unlike Glyma.03g171600 which was not expressed in leaves, GmST1 was strongly induced by salt treatment in the leaf tissues. By promoter analysis, a TATA box was detected to be positioned close to GmST1 start codon and a putative ABRE and a DRE cis-acting elements were identified at about 1 kb upstream of GmST1 gene. The data also indicated that GmST1-transgenic lines survived under drought stress and showed a significantly lower water loss than non-transgenic lines. In summary, our results suggest that overexpression of GmST1 significantly improves Arabidopsis tolerance to both salt and drought stresses and the gene may be a potential candidate for genetic engineering of salt- and drought-tolerant crops.

  20. Soybean salt tolerance 1 (GmST1 reduces ROS production, enhances ABA sensitivity and abiotic stress tolerance in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Shuxin eRen

    2016-04-01

    Full Text Available Abiotic stresses, including high soil salinity, significantly reduce crop production worldwide. Salt tolerance in plants is a complex trait and is regulated by multiple mechanisms. Understanding the mechanisms and dissecting the components on their regulatory pathways will provide new insights, leading to novel strategies for the improvement of salt tolerance in agricultural and economic crops of importance. Here we report that soybean salt tolerance 1, named GmST1, exhibited strong tolerance to salt stress in the Arabidopsis transgenic lines. The GmST1-overexpressed Arabidopsis also increased sensitivity to ABA and decreased production of reactive oxygen species (ROS under salt stress. In addition, GmST1 significantly improved drought tolerance in Arabidopsis transgenic lines. GmST1 belongs to a 3-prime part of Glyma.03g171600 gene in the current version of soybean genome sequence annotation. However, comparative RT-PCR analysis around Glyma.03g171600 genomic region confirmed that GmST1 might serve as an intact gene in soybean leaf tissues. Unlike Glyma.03g171600 which was not expressed in leaves, GmST1 was strongly induced by salt treatment in the leaf tissues. By promoter analysis, a TATA box was detected to be positioned close to GmST1 start codon and a putative ABRE and a DRE cis-acting elements were identified at about 1kb upstream of GmST1 gene. The data also indicated that GmST1-transgenic lines survived under drought stress and showed a significantly lower water loss than non-transgenic lines. In summary, our results suggest that overexpression of GmST1 significantly improves Arabidopsis tolerance to both salt and drought stresses and the gene may be a potential candidate for genetic engineering of salt- and drought-tolerant crops.