WorldWideScience

Sample records for disease resistance genes

  1. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  2. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  3. A maize resistance gene functions against bacterial streak disease in rice

    OpenAIRE

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

  4. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  5. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  6. A maize resistance gene functions against bacterial streak disease in rice.

    Science.gov (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  7. Genetic anaylsis of a disease resistance gene from loblolly pine

    Science.gov (United States)

    Yinghua Huang; Nili Jin; Alex Diner; Chuck Tauer; Yan Zhang; John Damicone

    2003-01-01

    Rapid advances in molecular genetics provide great opportunities for studies of host defense mechanisms. Examination of plant responses to disease at the cellular and molecular level permits both discovery of changes in gene expression in the tissues attacked by pathogens, and identification of genetic components involved in the interaction between host and pathogens....

  8. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

    Science.gov (United States)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  9. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525

  10. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm.

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.

  11. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  12. Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Ana Teresa P. Carvalho

    2014-01-01

    Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

  13. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  14. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    Directory of Open Access Journals (Sweden)

    Bin He

    Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

  15. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

    Science.gov (United States)

    Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

    2018-01-04

    The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. gene effects for resistance to groundnut rossette disease in exotic

    African Journals Online (AJOL)

    ACSS

    2016-02-25

    Feb 25, 2016 ... The materials were evaluated for biotic and abiotic stresses, but succumbed to groundnut rosette disease .... done, where male parents were planted 10 days ... pm) for 21 days. .... particular environment is paramount for.

  17. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  18. Molecular evolution of the disease resistance gene Rx in Solanum

    NARCIS (Netherlands)

    Butterbach, P.B.E.

    2007-01-01

    Potato (Solanum tuberosum ssp. tuberosum) is the fourth most important food crop with an annual yield of about 300 million tons over the world. The history of the domestication of potato shows that disease-causing agents followed the tracks of potato cultivation in temperate climates

  19. Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

    Science.gov (United States)

    Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

    2017-09-30

    Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

  20. A physical map of the heterozygous grapevine 'Cabernet Sauvignon' allows mapping candidate genes for disease resistance

    Directory of Open Access Journals (Sweden)

    Scalabrin Simone

    2008-06-01

    Full Text Available Abstract Background Whole-genome physical maps facilitate genome sequencing, sequence assembly, mapping of candidate genes, and the design of targeted genetic markers. An automated protocol was used to construct a Vitis vinifera 'Cabernet Sauvignon' physical map. The quality of the result was addressed with regard to the effect of high heterozygosity on the accuracy of contig assembly. Its usefulness for the genome-wide mapping of genes for disease resistance, which is an important trait for grapevine, was then assessed. Results The physical map included 29,727 BAC clones assembled into 1,770 contigs, spanning 715,684 kbp, and corresponding to 1.5-fold the genome size. Map inflation was due to high heterozygosity, which caused either the separation of allelic BACs in two different contigs, or local mis-assembly in contigs containing BACs from the two haplotypes. Genetic markers anchored 395 contigs or 255,476 kbp to chromosomes. The fully automated assembly and anchorage procedures were validated by BAC-by-BAC blast of the end sequences against the grape genome sequence, unveiling 7.3% of chimerical contigs. The distribution across the physical map of candidate genes for non-host and host resistance, and for defence signalling pathways was then studied. NBS-LRR and RLK genes for host resistance were found in 424 contigs, 133 of them (32% were assigned to chromosomes, on which they are mostly organised in clusters. Non-host and defence signalling genes were found in 99 contigs dispersed without a discernable pattern across the genome. Conclusion Despite some limitations that interfere with the correct assembly of heterozygous clones into contigs, the 'Cabernet Sauvignon' physical map is a useful and reliable intermediary step between a genetic map and the genome sequence. This tool was successfully exploited for a quick mapping of complex families of genes, and it strengthened previous clues of co-localisation of major NBS-LRR clusters and

  1. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  2. Effector genomics accelerates discovery and functional profiling of potato disease resistance and phytophthora infestans avirulence genes.

    Directory of Open Access Journals (Sweden)

    Vivianne G A A Vleeshouwers

    Full Text Available Potato is the world's fourth largest food crop yet it continues to endure late blight, a devastating disease caused by the Irish famine pathogen Phytophthora infestans. Breeding broad-spectrum disease resistance (R genes into potato (Solanum tuberosum is the best strategy for genetically managing late blight but current approaches are slow and inefficient. We used a repertoire of effector genes predicted computationally from the P. infestans genome to accelerate the identification, functional characterization, and cloning of potentially broad-spectrum R genes. An initial set of 54 effectors containing a signal peptide and a RXLR motif was profiled for activation of innate immunity (avirulence or Avr activity on wild Solanum species and tentative Avr candidates were identified. The RXLR effector family IpiO induced hypersensitive responses (HR in S. stoloniferum, S. papita and the more distantly related S. bulbocastanum, the source of the R gene Rpi-blb1. Genetic studies with S. stoloniferum showed cosegregation of resistance to P. infestans and response to IpiO. Transient co-expression of IpiO with Rpi-blb1 in a heterologous Nicotiana benthamiana system identified IpiO as Avr-blb1. A candidate gene approach led to the rapid cloning of S. stoloniferum Rpi-sto1 and S. papita Rpi-pta1, which are functionally equivalent to Rpi-blb1. Our findings indicate that effector genomics enables discovery and functional profiling of late blight R genes and Avr genes at an unprecedented rate and promises to accelerate the engineering of late blight resistant potato varieties.

  3. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  4. Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

    Directory of Open Access Journals (Sweden)

    Shenglong Tan

    2012-01-01

    Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

  5. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  6. SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species

    Directory of Open Access Journals (Sweden)

    Vleeshouwers Vivianne GAA

    2011-08-01

    Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a

  7. Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

    Science.gov (United States)

    Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

    2011-06-01

    Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

  8. Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

    Science.gov (United States)

    Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

    2017-06-01

    Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

  9. Proportional odds model applied to mapping of disease resistance genes in plants

    Directory of Open Access Journals (Sweden)

    Maria Helena Spyrides-Cunha

    2000-03-01

    Full Text Available Molecular markers have been used extensively to map quantitative trait loci (QTL controlling disease resistance in plants. Mapping is usually done by establishing a statistical association between molecular marker genotypes and quantitative variations in disease resistance. However, most statistical approaches require a continuous distribution of the response variable, a requirement not always met since evaluation of disease resistance is often done using visual ratings based on an ordinal scale of disease severity. This paper discusses the application of the proportional odds model to the mapping of disease resistance genes in plants amenable to expression as ordinal data. The model was used to map two resistance QTL of maize to Puccinia sorghi. The microsatellite markers bngl166 and bngl669, located on chromosomes 2 and 8, respectively, were used to genotype F2 individuals from a segregating population. Genotypes at each marker locus were then compared by assessing disease severity in F3 plants derived from the selfing of each genotyped F2 plant based on an ordinal scale severity. The residual deviance and the chi-square score statistic indicated a good fit of the model to the data and the odds had a constant proportionality at each threshold. Single-marker analyses detected significant differences among marker genotypes at both marker loci, indicating that these markers were linked to disease resistance QTL. The inclusion of the interaction term after single-marker analysis provided strong evidence of an epistatic interaction between the two QTL. These results indicate that the proportional odds model can be used as an alternative to traditional methods in cases where the response variable consists of an ordinal scale, thus eliminating the problems of heterocedasticity, non-linearity, and the non-normality of residuals often associated with this type of data.Marcadores moleculares têm sido extensivamente usados para o mapeamento de loci de

  10. Isolation and Manipulation of Quantitative Tra it Loci for DIsease Resistance in Rice Using a Candid ate Gene Approach

    Institute of Scientific and Technical Information of China (English)

    Ke-Ming Hu; De-Yun Qiu; Xiang-Ling Shen; Xiang-Hua Li; Shi-Ping Wang

    2008-01-01

    Bacterial blight caused by Xanthomonas oryzae pv.oryzae and fungal blast caused by Magnaporthe grisea result in heavy production losses in rice,a main staple food for approximately 50%of the world's population.Application of host resistance to these pathogens iS the most economical and environment-friendly approach to solve this problem.Quantitative trait loci(QTLs)controlling quantitative resistance are valuable sources for broad.spectrum and durable disease resistance.Although large numbers of QTLs for bacteriaI blight and blast resistance have been identified.these sources have not been used effectively in rice improvement because of the complex genetic controI of quantitative resistance and because the genes underlying resistance QTLs are unknown.To isolate disease resistance QTLs,we established a candidate gene strategy that integrates linkage map,expression profile,and functionaI complementation analyses.This strategy has proven to be applicable for identifying the genes underlying minor resistance QTLs in rice-Xoo and rice-M grisea systems and it may also help to shed light on disease resistance QTLs of other cereals.Our results also suggest that a single minor QTL can be used in rice improvement by modulating the expression of the gene underlying the QTL.Pyramiding two or three minor QTL genes,whose expression can be managed and that function in different defense signaI transduction pathways,may allow the breeding of rice cultivars that are highly resistant to bacteriaI blight and blast.

  11. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.

    Science.gov (United States)

    Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J

    1999-11-23

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

  12. Genome-Wide Distribution, Organisation and Functional Characterization of Disease Resistance and Defence Response Genes across Rice Species

    Science.gov (United States)

    Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj

    2015-01-01

    The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056

  13. SNP discovery and marker development for disease resistance candidate genes in common carp (Cyprinus carpio)

    Science.gov (United States)

    Single nucleotide polymorphisms (SNPs) in immune response genes have been reported as markers of susceptibility to infectious diseases in human and livestock. A disease caused by cyprinid herpes virus 3 (CyHV-3) is highly contagious and virulent in common carp. With the aim to investigate the gene...

  14. Towards allele mining of bacterial wilt disease resistance gene in tomato

    International Nuclear Information System (INIS)

    Galvez, H.F.; Narciso, J.O.; Opina, N.L.; Canama, A.O.; Colle, M.G.; Latiza, M.A.; Caspillo, C.L.; Bituin, J.L.; Frankie, R.B.; Hautea, D.M.

    2005-01-01

    Tomato (Lycopersicon esculentum Mill.) is the most important vegetable commodity of the Philippines. Bacterial wilt caused by Ralstonia solanacearum is one serious constraint in tomato production particularly during off-season planting. A major locus derived from H7996 that confers resistance to bacterial wilt has been mapped in the tomato genome. To validate the biological function of the resistance locus and generate multiple allele -mimics-, targeted mutation was induced in tomato using gamma ray and ethyl methane sulfonate (EMS) mutagens. Suitable mutagen treatment was established by evaluating a wide range of mutagen doses/concentrations for a) percent seed germination, b) reduction in plant height, and c) loss of resistance. Six hundred Gy and 1.0% EMS were identified to generate large M1 families of H7996. From 10,000 initial seeds treated with either gamma ray or EMS, a total of 3,663 M1 plants were generated. M2 seeds were harvested from all surviving M1 plants. Several DNA markers have been resourced and are being developed specific to the bacterial wilt resistant gene. In the large M2 population, of H7996, both the phenotypic manifestation of bacterial wilt susceptibility and nucleotide changes in the resistance locus will be evaluated. Large M3 families for the different allele series of the bacterial wilt resistance gene will be established for future high throughput TILLING (Targeting Induced Local Lesions in Genomes) analysis in the gene region

  15. Digital Gene Expression Analysis to Screen Disease Resistance-Relevant Genes from Leaves of Herbaceous Peony (Paeonia lactiflora Pall. Infected by Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Saijie Gong

    Full Text Available Herbaceous peony (Paeonia lactiflora Pall. is a well-known traditional flower in China and is widely used for landscaping and garden greening due to its high ornamental value. However, disease spots usually appear after the flowering of the plant and may result in the withering of the plant in severe cases. This study examined the disease incidence in an herbaceous peony field in the Yangzhou region, Jiangsu Province. Based on morphological characteristics and molecular data, the disease in this area was identified as a gray mold caused by Botrytis cinerea. Based on previously obtained transcriptome data, eight libraries generated from two herbaceous peony cultivars 'Zifengyu' and 'Dafugui' with different susceptibilities to the disease were then analyzed using digital gene expression profiling (DGE. Thousands of differentially expressed genes (DEGs were screened by comparing the eight samples, and these genes were annotated using the Gene ontology (GO and Kyoto encyclopedia of genes and genomes (KEGG database. The pathways related to plant-pathogen interaction, secondary metabolism synthesis and antioxidant system were concentrated, and 51, 76, and 13 disease resistance-relevant candidate genes were identified, respectively. The expression patterns of these candidate genes differed between the two cultivars: their expression of the disease-resistant cultivar 'Zifengyu' sharply increased during the early stages of infection, while it was relatively subdued in the disease-sensitive cultivar 'Dafugui'. A selection of ten candidate genes was evaluated by quantitative real-time PCR (qRT-PCR to validate the DGE data. These results revealed the transcriptional changes that took place during the interaction of herbaceous peony with B. cinerea, providing insight into the molecular mechanisms of host resistance to gray mold.

  16. Toward The identification Of candidate genes involved in black pod disease resistance in Theobroma cacao L.

    Science.gov (United States)

    Increasing yield, quality and disease resistance are important objectives for cacao breeding programs. Some of the diseases, such as black pod rot (Phytophtora spp), frosty pod (Moniliophthora roreri) and witches’ broom (M. perniciosa), produce significant losses in all or in some of the various pro...

  17. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    Directory of Open Access Journals (Sweden)

    Zongli eHu

    2015-01-01

    Full Text Available Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi technology to partially silence three different genes (FOW2, FRP1 and OPR in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  18. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    Science.gov (United States)

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  19. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Science.gov (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

    2017-01-01

    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  20. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik

    2017-11-01

    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  1. The Batten disease gene CLN3 confers resistance to endoplasmic reticulum stress induced by tunicamycin

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Dan, E-mail: danw@bjmu.edu.cn [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Liu, Jing; Wu, Baiyan [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Tu, Bo; Zhu, Weiguo [Department of Biochemistry and Molecular Biology, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Luo, Jianyuan, E-mail: jluo@som.umaryland.edu [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Department of Medical and Research Technology, School of Medicine, University of Maryland, Baltimore 21201 (United States)

    2014-04-25

    Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration.

  2. The Batten disease gene CLN3 confers resistance to endoplasmic reticulum stress induced by tunicamycin

    International Nuclear Information System (INIS)

    Wu, Dan; Liu, Jing; Wu, Baiyan; Tu, Bo; Zhu, Weiguo; Luo, Jianyuan

    2014-01-01

    Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration

  3. Pest and disease resistance enhanced by heterologous suppression of a Nicotiana plumbaginifolia cytochrome P450 gene CYP72A2.

    Science.gov (United States)

    Smigocki, Ann C; Wilson, Dennis

    2004-12-01

    The functional role of the Nicotiana plumbaginifolia cytochrome P450 gene CYP72A2 was investigated in transgenic plants. N. tabacum plants transformed with a sense or antisense CYP72A2 construct exhibited diminished heights, branched stems, smaller leaves and deformed flowers. Western blot analysis revealed reduced levels of a 58 kDa protein corresponding to CYP72A2, suggesting that the CYP72A2 homolog was suppressed in the sense and antisense plants. Transgenic plants had increased resistance to Manduca sexta larvae that consumed about 35 to 90 less of transgenic versus control leaves. A virulent strain of Pseudomonas syringae pv. tabaci induced a disease-limiting response followed by a delayed and decreased development of disease symptoms in the transgenics. CYP72A2 gene mediated resistance suggests that the plant-pest or -pathogen interactions may have been modified by changes in bioactive metabolite pools.

  4. Application of disease-associated differentially expressed genes – Mining for functional candidate genes for mastitis resistance in cattle

    Directory of Open Access Journals (Sweden)

    Schwerin Manfred

    2003-06-01

    Full Text Available Abstract In this study the mRNA differential display method was applied to identify mastitis-associated expressed DNA sequences based on different expression patterns in mammary gland samples of non-infected and infected udder quarters of a cow. In total, 704 different cDNA bands were displayed in both udder samples. Five hundred-and-thirty two bands, (75.6% were differentially displayed. Ninety prominent cDNA bands were isolated, re-amplified, cloned and sequenced resulting in 87 different sequences. Amongst the 19 expressed sequence tags showing a similarity with previously described genes, the majority of these sequences exhibited homology to protein kinase encoding genes (26.3%, to genes involved in the regulation of gene expression (26.3%, to growth and differentiation factor encoding genes (21.0% and to immune response or inflammation marker encoding genes (21.0%. These sequences were shown to have mastitis-associated expression in the udder samples of animals with and without clinical mastitis by quantitative RT-PCR. They were mapped physically using a bovine-hamster somatic cell hybrid panel and a 5000 rad bovine whole genome radiation hybrid panel. According to their localization in QTL regions based on an established integrated marker/gene-map and their disease-associated expression, four genes (AHCY, PRKDC, HNRPU, OSTF1 were suggested as potentially involved in mastitis defense.

  5. Avirulence (AVR) Gene-Based Diagnosis Complements Existing Pathogen Surveillance Tools for Effective Deployment of Resistance (R) Genes Against Rice Blast Disease.

    Science.gov (United States)

    Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N J; Leung, H; Zhou, B

    2017-06-01

    Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of a rice blast pathogen population and for predicting the

  6. Rice Gene Network Inferred from Expression Profiling of Plants Overexpressing OsWRKY13,a Positive Regulator of Disease Resistance

    Institute of Scientific and Technical Information of China (English)

    Deyun Qiu; Jun Xiao; Weibo Xie; Hongbo Liu; Xianghua Li; Lizhong Xiong; Shiping Wang

    2008-01-01

    Accumulating information indicates that plant disease resistance signaling pathways frequently interact with other pathways regulating developmental processes or abiotic stress responses. However, the molecular mechanisms of these types of crosstalk remain poorly understood in most cases. Here we report that OsWRKY13, an activator of rice resistance to both bacterial and fungal pathogens, appears to function as a convergent point for crosstalk among the pathogen-induced salicylate-dependent defense pathway and five other physiologic pathways. Genome-wide analysis of the expression profiles of OsWRKY13-overexpressing lines suggests that OsWRKY13 directly or indirectly regulates the expression of more than 500 genes that are potentially involved in different physiologic processes according to the classification of the Gene Ontology database. By comparing the expression patterns of genes functioning in known pathways or cellular processes of pathogen infection and the phenotypes between OsWRKY13-overexpressing and wildtype plants, our data suggest that OsWRKY13 is also a regulator of other physiologic processes during pathogen infection. The OsWRKY13-associated disease resistance pathway synergistically interacts via OsWRKY13 with the glutathione/glutaredoxin system and flavonoid biosynthesis pathway to monitor redox homeostasis and to putatively enhance the biosynthesis of antimicrobial flavonoid phytoalexins, respectively, in OsWRKY13-overexpressing lines. Meanwhile, the OsWRKY13-associated disease resistance pathway appears to interact antagonistically with the SNAC1-mediated abiotic stress defense pathway, jasmonic acid signaling pathway, and terpenoid metabolism pathway via OsWRKY13 to suppress salt and cold defense responses as well as to putatively retard rice growth and development.

  7. Dissection and Manipulation of LRR Domains in Plant Disease Resistance Gene Products.

    Energy Technology Data Exchange (ETDEWEB)

    Bent, Andrew [Univ. of Wisconsin, Madison, WI (United States)

    2012-11-28

    Leucine-rich repeat (LRR) protein domains offer a readily diversifiable platform - literally, an extended protein surface - for specific binding of very diverse ligands. The project addressed the following overlapping research questions: How do leucine-rich repeat proteins recognize their cognate ligands? What are the intra- and inter-molecular transitions that occur that cause transmembrane LRR proteins to switch between off and on states? How do plants use LRR receptor proteins to activate disease resistance? Can we synthetically evolve new LRR proteins that have acquired new ligand specificities?

  8. Gradient phenomenon of multidrug resistance gene expression in breast cancer during neoadjuvant chemotherapy is related to disease progression

    Directory of Open Access Journals (Sweden)

    N. V. Litviakov

    2013-01-01

    Full Text Available The paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good response to NAC while the expression increase associated with poor response to NAC. In 25% of patients there was no such change in studied gene expression that means the lack of a gradient phenomenon. The objective was to study whether gradient phenomenon for MDR gene expression during NAC is related to disease free survival in breast cancer patients. Five-year metastasis-free survival in patients having a gradient phenomenon was 73 % versus 39 % in patients who lack a gradient phenomenon (log-rank test p=0,0018. So, the presence of a gradient phenomenon in patients is appeared to be associated with a good disease prognosis. It is assumed that the gradiThe paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good

  9. Multicentre investigation of pathogenic bacteria and antibiotic resistance genes in Chinese patients with acute exacerbation of chronic obstructive pulmonary disease.

    Science.gov (United States)

    Ma, Xiuqing; Cui, Junchang; Wang, Jing; Chang, Yan; Fang, Qiuhong; Bai, Changqing; Zhou, Xiumei; Zhou, Hong; Feng, Huasong; Wang, Ying; Zhao, Weiguo; Wen, Zhongguang; Wang, Ping; Liu, Yi; Yu, Ling; Li, Chunsun; Chen, Liangan

    2015-10-01

    A prospective observational study to investigate the distribution and antimicrobial resistance of pathogenic bacteria in patients with acute exacerbation of chronic obstructive pulmonary disease (AECOPD) in Beijing, China. Patients with AECOPD were recruited from 11 general hospitals. Sputum specimens were cultured and bacteria identified. Antibiotic susceptibility was determined for each isolate, and presence of antibiotic resistance genes was evaluated using polymerase chain reaction. Pathogenic bacteria were isolated from 109/318 patients (34.28%); 124 isolates of 22 pathogenic bacterial species were identified, including Klebsiella pneumoniae (16.94%), Pseudomonas aeruginosa (16.94%), Acinetobacter baumannii (11.29%), Streptococcus pneumoniae (8.87%), and Staphylococcus aureus (7.26%). S. aureus was sensitive to tigecycline, teicoplanin, vancomycin and linezolid but resistant to penicillin and levofloxacin. K.pneumoniae, P. aeruginosa, A. baumannii and E. coli were susceptible to amikacin and cefoperazone. K. pneumoniae and P. aeruginosa are the most common pathogenic bacteria in AECOPD cases in Beijing, China. Our antibiotic resistance findings may be helpful in selecting antibiotic therapy. © The Author(s) 2015.

  10. Cyclooxygenase-2, multidrug resistance 1, and breast cancer resistance protein gene polymorphisms and inflammatory bowel disease in the Danish population

    DEFF Research Database (Denmark)

    Østergaard, Mette; Ernst, Anja; Labouriau, Rodrigo S.

    2009-01-01

    =0.006) and 1.39 ((0.99-1.92) p=0.054), respectively, and for UC of 2.63 ((1.33-5.26) p=0.005) and 1.28 ((0.96-1.51) p=0.093), respectively, assuming complete dominance. No association was found for BCRP or other MDR1 SNPs, or for selected MDR1 haplotypes. No effect-modification of smoking habit......OBJECTIVE: Crohn's disease (CD) and ulcerative colitis (UC) are characterized by an impaired mucosal defence to normal constituents of the intestinal flora and a dysregulated inflammatory response. The purpose of the study was to investigate whether single nucleotide polymorphisms (SNPs) in genes....../A, C3435T and G-rs3789243-A (intron 3) were assessed in a Danish case-control study comprising 373 CD and 541 UC patients and 796 healthy controls. RESULTS: Carriers of the homozygous COX-2 and MDR1 intron 3 variant had a relatively high risk of CD, odds ratio (95% CI) (OR (95% CI))=2.86 ((1.34-5.88) p...

  11. Association Between the P2RY12 Receptor Gene Polymorphism and Aspirin Resistance in Patients with Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    Ludmila Karazhanova

    2014-12-01

    Full Text Available Introduction. Platelet activation and aggregation are key elements in the development of coronary atherosclerosis. Recent studies have shown that the two polymorphisms of platelet ADP receptor P2RY12 (haplotypes H2 and 34T are associated with increased platelet aggregation and atherothrombotic risk. It was shown that these polymorphisms promote reduced body response to antiplatelet therapy.Aim. We investigated the association of P2RY12 gene polymorphisms with aspirin resistance in patients with coronary artery disease (CAD.Methods. This case-control study included 100 cases with CAD (mean age 57.6 ± 2.8 years treated in the cardiology department of the city hospital Semey, Kazakhstan, 90 of whom suffered from myocardial infarction. The control group (n = 100 were healthy people without a history of CAD, matched on sex and age. Genotyping of polymorphisms H1/H2 in P2RY12 gene was performed by PCR. Statistical analysis was performed using SPSS v.19.0.Results. The distribution of H1/H2 genotypes P2RY12 was 42%, 34%, and 24%, respectively, in cases and 42%, 58%, and 0%, respectively, in controls. All allele frequencies were consistent with the Hardy Weinberg equilibrium (p = 0.0036 and p = 0.0001 in cases and controls, respectively. Genotype H2 was associated with risk of CAD with aspirin resistance (co-dominant model: OR = 3.75, 95% CI 0.14 - 99.88, p = 0.05 and dominant model: OR = 2.78, 95% CI 0.11 - 70.93, p = 0.05. We found significant differences in the distribution of the mutant genotype H2 between CAD patients with aspirin resistance and healthy controls (χ2 = 30.3, p < 0.05.Conclusion. We found an association of H2 haplotype in P2RY12 gene with aspirin resistance in patients with CAD. However, in order to obtain definitive conclusions about the role of genetic variants with the development of aspirin resistance in patients with CAD, there is a need for further research with a larger sample size as well as the use of selective thromboxane

  12. Differential expression of genes encoding anti-oxidant enzymes in Sydney rock oysters, Saccostrea glomerata (Gould) selected for disease resistance.

    Science.gov (United States)

    Green, Timothy J; Dixon, Tom J; Devic, Emilie; Adlard, Robert D; Barnes, Andrew C

    2009-05-01

    Sydney rock oysters (Saccostrea glomerata) selectively bred for disease resistance (R) and wild-caught control oysters (W) were exposed to a field infection of disseminating neoplasia. Cumulative mortality of W oysters (31.7%) was significantly greater than R oysters (0.0%) over the 118 days of the experiment. In an attempt to understand the biochemical and molecular pathways involved in disease resistance, differentially expressed sequence tags (ESTs) between R and W S. glomerata hemocytes were identified using the PCR technique, suppression subtractive hybridisation (SSH). Sequencing of 300 clones from two SSH libraries revealed 183 distinct sequences of which 113 shared high similarity to sequences in the public databases. Putative function could be assigned to 64 of the sequences. Expression of nine ESTs homologous to genes previously shown to be involved in bivalve immunity was further studied using quantitative reverse-transcriptase PCR (qRT-PCR). The base-line expression of an extracellular superoxide dismutase (ecSOD) and a small heat shock protein (sHsP) were significantly increased, whilst peroxiredoxin 6 (Prx6) and interferon inhibiting cytokine factor (IK) were significantly decreased in R oysters. From these results it was hypothesised that R oysters would be able to generate the anti-parasitic compound, hydrogen peroxide (H(2)O(2)) faster and to higher concentrations during respiratory burst due to the differential expression of genes for the two anti-oxidant enzymes of ecSOD and Prx6. To investigate this hypothesis, protein extracts from hemolymph were analysed for oxidative burst enzyme activity. Analysis of the cell free hemolymph proteins separated by native-polyacrylamide gel electrophoresis (PAGE) failed to detect true superoxide dismutase (SOD) activity by assaying dismutation of superoxide anion in zymograms. However, the ecSOD enzyme appears to generate hydrogen peroxide, presumably via another process, which is yet to be elucidated. This

  13. Analysis of the grape (Vitis vinifera L.) thaumatin-like protein (TLP) gene family and demonstration that TLP29 contributes to disease resistance.

    Science.gov (United States)

    Yan, Xiaoxiao; Qiao, Hengbo; Zhang, Xiuming; Guo, Chunlei; Wang, Mengnan; Wang, Yuejin; Wang, Xiping

    2017-06-27

    Thaumatin-like protein (TLP) is present as a large family in plants, and individual members play different roles in various responses to biotic and abiotic stresses. Here we studied the role of 33 putative grape (Vitis vinifera L.) TLP genes (VvTLP) in grape disease resistance. Heat maps analysis compared the expression profiles of 33 genes in disease resistant and susceptible grape species infected with anthracnose (Elsinoe ampelina), powdery mildew (Erysiphe necator) or Botrytis cinerea. Among these 33 genes, the expression level of TLP29 increased following the three pathogens inoculations, and its homolog from the disease resistant Chinese wild grape V. quinquangularis cv. 'Shang-24', was focused for functional studies. Over-expression of TLP29 from grape 'Shang-24' (VqTLP29) in Arabidopsis thaliana enhanced its resistance to powdery mildew and the bacterium Pseudomonas syringae pv. tomato DC3000, but decreased resistance to B. cinerea. Moreover, the stomatal closure immunity response to pathogen associated molecular patterns was strengthened in the transgenic lines. A comparison of the expression profiles of various resistance-related genes after infection with different pathogens indicated that VqTLP29 may be involved in the salicylic acid and jasmonic acid/ethylene signaling pathways.

  14. Molecular cytogenetic characterization of alien introgressions with gene Fhb3 for resistance to Fusarium head blight disease of wheat

    Science.gov (United States)

    Fusarium head blight (FHB) resistance was identified in the alien species Leymus racemosus, and wheat-Leymus introgression lines with FHB resistance were reported previously. Detailed molecular cytogenetic analysis of alien introgressions T01, T09, and T14 and the mapping of Fhb3, a new gene for FHB...

  15. Genome editing of the disease susceptibility gene CsLOB1 in citrus confers resistance to citrus canker.

    Science.gov (United States)

    Jia, Hongge; Zhang, Yunzeng; Orbović, Vladimir; Xu, Jin; White, Frank F; Jones, Jeffrey B; Wang, Nian

    2017-07-01

    Citrus is a highly valued tree crop worldwide, while, at the same time, citrus production faces many biotic challenges, including bacterial canker and Huanglongbing (HLB). Breeding for disease-resistant varieties is the most efficient and sustainable approach to control plant diseases. Traditional breeding of citrus varieties is challenging due to multiple limitations, including polyploidy, polyembryony, extended juvenility and long crossing cycles. Targeted genome editing technology has the potential to shorten varietal development for some traits, including disease resistance. Here, we used CRISPR/Cas9/sgRNA technology to modify the canker susceptibility gene CsLOB1 in Duncan grapefruit. Six independent lines, D LOB 2, D LOB 3, D LOB 9, D LOB 10, D LOB 11 and D LOB 12, were generated. Targeted next-generation sequencing of the six lines showed the mutation rate was 31.58%, 23.80%, 89.36%, 88.79%, 46.91% and 51.12% for D LOB 2, D LOB 3, D LOB 9, D LOB 10, D LOB 11 and D LOB 12, respectively, of the cells in each line. D LOB 2 and D LOB 3 showed canker symptoms similar to wild-type grapefruit, when inoculated with the pathogen Xanthomonas citri subsp. citri (Xcc). No canker symptoms were observed on D LOB 9, D LOB 10, D LOB 11 and D LOB 12 at 4 days postinoculation (DPI) with Xcc. Pustules caused by Xcc were observed on D LOB 9, D LOB 10, D LOB 11 and D LOB 12 in later stages, which were much reduced compared to that on wild-type grapefruit. The pustules on D LOB 9 and D LOB 10 did not develop into typical canker symptoms. No side effects and off-target mutations were detected in the mutated plants. This study indicates that genome editing using CRISPR technology will provide a promising pathway to generate disease-resistant citrus varieties. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Effects of an inducible aiiA gene on disease resistance in Eucalyptus urophylla × Eucalyptus grandis.

    Science.gov (United States)

    Ouyang, L J; Li, L M

    2016-08-01

    N-acyl-homoserine lactones (AHLs) are metabolites of mostly gram-negative bacteria and are critical signaling molecules in bacterial quorum-sensing systems. At threshold concentrations, AHLs can activate the expression of pathogenic genes and induce diseases. Therefore, reducing AHL concentrations is a key point of disease control in plants. AHL-lactonase, which is expressed by aiiA, is widespread in Bacillus sp and can hydrolyze AHLs. In the present study, we cloned aiiA from Bacillus subtilis by PCR. A plant expression vector of aiiA was constructed and name Pcam-PPP3-aiiA, in which expression of aiiA was controlled by the pathogen-inducible plant promoter PPP3. The recombinant plasmid was transferred into Eucalyptus × urophylla × E. grandis by an Agrobacterium-mediated transformation. PCR and Southern blotting showed that aiiA was successfully integrated into the E. urophylla × E. grandis genome and its expression was induced by Ralstonia solanacearum 12 h after inoculation, as shown by reverse transcription-PCR. The transcription efficacy of aiiA increased 43.88-, 30.65-, and 18.95-fold after inoculation with R. solanacearum, Erwinia carotovora ssp. zeae (Sabet) and Cylindrocladium quinqueseptatum, respectively as shown by RT-real-time PCR. Transgenic E.urophylla × E.grandis expressing the AIIA protein exhibited significantly enhanced disease resistance compared to non-transgenic plants by delaying the onset of wilting and reducing the disease index.

  17. Infection processes of xylem-colonizing pathogenic bacteria: possible explanations for the scarcity of qualitative disease resistance genes against them in crops.

    Science.gov (United States)

    Bae, Chungyun; Han, Sang Wook; Song, Yu-Rim; Kim, Bo-Young; Lee, Hyung-Jin; Lee, Je-Min; Yeam, Inhwa; Heu, Sunggi; Oh, Chang-Sik

    2015-07-01

    Disease resistance against xylem-colonizing pathogenic bacteria in crops. Plant pathogenic bacteria cause destructive diseases in many commercially important crops. Among these bacteria, eight pathogens, Ralstonia solanacearum, Xanthomonas oryzae pv. oryzae, X. campestris pv. campestris, Erwinia amylovora, Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. actinidiae, and Xylella fastidiosa, infect their host plants through different infection sites and paths and eventually colonize the xylem tissues of their host plants, resulting in wilting symptoms by blocking water flow or necrosis of xylem tissues. Noticeably, only a relatively small number of resistant cultivars in major crops against these vascular bacterial pathogens except X. oryzae pv. oryzae have been found or generated so far, although these pathogens threaten productivity of major crops. In this review, we summarize the lifestyles of major xylem-colonizing bacterial pathogens and then discuss the progress of current research on disease resistance controlled by qualitative disease resistance genes or quantitative trait loci against them. Finally, we propose infection processes of xylem-colonizing bacterial pathogens as one of possible reasons for why so few qualitative disease resistance genes against these pathogens have been developed or identified so far in crops.

  18. Genetic analysis of rice blast disease resistance genes using USDA rice mini-core and a mapping population

    Science.gov (United States)

    Rice blast disease caused by the fungal pathogen Magnaporthe oryzae (M. oryzae) is one of the most destructive diseases of cultivated rice, resulting in significant yield loss each year all over the world. Developing and utilizing blast resistant rice varieties is the most economical and effective m...

  19. Influences of the disease resistance conferred by the individual ...

    African Journals Online (AJOL)

    To research possible influences of the disease resistance conferred by different trans-resistance genes on the transgenic rice plants in their yields and grain quality, three transgenic rice lines, including two with the resistance genes Pi-d2 and Pi-d3, respectively, for rice blast, and one with the resistance gene Xa21 for rice ...

  20. Induced multiple disease resistance in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.; Worland, A.J.

    1990-01-01

    Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)

  1. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  2. Identification of candidate genes involved in Witches' broom disease resistance in a segregating mapping population of Theobroma cacao L. in Brazil.

    Science.gov (United States)

    Royaert, Stefan; Jansen, Johannes; da Silva, Daniela Viana; de Jesus Branco, Samuel Martins; Livingstone, Donald S; Mustiga, Guiliana; Marelli, Jean-Philippe; Araújo, Ioná Santos; Corrêa, Ronan Xavier; Motamayor, Juan Carlos

    2016-02-11

    Witches' broom disease (WBD) caused by the fungus Moniliophthora perniciosa is responsible for considerable economic losses for cacao producers. One of the ways to combat WBD is to plant resistant cultivars. Resistance may be governed by a few genetic factors, mainly found in wild germplasm. We developed a dense genetic linkage map with a length of 852.8 cM that contains 3,526 SNPs and is based on the MP01 mapping population, which counts 459 trees from a cross between the resistant 'TSH 1188' and the tolerant 'CCN 51' at the Mars Center for Cocoa Science in Barro Preto, Bahia, Brazil. Seven quantitative trait loci (QTL) that are associated with WBD were identified on five different chromosomes using a multi-trait QTL analysis for outbreeders. Phasing of the haplotypes at the major QTL region on chromosome IX on a diversity panel of genotypes clearly indicates that the major resistance locus comes from a well-known source of WBD resistance, the clone 'SCAVINA 6'. Various potential candidate genes identified within all QTL may be involved in different steps leading to disease resistance. Preliminary expression data indicate that at least three of these candidate genes may play a role during the first 12 h after infection, with clear differences between 'CCN 51' and 'TSH 1188'. We combined the information from a large mapping population with very distinct parents that segregate for WBD, a dense set of mapped markers, rigorous phenotyping capabilities and the availability of a sequenced genome to identify several genomic regions that are involved in WBD resistance. We also identified a novel source of resistance that most likely comes from the 'CCN 51' parent. Thanks to the large population size of the MP01 population, we were able to pick up QTL and markers with relatively small effects that can contribute to the creation and selection of more tolerant/resistant plant material.

  3. Inducible expression of Bs2 R gene from Capsicum chacoense in sweet orange (Citrus sinensis L. Osbeck) confers enhanced resistance to citrus canker disease.

    Science.gov (United States)

    Sendín, Lorena Noelia; Orce, Ingrid Georgina; Gómez, Rocío Liliana; Enrique, Ramón; Grellet Bournonville, Carlos Froilán; Noguera, Aldo Sergio; Vojnov, Adrián Alberto; Marano, María Rosa; Castagnaro, Atilio Pedro; Filippone, María Paula

    2017-04-01

    Transgenic expression of the pepper Bs2 gene confers resistance to Xanthomonas campestris pv. vesicatoria (Xcv) pathogenic strains which contain the avrBs2 avirulence gene in susceptible pepper and tomato varieties. The avrBs2 gene is highly conserved among members of the Xanthomonas genus, and the avrBs2 of Xcv shares 96% homology with the avrBs2 of Xanthomonas citri subsp. citri (Xcc), the causal agent of citrus canker disease. A previous study showed that the transient expression of pepper Bs2 in lemon leaves reduced canker formation and induced plant defence mechanisms. In this work, the effect of the stable expression of Bs2 gene on citrus canker resistance was evaluated in transgenic plants of Citrus sinensis cv. Pineapple. Interestingly, Agrobacterium-mediated transformation of epicotyls was unsuccessful when a constitutive promoter (2× CaMV 35S) was used in the plasmid construction, but seven transgenic lines were obtained with a genetic construction harbouring Bs2 under the control of a pathogen-inducible promoter, from glutathione S-transferase gene from potato. A reduction of disease symptoms of up to 70% was observed in transgenic lines expressing Bs2 with respect to non-transformed control plants. This reduction was directly dependent on the Xcc avrBs2 gene since no effect was observed when a mutant strain of Xcc with a disruption in avrBs2 gene was used for inoculations. Additionally, a canker symptom reduction was correlated with levels of the Bs2 expression in transgenic plants, as assessed by real-time qPCR, and accompanied by the production of reactive oxygen species. These results indicate that the pepper Bs2 resistance gene is also functional in a family other than the Solanaceae, and could be considered for canker control.

  4. Brief review of the chicken Major Histocompatibility Complex: the genes, their distribution on chromosome 16, and their contributions to disease resistance

    Science.gov (United States)

    Miller, Marcia M.; Taylor, Robert L.

    2016-01-01

    Nearly all genes presently mapped to chicken chromosome 16 (GGA 16) have either a demonstrated role in immune responses or are considered to serve in immunity by reason of sequence homology with immune system genes defined in other species. The genes are best described in regional units. Among these, the best known is the polymorphic major histocompatibility complex-B (MHC-B) region containing genes for classical peptide antigen presentation. Nearby MHC-B is a small region containing two CD1 genes, which encode molecules known to bind lipid antigens and which will likely be found in chickens to present lipids to specialized T cells, as occurs with CD1 molecules in other species. Another region is the MHC-Y region, separated from MHC-B by an intervening region of tandem repeats. Like MHC-B, MHC-Y is polymorphic. It contains specialized class I and class II genes and c-type lectin-like genes. Yet another region, separated from MHC-Y by the single nucleolar organizing region (NOR) in the chicken genome, contains olfactory receptor genes and scavenger receptor genes, which are also thought to contribute to immunity. The structure, distribution, linkages and patterns of polymorphism in these regions, suggest GGA 16 evolves as a microchromosome devoted to immune defense. Many GGA 16 genes are polymorphic and polygenic. At the moment most disease associations are at the haplotype level. Roles of individual MHC genes in disease resistance are documented in only a very few instances. Provided suitable experimental stocks persist, the availability of increasingly detailed maps of GGA 16 genes combined with new means for detecting genetic variability will lead to investigations defining the contributions of individual loci and more applications for immunogenetics in breeding healthy poultry. PMID:26740135

  5. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  6. Analysis of TIR- and non-TIR-NBS-LRR disease resistance gene analogous in pepper: characterization, genetic variation, functional divergence and expression patterns

    Directory of Open Access Journals (Sweden)

    Wan Hongjian

    2012-09-01

    Full Text Available Abstract Background Pepper (Capsicum annuum L. is one of the most important vegetable crops worldwide. However, its yield and fruit quality can be severely threatened by several pathogens. The plant nucleotide-binding site (NBS-leucine-rich repeat (LRR gene family is the largest class of known disease resistance genes (R genes effective against such pathogens. Therefore, the isolation and identification of such R gene homologues from pepper will provide a critical foundation for improving disease resistance breeding programs. Results A total of 78 R gene analogues (CaRGAs were identified in pepper by degenerate PCR amplification and database mining. Phylogenetic tree analysis of the deduced amino acid sequences for 51 of these CaRGAs with typically conserved motifs ( P-loop, kinase-2 and GLPL along with some known R genes from Arabidopsis and tomato grouped these CaRGAs into the non-Toll interleukin-1 receptor (TIR-NBS-LRR (CaRGAs I to IV and TIR-NBS-LRR (CaRGAs V to VII subfamilies. The presence of consensus motifs (i.e. P-loop, kinase-2 and hydrophobic domain is typical of the non-TIR- and TIR-NBS-LRR gene subfamilies. This finding further supports the view that both subfamilies are widely distributed in dicot species. Functional divergence analysis provided strong statistical evidence of altered selective constraints during protein evolution between the two subfamilies. Thirteen critical amino acid sites involved in this divergence were also identified using DIVERGE version 2 software. Analyses of non-synonymous and synonymous substitutions per site showed that purifying selection can play a critical role in the evolutionary processes of non-TIR- and TIR-NBS-LRR RGAs in pepper. In addition, four specificity-determining positions were predicted to be responsible for functional specificity. qRT-PCR analysis showed that both salicylic and abscisic acids induce the expression of CaRGA genes, suggesting that they may primarily be involved in

  7. Detection of macrolide resistance genes in culture-negative specimens from Bangladeshi children with invasive pneumococcal diseases.

    Science.gov (United States)

    Hasanuzzaman, Md; Malaker, Roly; Islam, Maksuda; Baqui, Abdullah H; Darmstadt, Gary L; Whitney, Cynthia G; Saha, Samir K

    2017-03-01

    In recent years, an increasing prevalence of macrolide resistance among pneumococci in Bangladesh has been observed. However, the scenario remains incomplete, as few isolates (80%) are culture-negative. This study optimised a triplex PCR method to detect macrolide resistance genes (MRGs) (mefA and ermB) and cpsA from culture-negative pneumococcal cases to predict the prevalence and level of macrolide resistance. The presence of MRGs among pneumococcal strains (n=153) with a wide range of erythromycin MICs (culture-negative clinical specimens and corresponding isolates. The known impact of the presence of specific MRG(s) on MICs of strains was used to predict the MICs of non-culturable strains based on the presence/absence of MRG(s) in the specimens. None of the erythromycin-susceptible isolates possessed any of the MRGs, and all non-susceptible strains had ≥1 MRG. MICs were 2-16mg/L and ≥256mg/L for 93% of strains with mefA and ermB, respectively, whereas 100% of isolates with both genes had MICs≥256mg/L. PCR for body fluids showed 100% concordance with corresponding isolates when tested for MRG(s) in parallel. Erythromycin MICs can be predicted for non-culturable strains with 93-100% precision based on detection of ermB and/or mefA. This method will be useful for establishing comprehensive surveillance for macrolide resistance among pneumococci, specifically in the population with prior antibiotic use. Copyright © 2017. Published by Elsevier Ltd.

  8. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  9. A Rice Gene Homologous to Arabidopsis AGD2-LIKE DEFENSE1 Participates in Disease Resistance Response against Infection with Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Ga Young Jung

    2016-08-01

    Full Text Available ALD1 (ABERRANT GROWTH AND DEATH2 [AGD2]-LIKE DEFENSE1 is one of the key defense regulators in Arabidopsis thaliana and Nicotiana benthamiana. In these model plants, ALD1 is responsible for triggering basal defense response and systemic resistance against bacterial infection. As well ALD1 is involved in the production of pipecolic acid and an unidentified compound(s for systemic resistance and priming syndrome, respectively. These previous studies proposed that ALD1 is a potential candidate for developing genetically modified (GM plants that may be resistant to pathogen infection. Here we introduce a role of ALD1-LIKE gene of Oryza sativa, named as OsALD1, during plant immunity. OsALD1 mRNA was strongly transcribed in the infected leaves of rice plants by Magnaporthe oryzae, the rice blast fungus. OsALD1 proteins predominantly localized at the chloroplast in the plant cells. GM rice plants over-expressing OsALD1 were resistant to the fungal infection. The stable expression of OsALD1 also triggered strong mRNA expression of PATHOGENESIS-RELATED PROTEIN1 genes in the leaves of rice plants during infection. Taken together, we conclude that OsALD1 plays a role in disease resistance response of rice against the infection with rice blast fungus.

  10. Differential expression of Toll-like receptor pathway genes in chicken embryo fibroblasts from chickens resistant and susceptible to Marek's disease.

    Science.gov (United States)

    Haunshi, Santosh; Cheng, Hans H

    2014-03-01

    The Toll-like receptor (TLR) signaling pathway is one of the innate immune defense mechanisms against pathogens in vertebrates and invertebrates. However, the role of TLR in non-MHC genetic resistance or susceptibility to Marek's disease (MD) in the chicken is yet to be elucidated. Chicken embryo fibroblast (CEF) cells from MD susceptible and resistant lines were infected either with Marek's disease virus (MDV) or treated with polyionosinic-polycytidylic acid, a synthetic analog of dsRNA, and the expression of TLR and pro-inflammatory cytokines was studied at 8 and 36 h posttreatment by quantitative reverse transcriptase PCR. Findings of the present study reveal that MDV infection and polyionosinic-polycytidylic acid treatment significantly elevated the mRNA expression of TLR3, IL6, and IL8 in both susceptible and resistant lines. Furthermore, basal expression levels in uninfected CEF for TLR3, TLR7, and IL8 genes were significantly higher in resistant chickens compared with those of susceptible chickens. Our results suggest that TLR3 together with pro-inflammatory cytokines may play a significant role in genetic resistance to MD.

  11. The 'Green Revolution' dwarfing genes play a role in disease resistance in Triticum aestivum and Hordeum vulgare.

    Science.gov (United States)

    Saville, R J; Gosman, N; Burt, C J; Makepeace, J; Steed, A; Corbitt, M; Chandler, E; Brown, J K M; Boulton, M I; Nicholson, P

    2012-02-01

    The Green Revolution dwarfing genes, Rht-B1b and Rht-D1b, encode mutant forms of DELLA proteins and are present in most modern wheat varieties. DELLA proteins have been implicated in the response to biotic stress in the model plant, Arabidopsis thaliana. Using defined wheat Rht near-isogenic lines and barley Sln1 gain of function (GoF) and loss of function (LoF) lines, the role of DELLA in response to biotic stress was investigated in pathosystems representing contrasting trophic styles (biotrophic, hemibiotrophic, and necrotrophic). GoF mutant alleles in wheat and barley confer a resistance trade-off with increased susceptibility to biotrophic pathogens and increased resistance to necrotrophic pathogens whilst the converse was conferred by a LoF mutant allele. The polyploid nature of the wheat genome buffered the effect of single Rht GoF mutations relative to barley (diploid), particularly in respect of increased susceptibility to biotrophic pathogens. A role for DELLA in controlling cell death responses is proposed. Similar to Arabidopsis, a resistance trade-off to pathogens with contrasting pathogenic lifestyles has been identified in monocotyledonous cereal species. Appreciation of the pleiotropic role of DELLA in biotic stress responses in cereals has implications for plant breeding.

  12. [ALLELES C282Y AND H63D HFE GENE, INSULIN RESISTANCE AND SUSCEPTIBILITY TO DISTURBANCE OF PORPHYRIN METABOLISM IN NON-ALCOHOLIC FATTY LIVER DISEASE].

    Science.gov (United States)

    Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V

    2015-01-01

    The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.

  13. Powdery Mildew Disease Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Shauna C.

    2010-08-31

    The overall goal of this project was to characterize the PMR5 protein, a member of the DUF231/TBR family, and to determine its role in plant cell wall biogenesis. Since the pmr5 mutants are also resistant to the fungal powdery mildew pathogen, we wished to determine what specific cell wall changes are associated with disease resistance and why. The graduate student working on this project made mutations in the putative active site of PMR5, assuming it is a member of the SGNH/GDSL esterase superfamily (Anantharaman and Aravind, 2010, Biology Direct 5, 1). These mutants were inactive in planta suggesting that PMR5 is a functional enzyme and not a binding protein or chaperone. In addition, she determined that cell wall preparations from the pmr5 mutant exhibited a modest reduction (13%) in total acetyl groups. To pursue characterization further, the graduate student expressed the PMR5 protein in a heterologous E. coli system. She could purify PMR5 using a two step protocol based on tags added to the N and C terminus of the protein. She was able to show the PMR5 protein bound to pectins, including homogalacturonan, but not to other cell wall components (e.g., xyloglucans, arabinans). Based on these observations, a postdoctoral fellow is currently developing an enzyme assay for PMR5 based on the idea that it may be acetylating the homogalacturonic acid pectin fraction. Our initial experiments to localize PMR5 subcellularly suggested that it occurred in the endoplasmic reticulum. However, since the various pectins are believed to be synthesized in the Golgi apparatus, we felt it necessary to repeat our results using a native promoter expression system. Within the past year, we have demonstrated conclusively that PMR5 is localized to the endoplasmic reticulum, a location that sets it apart from most cell wall biogenesis and modification enzymes. The graduate student contributed to the characterization of two suppressor mutants, which were selected as restoring powdery

  14. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  15. Gene expression of leptin, resistin, and adiponectin in the white adipose tissue of obese patients with non-alcoholic fatty liver disease and insulin resistance.

    Science.gov (United States)

    Baranova, Ancha; Gowder, Shobha J; Schlauch, Karen; Elariny, Hazem; Collantes, Rochelle; Afendy, Arian; Ong, Janus P; Goodman, Zachary; Chandhoke, Vikas; Younossi, Zobair M

    2006-09-01

    Adipose tissue is an active endocrine organ that secretes a variety of metabolically important substances including adipokines. These factors affect insulin sensitivity and may represent a link between obesity, insulin resistance, type 2 diabetes (DM), and nonalcoholic fatty liver disease (NAFLD). This study uses real-time polymerase chain reaction (PCR) quantification of mRNAs encoding adiponectin, leptin, and resistin on snap-frozen samples of intra-abdominal adipose tissue of morbidly obese patients undergoing bariatric surgery. Morbidly obese patients undergoing bariatric surgery were studied. Patients were classified into two groups: Group A (with insulin resistance) (N=11; glucose 149.84 +/- 40.56 mg/dL; serum insulin 8.28 +/- 3.52 microU/mL), and Group B (without insulin resistance) (N=10; glucose 102.2 +/- 8.43 mg/dL; serum insulin 3.431 +/- 1.162 microU/mL). Adiponectin mRNA in intra-abdominal adipose tissue and serum adiponectin levels were significantly lower in Group A compared to Group B patients (P<0.016 and P<0.03, respectively). Although serum resistin was higher in Group A than in Group B patients (P<0.005), resistin gene expression was not different between the two groups. Finally, for leptin, neither serum level nor gene expression was different between the two groups. Serum adiponectin level was the only predictor of nonalcoholic steatohepatitis (NASH) in this study (P=0.024). Obese patients with insulin resistance have decreased serum adiponectin and increased serum resistin. Additionally, adiponectin gene expression is also decreased in the adipose tissue of these patients. This low level of adiponectin expression may predispose patients to the progressive form of NAFLD or NASH.

  16. Efficacy of Spirulina platensis diet supplements on disease resistance and immune-related gene expression in Cyprinus carpio L. exposed to herbicide atrazine.

    Science.gov (United States)

    Khalil, Samah R; Reda, Rasha M; Awad, Ashraf

    2017-08-01

    The present study evaluated the immunotoxicological effects of the herbicide atrazine (ATZ) at sub-lethal concentrations and the potential ameliorative influence of Spirulina platensis (SP) over a sub-chronic exposure period on Cyprinus carpio L., also known as common carp. Common carp was sampled after a 40-days exposure to ATZ (428 μg/L) and SP (1%), individually or in combination to assess the non-specific immune response, changes in mRNA expression of immune-related genes [lysozyme (LYZ), immunoglobulin M (IgM), and complement component 3 (C3)] in the spleen, and inflammatory cytokines (interleukins IL-1ß and IL-10) in the head kidney using real-time PCR. Additionally, disease resistance to Aeromonas sobria was evaluated. The results revealed that ATZ exposure caused a significant decline in most of the hematological variables, lymphocyte viability, and lysozyme and bactericidal activity. Moreover, ATZ increased the susceptibility to disease, reflected by a significantly lower post-challenge survival rate of the carp. ATZ may induce dysregulated expression of immune-related genes leading to downregulation of mRNA levels of IgM and LYZ in the spleen. However, expression of C3 remained unaffected. Of the cytokine-related genes examined, IL-1B was up-regulated in the head kidney. In contrast, the expression of IL-10 gene was down-regulated in the ATZ-exposed group. The SP supplementation resulted in a significant improvement in most indices; however, these values did not match with that of the controls. These results may conclude that ATZ affects both innate and adaptive immune responses through the negative transcriptional effect on genes involved in immunity and also due to the inflammation of the immune organs. In addition, dietary supplements with SP could be useful for modulation of the immunity in response to ATZ exposure, thereby presenting a promising feed additive for carps in aquaculture. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Effects of Bacillus subtilis on the growth performance, digestive enzymes, immune gene expression and disease resistance of white shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Zokaeifar, Hadi; Balcázar, José Luis; Saad, Che Roos; Kamarudin, Mohd Salleh; Sijam, Kamaruzaman; Arshad, Aziz; Nejat, Naghmeh

    2012-10-01

    We studied the effect of two probiotic Bacillus subtilis strains on the growth performance, digestive enzyme activity, immune gene expression and disease resistance of juvenile white shrimp (Litopenaeus vannamei). A mixture of two probiotic strains, L10 and G1 in equal proportions, was administered at two different doses 10(5) (BM5) and 10(8) (BM8) CFU g(-1) feed to shrimp for eight weeks. In comparison to untreated control group, final weight, weight gain and digestive enzyme activity were significantly greater in shrimp fed BM5 and BM8 diets. Significant differences for specific growth rate (SGR) and survival were recorded in shrimp fed BM8 diet as compared with the control; however, no significant differences were recorded for food conversion ratio (FCR) among all the experimental groups. Eight weeks after the start of the feeding period, shrimp were challenged with Vibrio harveyi. Statistical analysis revealed significant differences in shrimp survival between probiotic and control groups. Cumulative mortality of the control group was 63.3%, whereas cumulative mortality of the shrimp that had been given probiotics was 20.0% with BM8 and 33.3% with BM5. Subsequently, real-time PCR was employed to determine the mRNA levels of prophenoloxidase (proPO), peroxinectin (PE), lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP) and serine protein (SP). The expression of all immune-related genes studied was significantly up-regulated (P growth performance and disease resistance through an enhanced immune response in shrimp. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Correlation between rpoB gene mutation in Mycobacterium avium subspecies paratuberculosis and clinical rifabutin and rifampicin resistance for treatment of Crohn’s disease

    OpenAIRE

    Beckler, Daniel R; Elwasila, Sammer; Ghobrial, George; Valentine, John F; Naser, Saleh A

    2008-01-01

    AIM: To investigate overlapping regions of the rpoB gene previously involved with rifamycin resistance in M. tuberculosis and seek correlation between rpoB mutations in clinical MAP strains with susceptibility to RIF and RFB.

  19. Genome-wide association study identifies a major gene for beech bark disease resistance in American beech (Fagus grandifolia Ehrh.)

    Science.gov (United States)

    Irina Ćalić; Jennifer Koch; David Carey; Charles Addo-Quaye; John E. Carlson; David B. Neale

    2017-01-01

    Background: The American Beech tree (Fagus grandifolia Ehrh.), native to eastern North America, is ecologically important and provides high quality wood products. This species is susceptible to beech bark disease (BBD) and is facing high rates of mortality in North America. The disease occurs from an interaction between the woolly beech scale...

  20. Insulin Resistance in Alzheimer's Disease

    Science.gov (United States)

    Dineley, Kelly T; Jahrling, Jordan B; Denner, Larry

    2014-01-01

    Insulin is a key hormone regulating metabolism. Insulin binding to cell surface insulin receptors engages many signaling intermediates operating in parallel and in series to control glucose, energy, and lipids while also regulating mitogenesis and development. Perturbations in the function of any of these intermediates, which occur in a variety of diseases, cause reduced sensitivity to insulin and insulin resistance with consequent metabolic dysfunction. Chronic inflammation ensues which exacerbates compromised metabolic homeostasis. Since insulin has a key role in learning and memory as well as directly regulating ERK, a kinase required for the type of learning and memory compromised in early Alzheimer's disease (AD), insulin resistance has been identified as a major risk factor for the onset of AD. Animal models of AD or insulin resistance or both demonstrate that AD pathology and impaired insulin signaling form a reciprocal relationship. Of note are human and animal model studies geared toward improving insulin resistance that have led to the identification of the nuclear receptor and transcription factor, peroxisome proliferator-activated receptor gamma (PPARγ) as an intervention tool for early AD. Strategic targeting of alternate nodes within the insulin signaling network has revealed disease-stage therapeutic windows in animal models that coalesce with previous and ongoing clinical trial approaches. Thus, exploiting the connection between insulin resistance and AD provides powerful opportunities to delineate therapeutic interventions that slow or block the pathogenesis of AD. PMID:25237037

  1. Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Directory of Open Access Journals (Sweden)

    Huijuan Zhang

    2016-08-01

    Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

  2. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  3. Effect of mutagens on the quality characters and disease resistant genes of diploid cotton (Gossypium arboreum L.)

    International Nuclear Information System (INIS)

    Haidar, S.; Khan, I.A.; Mansoor, S.

    2002-01-01

    In both M1 and M2 plant height decreased with the increase in dose for both the mutagens. The 15 Krad and 0.15M EMS doses increased 122.7 and 128.3 gm seed cotton yield as compared to control respectively while all other doses of both mutagens decreased the yield of seed cotton. The EMS dose 0.10 M drastically decreased 184 gm seed cotton yield as compared to control. There was no larger effect of both mutagens on GOT % whereas staple length was slightly increased and micronaire value decreased as compared to control for all the doses of both mutagens. It was observed in M2 that mutation dose 10 Krad increased 165.6 gm seed cotton yield as compared to control but slight reduction in GOT % was observed. In M2 GOT were increased 3.5 % with 15 Krad and 3.6 % with EMS 0.10 M as compared to control. There were no larger effects for both mutagens in case of staple length, micronaire and uniformity ratio for all the doses as compared to control. respectively. In both M1 and M2 no plant was observed susceptible to cotton leaf curl virus and bacterial blight diseases of cotton

  4. Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-05-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  5. Nitric oxide responsive heavy metal-associated gene AtHMAD1 contributes to development and disease resistance in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Qari Muhammad Imran

    2016-11-01

    Full Text Available Exposure of plants to different biotic and abiotic stress condition instigates significant change in the cellular redox status; resulting in the elevation of reactive nitrogen species that play signaling role in mediating defense responses. Heavy metal associated (HMA domain containing genes are required for spatio-temporal transportation of metal ions that bind with various enzymes and co-factors within the cell. To uncover the underlying mechanisms mediated by AtHMA genes, we identified 14 Arabidopsis HMA genes that were differentially expressed in response to nitrosative stress through RNA-seq analysis. Of those 14 genes, the expression of eight HMA genes was significantly increased, whereas that of six genes was significantly reduced. We further validated the RNA-seq results through quantitative real-time PCR analysis. Gene ontology analysis revealed the involvement of these genes in biological processes such as hemostasis and transport. The majority of these nitric oxide (NO-responsive AtHMA gene products are carrier/transport proteins. AtHMAD1 (At1g51090 showed the highest fold change to S-nitrosocystein. We therefore, further investigated its role in oxidative and nitrosative mediated stress conditions and found that AtHMAD1 has antagonistic role in shoot and root growth. Characterization of AtHMAD1 through functional genomics showed that the knock out mutant athmad1 plants were resistant to virulent Pseudomonas syringae (DC3000 and showed early induction and high transcript accumulation of pathogenesis related gene. Furthermore, inoculation of athamd1 with avirulent strain of the same bacteria showed negative regulation of R-gene mediated resistance. These results were supported by hypersensitive cell death response and cell death induced electrolyte leakage. AtHMAD1 was also observed to negatively regulate systemic acquired resistance SAR as the KO mutant showed induction of SAR marker genes. Overall, these results imply that NO

  6. Gene Therapy for Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Rachel Denyer

    2012-01-01

    Full Text Available Current pharmacological and surgical treatments for Parkinson's disease offer symptomatic improvements to those suffering from this incurable degenerative neurological disorder, but none of these has convincingly shown effects on disease progression. Novel approaches based on gene therapy have several potential advantages over conventional treatment modalities. These could be used to provide more consistent dopamine supplementation, potentially providing superior symptomatic relief with fewer side effects. More radically, gene therapy could be used to correct the imbalances in basal ganglia circuitry associated with the symptoms of Parkinson's disease, or to preserve or restore dopaminergic neurons lost during the disease process itself. The latter neuroprotective approach is the most exciting, as it could theoretically be disease modifying rather than simply symptom alleviating. Gene therapy agents using these approaches are currently making the transition from the laboratory to the bedside. This paper summarises the theoretical approaches to gene therapy for Parkinson's disease and the findings of clinical trials in this rapidly changing field.

  7. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  8. Transgenic approaches for development of disease resistance in banana

    International Nuclear Information System (INIS)

    Shekhawat, Upendra K.S.; Ghag, Siddhesh B.; Ganapathi, Thumballi R.

    2014-01-01

    Banana (Musa spp.) is an important food and cash crop worldwide. Diseases and pests pose the most serious constraint to banana cultivation. Among the diseases, Fusarium wilt and Banana Bunchy Top Virus (BBTV) are the most important economically. We have explored different transgenic approaches for development of efficient resistance in banana against these two diseases. For countering Fusarium wilt, we have over expressed Petunia floral defensins using a strong constitutive promoter in transgenic banana plants. We have also tested a host induced gene silencing strategy targeting two vital fungal genes to obtain Fusarium resistant banana plants. For development of BBTV resistant banana plants also, we have used a host-induced gene silencing approach utilizing the full and partial coding sequence of the viral replication initiation protein. Successful bioassays performed in controlled greenhouse conditions have shown the efficacy of using these strategies to develop disease resistant banana plants. (author)

  9. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  10. Advances and Challenges in Genomic Selection for Disease Resistance.

    Science.gov (United States)

    Poland, Jesse; Rutkoski, Jessica

    2016-08-04

    Breeding for disease resistance is a central focus of plant breeding programs, as any successful variety must have the complete package of high yield, disease resistance, agronomic performance, and end-use quality. With the need to accelerate the development of improved varieties, genomics-assisted breeding is becoming an important tool in breeding programs. With marker-assisted selection, there has been success in breeding for disease resistance; however, much of this work and research has focused on identifying, mapping, and selecting for major resistance genes that tend to be highly effective but vulnerable to breakdown with rapid changes in pathogen races. In contrast, breeding for minor-gene quantitative resistance tends to produce more durable varieties but is a more challenging breeding objective. As the genetic architecture of resistance shifts from single major R genes to a diffused architecture of many minor genes, the best approach for molecular breeding will shift from marker-assisted selection to genomic selection. Genomics-assisted breeding for quantitative resistance will therefore necessitate whole-genome prediction models and selection methodology as implemented for classical complex traits such as yield. Here, we examine multiple case studies testing whole-genome prediction models and genomic selection for disease resistance. In general, whole-genome models for disease resistance can produce prediction accuracy suitable for application in breeding. These models also largely outperform multiple linear regression as would be applied in marker-assisted selection. With the implementation of genomic selection for yield and other agronomic traits, whole-genome marker profiles will be available for the entire set of breeding lines, enabling genomic selection for disease at no additional direct cost. In this context, the scope of implementing genomics selection for disease resistance, and specifically for quantitative resistance and quarantined pathogens

  11. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  12. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. High-density genetic map using whole-genome re-sequencing for fine mapping and candidate gene discovery for disease resistance in peanut

    Science.gov (United States)

    High-density genetic linkage maps are essential for fine mapping QTLs controlling disease resistance traits, such as early leaf spot (ELS), late leaf spot (LLS), and Tomato spotted wilt virus (TSWV). With completion of the genome sequences of two diploid ancestors of cultivated peanut, we could use ...

  14. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  15. Anatomy of a nonhost disease resistance response of pea to Fusarium solani: PR gene elicitation via DNase, chitosan and chromatin alterations.

    Directory of Open Access Journals (Sweden)

    Lee A Hadwiger

    2015-06-01

    Full Text Available Of the multiplicity of plant pathogens in nature, only a few are virulent on a given plant species. Conversely, plants develop a rapid nonhost resistance response to the majority of the pathogens. The anatomy of the nonhost resistance of pea endocarp tissue against a pathogen of bean, Fusarium solani f.sp. phaseoli (Fsph and the susceptibility of pea to F. solani f sp. pisi (Fspi has been described cytologically, biochemically and molecular-biologically. Cytological changes have been followed by electron microscope and stain differentiation under white and UV light. The induction of changes in transcription, protein synthesis, expression of pathogenesis-related (PR genes, and increases in metabolic pathways culminating in low molecular weight, antifungal compounds are described biochemically. Molecular changes initiated by fungal signals to host organelles, primarily to the chromatin within host nuclei, are identified according to source of the signal and the mechanisms utilized in activating defense genes. The functions of some PR genes are defined. A hypothesis based on this data is developed to explain both why fungal growth is suppressed in nonhost resistance and why growth can continue in a susceptible reaction.

  16. Anatomy of a nonhost disease resistance response of pea to Fusarium solani: PR gene elicitation via DNase, chitosan and chromatin alterations

    Science.gov (United States)

    Hadwiger, Lee A.

    2015-01-01

    Of the multiplicity of plant pathogens in nature, only a few are virulent on a given plant species. Conversely, plants develop a rapid “nonhost” resistance response to the majority of the pathogens. The anatomy of the nonhost resistance of pea endocarp tissue against a pathogen of bean, Fusarium solani f.sp. phaseoli (Fsph) and the susceptibility of pea to F. solani f sp. pisi (Fspi) has been described cytologically, biochemically and molecular-biologically. Cytological changes have been followed by electron microscope and stain differentiation under white and UV light. The induction of changes in transcription, protein synthesis, expression of pathogenesis-related (PR) genes, and increases in metabolic pathways culminating in low molecular weight, antifungal compounds are described biochemically. Molecular changes initiated by fungal signals to host organelles, primarily to chromatin within host nuclei, are identified according to source of the signal and the mechanisms utilized in activating defense genes. The functions of some PR genes are defined. A hypothesis based on this data is developed to explain both why fungal growth is suppressed in nonhost resistance and why growth can continue in a susceptible reaction. PMID:26124762

  17. Anatomy of a nonhost disease resistance response of pea to Fusarium solani: PR gene elicitation via DNase, chitosan and chromatin alterations.

    Science.gov (United States)

    Hadwiger, Lee A

    2015-01-01

    Of the multiplicity of plant pathogens in nature, only a few are virulent on a given plant species. Conversely, plants develop a rapid "nonhost" resistance response to the majority of the pathogens. The anatomy of the nonhost resistance of pea endocarp tissue against a pathogen of bean, Fusarium solani f.sp. phaseoli (Fsph) and the susceptibility of pea to F. solani f sp. pisi (Fspi) has been described cytologically, biochemically and molecular-biologically. Cytological changes have been followed by electron microscope and stain differentiation under white and UV light. The induction of changes in transcription, protein synthesis, expression of pathogenesis-related (PR) genes, and increases in metabolic pathways culminating in low molecular weight, antifungal compounds are described biochemically. Molecular changes initiated by fungal signals to host organelles, primarily to chromatin within host nuclei, are identified according to source of the signal and the mechanisms utilized in activating defense genes. The functions of some PR genes are defined. A hypothesis based on this data is developed to explain both why fungal growth is suppressed in nonhost resistance and why growth can continue in a susceptible reaction.

  18. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  19. Hericium caput-medusae (Bull.:Fr.) Pers. polysaccharide enhance innate immune response, immune-related genes expression and disease resistance against Aeromonas hydrophila in grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Gou, Changlong; Wang, Jiazhen; Wang, Yuqiong; Dong, Wenlong; Shan, Xiaofeng; Lou, Yujie; Gao, Yunhang

    2018-01-01

    The objective was to add 0, 400, 800 or 1200 mg/kg of Hericium caput-medusae polysaccharide (HCMP) to the basal diet of grass carp (Ctenopharyngodon idella) and determine effects on humoral innate immunity, expression of immune-related genes and disease resistance. Adding HCMP enhanced (P < 0.05) bactericidal activity at 1, 2 and 3 weeks and also lysozyme activity, complement C3, and SOD activity at 2 and 3 weeks. Supplementing 800 or 1200 mg/kg of HCMP for 2 or 3 weeks increased (P < 0.05) serum concentrations of total protein, albumin and globulin. Two immune-related genes (IL-1β and TNF-α) were up-regulated (P < 0.05) in HCMP supplemented groups given 800 or 1200 mg/kg HCMP after 2 and 3 weeks of feeding. Expression of anti-inflammatory cytokine IL-10 was down-regulated (P < 0.05) after receiving 800 or 1200 mg/kg HCMP for 2 or 3 weeks. Fish fed 800 mg/kg HCMP had maximal disease resistance against Aeromonas hydrophila (65.4%). In conclusion, HCMP enhanced immune response and expression of immune-related genes and increased disease resistance against Aeromonas hydrophila in grass carp, with greatest effects in fish given 800 mg/kg HCMP for 3 weeks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  1. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  2. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  3. Cucumis sativus L-type lectin receptor kinase (CsLecRK) gene family response to Phytophthora melonis, Phytophthora capsici and water immersion in disease resistant and susceptible cucumber cultivars.

    Science.gov (United States)

    Wu, Tingquan; Wang, Rui; Xu, Xiaomei; He, Xiaoming; Sun, Baojuan; Zhong, Yujuan; Liang, Zhaojuan; Luo, Shaobo; Lin, Yu'e

    2014-10-10

    L-type lectin receptor kinase (LecRK) proteins are an important family involved in diverse biological processes such as pollen development, senescence, wounding, salinity and especially in innate immunity in model plants such as Arabidopsis and tobacco. Till date, LecRK proteins or genes of cucumber have not been reported. In this study, a total of 25 LecRK genes were identified in the cucumber genome, unequally distributed across its seven chromosomes. According to similarity comparison of their encoded proteins, the Cucumis sativus LecRK (CsLecRK) genes were classified into six major clades (from Clade I to CladeVI). Expression of CsLecRK genes were tested using QRT-PCR method and the results showed that 25 CsLecRK genes exhibited different responses to abiotic (water immersion) and biotic (Phytophthora melonis and Phytophthora capsici inoculation) stresses, as well as that between disease resistant cultivar (JSH) and disease susceptible cultivar (B80). Among the 25 CsLecRK genes, we found CsLecRK6.1 was especially induced by P. melonis and P. capsici in JSH plants. All these results suggested that CsLecRK genes may play important roles in biotic and abiotic stresses. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Marker-assisted selection for disease resistance in lettuce

    Science.gov (United States)

    Lettuce (Lactuca sativa L.) is the most popular leafy vegetable that is cultivated mainly in moderate climate. Consumers demand lettuce with good visual appearance and free of disease. Improved disease resistance of new cultivars is achieved by combining desirable genes (or alleles) from existing cu...

  5. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  6. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  7. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  8. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    Science.gov (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  9. Effects of dietary inulin and mannan oligosaccharide on immune related genes expression and disease resistance of Pacific white shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Li, Yun; Liu, Hong; Dai, Xilin; Li, Jingjing; Ding, Fujiang

    2018-05-01

    The effects of inulin and mannan oligosaccharide (MOS) at different doses (2.5, 4 and 10 mg/g) in singular or combined diet on growth rate, immune related genes expression, and resistance to white spot syndrome virus (WSSV) and Vibrio alginolyticus in Pacific white shrimp (Litopenaeus vannamei) were investigated. At the end of 28-day singular feeding experiment, the highest values of specific growth rate (SGR) and the expression of toll-like receptor1, 2 and 3 (TLR1, 2, 3), signal transducer and activator of transcription (STAT), crustin, anti-lipopolysaccharide factor (ALF) as well as prophenoloxidase (proPO) were observed in shrimp individually fed with 5 mg/g dietary inulin or MOS, respectively. Compared with individual treatments, diet containing combined prebiotics (5 mg/g inulin and MOS) significantly improved the expression of TLRs, STAT, proPO, crustin and ALF in L. vannamei after four-week feeding. Additionally, Pacific white shrimp fed with combined dietary prebiotics showed significantly higher expression of immune related genes and lower cumulative mortality in WSSV and Vibrio alginolyticus challenges, compared to the singular feeding groups and control. These results in the present study demonstrated that the combined supplementation of inulin (5 mg/g) and MOS (5 mg/g) remarkably enhanced innate immune response and pathogen resistance of shrimp, and should be considered as a promising immunostimulatory additive for the culture of Pacific white shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Genes and Disease: Prader-Willi Syndrome

    Science.gov (United States)

    ... MD): National Center for Biotechnology Information (US); 1998-. Genes and Disease [Internet]. Show details National Center for ... 45K) PDF version of this title (3.8M) Gene sequence Genome view see gene locations Entrez Gene ...

  11. Survey of rice blast race identity for blast resistance gene identification in the USA and Puerto Rico

    Science.gov (United States)

    Rice blast disease is a significant threat to stable rice production in the USA and worldwide. The major resistance gene (Pi-ta) located within a cluster of resistance genes on rice chromosome 12 has been demonstrated to confer resistance to the rice blast disease. Katy, a rice cultivar released in ...

  12. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  13. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  14. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  15. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  16. Induced disease resistance signaling in plants

    NARCIS (Netherlands)

    Verhagen, B.W.M.; Loon, L.C. van; Pieterse, C.M.J.

    2006-01-01

    To protect themselves from disease, plants have evolved sophisticated inducible defense mechanisms in which the signal molecules salicylic acid, jasmonic acid and ethylene often play crucial roles. Elucidation of signaling pathways controlling induced disease resistance is a major objective in

  17. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  18. Mapping, isolation and characterization of genes responsible for late blight resistance in potato

    NARCIS (Netherlands)

    Pel, M.

    2010-01-01

    Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
    devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
    have been used by breeders to generate late blight resistant cultivars, but resistance was soon
    overcome

  19. Natural disease resistance in threatened staghorn corals.

    Directory of Open Access Journals (Sweden)

    Steven V Vollmer

    Full Text Available Disease epidemics have caused extensive damage to tropical coral reefs and to the reef-building corals themselves, yet nothing is known about the abilities of the coral host to resist disease infection. Understanding the potential for natural disease resistance in corals is critically important, especially in the Caribbean where the two ecologically dominant shallow-water corals, Acropora cervicornis and A. palmata, have suffered an unprecedented mass die-off due to White Band Disease (WBD, and are now listed as threatened under the US Threatened Species Act and as critically endangered under the IUCN Red List criteria. Here we examine the potential for natural resistance to WBD in the staghorn coral Acropora cervicornis by combining microsatellite genotype information with in situ transmission assays and field monitoring of WBD on tagged genotypes. We show that six percent of staghorn coral genotypes (3 out of 49 are resistant to WBD. This natural resistance to WBD in staghorn corals represents the first evidence of host disease resistance in scleractinian corals and demonstrates that staghorn corals have an innate ability to resist WBD infection. These resistant staghorn coral genotypes may explain why pockets of Acropora have been able to survive the WBD epidemic. Understanding disease resistance in these corals may be the critical link to restoring populations of these once dominant corals throughout their range.

  20. Norrie disease gene is distinct from the monoamine oxidase genes

    OpenAIRE

    Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

    1989-01-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

  1. Radiation therapy for resistant sternal hydatid disease

    International Nuclear Information System (INIS)

    Ulger, S.; Barut, H.; Tunc, M.; Aydinkarahaliloglu, E.; Aydin, E.; Karaoglanoglu, N.; Gokcek, A.

    2013-01-01

    Hydatid disease is a zoonotic infectious disease for which there are known treatment procedures and effective antibiotics; however, there are resistant cases that do not respond to medication or surgery. We report a case diagnosed as hydatid disease of the chest wall and treated with radiation therapy (RT) after medical and surgical therapy had failed. In conclusion, RT represents an alternative treatment modality in resistant cases. (orig.)

  2. Studies to identify genes and their expression for resistance to blast ...

    African Journals Online (AJOL)

    aps

    2013-06-26

    Jun 26, 2013 ... INTRODUCTION. Rice (Oryza sativa L.) is the staple food for more than ... disease under induced artificial epiphytotic conditions at SVP. University farm .... resistance is under the control of several additive genes having small ...

  3. Breeding wheat for disease resistance in Kenya

    International Nuclear Information System (INIS)

    Njau, P.N.; Kinyua, M.G.; Karanja, L.; Maling'a, J.

    2001-01-01

    Yellow rust caused by Puccinia striformis and stem rust caused by Puccinia graminis tritici are most destructive diseases in Kenya. In wheat improvement, development of varieties of wheat with resistance to these diseases has been among the foremost contributions in wheat breeding. In breeding programs each disease is considered as a separate problem. Attention has been given to varieties resistant to stem rust, yellow rust and leaf rust among other diseases. In the year 2001 program stem rust and yellow rust were recorded in all the sites where NPT was performed. Breeding for resistance for the two diseases is approached through the Introductions and Hybridisation. The Doubled Haploid Technique is used to quicken the time of homozygous lines production. The introduction and the homozygous lines are then evaluated for yield and disease resistance in the field under preliminary yield trials and the National Performance Trials (NPT) in 2001, 18 lines and 2 check varieties were included in the NPT. The results show that there were some differences in reaction to the three diseases where lines R946, K7972-1 and R899 had the lowest score of the diseases in all sites. In the commercial variety trial the results show that all the varietieshave become susceptible to stem rust and so the need to develop new cultivars which will be resistance to the rusts. Yombi a newly developed variety showed a substantially high level resistance. (author)

  4. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Science.gov (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  5. Breeding of new variety Yangfumai 4 with high resistance to wheat yellow mosaic disease

    International Nuclear Information System (INIS)

    He Zhentian; Chen Xiulan; Zhang Rong; Wang Jianhua; Wang Jinrong; Liu Jian

    2011-01-01

    To control the infection of wheat yellow mosaic disease,new wheat variety with high-yield, disease-resistant was selected. Ningmai 9, which carries yellow mosaic disease resistant genes, was used as original material. Combination of conventional breeding technique and radiation methods, a new wheat variety Yangfumai 4 was developed during 1996-2007, and registered in 2008. The new wheat variety with high yield and resistance to yellow mosaic disease is suitable to plant in the Yangtze River region. (authors)

  6. Enhanced tomato disease resistance primed by arbuscular mycorrhizal fungus.

    Science.gov (United States)

    Song, Yuanyuan; Chen, Dongmei; Lu, Kai; Sun, Zhongxiang; Zeng, Rensen

    2015-01-01

    Roots of most terrestrial plants form symbiotic associations (mycorrhiza) with soil- borne arbuscular mycorrhizal fungi (AMF). Many studies show that mycorrhizal colonization enhances plant resistance against pathogenic fungi. However, the mechanism of mycorrhiza-induced disease resistance remains equivocal. In this study, we found that mycorrhizal inoculation with AMF Funneliformis mosseae significantly alleviated tomato (Solanum lycopersicum Mill.) early blight disease caused by Alternaria solani Sorauer. AMF pre-inoculation led to significant increases in activities of β-1,3-glucanase, chitinase, phenylalanine ammonia-lyase (PAL) and lipoxygenase (LOX) in tomato leaves upon pathogen inoculation. Mycorrhizal inoculation alone did not influence the transcripts of most genes tested. However, pathogen attack on AMF-inoculated plants provoked strong defense responses of three genes encoding pathogenesis-related proteins, PR1, PR2, and PR3, as well as defense-related genes LOX, AOC, and PAL, in tomato leaves. The induction of defense responses in AMF pre-inoculated plants was much higher and more rapid than that in un-inoculated plants in present of pathogen infection. Three tomato genotypes: a Castlemart wild-type (WT) plant, a jasmonate (JA) biosynthesis mutant (spr2), and a prosystemin-overexpressing 35S::PS plant were used to examine the role of the JA signaling pathway in AMF-primed disease defense. Pathogen infection on mycorrhizal 35S::PS plants led to higher induction of defense-related genes and enzymes relative to WT plants. However, pathogen infection did not induce these genes and enzymes in mycorrhizal spr2 mutant plants. Bioassays showed that 35S::PS plants were more resistant and spr2 plants were more susceptible to early blight compared with WT plants. Our finding indicates that mycorrhizal colonization enhances tomato resistance to early blight by priming systemic defense response, and the JA signaling pathway is essential for mycorrhiza

  7. Overexpression of E3 Ubiquitin Ligase Gene AdBiL Contributes to Resistance against Chilling Stress and Leaf Mold Disease in Tomato

    Directory of Open Access Journals (Sweden)

    Shuangchen Chen

    2017-06-01

    Full Text Available Ubiquitination is a common regulatory mechanism, playing a critical role in diverse cellular and developmental processes in eukaryotes. However, a few reports on the functional correlation between E3 ubiquitin ligases and reactive oxygen species (ROS or reactive nitrogen species (RNS metabolism in response to stress are currently available in plants. In the present study, the E3 ubiquitin ligase gene AdBiL (Adi3 Binding E3 Ligase was introduced into tomato line Ailsa Craig via Agrobacterium-mediated method. Transgenic lines were confirmed for integration into the tomato genome using PCR. Transcription of AdBiL in various transgenic lines was determined using real-time PCR. Evaluation of stress tolerance showed that T1 generation of transgenic tomato lines showed only mild symptoms of chilling injury as evident by higher biomass accumulation and chlorophyll content than those of non-transformed plants. Compared with wild-type plants, the contents of AsA, AsA/DHA, GSH and the activity of GaILDH, γ-GCS and GSNOR were increased, while H2O2, O2.−, MDA, NO, SNOs, and GSNO accumulations were significantly decreased in AdBiL overexpressing plants in response to chilling stress. Furthermore, transgenic tomato plants overexpressing AdBiL showed higher activities of enzymes such as G6PDH, 6PGDH, NADP-ICDH, and NADP-ME involved in pentose phosphate pathway (PPP. The transgenic tomato plants also exhibited an enhanced tolerance against the necrotrophic fungus Cladosporium fulvum. Tyrosine nitration protein was activated in the plants infected with leaf mold disease, while the inhibition could be recovered in AdBiL gene overexpressing lines. Taken together, our results revealed a possible physiological role of AdBiL in the activation of the key enzymes of AsA–GSH cycle, PPP and down-regulation of GSNO reductase, thereby reducing oxidative and nitrosative stress in plants. This study demonstrates an optimized transgenic strategy using AdBiL gene for crop

  8. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  9. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  10. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2011-06-01

    Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

  12. Candidate gene association analyses for ketosis resistance in Holsteins.

    Science.gov (United States)

    Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J

    2018-06-01

    High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Mutagenesis and breeding for disease resistance in capsicum

    International Nuclear Information System (INIS)

    Saccardo, F.; Sree Ramulu, K.

    1977-01-01

    The principal diseases, for which no sources have so far been found within the cultivars of Capsicum annuum in Italy, are caused by Verticillium dahliae, Phytophthora capsici and cucumber mosaic virus (CMV). The wild species C. pendulum, C. frutescens, C. chinense, C. chacoense, C. pubescens and C. eximium were analysed to find out if the sources for resistance to the three diseases are available. It was observed that particularly the species C. frutescens and C. chinense had good sources of resistance to V. dahliae and Ph. capsici. However, the occurrence of reproductive barriers between the wild and cultivated species appears to be a problem for the transfer of disease-resistant genes. For CMV, none of the wild species showed good resistance; so in this case a screening technique was set up using mutagenic agents to isolate resistant types in the prominent agronomic cultivars of C. annuum. Also, for V. dahliae and Ph. capsici, mutation screening techniques were set up to induce disease resistance character directly in the cultivars of C. annuum, without causing any changes in the most important agronomic characters of the cultivars. (author)

  14. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

    Science.gov (United States)

    Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-01-01

    A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

  15. Inheritance and molecular mapping of anthracnose resistance genes present in sorghum line SC112-14

    Science.gov (United States)

    Anthracnose (Colletotrichum sublineolum) is one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) affecting all aerial tissues of the plant. The most effective strategy for its control is the incorporation of resistance genes. Therefore, the anthracnose resistance response pr...

  16. Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

    NARCIS (Netherlands)

    Schouten, H.J.; Brinkhuis, J.; Burgh, van der S.; Schaart, J.; Groenwold, R.; Broggini, G.A.L.; Gessler, C.

    2014-01-01

    Apple scab, caused by Venturia inaequalis, is a serious disease of apple. Previously, the scab resistance Rvi15 (Vr2) from the accession GMAL 2473 was genetically mapped, and three candidate resistance genes were identified. Here, we report the cloning and functional characterization of these three

  17. Disease resistance in sugarcane – An overview

    Directory of Open Access Journals (Sweden)

    A. Ramesh Sundar

    2015-12-01

    Full Text Available Sugarcane is one of the important commercial crops cultivated world-wide both under tropical and sub-tropical conditions. The crop gains economic importance by virtue of its industrial potential in terms of products like crystal white sugar, bagasse, pressmud, power etc. Among the various production constraints of the crop, diseases are seen as a major threat for sustaining the productivity of sugarcane. Conventional Breeding is a lengthy process and it involves almost more than 10 years for the release of a commercial variety. Many varieties with superior agronomical traits have succumbed to diseases like red rot and smut during the course of cultivation, which hitherto at the time of release were rated to be resistant. The breakdown of disease resistance is attributed to the possible emergence of new virulent pathotypes. This situation has warranted a pertinent need to have a thorough understanding on inheritance pattern and mechanism of disease resistance in sugarcane, which would aid for quick screening of disease resistant clones and successful management of the diseases, respectively. Overall, there is a paradigm shift in the understanding of plant disease resistance, thanks to the advent of robust molecular tools. An integration of the tools of “Omics” namely genomics, proteomics, metabolomics etc. has further strengthened in deciphering plant-pathogen interactions at the molecular level. With the accomplishments in elucidating sugarcane ESTs, which was ably supported by employing the next generation sequencing platforms to unlock the secrets of pathogenomics in sugarcane, it is now made possible to further improve our understanding on disease resistance in sugarcane. Giving the scenario, the future looks evenmore promising, wherein convincing results are in the offing to thoroughly unravel the enigmatic relationship between sugarcane and its important pathogens.

  18. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  19. Transgenic strategies for improving rice disease resistance

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... practice. However, the useful life-span of many resistant cultivars is only a few years, due to the breakdown of the .... Thus, suppression of insect feeding by transgenic .... different types of defense-responsive genes were found.

  20. Gene transfer therapy in vascular diseases.

    Science.gov (United States)

    McKay, M J; Gaballa, M A

    2001-01-01

    Somatic gene therapy of vascular diseases is a promising new field in modern medicine. Recent advancements in gene transfer technology have greatly evolved our understanding of the pathophysiologic role of candidate disease genes. With this knowledge, the expression of selective gene products provides the means to test the therapeutic use of gene therapy in a multitude of medical conditions. In addition, with the completion of genome sequencing programs, gene transfer can be used also to study the biologic function of novel genes in vivo. Novel genes are delivered to targeted tissue via several different vehicles. These vectors include adenoviruses, retroviruses, plasmids, plasmid/liposomes, and oligonucleotides. However, each one of these vectors has inherent limitations. Further investigations into developing delivery systems that not only allow for efficient, targeted gene transfer, but also are stable and nonimmunogenic, will optimize the clinical application of gene therapy in vascular diseases. This review further discusses the available mode of gene delivery and examines six major areas in vascular gene therapy, namely prevention of restenosis, thrombosis, hypertension, atherosclerosis, peripheral vascular disease in congestive heart failure, and ischemia. Although we highlight some of the recent advances in the use of gene therapy in treating vascular disease discovered primarily during the past two years, many excellent studies published during that period are not included in this review due to space limitations. The following is a selective review of practical uses of gene transfer therapy in vascular diseases. This review primarily covers work performed in the last 2 years. For earlier work, the reader may refer to several excellent review articles. For instance, Belalcazer et al. (6) reviewed general aspects of somatic gene therapy and the different vehicles used for the delivery of therapeutic genes. Gene therapy in restenosis and stimulation of

  1. Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

    Science.gov (United States)

    Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

    2015-07-01

    The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

  2. Animal genomics and infectious disease resistance in poultry.

    Science.gov (United States)

    Smith, J; Gheyas, A; Burt, D W

    2016-04-01

    Avian pathogens are responsible for major costs to society, both in terms of huge economic losses to the poultry industry and their implications for human health. The health and welfare of millions of birds is under continued threat from many infectious diseases, some of which are increasing in virulence and thus becoming harder to control, such as Marek's disease virus and avian influenza viruses. The current era in animal genomics has seen huge developments in both technologies and resources, which means that researchers have never been in a better position to investigate the genetics of disease resistance and determine the underlying genes/mutations which make birds susceptible or resistant to infection. Avian genomics has reached a point where the biological mechanisms of infectious diseases can be investigated and understood in poultry and other avian species. Knowledge of genes conferring disease resistance can be used in selective breeding programmes or to develop vaccines which help to control the effects of these pathogens, which have such a major impact on birds and humans alike.

  3. Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

    Science.gov (United States)

    Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

    2012-04-01

    Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

  4. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  5. Induced mutations for disease resistance in wheat

    International Nuclear Information System (INIS)

    Cerny, J.; Hanis, M.; Hanisova, A.; Knytl, V.; Sasek, A.

    1983-01-01

    Mutation induction has been used over a period of 20 years to obtain mutants of wheat with improved disease resistance. 34 wheat cultivars have been treated with X-rays, gamma rays, thermal neutrons or EMS. A great number of mutants were selected. Their mutational origin was verified by electrophoretic analysis of gliadin spectra. Resistances have been confirmed over several generations. None of the mutants have been released yet for commercial cultivation because of shortcomings in yield or susceptibility to other diseases. The use of mutants in cross-breeding is considered. (author)

  6. Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant.

    Science.gov (United States)

    Lebeau, A; Gouy, M; Daunay, M C; Wicker, E; Chiroleu, F; Prior, P; Frary, A; Dintinger, J

    2013-01-01

    Resistance of eggplant against Ralstonia solanacearum phylotype I strains was assessed in a F(6) population of recombinant inbred lines (RILs) derived from a intra-specific cross between S. melongena MM738 (susceptible) and AG91-25 (resistant). Resistance traits were determined as disease score, percentage of wilted plants, and stem-based bacterial colonization index, as assessed in greenhouse experiments conducted in Réunion Island, France. The AG91-25 resistance was highly efficient toward strains CMR134, PSS366 and GMI1000, but only partial toward the highly virulent strain PSS4. The partial resistance found against PSS4 was overcome under high inoculation pressure, with heritability estimates from 0.28 to 0.53, depending on the traits and season. A genetic map was built with 119 AFLP, SSR and SRAP markers positioned on 18 linkage groups (LG), for a total length of 884 cM, and used for quantitative trait loci (QTL) analysis. A major dominant gene, named ERs1, controlled the resistance to strains CMR134, PSS366, and GMI1000. Against strain PSS4, this gene was not detected, but a significant QTL involved in delay of disease progress was detected on another LG. The possible use of the major resistance gene ERs1 in marker-assisted selection and the prospects offered for academic studies of a possible gene for gene system controlling resistance to bacterial wilt in solanaceous plants are discussed.

  7. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  8. Gene expression profiling in autoimmune diseases

    DEFF Research Database (Denmark)

    Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo

    2007-01-01

    A central issue in autoimmune disease is whether the underlying inflammation is a repeated stereotypical process or whether disease specific gene expression is involved. To shed light on this, we analysed whether genes previously found to be differentially regulated in rheumatoid arthritis (RA...

  9. Inheritance and molecular mapping of anthracnose resistance gene present in the differential line PI533918

    Science.gov (United States)

    Anthracnose (Collectrotichum sublineolum) is considered one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) because it infects all aerial tissues of the plant. The best strategy to control the disease is the incorporation of resistance genes. At present, eighteen sorghum line...

  10. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis

    2016-11-01

    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  11. Republished review: Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-07-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  12. Norrie disease gene is distinct from the monoamine oxidase genes.

    Science.gov (United States)

    Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

    1989-09-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

  13. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  14. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  15. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

    Science.gov (United States)

    Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

    2018-04-01

    Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  16. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  17. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis.

    Directory of Open Access Journals (Sweden)

    Silvia Libro

    Full Text Available Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD alone has killed up to 95% of the Caribbean`s dominant shallow-water corals--the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience.

  18. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis.

    Science.gov (United States)

    Libro, Silvia; Vollmer, Steven V

    2016-01-01

    Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD) alone has killed up to 95% of the Caribbean`s dominant shallow-water corals--the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs) were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience.

  19. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  20. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  1. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  2. Nuclear and allied approaches in improvement of wheat for disease and pest resistance

    Energy Technology Data Exchange (ETDEWEB)

    Sawhney, R N

    1987-09-01

    The paper attempts to review information on the role of physical and chemical mutagens used directly and indirectly in the improvement of wheat for disease and pest resistance. The illustrations relate to transfer of many useful genes for resistance to rusts and pest from alien sources to Triticum aestivum. Popular wheats have been rectified for resistance to rusts mostly without any negative effects on yield potential. The mutation approach has also been successful in the development of multilines. Multiline constituting mutant components conferring simultaneous resistance to more than one rust pathogen has an additional value. The use of induced mutagenesis in breaking linkage between the genes conferring resistance and other genes for undesirable characters has been described. New disease resistant mutant variations with additional changes of positive effect have been obtained for practical utilization with widening the genetic base of future breeding programmes. (author). 56 refs.

  3. Genetic modification of European winegrapes with genes from an American wild relative confers resistance to the major diseases powdery and downy mildew

    Science.gov (United States)

    The two most economically important diseases of grapevine cultivation worldwide are caused by the fungal pathogen powdery mildew (Erysiphe necator syn. Uncinula necator) and the oomycete, downy mildew (Plasmopara viticola). These pathogens, endemic to North America, were introduced into Europe in t...

  4. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  5. Comparison of antimicrobial resistant genes in chicken gut microbiome grown on organic and conventional diet

    Directory of Open Access Journals (Sweden)

    Narasimha V. Hegde

    2016-12-01

    Full Text Available Antibiotics are widely used in chicken production for therapeutic purposes, disease prevention and growth promotion, and this may select for drug resistant microorganisms known to spread to humans through consumption of contaminated food. Raising chickens on an organic feed regimen, without the use of antibiotics, is increasingly popular with the consumers. In order to determine the effects of diet regimen on antibiotic resistant genes in the gut microbiome, we analyzed the phylotypes and identified the antimicrobial resistant genes in chicken, grown under conventional and organic dietary regimens. Phylotypes were analyzed from DNA extracted from fecal samples from chickens grown under these dietary conditions. While gut microbiota of chicken raised in both conventional and organic diet exhibited the presence of DNA from members of Proteobacteria and Bacteroidetes, organic diet favored the growth of members of Fusobacteria. Antimicrobial resistance genes were identified from metagenomic libraries following cloning and sequencing of DNA fragments from fecal samples and selecting for the resistant clones (n=340 on media containing different concentrations of eight antibiotics. The antimicrobial resistant genes exhibited diversity in their host distribution among the microbial population and expressed more in samples from chicken grown on a conventional diet at higher concentrations of certain antimicrobials than samples from chicken grown on organic diet. Further studies will elucidate if this phenomena is widespread and whether the antimicrobial resistance is indeed modulated by diet. This may potentially assist in defining strategies for intervention to reduce the prevalence and dissemination of antibiotic resistance genes in the production environment.

  6. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  7. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  8. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  9. Transgenic Citrus Expressing an Arabidopsis NPR1 Gene Exhibit Enhanced Resistance against Huanglongbing (HLB; Citrus Greening).

    Science.gov (United States)

    Dutt, Manjul; Barthe, Gary; Irey, Michael; Grosser, Jude

    2015-01-01

    Commercial sweet orange cultivars lack resistance to Huanglongbing (HLB), a serious phloem limited bacterial disease that is usually fatal. In order to develop sustained disease resistance to HLB, transgenic sweet orange cultivars 'Hamlin' and 'Valencia' expressing an Arabidopsis thaliana NPR1 gene under the control of a constitutive CaMV 35S promoter or a phloem specific Arabidopsis SUC2 (AtSUC2) promoter were produced. Overexpression of AtNPR1 resulted in trees with normal phenotypes that exhibited enhanced resistance to HLB. Phloem specific expression of NPR1 was equally effective for enhancing disease resistance. Transgenic trees exhibited reduced diseased severity and a few lines remained disease-free even after 36 months of planting in a high-disease pressure field site. Expression of the NPR1 gene induced expression of several native genes involved in the plant defense signaling pathways. The AtNPR1 gene being plant derived can serve as a component for the development of an all plant T-DNA derived consumer friendly GM tree.

  10. Transgenic Citrus Expressing an Arabidopsis NPR1 Gene Exhibit Enhanced Resistance against Huanglongbing (HLB; Citrus Greening.

    Directory of Open Access Journals (Sweden)

    Manjul Dutt

    Full Text Available Commercial sweet orange cultivars lack resistance to Huanglongbing (HLB, a serious phloem limited bacterial disease that is usually fatal. In order to develop sustained disease resistance to HLB, transgenic sweet orange cultivars 'Hamlin' and 'Valencia' expressing an Arabidopsis thaliana NPR1 gene under the control of a constitutive CaMV 35S promoter or a phloem specific Arabidopsis SUC2 (AtSUC2 promoter were produced. Overexpression of AtNPR1 resulted in trees with normal phenotypes that exhibited enhanced resistance to HLB. Phloem specific expression of NPR1 was equally effective for enhancing disease resistance. Transgenic trees exhibited reduced diseased severity and a few lines remained disease-free even after 36 months of planting in a high-disease pressure field site. Expression of the NPR1 gene induced expression of several native genes involved in the plant defense signaling pathways. The AtNPR1 gene being plant derived can serve as a component for the development of an all plant T-DNA derived consumer friendly GM tree.

  11. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  12. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan

    2017-01-01

    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...... the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal...

  13. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  14. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  15. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  16. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  17. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  18. Identification of virus and nematode resistance genes in the Chilota Potato Genebank of the Universidad Austral de Chile

    Directory of Open Access Journals (Sweden)

    Marlon López

    2015-09-01

    Full Text Available Potato Genebank of the Universidad Austral de Chile (UACh is an important gene bank in Chile. The accessions collected all over the country possess high genetic diversity, present interesting agronomic and cooking traits, and show resistance to biotic and abiotic stress. A particularly interesting subgroup of the gene bank includes the accessions collected in the South of Chile, the Chilota Potato Genebank. The focus of this study is the identification of virus and nematode resistant genes in potatoes (Solatium tuberosum L., using the RYSC3 and YES3-3B molecular markers. The Potato virus Y(PVY resistance genes Ry adg and Ry sto were identified. Furthermore, the CP60 marker was used to assess the Rx resistance gene that confers resistance to Potato virus X (PVX. In addition, the HC and GRO1-4 markers were utilized to identify the GpaVvrn_QTL and Gro1-4, resistance genes of Globodera pallida and Globodera rostochiensis, respectively. Both G. pallida and G. rostochiensis are Potato Cyst Nematodes (PCN. The plant material used in this study included leaves from 271 accessions of the gene bank. These samples were collected in the field where natural pathogen pressure of potential viruses and diseases exists. ELISA assays were run for field detection of PVY and PVX. However, there have been no previous reports of nematode presence in the plant material. The results herein presented indicate presence of virus and nematode resistance genes in accessions of the Chilota Potato Genebank. In terms of virus resistance, 99 accessions out of the 271 tested possess the Ry adg resistance gene and 17 accessions of these 271 tested have the Ry sto resistance gene. Also, 10 accessions showed positive amplification of the Rxl resistant gene marker. As to nematode resistance, 99 accessions have possible resistance to G. pallida and 54 accessions show potential resistance to G. rostochiensis as detected using the available molecular markers.

  19. Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes.

    Science.gov (United States)

    Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

    2017-10-03

    Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.

  20. Gene Expression Analysis of Four Radiation-resistant Bacteria

    OpenAIRE

    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

    2009-01-01

    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  1. Overexpression of antibiotic resistance genes in hospital effluents over time

    OpenAIRE

    Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

    2017-01-01

    $\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

  2. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...

  3. Gene-Environment Interaction in Parkinson's Disease

    DEFF Research Database (Denmark)

    Chuang, Yu-Hsuan; Lill, Christina M; Lee, Pei-Chen

    2016-01-01

    BACKGROUND AND PURPOSE: Drinking caffeinated coffee has been reported to provide protection against Parkinson's disease (PD). Caffeine is an adenosine A2A receptor (encoded by the gene ADORA2A) antagonist that increases dopaminergic neurotransmission and Cytochrome P450 1A2 (gene: CYP1A2...

  4. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  5. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  6. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  7. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  8. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  9. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  10. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  11. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  12. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Science.gov (United States)

    Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

    2015-01-01

    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  13. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    Directory of Open Access Journals (Sweden)

    Aimée M Moore

    Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

  14. Disease resistance breeding in rose: current status and potential of biotechnological tools.

    Science.gov (United States)

    Debener, Thomas; Byrne, David H

    2014-11-01

    The cultivated rose is a multispecies complex for which a high level of disease protection is needed due to the low tolerance of blemishes in ornamental plants. The most important fungal diseases are black spot, powdery mildew, botrytis and downy mildew. Rose rosette, a lethal viral pathogen, is emerging as a devastating disease in North America. Currently rose breeders use a recurrent phenotypic selection approach and perform selection for disease resistance for most pathogen issues in a 2-3 year field trial. Marker assisted selection could accelerate this breeding process. Thus far markers have been identified for resistance to black spot (Rdrs) and powdery mildew and with the ability of genotyping by sequencing to generate 1000s of markers our ability to identify markers useful in plant improvement should increase exponentially. Transgenic rose lines with various fungal resistance genes inserted have shown limited success and RNAi technology has potential to provide virus resistance. Roses, as do other plants, have sequences homologous to characterized R-genes in their genomes, some which have been related to specific disease resistance. With improving next generation sequencing technology, our ability to do genomic and transcriptomic studies of the resistance related genes in both the rose and the pathogens to reveal novel gene targets to develop resistant roses will accelerate. Finally, the development of designer nucleases opens up a potentially non-GMO approach to directly modify a rose's DNA to create a disease resistant rose. Although there is much potential, at present rose breeders are not using marker assisted breeding primarily because a good suite of marker/trait associations (MTA) that would ensure a path to stable disease resistance is not available. As our genomic analytical tools improve, so will our ability to identify useful genes and linked markers. Once these MTAs are available, it will be the cost savings, both in time and money, that will

  15. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  16. Gene therapy for CNS diseases – Krabbe disease

    Directory of Open Access Journals (Sweden)

    Mohammad A. Rafi

    2016-06-01

    Full Text Available This is a brief report of the 19th Annual Meeting of the American Society of Gene and Cell Therapy that took place from May 4th through May 7th, 2016 in Washington, DC, USA. While the meeting provided many symposiums, lectures, and scientific sessions this report mainly focuses on one of the sessions on the "Gene Therapy for central nervous system (CNS Diseases" and specifically on the "Gene Therapy for the globoid cell leukodystrophy or Krabbe disease. Two presentations focused on this subject utilizing two animal models of this disease: mice and dog models. Different serotypes of adeno-associate viral vectors (AAV alone or in combination with bone marrow transplantations were used in these research projects. The Meeting of the ASGCT reflected continuous growth in the fields of gene and cell therapy and brighter forecast for efficient treatment options for variety of human diseases.

  17. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  18. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  19. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  20. beta. -Amyloid gene dosage in Alzheimer's disease

    Energy Technology Data Exchange (ETDEWEB)

    Murdoch, G H; Manuelidis, L; Kim, J H; Manuelidis, E E

    1988-01-11

    The 4-5 kd amyloid ..beta..-peptide is a major constituent of the characteristic amyloid plaque of Alzheimer's disease. It has been reported that some cases of sporatic Alzheimer's disease are associated with at least a partial duplication of chromosome 21 containing the gene corresponding to the 695 residue precursor of this peptide. To contribute to an understanding of the frequency to such a duplication event in the overall Alzheimer's population, the authors have determined the gene dosage of the ..beta..-amyloid gene in this collection of cases. All cases had a clinical diagnosis of Alzheimer's confirmed neuropathologically. Each Alzheimer's case had an apparent normal diploid ..beta..-amyloid gene dosage, while control Down's cases had the expected triploid dosage. Thus partial duplication of chromosome 21 may be a rare finding in Alzheimer's disease. Similar conclusions were just reported in several studies of the Harvard Alzheimer collection.

  1. Molecular Breeding Strategy and Challenges toward Improvement of Blast Disease Resistance in Rice Crops

    Directory of Open Access Journals (Sweden)

    Sadegh eAshkani

    2015-11-01

    Full Text Available Rice is a staple and most important security food crop consumed by almost half of the world’s population. More rice production is needed due to the rapid population growth in the world. Rice blast caused by the fungus, Magnaporthe oryzae is one of the most destructive diseases of this crop in different part of the world. Breakdown of blast resistance is the major cause of yield instability in several rice growing areas. There is a need to develop strategies providing long-lasting disease resistance against a broad spectrum of pathogens, giving protection for a long time over a broad geographic area, promising for sustainable rice production in the future. So far, molecular breeding approaches involving DNA markers, such as QTL mapping, marker-aided selection, gene pyramiding, allele mining and genetic transformation have been used to develop new resistant rice cultivars. Such techniques now are used as a low-cost, high-throughput alternative to conventional methods allowing rapid introgression of disease resistance genes into susceptible varieties as well as the incorporation of multiple genes into individual lines for more durable blast resistance. The paper briefly reviewed the progress of studies on this aspect to provide the interest information for rice disease resistance breeding. This review includes examples of how advanced molecular method have been used in breeding programs for improve blast resistance. New information and knowledge gained from previous research on the recent strategy and challenges toward improvement of blast disease such as pyramiding disease resistance gene for creating new rice varieties with high resistance against multiple diseases will undoubtedly provide new insights into the rice disease control.

  2. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  3. Overexpression of the Synthetic Chimeric Native-T-phylloplanin-GFP Genes Optimized for Monocot and Dicot Plants Renders Enhanced Resistance to Blue Mold Disease in Tobacco (N. tabacum L.

    Directory of Open Access Journals (Sweden)

    Dipak K. Sahoo

    2014-01-01

    Full Text Available To enhance the natural plant resistance and to evaluate the antimicrobial properties of phylloplanin against blue mold, we have expressed a synthetic chimeric native-phylloplanin-GFP protein fusion in transgenic Nicotiana tabacum cv. KY14, a cultivar that is highly susceptible to infection by Peronospora tabacina. The coding sequence of the tobacco phylloplanin gene along with its native signal peptide was fused with GFP at the carboxy terminus. The synthetic chimeric gene (native-phylloplanin-GFP was placed between the modified Mirabilis mosaic virus full-length transcript promoter with duplicated enhancer domains and the terminator sequence from the rbcSE9 gene. The chimeric gene, expressed in transgenic tobacco, was stably inherited in successive plant generations as shown by molecular characterization, GFP quantification, and confocal fluorescent microscopy. Transgenic plants were morphologically similar to wild-type plants and showed no deleterious effects due to transgene expression. Blue mold-sensitivity assays of tobacco lines were performed by applying P. tabacina sporangia to the upper leaf surface. Transgenic lines expressing the fused synthetic native-phyllopanin-GFP gene in the leaf apoplast showed resistance to infection. Our results demonstrate that in vivo expression of a synthetic fused native-phylloplanin-GFP gene in plants can potentially achieve natural protection against microbial plant pathogens, including P. tabacina in tobacco.

  4. RESISTANCE-RELATED GENE TRANSCRIPTION AND ...

    African Journals Online (AJOL)

    jdx

    2014-02-05

    Feb 5, 2014 ... By 72 hpi, the pathogen switched to necrotrophic growth to avoid contact with the increasing ... A better understanding of the gene network underlying ... 5.0 software under default parameters and were custom-ordered.

  5. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

    Science.gov (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

    2017-09-01

    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  6. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  8. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  9. Norrie disease and MAO genes: nearest neighbors.

    Science.gov (United States)

    Chen, Z Y; Denney, R M; Breakefield, X O

    1995-01-01

    The Norrie disease and MAO genes are tandemly arranged in the p11.4-p11.3 region of the human X chromosome in the order tel-MAOA-MAOB-NDP-cent. This relationship is conserved in the mouse in the order tel-MAOB-MAOA-NDP-cent. The MAO genes appear to have arisen by tandem duplication of an ancestral MAO gene, but their positional relationship to NDP appears to be random. Distinctive X-linked syndromes have been described for mutations in the MAOA and NDP genes, and in addition, individuals have been identified with contiguous gene syndromes due to chromosomal deletions which encompass two or three of these genes. Loss of function of the NDP gene causes a syndrome of congenital blindness and progressive hearing loss, sometimes accompanied by signs of CNS dysfunction, including variable mental retardation and psychiatric symptoms. Other mutations in the NDP gene have been found to underlie another X-linked eye disease, exudative vitreo-retinopathy. An MAOA deficiency state has been described in one family to date, with features of altered amine and amine metabolite levels, low normal intelligence, apparent difficulty in impulse control and cardiovascular difficulty in affected males. A contiguous gene syndrome in which all three genes are lacking, as well as other as yet unidentified flanking genes, results in severe mental retardation, small stature, seizures and congenital blindness, as well as altered amine and amine metabolites. Issues that remain to be resolved are the function of the NDP gene product, the frequency and phenotype of the MAOA deficiency state, and the possible occurrence and phenotype of an MAOB deficiency state.

  10. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...

  11. Interference, heterogeneity and disease gene mapping

    Energy Technology Data Exchange (ETDEWEB)

    Keats, B. [Louisiana State Univ. Medical Center, New Orleans, LA (United States)

    1996-12-31

    The Human Genome Project has had a major impact on genetic research over the past five years. The number of mapped genes is now over 3,000 compared with approximately 1,600 in 1989 and only about 260 ten years before that. The realization that extensive variation could be detected in anonymous DNA segments greatly enhanced the potential for mapping by linkage analysis. Previously, linkage studies had depended on polymorphisms that could be detected in red blood cell antigens, proteins (revealed by electrophoresis and isoelectric focusing), and cytogenetic heteromorphisms. The identification of thousands of polymorphic DNA markers throughout the human genome has led to the construction of high density genetic linkage maps. These maps provide the data necessary to test hypotheses concerning differences in recombination rates and levels of interference. They are also important for disease gene mapping because the existence of these genes must be inferred from the phenotype. Showing linkage of a disease gene to a DNA marker is the first step towards isolating the disease gene, determining its protein product, and developing effective therapies. However, interpretation of results is not always straightforward. Factors such as etiological heterogeneity and undetected irregular segregation can lead to confusing linkage results and incorrect conclusions about the locations of disease genes. This paper will discuss these phenomena and present examples that illustrate the problems, as well as approaches to dealing with them. 23 refs., 3 figs., 3 tabs.

  12. Molecular screening for erythromycin resistance genes in ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-15

    Jul 15, 2015 ... in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. Hassan .... is an automated colorimetric method used for identification of bacteria and for .... counter medicines in private pharmacies against the regulations. ... Effect of telithromycin on erythromycin resistant S. pyogenes. In this ...

  13. Mining biological databases for candidate disease genes

    Science.gov (United States)

    Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

    2001-07-01

    The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

  14. Differential expression of jasmonate biosynthesis genes in cacao genotypes contrasting for resistance against Moniliophthora perniciosa.

    Science.gov (United States)

    Litholdo, Celso G; Leal, Gildemberg A; Albuquerque, Paulo S B; Figueira, Antonio

    2015-10-01

    The resistance mechanism of cacao against M. perniciosa is likely to be mediated by JA/ET-signaling pathways due to the preferential TcAOS and TcSAM induction in a resistant genotype. The basidiomycete Moniliophthora perniciosa causes a serious disease in cacao (Theobroma cacao L.), and the use of resistant varieties is the only sustainable long-term solution. Cacao resistance against M. perniciosa is characterized by pathogen growth inhibition with reduced colonization and an attenuation of disease symptoms, suggesting a regulation by jasmonate (JA)/ethylene (ET) signaling pathways. The hypothesis that genes involved in JA biosynthesis would be active in the interaction of T. cacao and M. perniciosa was tested here. The cacao JA-related genes were evaluated for their relative quantitative expression in susceptible and resistant genotypes upon the exogenous application of ET, methyl-jasmonate (MJ), and salicylic acid (SA), or after M. perniciosa inoculation. MJ treatment triggered changes in the expression of genes involved in JA biosynthesis, indicating that the mechanism of positive regulation by exogenous MJ application occurs in cacao. However, a higher induction of these genes was observed in the susceptible genotype. Further, a contrast in JA-related transcriptional expression was detected between susceptible and resistant plants under M. perniciosa infection, with the induction of the allene oxide synthase gene (TcAOS), which encodes a key enzyme in the JA biosynthesis pathway in the resistant genotype. Altogether, this work provides additional evidences that the JA-dependent signaling pathway is modulating the defense response against M. perniciosa in a cacao-resistant genotype.

  15. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  16. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  17. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  18. Signaling requirements for Erwinia amylovora-induced disease resistance, callose deposition, and cell growth in the nonhost Arabidopsis thaliana

    Science.gov (United States)

    Erwinia amylovora is the causal agent of the fire blight disease in some plants of the Rosaceae family. The nonhost plant Arabidopsis serves as a powerful system to dissect mechanisms of resistance to E. amylovora. Although not yet known to mount gene-for-gene resistance to E. amylovora, we found ...

  19. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  20. Gene therapy for Stargardt disease associated with ABCA4 gene.

    Science.gov (United States)

    Han, Zongchao; Conley, Shannon M; Naash, Muna I

    2014-01-01

    Mutations in the photoreceptor-specific flippase ABCA4 lead to accumulation of the toxic bisretinoid A2E, resulting in atrophy of the retinal pigment epithelium (RPE) and death of the photoreceptor cells. Many blinding diseases are associated with these mutations including Stargardt's disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), and increased susceptibility to age-related macular degeneration. There are no curative treatments for any of these dsystrophies. While the monogenic nature of many of these conditions makes them amenable to treatment with gene therapy, the ABCA4 cDNA is 6.8 kb and is thus too large for the AAV vectors which have been most successful for other ocular genes. Here we review approaches to ABCA4 gene therapy including treatment with novel AAV vectors, lentiviral vectors, and non-viral compacted DNA nanoparticles. Lentiviral and compacted DNA nanoparticles in particular have a large capacity and have been successful in improving disease phenotypes in the Abca4 (-/-) murine model. Excitingly, two Phase I/IIa clinical trials are underway to treat patients with ABCA4-associated Startgardt's disease (STGD1). As a result of the development of these novel technologies, effective therapies for ABCA4-associated diseases may finally be within reach.

  1. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  2. Experimental mutation of disease resistance in wheat

    International Nuclear Information System (INIS)

    Hanisova, A.; Hanis, M.; Knytl, V.; Cerny, J.

    1980-01-01

    In 1968 to 1974, 19 cultivars and lines of wheat were treated with mutagens (i.e., with X rays, gamma radiation, neutrons, EMS). ALtogether 140 lines were obtained showing better resistance and/or tolerance to black stem rust, yellow rust, stem rust of wheat, powdery mildew of cereals, and root-rot of wheat. The frequency of the induced mutations was sufficiently high, i.e., 0.0012 to 0.078 mutants per 100 plants of M 2 . The major part of mutant lines showed a lower agronomical value due to negative pleiotropy of mutant genes and a changed genetic background of mutants. Some mutant lines can be used as the starting material in hybridization programmes. (author)

  3. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  4. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Science.gov (United States)

    Traverso, Lucila; Lavore, Andrés; Sierra, Ivana; Palacio, Victorio; Martinez-Barnetche, Jesús; Latorre-Estivalis, José Manuel; Mougabure-Cueto, Gaston; Francini, Flavio; Lorenzo, Marcelo G; Rodríguez, Mario Henry; Ons, Sheila; Rivera-Pomar, Rolando V

    2017-02-01

    Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs), Cytochromes P450 (CYPs) and Carboxyl/Cholinesterases (CCEs). Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease. The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms on the high

  5. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso

    2017-02-01

    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  6. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    Science.gov (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  7. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  8. Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

    Science.gov (United States)

    Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

    2014-02-01

    This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

  9. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  10. Comparative genomics of Fusarium oxysporum f. sp. melonis reveals the secreted protein recognized by the Fom-2 resistance gene in melon

    NARCIS (Netherlands)

    Schmidt, S.M.; Lukasiewicz, J.; Farrer, R.; van Dam, P.; Bertoldo, C.; Rep, M.

    Development of resistant crops is the most effective way to control plant diseases to safeguard food and feed production. Disease resistance is commonly based on resistance genes, which generally mediate the recognition of small proteins secreted by invading pathogens. These proteins secreted by

  11. Comparative Transcriptomics Reveals Differential Gene Expression Related to Colletotrichum gloeosporioides Resistance in the Octoploid Strawberry

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2017-05-01

    Full Text Available The strawberry is an important fruit worldwide; however, the development of the strawberry industry is limited by fungal disease. Anthracnose is caused by the pathogen Colletotrichum gloeosporioides and leads to large-scale losses in strawberry quality and production. However, the transcriptional response of strawberry to infection with C. gloeosporioides is poorly understood. In the present study, the strawberry leaf transcriptome of the ‘Yanli’ and ‘Benihoppe’ cultivars were deep sequenced via an RNA-seq analysis to study C. gloeosporioides resistance in strawberry. Among the sequences, differentially expressed genes were annotated with Gene Ontology terms and subjected to pathway enrichment analysis. Significant categories included defense, plant–pathogen interactions and flavonoid biosynthesis were identified. The comprehensive transcriptome data set provides molecular insight into C. gloeosporioides resistance genes in resistant and susceptible strawberry cultivars. Our findings can enhance breeding efforts in strawberry.

  12. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  13. Prospects of Understanding the Molecular Biology of Disease Resistance in Rice

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Rice is one of the important crops grown worldwide and is considered as an important crop for global food security. Rice is being affected by various fungal, bacterial and viral diseases resulting in huge yield losses every year. Deployment of resistance genes in various crops is one of the important methods of disease management. However, identification, cloning and characterization of disease resistance genes is a very tedious effort. To increase the life span of resistant cultivars, it is important to understand the molecular basis of plant host–pathogen interaction. With the advancement in rice genetics and genomics, several rice varieties resistant to fungal, bacterial and viral pathogens have been developed. However, resistance response of these varieties break down very frequently because of the emergence of more virulent races of the pathogen in nature. To increase the durability of resistance genes under field conditions, understanding the mechanismof resistance response and its molecular basis should be well understood. Some emerging concepts like interspecies transfer of pattern recognition receptors (PRRs and transgenerational plant immunitycan be employed to develop sustainable broad spectrum resistant varieties of rice.

  14. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  15. Intracellular, genetic or congenital immunisation--transgenic approaches to increase disease resistance of farm animals.

    Science.gov (United States)

    Müller, M; Brem, G

    1996-01-26

    Novel approaches to modify disease resistance or susceptibility in livestock are justified not only by economical reasons and with respect to animal welfare but also by recent advancements in molecular genetics. The control or elimination of infectious pathogens in farm animals is historically achieved by the use of vaccines and drugs and by quarantine safeguards and eradication. Currently, research on the improvement of disease resistance based on nucleic acid technology focuses on two main issues: additive gene transfer and the development of nucleic acid vaccines. The strategies aim at the stable or transient expression of components known to influence non-specific or specific host defence mechanisms against infectious pathogens. Thus, candidates for gene transfer experiments include all genes inducing or conferring innate and acquired immunity as well as specific disease resistance genes. Referring to the site and mode of action and the source of the effective agent the strategies are termed 'intracellular', 'genetic' and 'congenital' immunisation. The targeted disruption (deletive gene transfer) of disease susceptibility genes awaits the establishment of totipotential embryonic cell lineages in farm animals. The cytokine network regulates cellular viability, growth and differentiation in physiological and pathophysiological states. The identification of the JAK-STAT pathway used by many cytokines for their intracellular signal propagation has provided not only new target molecules for modulating the immune response but will also permit the further elucidation of host-pathogen interactions and resistance mechanisms.

  16. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  17. Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

    Directory of Open Access Journals (Sweden)

    Wan Hongjian

    2010-08-01

    Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

  18. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  19. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  20. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  1. Bacterial metal resistance genes and metal bioavailability in contaminated sediments

    International Nuclear Information System (INIS)

    Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

    2014-01-01

    In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

  2. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional...... resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis, and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n = 6), gentamicin (n = 1), amikacin (n = 7), trimethoprim (n = 17), chloramphenicol (n = 1), rifampicin (n = 2) and ampicillin (n = 3......-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance...

  3. The wheat homolog of putative nucleotide-binding site-leucine-rich repeat resistance gene TaRGA contributes to resistance against powdery mildew.

    Science.gov (United States)

    Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong

    2016-03-01

    Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.

  4. Skeletal Muscle Insulin Resistance in Endocrine Disease

    Directory of Open Access Journals (Sweden)

    Melpomeni Peppa

    2010-01-01

    Full Text Available We summarize the existing literature data concerning the involvement of skeletal muscle (SM in whole body glucose homeostasis and the contribution of SM insulin resistance (IR to the metabolic derangements observed in several endocrine disorders, including polycystic ovary syndrome (PCOS, adrenal disorders and thyroid function abnormalities. IR in PCOS is associated with a unique postbinding defect in insulin receptor signaling in general and in SM in particular, due to a complex interaction between genetic and environmental factors. Adrenal hormone excess is also associated with disrupted insulin action in peripheral tissues, such as SM. Furthermore, both hyper- and hypothyroidism are thought to be insulin resistant states, due to insulin receptor and postreceptor defects. Further studies are definitely needed in order to unravel the underlying pathogenetic mechanisms. In summary, the principal mechanisms involved in muscle IR in the endocrine diseases reviewed herein include abnormal phosphorylation of insulin signaling proteins, altered muscle fiber composition, reduced transcapillary insulin delivery, decreased glycogen synthesis, and impaired mitochondrial oxidative metabolism.

  5. Characterizing and identifying black spot resistance genes in polyploid roses

    Science.gov (United States)

    The ornamental quality of outdoor grown roses (Rosa hybrida) is under constant threat from foliar diseases, such as black spot caused by Diplocarpon rosae. Fungicides are primarily used to manage black spot; however, there is a high consumer demand for disease resistant roses which eliminate the nee...

  6. Pyramiding of blast and bacterial leaf blight resistance genes into ...

    African Journals Online (AJOL)

    Blast caused by the fungus Magnaporthe oryzae (Hebert) Barr. and bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae (Xoo) are two major diseases of rice (Oryza sativa). The use of varietal resistance is the most appropriate strategy for controlling the diseases, and molecular assisted selection can ...

  7. Improvement of resistance to Fusarium root rot through gene ...

    African Journals Online (AJOL)

    Fusarium root rot (FRR), caused by Fusarium solani f.sp. , is one of the most serious root rot diseases of common bean (Phaseolus vulgaris L.) throughout the world. Yield losses of up to 84% have been attributed to the disease. Development and deployment of resistant materials is the most feasible approach to managing ...

  8. Reprogramming of the ERRα and ERα target gene landscape triggers tamoxifen resistance in breast cancer.

    Science.gov (United States)

    Thewes, Verena; Simon, Ronald; Schroeter, Petra; Schlotter, Magdalena; Anzeneder, Tobias; Büttner, Reinhard; Benes, Vladimir; Sauter, Guido; Burwinkel, Barbara; Nicholson, Robert I; Sinn, Hans-Peter; Schneeweiss, Andreas; Deuschle, Ulrich; Zapatka, Marc; Heck, Stefanie; Lichter, Peter

    2015-02-15

    Endocrine treatment regimens for breast cancer that target the estrogen receptor-α (ERα) are effective, but acquired resistance remains a limiting drawback. One mechanism of acquired resistance that has been hypothesized is functional substitution of the orphan receptor estrogen-related receptor-α (ERRα) for ERα. To examine this hypothesis, we analyzed ERRα and ERα in recurrent tamoxifen-resistant breast tumors and conducted a genome-wide target gene profiling analysis of MCF-7 breast cancer cell populations that were sensitive or resistant to tamoxifen treatment. This analysis uncovered a global redirection in the target genes controlled by ERα, ERRα, and their coactivator AIB1, defining a novel set of target genes in tamoxifen-resistant cells. Beyond differences in the ERα and ERRα target gene repertoires, both factors were engaged in similar pathobiologic processes relevant to acquired resistance. Functional analyses confirmed a requirement for ERRα in tamoxifen- and fulvestrant-resistant MCF-7 cells, with pharmacologic inhibition of ERRα sufficient to partly restore sensitivity to antiestrogens. In clinical specimens (n = 1041), increased expression of ERRα was associated with enhanced proliferation and aggressive disease parameters, including increased levels of p53 in ERα-positive cases. In addition, increased ERRα expression was linked to reduced overall survival in independent tamoxifen-treated patient cohorts. Taken together, our results suggest that ERα and ERRα cooperate to promote endocrine resistance, and they provide a rationale for the exploration of ERRα as a candidate drug target to treat endocrine-resistant breast cancer. ©2015 American Association for Cancer Research.

  9. Prediction of novel target genes and pathways involved in irinotecan-resistant colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Precious Takondwa Makondi

    Full Text Available Acquired drug resistance to the chemotherapeutic drug irinotecan (the active metabolite of which is SN-38 is one of the significant obstacles in the treatment of advanced colorectal cancer (CRC. The molecular mechanism or targets mediating irinotecan resistance are still unclear. It is urgent to find the irinotecan response biomarkers to improve CRC patients' therapy.Genetic Omnibus Database GSE42387 which contained the gene expression profiles of parental and irinotecan-resistant HCT-116 cell lines was used. Differentially expressed genes (DEGs between parental and irinotecan-resistant cells, protein-protein interactions (PPIs, gene ontologies (GOs and pathway analysis were performed to identify the overall biological changes. The most common DEGs in the PPIs, GOs and pathways were identified and were validated clinically by their ability to predict overall survival and disease free survival. The gene-gene expression correlation and gene-resistance correlation was also evaluated in CRC patients using The Cancer Genomic Atlas data (TCGA.The 135 DEGs were identified of which 36 were upregulated and 99 were down regulated. After mapping the PPI networks, the GOs and the pathways, nine genes (GNAS, PRKACB, MECOM, PLA2G4C, BMP6, BDNF, DLG4, FGF2 and FGF9 were found to be commonly enriched. Signal transduction was the most significant GO and MAPK pathway was the most significant pathway. The five genes (FGF2, FGF9, PRKACB, MECOM and PLA2G4C in the MAPK pathway were all contained in the signal transduction and the levels of those genes were upregulated. The FGF2, FGF9 and MECOM expression were highly associated with CRC patients' survival rate but not PRKACB and PLA2G4C. In addition, FGF9 was also associated with irinotecan resistance and poor disease free survival. FGF2, FGF9 and PRKACB were positively correlated with each other while MECOM correlated positively with FGF9 and PLA2G4C, and correlated negatively with FGF2 and PRKACB after doing gene-gene

  10. The identification of new genes related to cisplatin resistance in ovarian adenocarcinoma cell line A2780

    International Nuclear Information System (INIS)

    Solar, P.; Fedorocko, P.; Sytkowski, A.; Hodorova, I.

    2006-01-01

    Ovarian cancer cells are usually sensitive to platinum-based chemotherapy, such as cisplatin (CDDP), initially but typically become resistant to the drug over time. The phenomenon of clinical drug resistance represents a serious problem for successful disease treatment, and the molecular mechanism(s) are not fully understood. In search of novel mechanisms that may lead to the development of CDDP chemoresistance we have applied subtractive hybridization based on the PCR-select cDNA subtraction. In current study we have used subtractive hybridization to identify differentially-expressed genes in CDDP resistant CP70 and C200 cells versus CDDP-sensitive A2780 human ovarian adenocarcinoma cells. We have analyzed 256 randomly selected clones. Subtraction efficiency was determined by dot blot and DNA sequencing. Confirmation of differentially expressed cDNAs was done by virtual northern blot analysis, and 17 genes that were differentially expressed in both CDDP resistant cell lines versus CDDP sensitive A2780 cells were identified. The expression of 10 of these genes was undetectable or detected with low expression in sensitive A2780 cells in comparison to resistant ones. These genes included ARHGDIB, RANBP2, ASPH, PRTFDC1, SSX2IP, MBNL1, DNAJC15, MMP10, TCTE1L and one unidentified sequence. Additional 7 genes that were more highly expressed in resistant CP70 and C200 vs. A2780 cells included ANXA2, USP8, HSPCA, TRA1, CNAP1, ATP2B1 and COX2. Interestingly, multi-drug resistance associated p-glycoprotein (p170) was not detected by the western blot in CDDP resistant CP70 and C200 cells. Our identified genes are involved in diverse processes, such as stress response, chromatin condensation, protection from protein degradation, invasiveness of cells, alterations of Ca 2+ homeostasis and others which may contribute to CDDP resistance of ovarian adenocarcinoma cells. Further characterization of these genes and gene products should yield important insights into the biology of

  11. Analysis of a positional candidate gene for inflammatory bowel disease: NRAMP2

    NARCIS (Netherlands)

    Stokkers, P. C.; Huibregtse, K.; Leegwater, A. C.; Reitsma, P. H.; Tytgat, G. N.; van Deventer, S. J.

    2000-01-01

    Genome scans have identified a region spanning 40 cM on the long arm of chromosome 12 as a susceptibility locus for inflammatory bowel disease (IBD). This locus contains several candidate genes for IBD, one of which is the gene for the natural resistance associated macrophage protein 2 (NRAMP2).

  12. Mutant of Japanese pear resistant to Black Spot Disease

    International Nuclear Information System (INIS)

    Sanada, T.; Nishida, T.; Ikeda, F.

    1987-01-01

    Full text: Nijisseike is one of the leading cultivars of Japanese pear (Pyrus serotinea Rehd.), but susceptible to black spot disease. Farmers try to prevent this disease by wrapping the fruit with a paper bag and by repeated spraying of fungicides. The disease is caused by a Japanese pear pathotype of Alternaria alternata (Fr.) Keissler. Susceptibility is controlled by a single dominant gene. In 1962, grafted trees of this cultivar were planted at a distance between 53 and 93 m from the 60 Co source in the gamma-field (daily dose 15-4 rad). One branch on a tree planted at 53 m was detected as resistant in 1981. Under field conditions, black spots were observed on many fruits and leaves of the original trees by natural infection in early July, however, they were not observed on the mutant. To examine the resistance of the mutant, artificial inoculations were made using spores of the pathogen and the host specific toxin produced by germinating spores. When some drops of the spore suspension are placed on leaves, the formation of black spots depends upon the leaf age. In a resistant cv. as Chojuro, black spot symptoms are formed only when inoculated on young leaves. An intermediate reaction was observed in the mutant, whereas the original Nijisseiki showed severe symptoms. When inoculation was made on matured fruit skins, no black spot was formed on the mutant just like on the resistant cv. Chojuro, while many small black spots were formed and grew into large spots overlapping each other on the susceptible cv. Nijisseiki. In case of the crude toxin inoculation (4-0.04 ppm) of cv. Nijisseiki black spots were formed on the surface of the susceptible fruit skin, and necrotic lesions at the cut end of detached small pieces of leaves, although reaction on fruit skins was weaker compared with inoculation by spores. However, no symptoms were observed from the toxin application on the mutant and the resistant cv. Chojuro. That the resistance of the mutant is classified as

  13. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  14. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  15. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  16. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  17. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased...

  18. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  19. Fine Mapping of Two Wheat Powdery Mildew Resistance Genes Located at the Pm1 Cluster

    Directory of Open Access Journals (Sweden)

    Junchao Liang

    2016-07-01

    Full Text Available Powdery mildew caused by (DC. f. sp. ( is a globally devastating foliar disease of wheat ( L.. More than a dozen genes against this disease, identified from wheat germplasms of different ploidy levels, have been mapped to the region surrounding the locus on the long arm of chromosome 7A, which forms a resistance (-gene cluster. and from einkorn wheat ( L. were two of the genes belonging to this cluster. This study was initiated to fine map these two genes toward map-based cloning. Comparative genomics study showed that macrocolinearity exists between L. chromosome 1 (Bd1 and the – region, which allowed us to develop markers based on the wheat sequences orthologous to genes contained in the Bd1 region. With these and other newly developed and published markers, high-resolution maps were constructed for both and using large F populations. Moreover, a physical map of was constructed through chromosome walking with bacterial artificial chromosome (BAC clones and comparative mapping. Eventually, and were restricted to a 0.12- and 0.86-cM interval, respectively. Based on the closely linked common markers, , , and (another powdery mildew resistance gene in the cluster were not allelic to one another. Severe recombination suppression and disruption of synteny were noted in the region encompassing . These results provided useful information for map-based cloning of the genes in the cluster and interpretation of their evolution.

  20. Overexpression of Poplar PtrWRKY89 in Transgenic Arabidopsis Leads to a Reduction of Disease Resistance by Regulating Defense-Related Genes in Salicylate- and Jasmonate-Dependent Signaling.

    Science.gov (United States)

    Jiang, Yuanzhong; Guo, Li; Liu, Rui; Jiao, Bo; Zhao, Xin; Ling, Zhengyi; Luo, Keming

    2016-01-01

    The plant hormones jasmonic acid (JA) and salicylic acid (SA) play key roles in plant defenses against pathogens and several WRKY transcription factors have been shown to have a role in SA/JA crosstalk. In a previous study, overexpression of the poplar WRKY gene PtrWRKY89 enhanced resistance to pathogens in transgenic poplars. In this study, the promoter of PtrWRKY89 (ProPtrWRKY89) was isolated and used to drive GUS reporter gene. High GUS activity was observed in old leaves of transgenic Arabidopsis containing ProPtrWRKY89-GUS construct and GUS expression was extremely induced by SA solution and SA+MeJA mixture but not by MeJA treatment. Subcellular localization and transactivation assays showed that PtrWRKY89 acted as a transcription activator in the nucleus. Constitutive expression of PtrWRKY89 in Arabidopsis resulted in more susceptible to Pseudomonas syringae and Botrytis cinerea compared to wild-type plants. Quantitative real-time PCR (qRT-PCR) analysis confirmed that marker genes of SA and JA pathways were down-regulated in transgenic Arabidopsis after pathogen inoculations. Overall, our results indicated that PtrWRKY89 modulates a cross talk in resistance to P. syringe and B. cinerea by negatively regulating both SA and JA pathways in Arabidopsis.

  1. Overexpression of Poplar PtrWRKY89 in Transgenic Arabidopsis Leads to a Reduction of Disease Resistance by Regulating Defense-Related Genes in Salicylate- and Jasmonate-Dependent Signaling.

    Directory of Open Access Journals (Sweden)

    Yuanzhong Jiang

    Full Text Available The plant hormones jasmonic acid (JA and salicylic acid (SA play key roles in plant defenses against pathogens and several WRKY transcription factors have been shown to have a role in SA/JA crosstalk. In a previous study, overexpression of the poplar WRKY gene PtrWRKY89 enhanced resistance to pathogens in transgenic poplars. In this study, the promoter of PtrWRKY89 (ProPtrWRKY89 was isolated and used to drive GUS reporter gene. High GUS activity was observed in old leaves of transgenic Arabidopsis containing ProPtrWRKY89-GUS construct and GUS expression was extremely induced by SA solution and SA+MeJA mixture but not by MeJA treatment. Subcellular localization and transactivation assays showed that PtrWRKY89 acted as a transcription activator in the nucleus. Constitutive expression of PtrWRKY89 in Arabidopsis resulted in more susceptible to Pseudomonas syringae and Botrytis cinerea compared to wild-type plants. Quantitative real-time PCR (qRT-PCR analysis confirmed that marker genes of SA and JA pathways were down-regulated in transgenic Arabidopsis after pathogen inoculations. Overall, our results indicated that PtrWRKY89 modulates a cross talk in resistance to P. syringe and B. cinerea by negatively regulating both SA and JA pathways in Arabidopsis.

  2. Molecular mapping and candidate gene analysis for resistance to powdery mildew in Cucumis sativus stem.

    Science.gov (United States)

    Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P

    2017-08-31

    Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.

  3. Pl(17) is a novel gene independent of known downy mildew resistance genes in the cultivated sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J

    2015-04-01

    Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.

  4. A dual resistance gene system prevents infection by three distinct pathogens.

    Science.gov (United States)

    Narusaka, Mari; Kubo, Yasuyuki; Shiraishi, Tomonori; Iwabuchi, Masaki; Narusaka, Yoshihiro

    2009-10-01

    Colletotrichum higginsianum causes typical anthracnose lesions on the leaves, petioles, and stems of cruciferous plants. Inoculation of Arabidopsis thaliana ecotype Columbia leaves with C. higginsianum results in fungal growth and disease symptoms reminiscent of those induced in other cruciferous plants. We performed map-based cloning and natural variation analysis of 19 A. thaliana ecotypes to identify a dominant resistance locus against C. higginsianum. We found that the A. thaliana RCH2 (for recognition of C. higginsianum) locus encodes two NB-LRR proteins, both of which are required for resistance to C. higginsianum in the A. thaliana ecotype Ws-0. Both proteins are well-characterized R proteins involved in resistance against bacterial pathogens; RRS1 (resistance to Ralstonia solanacearum 1) confers resistance to strain Rs1000 of R. solanacearum and RPS4 to Pseudomonas syringae pv. tomato strain DC3000 expressing avrRps4 (Pst-avrRps4). Furthermore, we found that both RRS1-Ws and RPS4-Ws genes are required for resistance to Pst-avrRps4 and to Rs1002 R. solanacearum. We therefore demonstrate that a pair of neighboring genes, RRS1-Ws and RPS4-Ws, function cooperatively as a dual R-gene system against at least three distinct pathogens.

  5. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Directory of Open Access Journals (Sweden)

    Andrew J Burt

    Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  6. Characterization of the duodenase-1 gene and its associations with resistance to Streptococuus agalactiae in hybrid tilapia (Oreochromis spp.).

    Science.gov (United States)

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-08-01

    Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  8. Meta-genomic analysis of toilet waste from long distance flights; a step towards global surveillance of infectious diseases and antimicrobial resistance

    DEFF Research Database (Denmark)

    Petersen, Thomas Nordahl; Rasmussen, Simon; Hasman, Henrik

    2015-01-01

    Human populations worldwide are increasingly confronted with infectious diseases and antimicrobial resistance spreading faster and appearing more frequently. Knowledge regarding their occurrence and worldwide transmission is important to control outbreaks and prevent epidemics. Here, we performed...... for bacteria and antimicrobial resistance genes. An average of 106,839 (0.06%) reads were assigned to resistance genes with genes encoding resistance to tetracycline, macrolide and beta-lactam resistance genes as the most abundant in all samples. We found significantly higher abundance and diversity of genes...

  9. Characterization of Pm59, a novel powdery mildew resistance gene in Afghanistan wheat landrace PI 181356.

    Science.gov (United States)

    Tan, Chengcheng; Li, Genqiao; Cowger, Christina; Carver, Brett F; Xu, Xiangyang

    2018-05-01

    A new powdery mildew resistance gene, designated Pm59, was identified in Afghanistan wheat landrace PI 181356, and mapped in the terminal region of the long arm of chromosome 7A. Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is an important foliar disease of wheat worldwide. In the Great Plains of the USA, Bgt isolates virulent to widely used powdery mildew resistance genes, such as Pm3a, were previously identified. The objectives of this study were to characterize the powdery mildew resistance gene in Afghanistan landrace PI 181356, which exhibited high resistance to Bgt isolates collected in southern Great Plains, and identify molecular markers for marker-assisted selection. An F 2 population and F 2:3 lines derived from a cross between PI 181356 and OK1059060-126135-3 were used in this study. Genetic analysis indicated that PI 181356 carries a single dominant gene, designated Pm59, in the terminal region of the long arm of chromosome 7A. Pm59 was mapped to an interval between sequence tag site (STS) markers Xmag1759 and Xmag1714 with genetic distances of 0.4 cM distal to Xmag1759 and 5.7 cM proximal to Xmag1714. Physical mapping suggested that Pm59 is in the distal bin 7AL 0.99-1.00. Pm59 is a novel powdery mildew resistance gene, and confers resistance to Bgt isolates collected from the Great Plains and the state of Montana. Therefore, Pm59 can be used to breed powdery mildew-resistant cultivars in these regions. Xmag1759 is ideal for marker-assisted selection of Pm59 in wheat breeding.

  10. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  11. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  12. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    Science.gov (United States)

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-01-01

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340

  13. Semantic Disease Gene Embeddings (SmuDGE): phenotype-based disease gene prioritization without phenotypes

    KAUST Repository

    Alshahrani, Mona

    2018-04-30

    In the past years, several methods have been developed to incorporate information about phenotypes into computational disease gene prioritization methods. These methods commonly compute the similarity between a disease\\'s (or patient\\'s) phenotypes and a database of gene-to-phenotype associations to find the phenotypically most similar match. A key limitation of these methods is their reliance on knowledge about phenotypes associated with particular genes which is highly incomplete in humans as well as in many model organisms such as the mouse. Results: We developed SmuDGE, a method that uses feature learning to generate vector-based representations of phenotypes associated with an entity. SmuDGE can be used as a trainable semantic similarity measure to compare two sets of phenotypes (such as between a disease and gene, or a disease and patient). More importantly, SmuDGE can generate phenotype representations for entities that are only indirectly associated with phenotypes through an interaction network; for this purpose, SmuDGE exploits background knowledge in interaction networks comprising of multiple types of interactions. We demonstrate that SmuDGE can match or outperform semantic similarity in phenotype-based disease gene prioritization, and furthermore significantly extends the coverage of phenotype-based methods to all genes in a connected interaction network.

  14. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  15. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  16. Mapping of powdery mildew resistance gene Pm53 introgressed from Aegilops speltoides into soft red winter wheat.

    Science.gov (United States)

    Petersen, Stine; Lyerly, Jeanette H; Worthington, Margaret L; Parks, Wesley R; Cowger, Christina; Marshall, David S; Brown-Guedira, Gina; Murphy, J Paul

    2015-02-01

    A powdery mildew resistance gene was introgressed from Aegilops speltoides into winter wheat and mapped to chromosome 5BL. Closely linked markers will permit marker-assisted selection for the resistance gene. Powdery mildew of wheat (Triticum aestivum L.) is a major fungal disease in many areas of the world, caused by Blumeria graminis f. sp. tritici (Bgt). Host plant resistance is the preferred form of disease prevention because it is both economical and environmentally sound. Identification of new resistance sources and closely linked markers enable breeders to utilize these new sources in marker-assisted selection as well as in gene pyramiding. Aegilops speltoides (2n = 2x = 14, genome SS), has been a valuable disease resistance donor. The powdery mildew resistant wheat germplasm line NC09BGTS16 (NC-S16) was developed by backcrossing an Ae. speltoides accession, TAU829, to the susceptible soft red winter wheat cultivar 'Saluda'. NC-S16 was crossed to the susceptible cultivar 'Coker 68-15' to develop F2:3 families for gene mapping. Greenhouse and field evaluations of these F2:3 families indicated that a single gene, designated Pm53, conferred resistance to powdery mildew. Bulked segregant analysis showed that multiple simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers specific to chromosome 5BL segregated with the resistance gene. The gene was flanked by markers Xgwm499, Xwmc759, IWA6024 (0.7 cM proximal) and IWA2454 (1.8 cM distal). Pm36, derived from a different wild wheat relative (T. turgidum var. dicoccoides), had previously been mapped to chromosome 5BL in a durum wheat line. Detached leaf tests revealed that NC-S16 and a genotype carrying Pm36 differed in their responses to each of three Bgt isolates. Pm53 therefore appears to be a new source of powdery mildew resistance.

  17. Fluid Mechanics, Arterial Disease, and Gene Expression.

    Science.gov (United States)

    Tarbell, John M; Shi, Zhong-Dong; Dunn, Jessilyn; Jo, Hanjoong

    2014-01-01

    This review places modern research developments in vascular mechanobiology in the context of hemodynamic phenomena in the cardiovascular system and the discrete localization of vascular disease. The modern origins of this field are traced, beginning in the 1960s when associations between flow characteristics, particularly blood flow-induced wall shear stress, and the localization of atherosclerotic plaques were uncovered, and continuing to fluid shear stress effects on the vascular lining endothelial) cells (ECs), including their effects on EC morphology, biochemical production, and gene expression. The earliest single-gene studies and genome-wide analyses are considered. The final section moves from the ECs lining the vessel wall to the smooth muscle cells and fibroblasts within the wall that are fluid me chanically activated by interstitial flow that imposes shear stresses on their surfaces comparable with those of flowing blood on EC surfaces. Interstitial flow stimulates biochemical production and gene expression, much like blood flow on ECs.

  18. Surfactant gene polymorphisms and interstitial lung diseases

    Directory of Open Access Journals (Sweden)

    Pantelidis Panagiotis

    2001-11-01

    Full Text Available Abstract Pulmonary surfactant is a complex mixture of phospholipids and proteins, which is present in the alveolar lining fluid and is essential for normal lung function. Alterations in surfactant composition have been reported in several interstitial lung diseases (ILDs. Furthermore, a mutation in the surfactant protein C gene that results in complete absence of the protein has been shown to be associated with familial ILD. The role of surfactant in lung disease is therefore drawing increasing attention following the elucidation of the genetic basis underlying its surface expression and the proof of surfactant abnormalities in ILD.

  19. Strategies to be used in the struggle between resistance and virulence genes

    International Nuclear Information System (INIS)

    Zitelli, G.; Vallega, V.

    1977-01-01

    The cultivation of wheat varieties resistant to diseases such as stem and leaf rusts, mildew and septoria plays an important role in modern agriculture. However, the problem of how to keep varieties resistant for a long period has not yet been solved. Whatever type of resistance (specific, non-specific, tolerance etc.) the breeder chooses to use in his breeding work, the resistance stability will depend very much on the strategy used. There are many different approaches: (i) To introduce single specific factors into the cultivated varieties; (ii) To introduce the maximum number of factors in the same variety; (iii) To create multiline varieties; (iv) To cultivate different varieties carrying different resistant factors. Such a ''mosaic'' artificially creates, as in the case of multiline varieties, conditions similar to those which we find in wild populations. The use of multiline varieties and of ''mosaic'' varieties stresses the need for finding a greater number of different genes for resistance. At present we know that a large number of genes for resistance to rusts and to mildew is available in bread and durum wheats and in related species. (author)

  20. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.

    2007-01-01

    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  1. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  2. Retinitis pigmentosa: genes and disease mechanisms.

    Science.gov (United States)

    Ferrari, Stefano; Di Iorio, Enzo; Barbaro, Vanessa; Ponzin, Diego; Sorrentino, Francesco S; Parmeggiani, Francesco

    2011-06-01

    Retinitis pigmentosa (RP) is a group of inherited disorders affecting 1 in 3000-7000 people and characterized by abnormalities of the photoreceptors (rods and cones) or the retinal pigment epithelium of the retina which lead to progressive visual loss. RP can be inherited in an autosomal dominant, autosomal recessive or X-linked manner. While usually limited to the eye, RP may also occur as part of a syndrome as in the Usher syndrome and Bardet-Biedl syndrome. Over 40 genes have been associated with RP so far, with the majority of them expressed in either the photoreceptors or the retinal pigment epithelium. The tremendous heterogeneity of the disease makes the genetics of RP complicated, thus rendering genotype-phenotype correlations not fully applicable yet. In addition to the multiplicity of mutations, in fact, different mutations in the same gene may cause different diseases. We will here review which genes are involved in the genesis of RP and how mutations can lead to retinal degeneration. In the future, a more thorough analysis of genetic and clinical data together with a better understanding of the genotype-phenotype correlation might allow to reveal important information with respect to the likelihood of disease development and choices of therapy.

  3. Semantic Disease Gene Embeddings (SmuDGE): phenotype-based disease gene prioritization without phenotypes

    KAUST Repository

    AlShahrani, Mona; Hoehndorf, Robert

    2018-01-01

    In the past years, several methods have been developed to incorporate information about phenotypes into computational disease gene prioritization methods. These methods commonly compute the similarity between a disease's (or patient's) phenotypes and a database of gene-to-phenotype associations to find the phenotypically most similar match. A key limitation of these methods is their reliance on knowledge about phenotypes associated with particular genes which is highly incomplete in humans as well as in many model organisms such as the mouse. Results: We developed SmuDGE, a method that uses feature learning to generate vector-based representations of phenotypes associated with an entity. SmuDGE can be used as a trainable semantic similarity measure to compare two sets of phenotypes (such as between a disease and gene, or a disease and patient). More importantly, SmuDGE can generate phenotype representations for entities that are only indirectly associated with phenotypes through an interaction network; for this purpose, SmuDGE exploits background knowledge in interaction networks comprising of multiple types of interactions. We demonstrate that SmuDGE can match or outperform semantic similarity in phenotype-based disease gene prioritization, and furthermore significantly extends the coverage of phenotype-based methods to all genes in a connected interaction network.

  4. Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

    Science.gov (United States)

    Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

    2018-06-01

    Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  5. Modeling deployment of Pierce’s disease resistant grapevines

    Science.gov (United States)

    Deployment of Pierce’s disease resistant grapevines is a key solution to mitigating economic losses caused by Xylella fastidiosa. While Pierce’s disease resistant grapevines under development display mild symptoms and have lower bacterial populations than susceptible varieties, all appear to remain ...

  6. Biomarkers and mechanisms of natural disease resistance in dairy cows

    NARCIS (Netherlands)

    Altena, van S.E.C.

    2016-01-01

    The aim of this thesis was to define and test biomarkers for disease resistance in dairy cows and to determine the underlying mechanism in natural disease resistance. The health status of the cows is an important issue in dairy farming. Due to the mandatory reduction in the use of antibiotics,

  7. Working Towards Disease Resistance in Peanuts Through Biotechnology

    Science.gov (United States)

    Resistant cultivars are the most desirable approach to disease control in agriculture. Early and late leaf spot are the most important foliar diseases of peanut worldwide. Significant progress for leaf spot resistance in peanut can be achieved through biotechnology. The National Peanut Research ...

  8. Companion cropping with potato onion enhances the disease resistance of tomato against Verticillium dahliae

    Directory of Open Access Journals (Sweden)

    Xuepeng eFu

    2015-09-01

    Full Text Available Intercropping could alleviate soil-borne diseases, however, few studies focused on the immunity of the host plant induced by the interspecific interactions. To test whether or not intercropping could enhance the disease resistance of host plant, we investigated the effect of companion cropping with potato onion on tomato Verticillium wilt caused by Verticillium dahliae (V. dahliae. To investigate the mechanisms, the root exudates were collected from tomato and potato onion which were grown together or separately, and were used to examine the antifungal activities against V. dahliae in vitro, respectively. Furthermore, RNA-seq was used to examine the expression pattern of genes related to disease resistance in tomato companied with potato onion compared to that in tomato grown alone, under the condition of infection with V. dahliae. The results showed that companion cropping with potato onion could alleviate the incidence and severity of tomato Verticillium wilt. The further studies revealed that the root exudates from tomato companied with potato onion significantly inhibited the mycelia growth and spore germination of V. dahliae. However, there were no significant effects on these two measurements for the root exudates from potato onion grown alone or from potato onion grown with tomato. RNA-seq data analysis showed the disease defense genes associated with pathogenesis-related proteins, biosynthesis of lignin, hormone metabolism and signal transduction were expressed much higher in the tomato companied with potato onion than those in the tomato grown alone, which indicated that these defense genes play important roles in tomato against V. dahliae infection, and meant that the disease resistance of tomato against V. dahliae was enhanced in the companion copping with potato onion. We proposed that companion cropping with potato onion could enhance the disease resistance of tomato against V. dahliae by regulating the expression of genes related

  9. Genetically pyramiding protease-inhibitor genes for dual broad-spectrum resistance against insect and phytopathogens in transgenic tobacco.

    Science.gov (United States)

    Senthilkumar, Rajendran; Cheng, Chiu-Ping; Yeh, Kai-Wun

    2010-01-01

    Protease inhibitors provide a promising means of engineering plant resistance against attack by insects and pathogens. Sporamin (trypsin inhibitor) from sweet potato and CeCPI (phytocystatin) from taro were stacked in a binary vector, using pMSPOA (a modified sporamin promoter) to drive both genes. Transgenic tobacco lines of T0 and T1 generation with varied inhibitory activity against trypsin and papain showed resistance to both insects and phytopathogens. Larvae of Helicoverpa armigera that ingested tobacco leaves either died or showed delayed growth and development relative to control larvae. Transgenic tobacco-overexpressing the stacked genes also exhibited strong resistance against bacterial soft rot disease caused by Erwinia carotovora and damping-off disease caused by Pythium aphanidermatum. Thus, stacking protease-inhibitor genes, driven by the wound and pathogen responsive pMSPOA promoter, is an effective strategy for engineering crops to resistance against insects and phytopathogens.

  10. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  11. Gene regulatory networks elucidating huanglongbing disease mechanisms.

    Directory of Open Access Journals (Sweden)

    Federico Martinelli

    Full Text Available Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas, especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein - protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation, sucrose metabolism (upregulation, and starch biosynthesis (upregulation. In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70 was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur.

  12. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  13. Disease resistance is related to inherent swimming performance in Atlantic salmon.

    Science.gov (United States)

    Castro, Vicente; Grisdale-Helland, Barbara; Jørgensen, Sven M; Helgerud, Jan; Claireaux, Guy; Farrell, Anthony P; Krasnov, Aleksei; Helland, Ståle J; Takle, Harald

    2013-01-21

    Like humans, fish can be classified according to their athletic performance. Sustained exercise training of fish can improve growth and physical capacity, and recent results have documented improved disease resistance in exercised Atlantic salmon. In this study we investigated the effects of inherent swimming performance and exercise training on disease resistance in Atlantic salmon.Atlantic salmon were first classified as either poor or good according to their swimming performance in a screening test and then exercise trained for 10 weeks using one of two constant-velocity or two interval-velocity training regimes for comparison against control trained fish (low speed continuously). Disease resistance was assessed by a viral disease challenge test (infectious pancreatic necrosis) and gene expression analyses of the host response in selected organs. An inherently good swimming performance was associated with improved disease resistance, as good swimmers showed significantly better survival compared to poor swimmers in the viral challenge test. Differences in mortalities between poor and good swimmers were correlated with cardiac mRNA expression of virus responsive genes reflecting the infection status. Although not significant, fish trained at constant-velocity showed a trend towards higher survival than fish trained at either short or long intervals. Finally, only constant training at high intensity had a significant positive effect on fish growth compared to control trained fish. This is the first evidence suggesting that inherent swimming performance is associated with disease resistance in fish.

  14. Disease resistance is related to inherent swimming performance in Atlantic salmon

    Directory of Open Access Journals (Sweden)

    Castro Vicente

    2013-01-01

    Full Text Available Abstract Background Like humans, fish can be classified according to their athletic performance. Sustained exercise training of fish can improve growth and physical capacity, and recent results have documented improved disease resistance in exercised Atlantic salmon. In this study we investigated the effects of inherent swimming performance and exercise training on disease resistance in Atlantic salmon. Atlantic salmon were first classified as either poor or good according to their swimming performance in a screening test and then exercise trained for 10 weeks using one of two constant-velocity or two interval-velocity training regimes for comparison against control trained fish (low speed continuously. Disease resistance was assessed by a viral disease challenge test (infectious pancreatic necrosis and gene expression analyses of the host response in selected organs. Results An inherently good swimming performance was associated with improved disease resistance, as good swimmers showed significantly better survival compared to poor swimmers in the viral challenge test. Differences in mortalities between poor and good swimmers were correlated with cardiac mRNA expression of virus responsive genes reflecting the infection status. Although not significant, fish trained at constant-velocity showed a trend towards higher survival than fish trained at either short or long intervals. Finally, only constant training at high intensity had a significant positive effect on fish growth compared to control trained fish. Conclusions This is the first evidence suggesting that inherent swimming performance is associated with disease resistance in fish.

  15. Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants.

    Science.gov (United States)

    Pourahmad Jaktaji, Razieh; Pasand, Shirin

    2016-01-15

    Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  17. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Science.gov (United States)

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  18. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying; Aljassim, Nada I.; Ansari, Mohd Ikram; Mackie, Roderick

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  19. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Roderick I. Mackie

    2013-07-01

    Full Text Available Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  20. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  1. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  2. Barley yellow dwarf disease as a target of breeding for resistance (short review

    Directory of Open Access Journals (Sweden)

    Katarzyna Golnik

    2012-12-01

    Full Text Available The aim of this work was to give a brief review of some points of wide knowledge of barley yellow dwarf (BYD disease and its breeding for resistance program.Yd2 gene has been shortly characterised. Current situation in Poland has been underlined.

  3. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia

    2017-10-11

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  4. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia; Requena, David; Gushiken, Eduardo; Gilman, Robert H.; Antiparra, Ricardo; Lucero, Bryan; Lizá rraga, Pilar; Cieza, Basilio; Roncal, Elisa; Grandjean, Louis; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; Moore, David; Zimic, Mirko

    2017-01-01

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  5. Expression profile of genes during resistance reversal in a temephos selected strain of the dengue vector, Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Clare Strode

    Full Text Available BACKGROUND: The mosquito Aedes aegypti is one of the most important disease vectors because it transmits two major arboviruses, dengue and yellow fever, which cause significant global morbidity and mortality. Chemical insecticides form the cornerstone of vector control. The organophosphate temephos a larvicide recommended by WHO for controlling Ae. aegypti, however, resistance to this compound has been reported in many countries, including Brazil. METHODOLOGY/PRINCIPAL FINDINGS: The aim of this study was to identify genes implicated in metabolic resistance in an Ae. aegypti temephos resistant strain, named RecR, through microarray analysis. We utilized a custom 'Ae. aegypti detox chip' and validated microarray data through RT-PCR comparing susceptible and resistant individuals. In addition, we analyzed gene expression in 4(th instar larvae from a reversed susceptible strain (RecRev, exposed and unexposed to temephos. The results obtained revealed a set of 13 and 6 genes significantly over expressed in resistant adult mosquitoes and larvae, respectively. One of these genes, the cytochrome P450 CYP6N12, was up-regulated in both stages. RT-PCR confirmed the microarray results and, additionally, showed no difference in gene expression between temephos exposed and unexposed RecRev mosquitoes. This suggested that the differences in the transcript profiles among the strains are heritable due to a selection process and are not caused by immediate insecticide exposure. Reversal of temephos resistance was demonstrated and, importantly, there was a positive correlation between a decrease in the resistance ratio and an accompanying decrease in the expression levels of previously over expressed genes. Some of the genes identified here have also been implicated in metabolic resistance in other mosquito species and insecticide resistant populations of Ae. aegypti. CONCLUSIONS/SIGNIFICANCE: The identification of gene expression signatures associated to

  6. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui

    2018-03-01

    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  7. Relationship of Resistance to Benzimidazole Fungicides with Mutation of β-Tubulin Gene in Venturia nashicola

    Directory of Open Access Journals (Sweden)

    Yeonsoo Kwak

    2017-06-01

    Full Text Available Pear scab caused by Venturia nashicola has been reported as an important disease of pear resulting in lowering the quality of pear fruits. In this study, it was conducted to investigate the relationship between resistance of V. nashicola and mutation of β-tubulin gene and the fungicide resistance in field isolate group in benzimidazole fungicides. Responce of V. nashicola to carbendazim could be classified into 3 groups as sensitive that does not grow at all on PDA amended with 0.16 μg/ml of carbendazim, low resistance that could not grow in 4.0 μg/ml medium, and high resistance that can grow even at 100 μg/ml. Thirty isolates of V. nashicola collected from 3 regions as Wonju, Naju, and Okcheon were highly resistant to carbendazim. Analysis of the nucleotide sequence of β-tubulin gene of V. nashicola showed that there was no difference in the nucleotide sequence between the sensitive and the low-resistant isolate, but GAG at codon 198 (glutamic acid was replaced with GCG (alanine in the high-resistant isolate. Among 10 isolates obtained from the Okcheon, 5 isolates showed the substitution of glycine for glutamic acid, which were resistant to carbendazim, but more sensitive to the mixture of carbendazim and diethofencarb than others. Through these results, all isolates of V. nashicola isolated in pear orchard were found to be resistant to benzimidazoles. Also, mutants E198A and E198G at β-tubulin were found to be important mechanisms of V. nashicola resistance against benzimidazole fungicides.

  8. Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew.

    Science.gov (United States)

    Chowdhury, Jamil; Lück, Stefanie; Rajaraman, Jeyaraman; Douchkov, Dimitar; Shirley, Neil J; Schwerdt, Julian G; Schweizer, Patrick; Fincher, Geoffrey B; Burton, Rachel A; Little, Alan

    2017-01-01

    Heteroxylan has recently been identified as an important component of papillae, which are formed during powdery mildew infection of barley leaves. Deposition of heteroxylan near the sites of attempted fungal penetration in the epidermal cell wall is believed to enhance the physical resistance to the fungal penetration peg and hence to improve pre-invasion resistance. Several glycosyltransferase (GT) families are implicated in the assembly of heteroxylan in the plant cell wall, and are likely to work together in a multi-enzyme complex. Members of key GT families reported to be involved in heteroxylan biosynthesis are up-regulated in the epidermal layer of barley leaves during powdery mildew infection. Modulation of their expression leads to altered susceptibility levels, suggesting that these genes are important for penetration resistance. The highest level of resistance was achieved when a GT43 gene was co-expressed with a GT47 candidate gene, both of which have been predicted to be involved in xylan backbone biosynthesis. Altering the expression level of several candidate heteroxylan synthesis genes can significantly alter disease susceptibility. This is predicted to occur through changes in the amount and structure of heteroxylan in barley papillae.

  9. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant.

    Science.gov (United States)

    Mutlu, Nedim; Boyaci, Filiz Hatice; Göçmen, Münevver; Abak, Kazim

    2008-11-01

    Fusarium wilt (Fusarium oxysporum Schlecht. f. sp. melongenae) is a vascular disease of eggplant (Solanum melongena L.). The objectives of this work were (1) to confirm the monogenic inheritance of fusarium wilt resistance in eggplant, (2) to identify molecular markers linked to this resistance, and (3) to develop SCAR markers from most informative markers. We report the tagging of the gene for resistance to fusarium wilt (FOM) in eggplant using SRAP, RGA, SRAP-RGA and RAPD markers. Analysis of segregation data confirmed the monogenic inheritance of resistance. DNA from F(2) and BC(1) populations of eggplant segregating for fusarium wilt resistance was screened with 2,316 primer combinations to detect polymorphism. Three markers were linked within 2.6 cM of the gene. The codominant SRAP marker Me8/Em5 and dominant SRAP-RGA marker Em12/GLPL2 were tightly linked to each other and mapped 1.2 cM from the resistance gene, whereas RAPD marker H12 mapped 2.6 cM from the gene and on the same side as the other two markers. The SRAP marker was converted into two dominant SCAR markers that were confirmed to be linked to the resistance gene in the F(2,) BC(1) and F(2) of BC(3) generations of the same cross. These markers provide a starting point for mapping the eggplant FOM resistance gene in eggplant and for exploring the synteny between solanaceous crops for fusarium wilt resistance genes. The SCAR markers will be useful for identifying fusarium wilt-resistant genotypes in marker-assisted selection breeding programs using segregating progenies of the resistant eggplant progenitor used in this study.

  10. Receptor-like proteins involved in plant disease resistance

    NARCIS (Netherlands)

    Kruijt, M.; Kock, de M.J.D.; Wit, de P.J.G.M.

    2005-01-01

    Race-specific resistance in plants against microbial pathogens is governed by several distinct classes of resistance (R) genes. This review focuses on the class that consists of the plasma membrane-bound leucine-rich repeat proteins known as receptor-like proteins (RLPs). The first isolated

  11. Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

    Directory of Open Access Journals (Sweden)

    Yuichiro Iida

    Full Text Available Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i frameshift mutations and (ii transposon insertions in Avr2, (iii point mutations in Avr4 and Avr4E, and (iv deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

  12. Breeding of Yangfumai No.5 with multiple disease resistance

    International Nuclear Information System (INIS)

    He Zhentian; Chen Xiulan; Zhang Rong; Wang Jianhua; Wang Jinrong

    2013-01-01

    To control the damage of wheat yellow mosaic disease and powdery mildew, new wheat cultivar with high-yield, disease-resistant was bred. Yangfumai 9311 with yellow mosaic disease resistant was used as donor parent to backcross with recurrent parent Yangmai 11, and combined with conventional breeding techniques and irradiation methods, a new wheat variety Yangfumai No.5 was developed and registered in 2011. Yangfumai No.5 with resistance of yellow mosaic disease and powdery mildew is suitable to grow in the Yangtze River region. (authors)

  13. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  14. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    %, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  15. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  16. (SRAP) markers linked to bacterial wilt resistance genes i

    African Journals Online (AJOL)

    SAM

    2014-03-19

    Mar 19, 2014 ... Bacterial wilt caused by Ralstonia solanacearum is one of the most economically important diseases affecting potato (Solanum tuberosum). It is necessary to develop more molecular markers for potential use in potato genetic research. A highly resistant primitive cultivated species Solanum phureja was.

  17. Coincidence in map positions between pathogen-induced defense-responsive genes and quantitative resistance loci in rice

    Institute of Scientific and Technical Information of China (English)

    熊敏; 王石平; 张启发

    2002-01-01

    Quantitative disease resistance conferred by quantitative trait loci (QTLs) is presumably of wider spectrum and durable. Forty-four cDNA clones, representing 44 defense-responsive genes, were fine mapped to 56 loci distributed on 9 of the 12 rice chromosomes. The locations of 32 loci detected by 27 cDNA clones were associated with previously identified resistance QTLs for different rice diseases, including blast, bacterial blight, sheath blight and yellow mottle virus. The loci detected by the same multiple-copy cDNA clones were frequently located on similar locations of different chromosomes. Some of the multiple loci detected by the same clones were all associated with resistance QTLs. These results suggest that some of the genes may be important components in regulation of defense responses against pathogen invasion and they may be the candidates for studying the mechanism of quantitative disease resistance in rice.

  18. Biomedical Information Extraction: Mining Disease Associated Genes from Literature

    Science.gov (United States)

    Huang, Zhong

    2014-01-01

    Disease associated gene discovery is a critical step to realize the future of personalized medicine. However empirical and clinical validation of disease associated genes are time consuming and expensive. In silico discovery of disease associated genes from literature is therefore becoming the first essential step for biomarker discovery to…

  19. Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

    Directory of Open Access Journals (Sweden)

    Dhananjay Dhokane

    Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

  20. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the

  1. Evolution of resistance against CRISPR/Cas9 gene drive

    OpenAIRE

    Clark, Andrew; Unckless, Robert; Messer, Philipp

    2016-01-01

    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which inc...

  2. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  3. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    OpenAIRE

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

  4. Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

    Directory of Open Access Journals (Sweden)

    Srećko Jelenić

    2003-01-01

    Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

  5. Effects of Resistance Exercise Intensity on Cytokine and Chemokine Gene Expression in Atopic Dermatitis Mouse Model

    Directory of Open Access Journals (Sweden)

    Eun-Ju Choi

    2018-04-01

    Full Text Available Background and Objective: Although the evidence is unclear, literature indicates that resistance exercise reduces inflammation in colorectal disease. The purpose of this study was to identify the effects of colon tissue on cytokine and chemokine gene expression with changes in resistance exercise intensity. Material and Methods: We divided male BABL/c mice into 6 groups (each group n=10, total=60 (control group: CON, low resistance exercise group: EX_L, high resistance exercise group: EX_H, atopic dermatitis group: AD, atopic dermatitis+low resistance exercise group: AD+EX_L, atopic dermatitis+high resistance exercise group: AD+EX_H and subjected them to ladder climbing resistance exercise for 4 weeks. After 24 h of each exercise schedule, a real-time polymerase chain reaction was performed to determine mRNA expression of interleukin-6 (IL-6 and chemokine ligand 20 (CCL20. Results: The AD group showed significantly higher mRNA expression of IL-6 and CCL20 compared with the CON, EX_L, EX_H, AD+EX_L, and AD+EX_H groups (p<0.05. Conclusion: In conclusion, both high and low resistance exercise effectively decreases the concentration of IL-6 and CCL20 in mice with and without AD.

  6. Tetracycline residues and tetracycline resistance genes in groundwater impacted by swine production facilities

    Science.gov (United States)

    Mackie, R.I.; Koike, S.; Krapac, I.; Chee-Sanford, J.; Maxwell, Susan; Aminov, R.I.

    2006-01-01

    Antibiotics are used at therapeutic levels to treat disease; at slightly lower levels as prophylactics; and at low, subtherapeutic levels for growth promotion and improvement of feed efficiency. Over 88% of swine producers in the United States gave antimicrobials to grower/finisher pigs in feed as a growth promoter in 2000. It is estimated that ca. 75% of antibiotics are not absorbed by animals and are excreted in urine and feces. The extensive use of antibiotics in swine production has resulted in antibiotic resistance in many intestinal bacteria, which are also excreted in swine feces, resulting in dissemination of resistance genes into the environment.To assess the impact of manure management on groundwater quality, groundwater samples have been collected near two swine confinement facilities that use lagoons for manure storage and treatment. Several key contaminant indicators-including inorganic ions, antibiotics, and antibiotic resistance genes-were analyzed in groundwater collected from the monitoring wells. Chloride, ammonium, potassium, and sodium were predominant inorganic constituents in the manure samples and served as indicators of groundwater contamination. Based on these analyses, shallow groundwater has been impacted by lagoon seepage at both sites. Liquid chromatography-mass spectroscopy (LC-MS) was used to measure the dissolved concentrations of tetracycline, chlortetracycline, and oxytetracycline in groundwater and manure. Although tetracyclines were regularly used at both facilities, they were infrequently detected in manure samples and then at relatively trace concentrations. Concentrations of all tetracyclines and their breakdown products in the groundwater sampled were generally less than 0.5 ??g/L.Bacterial tetracycline resistance genes served as distinct genotypic markers to indicate the dissemination and mobility of antibiotic resistance genes that originated from the lagoons. Applying PCR to genomic DNA extracted from the lagoon and

  7. Effector-mediated discovery of a novel resistance gene against Bremia lactucae in a nonhost lettuce species.

    Science.gov (United States)

    Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W

    2017-11-01

    Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its cross-compatibility with the host species L. sativa enables the study of inheritance of nonhost resistance (NHR). We performed transient expression of candidate RXLR effector genes from B. lactucae in a diverse Lactuca germplasm set. Responses to two candidate effectors (BLR31 and BLN08) were genetically mapped and tested for co-segregation with disease resistance. BLN08 induced a hypersensitive response (HR) in 55% of the L. saligna accessions, but responsiveness did not co-segregate with resistance to Bl:24. BLR31 triggered an HR in 5% of the L. saligna accessions, and revealed a novel R gene providing complete B. lactucae race Bl:24 resistance. Resistant hybrid plants that were BLR31 nonresponsive indicated other unlinked R genes and/or nonhost QTLs. We have identified a candidate avirulence effector of B. lactucae (BLR31) and its cognate R gene in L. saligna. Concurrently, our results suggest that R genes are not required for NHR of L. saligna. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  8. Ranking candidate disease genes from gene expression and protein interaction: a Katz-centrality based approach.

    Directory of Open Access Journals (Sweden)

    Jing Zhao

    Full Text Available Many diseases have complex genetic causes, where a set of alleles can affect the propensity of getting the disease. The identification of such disease genes is important to understand the mechanistic and evolutionary aspects of pathogenesis, improve diagnosis and treatment of the disease, and aid in drug discovery. Current genetic studies typically identify chromosomal regions associated specific diseases. But picking out an unknown disease gene from hundreds of candidates located on the same genomic interval is still challenging. In this study, we propose an approach to prioritize candidate genes by integrating data of gene expression level, protein-protein interaction strength and known disease genes. Our method is based only on two, simple, biologically motivated assumptions--that a gene is a good disease-gene candidate if it is differentially expressed in cases and controls, or that it is close to other disease-gene candidates in its protein interaction network. We tested our method on 40 diseases in 58 gene expression datasets of the NCBI Gene Expression Omnibus database. On these datasets our method is able to predict unknown disease genes as well as identifying pleiotropic genes involved in the physiological cellular processes of many diseases. Our study not only provides an effective algorithm for prioritizing candidate disease genes but is also a way to discover phenotypic interdependency, cooccurrence and shared pathophysiology between different disorders.

  9. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae.

    Science.gov (United States)

    Das, Alok; Soubam, D; Singh, P K; Thakur, S; Singh, N K; Sharma, T R

    2012-06-01

    The dominant rice blast resistance gene, Pi54 confers resistance to Magnaporthe oryzae in different parts of India. In our effort to identify more effective forms of this gene, we isolated an orthologue of Pi54 named as Pi54rh from the blast-resistant wild species of rice, Oryza rhizomatis, using allele mining approach and validated by complementation. The Pi54rh belongs to CC-NBS-LRR family of disease resistance genes with a unique Zinc finger (C(3)H type) domain. The 1,447 bp Pi54rh transcript comprises of 101 bp 5'-UTR, 1,083 bp coding region and 263 bp 3'-UTR, driven by pathogen inducible promoter. We showed the extracellular localization of Pi54rh protein and the presence of glycosylation, myristoylation and phosphorylation sites which implicates its role in signal transduction process. This is in contrast to other blast resistance genes that are predicted to be intracellular NBS-LRR-type resistance proteins. The Pi54rh was found to express constitutively at basal level in the leaves, but upregulates 3.8-fold at 96 h post-inoculation with the pathogen. Functional validation of cloned Pi54rh gene using complementation test showed high degree of resistance to seven isolates of M. oryzae collected from different geographical locations of India. In this study, for the first time, we demonstrated that a rice blast resistance gene Pi54rh cloned from wild species of rice provides broad spectrum resistance to M. oryzae hence can be used in rice improvement breeding programme.

  10. The CAPN10 Gene Is Associated with Insulin Resistance Phenotypes in the Spanish Population

    Science.gov (United States)

    Sáez, María E.; González-Sánchez, José L.; Ramírez-Lorca, Reposo; Martínez-Larrad, María T.; Zabena, Carina; González, Alejandro; Morón, Francisco J.; Ruiz, Agustín; Serrano-Ríos, Manuel

    2008-01-01

    Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10) has been associated with type 2 diabetes (T2DM), a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS) in T2DM and in polycystic ovary syndrome (PCOS). In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT) and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF) diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population. PMID:18698425

  11. The CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population.

    Directory of Open Access Journals (Sweden)

    María E Sáez

    Full Text Available Cardiovascular disease is the leading cause of morbidity and mortality in the industrialized world. Familial aggregation of cardiovascular risk factors is a frequent finding, but genetic factors affecting its presentation are still poorly understood. The calpain 10 gene (CAPN10 has been associated with type 2 diabetes (T2DM, a complex metabolic disorder with increased risk of cardiovascular disease. Moreover, the CAPN10 gene has been associated with the presence of metabolic syndrome (MS in T2DM and in polycystic ovary syndrome (PCOS. In this work, we have analysed whether the polymorphisms UCSNP44, -43, -19 and -63 are related to several cardiovascular risk factors in the context of MS. Molecular analysis of CAPN10 gene was performed in 899 individuals randomly chosen from a cross-sectional population-based epidemiological survey. We have found that CAPN10 gene in our population is mainly associated with two indicators of the presence of insulin resistance: glucose levels two hours after a 75-g oral glucose tolerance test (OGTT and HOMA values, although cholesterol levels and blood pressure values are also influenced by CAPN10 variants. In addition, the 1221/1121 haplogenotype is under-represented in individuals that fulfil the International Diabetes Federation (IDF diagnostic criteria for MS. Our results suggest that CAPN10 gene is associated with insulin resistance phenotypes in the Spanish population.

  12. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    Science.gov (United States)

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  13. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  14. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  15. The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

    DEFF Research Database (Denmark)

    Andersen, V.; Agerstjerne, L.; Jensen, D.

    2009-01-01

    Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

  16. Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

    2013-03-23

    Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat

    Science.gov (United States)

    Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most damaging diseases of wheat worldwide. It is essential to identify new genes for effective resistance against the disease. Durum wheat PI 480148, originally from Ethiopia, was resistant in all seedling tests with s...

  18. Comparative genomics and association mapping approaches for blast resistant genes in finger millet using SSRs.

    Directory of Open Access Journals (Sweden)

    B Kalyana Babu

    Full Text Available The major limiting factor for production and productivity of finger millet crop is blast disease caused by Magnaporthe grisea. Since, the genome sequence information available in finger millet crop is scarce, comparative genomics plays a very important role in identification of genes/QTLs linked to the blast resistance genes using SSR markers. In the present study, a total of 58 genic SSRs were developed for use in genetic analysis of a global collection of 190 finger millet genotypes. The 58 SSRs yielded ninety five scorable alleles and the polymorphism information content varied from 0.186 to 0.677 at an average of 0.385. The gene diversity was in the range of 0.208 to 0.726 with an average of 0.487. Association mapping for blast resistance was done using 104 SSR markers which identified four QTLs for finger blast and one QTL for neck blast resistance. The genomic marker RM262 and genic marker FMBLEST32 were linked to finger blast disease at a P value of 0.007 and explained phenotypic variance (R² of 10% and 8% respectively. The genomic marker UGEP81 was associated to finger blast at a P value of 0.009 and explained 7.5% of R². The QTLs for neck blast was associated with the genomic SSR marker UGEP18 at a P value of 0.01, which explained 11% of R². Three QTLs for blast resistance were found common by using both GLM and MLM approaches. The resistant alleles were found to be present mostly in the exotic genotypes. Among the genotypes of NW Himalayan region of India, VHC3997, VHC3996 and VHC3930 were found highly resistant, which may be effectively used as parents for developing blast resistant cultivars in the NW Himalayan region of India. The markers linked to the QTLs for blast resistance in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of blast resistant alleles into locally adapted cultivars.

  19. Comparative genomics and association mapping approaches for blast resistant genes in finger millet using SSRs.

    Science.gov (United States)

    Babu, B Kalyana; Dinesh, Pandey; Agrawal, Pawan K; Sood, S; Chandrashekara, C; Bhatt, Jagadish C; Kumar, Anil

    2014-01-01

    The major limiting factor for production and productivity of finger millet crop is blast disease caused by Magnaporthe grisea. Since, the genome sequence information available in finger millet crop is scarce, comparative genomics plays a very important role in identification of genes/QTLs linked to the blast resistance genes using SSR markers. In the present study, a total of 58 genic SSRs were developed for use in genetic analysis of a global collection of 190 finger millet genotypes. The 58 SSRs yielded ninety five scorable alleles and the polymorphism information content varied from 0.186 to 0.677 at an average of 0.385. The gene diversity was in the range of 0.208 to 0.726 with an average of 0.487. Association mapping for blast resistance was done using 104 SSR markers which identified four QTLs for finger blast and one QTL for neck blast resistance. The genomic marker RM262 and genic marker FMBLEST32 were linked to finger blast disease at a P value of 0.007 and explained phenotypic variance (R²) of 10% and 8% respectively. The genomic marker UGEP81 was associated to finger blast at a P value of 0.009 and explained 7.5% of R². The QTLs for neck blast was associated with the genomic SSR marker UGEP18 at a P value of 0.01, which explained 11% of R². Three QTLs for blast resistance were found common by using both GLM and MLM approaches. The resistant alleles were found to be present mostly in the exotic genotypes. Among the genotypes of NW Himalayan region of India, VHC3997, VHC3996 and VHC3930 were found highly resistant, which may be effectively used as parents for developing blast resistant cultivars in the NW Himalayan region of India. The markers linked to the QTLs for blast resistance in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of blast resistant alleles into locally adapted cultivars.

  20. Inheritance of resistance to cotton blue disease Herança da resistência do algodoeiro à doença-azul

    Directory of Open Access Journals (Sweden)

    Osmério Pupim Junior

    2008-05-01

    Full Text Available The objective of this work was to determine the inheritance of cotton blue disease resistance by cotton plants. Populations derived from the CD 401 and Delta Opal resistant varieties were evaluated, through a greenhouse test with artificial inoculation by viruliferous aphids. Cotton blue disease resistance is conditioned by one dominant gene, both in CD 401 and Delta Opal varieties.O objetivo deste trabalho foi determinar a herança da resistência do algodoeiro à doença-azul. Populações derivadas das variedades resistentes CD 401 e Delta Opal foram avaliadas em casa de vegetação, por meio da inoculação de pulgões virulíferos. A resistência à doença-azul do algodoeiro é condicionada por um gene dominante, tanto em 'DC 401' quanto em 'Delta Opal'.

  1. In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

    Science.gov (United States)

    Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

    2017-02-01

    Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

  2. Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

    Directory of Open Access Journals (Sweden)

    Jong-nam Oh

    2018-04-01

    Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

  3. Mutation spectrum of genes associated with steroid-resistant nephrotic syndrome in Chinese children.

    Science.gov (United States)

    Wang, Ying; Dang, Xiqiang; He, Qingnan; Zhen, Yan; He, Xiaoxie; Yi, Zhuwen; Zhu, Kuichun

    2017-08-20

    Approximately 20% of children with idiopathic nephrotic syndrome do not respond to steroid therapy. More than 30 genes have been identified as disease-causing genes for the steroid-resistant nephrotic syndrome (SRNS). Few reports were from the Chinese population. The coding regions of genes commonly associated with SRNS were analyzed to characterize the gene mutation spectrum in children with SRNS in central China. The first phase study involved 38 children with five genes (NPHS1, NPHS2, PLCE1, WT1, and TRPC6) by Sanger sequencing. The second phase study involved 33 children with 17 genes by next generation DNA sequencing (NGS. 22 new patients, and 11 patients from first phase study but without positive findings). Overall deleterious or putatively deleterious gene variants were identified in 19 patients (31.7%), including four NPHS1 variants among five patients and three PLCE1 variants among four other patients. Variants in COL4A3, COL4A4, or COL4A5 were found in six patients. Eight novel variants were identified, including two in NPHS1, two in PLCE1, one in NPHS2, LAMB2, COL4A3, and COL4A4, respectively. 55.6% of the children with variants failed to respond to immunosuppressive agent therapy, while the resistance rate in children without variants was 44.4%. Our results show that screening for deleterious variants in some common genes in children clinically suspected with SRNS might be helpful for disease diagnosis as well as prediction of treatment efficacy and prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  5. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  6. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  7. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  8. Finding Cardiovascular Disease Genes in the Dog

    Science.gov (United States)

    Parker, Heidi G.; Meurs, Kathryn M.; Ostrander, Elaine A.

    2013-01-01

    Recent advances in canine genomics are changing the landscape of veterinary biology, and by default, veterinary medicine. No longer are clinicians locked into traditional methods of diagnoses and therapy. Rather major advances in canine genetics and genomics from the past five years are now changing the way the veterinarian of the 21st century practices medicine. First, the availability of a dense genome map gives canine genetics a much needed foothold in comparative medicine, allowing advances made in human and mouse genetics to be applied to companion animals. Second, the recently released 7.5x whole genome sequence of the dog is facilitating the identification of hereditary disease genes. Finally, development of genetic tools for rapid screening of families and populations at risk for inherited disease means that the cost of identifying and testing for disease loci will significantly decrease in coming years. Out of these advances will come major changes in companion animal diagnostics and therapy. Clinicians will be able to offer their clients genetic testing and counseling for a myriad of disorders. Such advances are certain to generate healthier and more long lived dogs, improving quality of life for owner and pet alike. The clinician of the 21st century, therefore, faces incredible opportunities as well as challenges in the management of genetic disease. In this review we summarize recent findings in canine genomics and discuss their application to the study of canine cardiac health. PMID:19083345

  9. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  10. The tobacco smoke component acrolein induces glucocorticoid resistant gene expression via inhibition of histone deacetylase.

    Science.gov (United States)

    Randall, Matthew J; Haenen, Guido R M M; Bouwman, Freek G; van der Vliet, Albert; Bast, Aalt

    2016-01-05

    Chronic obstructive pulmonary disease (COPD) is the leading cause of cigarette smoke-related death worldwide. Acrolein, a crucial reactive electrophile found in cigarette smoke mimics many of the toxic effects of cigarette smoke-exposure in the lung. In macrophages, cigarette smoke is known to hinder histone deacetylases (HDACs), glucocorticoid-regulated enzymes that play an important role in the pathogenesis of glucocorticoid resistant inflammation, a common feature of COPD. Thus, we hypothesize that acrolein plays a role in COPD-associated glucocorticoid resistance. To examine the role of acrolein on glucocorticoid resistance, U937 monocytes, differentiated with PMA to macrophage-like cells were treated with acrolein for 0.5h followed by stimulation with hydrocortisone for 8h, or treated simultaneously with LPS and hydrocortisone for 8h without acrolein. GSH and nuclear HDAC activity were measured, or gene expression was analyzed by qPCR. Acrolein-mediated TNFα gene expression was not suppressed by hydrocortisone whereas LPS-induced TNFα expression was suppressed. Acrolein also significantly inhibited nuclear HDAC activity in macrophage-like cells. Incubation of recombinant HDAC2 with acrolein led to the formation of an HDAC2-acrolein adduct identified by mass spectrometry. Therefore, these results suggest that acrolein-induced inflammatory gene expression is resistant to suppression by the endogenous glucocorticoid, hydrocortisone. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. HFE gene mutations in coronary atherothrombotic disease

    Directory of Open Access Journals (Sweden)

    Calado R.T.

    2000-01-01

    Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

  12. Characterization of a disease susceptibility locus for exploring an efficient way to improve rice resistance against bacterial blight

    Institute of Scientific and Technical Information of China (English)

    Qi Cheng; Weihua Mao; Wenya Xie; Qinsong Liu; Jianbo Cao; Meng Yuan; Qinglu Zhang; Xianghua Li; Shiping Wang

    2017-01-01

    Bacterial blight caused by Xanthomonas oryzae pv.oryzae (Xoo) is the most harmful bacterial disease of rice worldwide.Previously,we characterized major disease resistance (MR) gene xa25,which confers race-specific resistance to Xoo strain PXO339.The xa25 is a recessive allele of the SWEET13 locus,but SWEET13's interaction with PXO339 and how efficiently using this locus for rice breeding still need to be defined.Here we show that the SWEET13 allele from rice Zhenshan 97 is a susceptibility gene to PXO339.Using this allele's promoter to regulate xa25 resulted in disease,suggesting that the promoter is a key determinant in SWEET13 caused disease in Zhanshan 97 after PXO339 infection.PXO339 transcriptionally induces SWEET13 to cause disease.Partial suppressing SWEET13 expression leads to a high level of resistance to PXO339.Thus,the transcriptionally suppressed SWEET13 functions as xa25 in resistance to PXO339.Hybrid rice is widely grown in many countries.However,recessive MR genes have not been efficiently used for disease resistance breeding in hybrid rice production for both parents of the hybrid have to carry the same recessive gene.However,the suppressed SWEET13 functions dominantly,which will have advantage to improve the resistance of hybrid rice to xa25-incomptible Xoo.

  13. Differential disease resistance response in the barley necrotic mutant nec1

    Directory of Open Access Journals (Sweden)

    Kunga Laura

    2011-04-01

    Full Text Available Abstract Background Although ion fluxes are considered to be an integral part of signal transduction during responses to pathogens, only a few ion channels are known to participate in the plant response to infection. CNGC4 is a disease resistance-related cyclic nucleotide-gated ion channel. Arabidopsis thaliana CNGC4 mutants hlm1 and dnd2 display an impaired hypersensitive response (HR, retarded growth, a constitutively active salicylic acid (SA-mediated pathogenesis-related response and elevated resistance against bacterial pathogens. Barley CNGC4 shares 67% aa identity with AtCNGC4. The barley mutant nec1 comprising of a frame-shift mutation of CNGC4 displays a necrotic phenotype and constitutively over-expresses PR-1, yet it is not known what effect the nec1 mutation has on barley resistance against different types of pathogens. Results nec1 mutant accumulated high amount of SA and hydrogen peroxide compared to parental cv. Parkland. Experiments investigating nec1 disease resistance demonstrated positive effect of nec1 mutation on non-host resistance against Pseudomonas syringae pv. tomato (Pst at high inoculum density, whereas at normal Pst inoculum concentration nec1 resistance did not differ from wt. In contrast to augmented P. syringae resistance, penetration resistance against biotrophic fungus Blumeria graminis f. sp. hordei (Bgh, the causal agent of powdery mildew, was not altered in nec1. The nec1 mutant significantly over-expressed race non-specific Bgh resistance-related genes BI-1 and MLO. Induction of BI-1 and MLO suggested putative involvement of nec1 in race non-specific Bgh resistance, therefore the effect of nec1on mlo-5-mediated Bgh resistance was assessed. The nec1/mlo-5 double mutant was as resistant to Bgh as Nec1/mlo-5 plants, suggesting that nec1 did not impair mlo-5 race non-specific Bgh resistance. Conclusions Together, the results suggest that nec1 mutation alters activation of systemic acquired resistance

  14. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  15. Comparative genomics on Norrie disease gene.

    Science.gov (United States)

    Katoh, Masuko; Katoh, Masaru

    2005-05-01

    DAND1 (NBL1), DAND2 (CKTSF1B1 or GREM1 or GREMLIN), DAND3 (CKTSF1B2 or GREM2 or PRDC), DAND4 (CER1), DAND5 (CKTSF1B3 or GREM3 or DANTE), MUC2, MUC5AC, MUC5B, MUC6, MUC19, WISP1, WISP2, WISP3, VWF, NOV and Norrie disease (NDP or NORRIN) genes encode proteins with cysteine knot domain. Cysteine-knot superfamily proteins regulate ligand-receptor interactions for a variety of signaling pathways implicated in embryogenesis, homeostasis, and carcinogenesis. Although Ndp is unrelated to Wnt family members, Ndp is claimed to function as a ligand for Fzd4. Here, we identified and characterized rat Ndp, cow Ndp, chicken ndp and zebrafish ndp genes by using bioinformatics. Rat Ndp gene, consisting of three exons, was located within AC105563.4 genome sequence. Cow Ndp and chicken ndp complete CDS were derived from CB467544.1 EST and BX932859.2 cDNA, respectively. Zebrafish ndp gene was located within BX572627.5 genome sequence. Rat Ndp (131 aa) was a secreted protein with C-terminal cysteine knot-like (CTCK) domain. Rat Ndp showed 100, 96.9, 95.4, 87.8 and 66.4 total-amino-acid identity with mouse Ndp, cow Ndp, human NDP, chicken ndp and zebrafish ndp, respectively. Exon-intron structure of mammalian Ndp orthologs was well conserved. FOXA2, CUTL1 (CCAAT displacement protein), LMO2, CEBPA (C/EBPalpha)-binding sites and triple POU2F1 (OCT1)-binding sites were conserved among promoters of mammalian Ndp orthologs.

  16. Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.

    Science.gov (United States)

    López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V

    2003-08-01

    Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.

  17. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  18. Selection on resilience improves disease resistance and tolerance to infections

    NARCIS (Netherlands)

    Mulder, H.A.; Rashidi, H.

    2017-01-01

    Response to infection in animals has 2 main mechanisms: resistance (ability to control pathogen burden) and tolerance (ability to maintain performance given the pathogen burden). Selection on disease resistance and tolerance to infections seems a promising avenue to increase productivity of animals

  19. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  20. TaCPK2-A, a calcium-dependent protein kinase gene that is required for wheat powdery mildew resistance enhances bacterial blight resistance in transgenic rice.

    Science.gov (United States)

    Geng, Shuaifeng; Li, Aili; Tang, Lichuan; Yin, Lingjie; Wu, Liang; Lei, Cailin; Guo, Xiuping; Zhang, Xin; Jiang, Guanghuai; Zhai, Wenxue; Wei, Yuming; Zheng, Youliang; Lan, Xiujin; Mao, Long

    2013-08-01

    Calcium-dependent protein kinases (CPKs) are important Ca2+ signalling components involved in complex immune and stress signalling networks; but the knowledge of CPK gene functions in the hexaploid wheat is limited. Previously, TaCPK2 was shown to be inducible by powdery mildew (Blumeria graminis tritici, Bgt) infection in wheat. Here, its functions in disease resistance are characterized further. This study shows the presence of defence-response and cold-response cis-elements on the promoters of the A subgenome homoeologue (TaCPK2-A) and D subgenome homoeologue (TaCPK2-D), respectively. Their expression patterns were then confirmed by quantitative real-time PCR (qRT-PCR) using genome-specific primers, where TaCPK2-A was induced by Bgt treatment while TaCPK2-D mainly responded to cold treatment. Downregulation of TaCPK2-A by virus-induced gene silencing (VIGS) causes loss of resistance to Bgt in resistant wheat lines, indicating that TaCPK2-A is required for powdery mildew resistance. Furthermore, overexpression of TaCPK2-A in rice enhanced bacterial blight (Xanthomonas oryzae pv. oryzae, Xoo) resistance. qRT-PCR analysis showed that overexpression of TaCPK2-A in rice promoted the expression of OsWRKY45-1, a transcription factor involved in both fungal and bacterial resistance by regulating jasmonic acid and salicylic acid signalling genes. The opposite effect was found in wheat TaCPK2-A VIGS plants, where the homologue of OsWRKY45-1 was significantly repressed. These data suggest that modulation of WRKY45-1 and associated defence-response genes by CPK2 genes may be the common mechanism for multiple disease resistance in grass species, which may have undergone subfunctionalization in promoters before the formation of hexaploid wheat.

  1. Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

    Science.gov (United States)

    Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

    2008-01-01

    Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

  2. Non-host Plant Resistance against Phytophthora capsici Is Mediated in Part by Members of the I2 R Gene Family in Nicotiana spp.

    Science.gov (United States)

    Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter

    2017-01-01

    The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.

  3. Prevalence of the Antibiotic Resistance Genes in Coagulase-Positive-and Negative-Staphylococcus in Chicken Meat Retailed to Consumers

    OpenAIRE

    Osman, Kamelia; Badr, Jihan; Al-Maary, Khalid S.; Moussa, Ihab M. I.; Hessain, Ashgan M.; Girah, Zeinab M. S. Amin; Abo-shama, Usama H.; Orabi, Ahmed; Saad, Aalaa

    2016-01-01

    The use of antibiotics in farm management (growing crops and raising animals) has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB) and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG) to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resista...

  4. Prevalence of Antibiotic Resistance Genes among Human Gut-Derived Bifidobacteria.

    Science.gov (United States)

    Duranti, Sabrina; Lugli, Gabriele Andrea; Mancabelli, Leonardo; Turroni, Francesca; Milani, Christian; Mangifesta, Marta; Ferrario, Chiara; Anzalone, Rosaria; Viappiani, Alice; van Sinderen, Douwe; Ventura, Marco

    2017-02-01

    The microbiota of the human gastrointestinal tract (GIT) may regularly be exposed to antibiotics, which are used to prevent and treat infectious diseases caused by bacteria and fungi. Bacterial communities of the gut retain a reservoir of antibiotic resistance (AR) genes, and antibiotic therapy thus positively selects for those microorganisms that harbor such genetic features, causing microbiota modulation. During the first months following birth, bifidobacteria represent some of the most dominant components of the human gut microbiota, although little is known about their AR gene complement (or resistome). In the current study, we assessed the resistome of the Bifidobacterium genus based on phenotypic and genotypic data of members that represent all currently recognized bifidobacterial (sub)species. Moreover, a comparison between the bifidobacterial resistome and gut metagenome data sets from adults and infants shows that the bifidobacterial community present at the first week following birth possesses a reduced AR arsenal compared to that present in the infant bifidobacterial population in subsequent weeks of the first year of life. Our findings reinforce the concept that the early infant gut microbiota is more susceptible to disturbances by antibiotic treatment than the gut microbiota developed at a later life stage. The spread of resistance to antibiotics among bacterial communities has represented a major concern since their discovery in the last century. The risk of genetic transfer of resistance genes between microorganisms has been extensively investigated due to its relevance to human health. In contrast, there is only limited information available on antibiotic resistance among human gut commensal microorganisms such as bifidobacteria, which are widely exploited by the food industry as health-promoting microorganisms or probiotic ingredients. In the current study, we explored the occurrence of antibiotic resistance genes in the genomes of bifidobacteria

  5. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  6. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  7. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  8. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  9. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.

    Directory of Open Access Journals (Sweden)

    Jinita Sthapit Kandel

    Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.

  10. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens

    OpenAIRE

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-01-01

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers d...

  11. More nutritious bananas resist disease | IDRC - International ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2010-10-28

    Oct 28, 2010 ... English · Français ... By inserting resistant varieties (like FHIA-17 and FHIA-23) between traditional, susceptible plants, we 'trap' ... This has a direct impact on food security by restoring the productivity of the traditional varieties.

  12. Usage of the Heterologous Expression of the Antimicrobial Gene afp From Aspergillus giganteus for Increasing Fungal Resistance in Olive

    Science.gov (United States)

    Narvaez, Isabel; Khayreddine, Titouh; Pliego, Clara; Cerezo, Sergio; Jiménez-Díaz, Rafael M.; Trapero-Casas, José L.; López-Herrera, Carlos; Arjona-Girona, Isabel; Martín, Carmen; Mercado, José A.; Pliego-Alfaro, Fernando

    2018-01-01

    The antifungal protein (AFP) produced by Aspergillus giganteus, encoded by the afp gene, has been used to confer resistance against a broad range of fungal pathogens in several crops. In this research, transgenic olive plants expressing the afp gene under the control of the constitutive promoter CaMV35S were generated and their disease response against two root infecting fungal pathogens, Verticillium dahliae and Rosellinia necatrix, was evaluated. Embryogenic cultures derived from a mature zygotic embryo of cv. ‘Picual’ were used for A. tumefaciens transformation. Five independent transgenic lines were obtained, showing a variable level of afp expression in leaves and roots. None of these transgenic lines showed enhanced resistance to Verticillium wilt. However, some of the lines displayed a degree of incomplete resistance to white root rot caused by R. necatrix compared with disease reaction of non-transformed plants or transgenic plants expressing only the GUS gene. The level of resistance to this pathogen correlated with that of the afp expression in root and leaves. Our results indicate that the afp gene can be useful for enhanced partial resistance to R. necatrix in olive, but this gene does not protect against V. dahliae. PMID:29875785

  13. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

  14. An antibody that confers plant disease resistance targets a membrane-bound glyoxal oxidase in Fusarium.

    Science.gov (United States)

    Song, Xiu-Shi; Xing, Shu; Li, He-Ping; Zhang, Jing-Bo; Qu, Bo; Jiang, Jin-He; Fan, Chao; Yang, Peng; Liu, Jin-Long; Hu, Zu-Quan; Xue, Sheng; Liao, Yu-Cai

    2016-05-01

    Plant germplasm resources with natural resistance against globally important toxigenic Fusarium are inadequate. CWP2, a Fusarium genus-specific antibody, confers durable resistance to different Fusarium pathogens that infect cereals and other crops, producing mycotoxins. However, the nature of the CWP2 target is not known. Thus, investigation of the gene coding for the CWP2 antibody target will likely provide critical insights into the mechanism underlying the resistance mediated by this disease-resistance antibody. Immunoblots and mass spectrometry analysis of two-dimensional electrophoresis gels containing cell wall proteins from Fusarium graminearum (Fg) revealed that a glyoxal oxidase (GLX) is the CWP2 antigen. Cellular localization studies showed that GLX is localized to the plasma membrane. This GLX efficiently catalyzes hydrogen peroxide production; this enzymatic activity was specifically inhibited by the CWP2 antibody. GLX-deletion strains of Fg, F. verticillioides (Fv) and F. oxysporum had significantly reduced virulence on plants. The GLX-deletion Fg and Fv strains had markedly reduced mycotoxin accumulation, and the expression of key genes in mycotoxin metabolism was downregulated. This study reveals a single gene-encoded and highly conserved cellular surface antigen that is specifically recognized by the disease-resistance antibody CWP2 and regulates both virulence and mycotoxin biosynthesis in Fusarium species. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. Breeding for disease resistance in cacao

    Science.gov (United States)

    Cacao production must increase in order to meet the projected rise in the demand for chocolate. Approximately one-third of global production is lost annually to diseases and insects. Four diseases account for the greatest losses worldwide: black pod, caused by four Phytophthora spp; witches’ broom...

  16. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  17. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

    Science.gov (United States)

    Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

    2014-02-22

    Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

  18. Evolutionary signatures amongst disease genes permit novel methods for gene prioritization and construction of informative gene-based networks.

    Directory of Open Access Journals (Sweden)

    Nolan Priedigkeit

    2015-02-01

    Full Text Available Genes involved in the same function tend to have similar evolutionary histories, in that their rates of evolution covary over time. This coevolutionary signature, termed Evolutionary Rate Covariation (ERC, is calculated using only gene sequences from a set of closely related species and has demonstrated potential as a computational tool for inferring functional relationships between genes. To further define applications of ERC, we first established that roughly 55% of genetic diseases posses an ERC signature between their contributing genes. At a false discovery rate of 5% we report 40 such diseases including cancers, developmental disorders and mitochondrial diseases. Given these coevolutionary signatures between disease genes, we then assessed ERC's ability to prioritize known disease genes out of a list of unrelated candidates. We found that in the presence of an ERC signature, the true disease gene is effectively prioritized to the top 6% of candidates on average. We then apply this strategy to a melanoma-associated region on chromosome 1 and identify MCL1 as a potential causative gene. Furthermore, to gain global insight into disease mechanisms, we used ERC to predict molecular connections between 310 nominally distinct diseases. The resulting "disease map" network associates several diseases with related pathogenic mechanisms and unveils many novel relationships between clinically distinct diseases, such as between Hirschsprung's disease and melanoma. Taken together, these results demonstrate the utility of molecular evolution as a gene discovery platform and show that evolutionary signatures can be used to build informative gene-based networks.

  19. Mutations in the Norrie disease gene.

    Science.gov (United States)

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Science.gov (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  1. Identification of nine pathotype-specific genes conferring resistance to fusiform rust in loblolly pine (Pinus taeda L.)

    Science.gov (United States)

    Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia

    2015-01-01

    Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...

  2. Distribution and frequency of Bru1, a major brown rust resistance gene, in the sugarcane world collection

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane worldwide. Molecular markers for a major brown rust resistance gene, Bru1, were used to screen a total of 1,282 clones in the World Collection of Sugarcane and Related Grasses (WCSRG) to determine the distribution and...

  3. Frequency and distribution of the brown rust resistance gene Bru1 and implications for the Louisiana sugarcane breeding programme

    Science.gov (United States)

    Brown rust, caused by the fungus Puccinia melanocephala, is an important disease of sugarcane posing an increasing threat to sugarcane industries worldwide. A major gene, Bru1, has been shown to contribute a significant proportion of brown rust resistance in multiple sugarcane industries. The recent...

  4. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  5. XA23 is an executor R protein and confers broad-spectrum disease resistance in rice.

    Science.gov (United States)

    Wang, Chunlian; Zhang, Xiaoping; Fan, Yinglun; Gao, Ying; Zhu, Qinlong; Zheng, Chongke; Qin, Tengfei; Li, Yanqiang; Che, Jinying; Zhang, Mingwei; Yang, Bing; Liu, Yaoguang; Zhao, Kaijun

    2014-11-09

    The majority of plant disease resistance (R) genes encode proteins that share common structural features. However, the transcription activator-like effector (TALE) associated executor type R genes show no considerable sequence homology to any known R genes. We adopted a map-based cloning approach and TALE-based technology to isolate and characterize Xa23, a new executor R gene derived from the wild rice (Oryza rufipogon) that confers an extremely broad spectrum of resistance to bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo). Xa23 encodes a 113-amino acid protein that shares 50% identity to the known executor R protein XA10. The predicted transmembrane helices in XA23 also overlap with those of XA10. Unlike Xa10, however, Xa23 transcription is specifically activated by AvrXa23, a TALE present in all examined Xoo field isolates. Moreover, the susceptible xa23 allele has an identical open reading frame of Xa23, but differs in promoter region by lacking the TALE binding-element (EBE) for AvrXa23. XA23 can trigger strong hypersensitive response in rice, tobacco and tomato. Our results provide the first evidence that plant genomes have an executor R gene family in which members execute their function and spectrum of disease resistance by recognizing the cognate TALEs in pathogen. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.

  6. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bac......The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across.......6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor– encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance...

  7. Thyroid hormone resistance misdiagnosed as Graves' disease

    Directory of Open Access Journals (Sweden)

    Manish Gutch

    2017-01-01

    Full Text Available Resistance to thyroid hormone (RTH syndrome is a very rare disorder characterized by mutations of the thyroid hormone receptor beta and is usually inherited as an autosomal dominant trait. Patients with RTH are usually euthyroid but rarely may present with signs and symptoms consistent with hyperthyroidism. Here, we describe the case of a young girl with goiter who was previously misdiagnosed to have hyperthyroidism and was subsequently diagnosed to be suffering from RTH.

  8. Identification and validation of a gene causing cross-resistance between insecticide classes in Anopheles gambiae from Ghana.

    Science.gov (United States)

    Mitchell, Sara N; Stevenson, Bradley J; Müller, Pie; Wilding, Craig S; Egyir-Yawson, Alexander; Field, Stuart G; Hemingway, Janet; Paine, Mark J I; Ranson, Hilary; Donnelly, Martin James

    2012-04-17

    In the last decade there have been marked reductions in malaria incidence in sub-Saharan Africa. Sustaining these reductions will rely upon insecticides to control the mosquito malaria vectors. We report that in the primary African malaria vector, Anopheles gambiae sensu stricto, a single enzyme, CYP6M2, confers resistance to two classes of insecticide. This is unique evidence in a disease vector of cross-resistance associated with a single metabolic gene that simultaneously reduces the efficacy of two of the four classes of insecticide routinely used for malaria control. The gene-expression profile of a highly DDT-resistant population of A. gambiae s.s. from Ghana was characterized using a unique whole-genome microarray. A number of genes were significantly overexpressed compared with two susceptible West African colonies, including genes from metabolic families previously linked to insecticide resistance. One of the most significantly overexpressed probe groups (false-discovery rate-adjusted P P450 gene CYP6M2. This gene is associated with pyrethroid resistance in wild A. gambiae s.s. populations) and can metabolize both type I and type II pyrethroids in recombinant protein assays. Using in vitro assays we show that recombinant CYP6M2 is also capable of metabolizing the organochlorine insecticide DDT in the presence of solubilizing factor sodium cholate.

  9. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function[OPEN

    Science.gov (United States)

    2018-01-01

    Plants have many, highly variable resistance (R) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize (Zea mays) Hm1, was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. PMID:29382771

  10. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function.

    Science.gov (United States)

    Kourelis, Jiorgos; van der Hoorn, Renier A L

    2018-02-01

    Plants have many, highly variable resistance ( R ) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize ( Zea mays ) Hm1 , was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. © 2018 American Society of Plant Biologists. All rights reserved.

  11. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  12. Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

    Directory of Open Access Journals (Sweden)

    Roderick M. Card

    2018-06-01

    Full Text Available Brachyspira hyodysenteriae is the aetiological agent of swine dysentery, a globally distributed disease that causes profound economic loss, impedes the free trade and movement of animals, and has significant impact on pig health. Infection is generally treated with antibiotics of which pleuromutilins, such as tiamulin, are widely used for this purpose, but reports of resistance worldwide threaten continued effective control. In Brachyspira hyodysenteriae pleuromutilin resistance has been associated with mutations in chromosomal genes encoding ribosome-associated functions, however the dynamics of resistance acquisition are poorly understood, compromising stewardship efforts to preserve pleuromutilin effectiveness. In this study we undertook whole genome sequencing (WGS and phenotypic susceptibility testing of 34 UK field isolates and 3 control strains to investigate pleuromutilin resistance in Brachyspira hyodysenteriae. Genome-wide association studies identified a new pleuromutilin resistance gene, tva(A (tiamulin valnemulin antibiotic resistance, encoding a predicted ABC-F transporter. In vitro culture of isolates in the presence of inhibitory or sub-inhibitory concentrations of tiamulin showed that tva(A confers reduced pleuromutilin susceptibility that does not lead to clinical resistance but facilitates the development of higher-level resistance via mutations in genes encoding ribosome-associated functions. Genome sequencing of antibiotic-exposed isolates identified both new and previously described mutations in chromosomal genes associated with reduced pleuromutilin susceptibility, including the 23S rRNA gene and rplC, which encodes the L3 ribosomal protein. Interesting three antibiotic-exposed isolates harboured mutations in fusA, encoding Elongation Factor G, a gene not previously associated with pleuromutilin resistance. A longitudinal molecular epidemiological examination of two episodes of swine dysentery at the same farm indicated

  13. Markers associated with disease resistance in Eastern oysters, Crassostrea virginica

    Science.gov (United States)

    Eastern oyster, Crassostrea viginica, is an economically important aquaculture species in the USA, but production has been impacted by diseases such as dermo and MSX. Efforts have been put into the development of disease-resistant oyster lines using selective breeding techniques. However, these met...

  14. Molecular characterization of early blight disease resistant and ...

    African Journals Online (AJOL)

    Potato early blight disease caused by Alternaria solani is one of the major factors limiting potato production worldwide. Developing highly resistant cultivars is the most effective way to control the disease. In this study, 20 random amplified polymorphic DNA (RAPD) and 6 simple sequence repeats (SSR) primers were ...

  15. SSR Markers Assessed for Peanut Smut Disease Resistance

    Science.gov (United States)

    Peanut smut disease, caused by Thecaphora frezii (Carranza & Lindquist), can result in yield losses higher than 50%. Several strategies have been developed for disease management but they are still insufficient. The smut genetic resistance found in wild species and Bolivian landraces is currently th...

  16. A Genome-Wide Association Study Reveals Genes Associated with Fusarium Ear Rot Resistance in a Maize Core Diversity Panel

    Science.gov (United States)

    Zila, Charles T.; Samayoa, L. Fernando; Santiago, Rogelio; Butrón, Ana; Holland, James B.

    2013-01-01

    Fusarium ear rot is a common disease of maize that affects food and feed quality globally. Resistance to the disease is highly quantitative, and maize breeders have difficulty incorporating polygenic resistance alleles from unadapted donor sources into elite breeding populations without having a negative impact on agronomic performance. Identification of specific allele variants contributing to improved resistance may be useful to breeders by allowing selection of resistance alleles in coupling phase linkage with favorable agronomic characteristics. We report the results of a genome-wide association study to detect allele variants associated with increased resistance to Fusarium ear rot in a maize core diversity panel of 267 inbred lines evaluated in two sets of environments. We performed association tests with 47,445 single-nucleotide polymorphisms (SNPs) while controlling for background genomic relationships with a mixed model and identified three marker loci significantly associated with disease resistance in at least one subset of environments. Each associated SNP locus had relatively small additive effects on disease resistance (±1.1% on a 0–100% scale), but nevertheless were associated with 3 to 12% of the genotypic variation within or across environment subsets. Two of three identified SNPs colocalized with genes that have been implicated with programmed cell death. An analysis of associated allele frequencies within the major maize subpopulations revealed enrichment for resistance alleles in the tropical/subtropical and popcorn subpopulations compared with other temperate breeding pools. PMID:24048647

  17. Prevalence of the Antibiotic Resistance Genes in Coagulase-Positive-and Negative-Staphylococcus in Chicken Meat Retailed to Consumers.

    Science.gov (United States)

    Osman, Kamelia; Badr, Jihan; Al-Maary, Khalid S; Moussa, Ihab M I; Hessain, Ashgan M; Girah, Zeinab M S Amin; Abo-Shama, Usama H; Orabi, Ahmed; Saad, Aalaa

    2016-01-01

    The use of antibiotics in farm management (growing crops and raising animals) has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB) and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG) to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mec A and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus (MRSA), methicillin-resistant coagulase-negative staphylococci (MRCNS) and methicillin-susceptible coagulase-negative staphylococci (MSCNS) isolated from the retail trade of ready-to-eat raw chicken meat samples collected during 1 year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim, and vancomycin) and their endorsement of the quinolone resistance determining region, mec A and cfr genes. The isolation results revealed 50 isolates, CPS (14) and CNS (36), representing ten species ( S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius , and S. lentus ). Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mec A gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides, and streptogramin B [MLS( B )] in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone-resistance

  18. Induced disease resistance of satsuma mandarings against penicillium digitatum by gamma irradiation

    International Nuclear Information System (INIS)

    Jeong, Rae Dong

    2017-01-01

    Gamma irradiation, which is a type of ionizing radiation, can be used as a fruit inducible factor. In the present study, the effects of gamma irradiation on the resistance of mandarin fruits against Penicillium digitatum, the causal agent of postharvest green mold disease, were investigated. Pretreatment of a low dose of gamma irradiation effectively reduced the disease incidence and lesion diameter of mandarin fruits inoculated with P. digatatum during storage for 14 d. Interestingly, exposed to 400 Gy of gamma irradiation significantly maintained firmness and stimulated the synthesis of defense-related enzymes, (e.g., β-1,3-glucanase, phenylalanine, peroxidase, and polyphenol oxidase) and pathogenesis-related (PR) genes (e.g., PR-1 and PR-2). Therefore, the gamma irradiation-induced resistance against P. digatatum involves both changes of phenolic compounds and the induction of expression of defense-related genes. In addition, scanning electron microscopy analysis revealed that induced disease resistance by gamma irradiation signifcantly inhibits the growth of P. digatatum in mandarin fruits. These results suggest that the exposure of gamma irradiation is a potential methods for inducing the disease resistance of fruit to postharvest fungal pathogens and for extending the postharvest life of mandarin fruit

  19. Induced disease resistance of satsuma mandarings against penicillium digitatum by gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Rae Dong [Dept. of Applied Biology, Institute of Environmentally Friendly Agriculture, Chonnam National University, Gwangju (Korea, Republic of)

    2017-06-15

    Gamma irradiation, which is a type of ionizing radiation, can be used as a fruit inducible factor. In the present study, the effects of gamma irradiation on the resistance of mandarin fruits against Penicillium digitatum, the causal agent of postharvest green mold disease, were investigated. Pretreatment of a low dose of gamma irradiation effectively reduced the disease incidence and lesion diameter of mandarin fruits inoculated with P. digatatum during storage for 14 d. Interestingly, exposed to 400 Gy of gamma irradiation significantly maintained firmness and stimulated the synthesis of defense-related enzymes, (e.g., β-1,3-glucanase, phenylalanine, peroxidase, and polyphenol oxidase) and pathogenesis-related (PR) genes (e.g., PR-1 and PR-2). Therefore, the gamma irradiation-induced resistance against P. digatatum involves both changes of phenolic compounds and the induction of expression of defense-related genes. In addition, scanning electron microscopy analysis revealed that induced disease resistance by gamma irradiation signifcantly inhibits the growth of P. digatatum in mandarin fruits. These results suggest that the exposure of gamma irradiation is a potential methods for inducing the disease resistance of fruit to postharvest fungal pathogens and for extending the postharvest life of mandarin fruit.

  20. Gene blaCTX-M Mutation as Risk Factor of Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Devinna Kang

    2017-06-01

    Full Text Available Currently there are more than half from all antibiotics used in the world which is belong to β lactam group, but clinical effectiveness of the antibiotics are limited by antibiotic resistance of microorganisms as causative agents from infectious diseases. Several resistance mechanisms for Enterobacteriaceae are mostly caused by enzymatic hydrolysis of antibiotics specific enzymes, called β lactamases. β lactamases represent a large group of enzyme which is genetically and functionally different as extended‑spectrum β-lactamase (ESBL and known as greatest threat of resistence. Plasmid localization from the encoded gene and enzyme distribution among the pathogen increases every year. Most widespread and clinically relevant ESBL are class A ESBL of Temoniera (TEM, Sulphydryl variable (SHV and Cefotaxime (CTX-M types. The purpose of this review was to analyze variant of blaCTX-M gene which cause the most increase incidence of antibiotic resistance. The methods of this review were data-based searching based on Pubmed, Scopus and Google Scholar, without limitation of index factor by using the keyword “blaCTX-M”, “Extended-spectrum β-lactamase”, and “antibiotic resistance”. The conclusion of the review is CTX-M type ESBL have replaced TEM and SHV type as dominant enzyme in last decade. ESBL produced by Klebsiella pneumoniae have emerged as one of major nosocomial pathogens. Nosocomial infection caused by CTX-M-15 in Klebsiella pneumoniae dramatically increased in recent years.

  1. Gene Expression Profiling Soybean Stem Tissue Early Response to Sclerotinia sclerotiorum and In Silico Mapping in Relation to Resistance Markers

    Directory of Open Access Journals (Sweden)

    Bernarda Calla

    2009-07-01

    Full Text Available White mold, caused by (Lib. de Bary, can be a serious disease of crops grown under cool, moist environments. In many plants, such as soybean [ (L. Merr.], complete genetic resistance does not exist. To identify possible genes involved in defense against this pathogen, and to determine possible physiological changes that occur during infection, a microarray screen was conducted using stem tissue to evaluate changes in gene expression between partially resistant and susceptible soybean genotypes at 8 and 14 hours post inoculation. RNA from 15 day-old inoculated plants was labeled and hybridized to soybean cDNA microarrays. ANOVA identified 1270 significant genes from the comparison between time points and 105 genes from the comparison between genotypes. Selected genes were classified into functional categories. The analyses identified changes in cell-wall composition and signaling pathways, as well as suggesting a role for anthocyanin and anthocyanidin synthesis in the defense against . In-silico mapping of both the differentially expressed transcripts and of public markers associated with partial resistance to white mold, provided evidence of several differentially expressed genes being closely positioned to white mold resistance markers, with the two most promising genes encoding a PR-5 and anthocyanidin synthase.

  2. [A method for genetic transformation of maize for resistance to viral diseases].

    Science.gov (United States)

    Valdez, Marta; Madriz, Kenneth; Ramírez, Pilar

    2004-09-01

    A system for the genetic transformation of maize was developed for two Costa Rican varieties: CR-7 and Diamantes 8843, that can allow the subsequent transfer of viral-derived genes in order to confer resistance to the disease caused by maize rayado fino virus (MRFV). The method is based on particle bombardment of organogenic calli derived from shoot tips. On the other hand, the molecular construction pRFcp-bar, containing the coat protein gene of MRFV and the marker gene bar, was elaborated. For the visual selection of the transformed material was used also the plasmid pDM803 that contains the reporter gene uidA (GUS). The results indicate that devices evaluated: the PIG ("Particle Inflow Gun") and the Bio-Rad are both enough efficient to transfer foreign genes to the genome of the maize.

  3. Virulence Genes and Antimicrobial Resistance Profiles of Pasteurella multocida Strains Isolated from Rabbits in Brazil

    Directory of Open Access Journals (Sweden)

    Thais Sebastiana Porfida Ferreira

    2012-01-01

    Full Text Available Pasteurella multocida is responsible for a wide range of diseases in domestic animals. In rabbits, the agent is related to nasal discharge, pneumonia, otitis media, pyometra, orchitis, abscess, and septicemia. One hundred and forty rabbits with respiratory diseases from four rabbitries in São Paulo State, Brazil were evaluated for the detection of P. multocida in their nasal cavities. A total of twenty-nine animals were positive to P. multocida isolation, and 46 strains were selected and characterized by means of biochemical tests and PCR. P. multocida strains were tested for capsular type, virulence genes, and resistance profile. A total of 45.6% (21/46 of isolates belonged to capsular type A, and 54.34% (25/46 of the isolates were untypeable. None of the strains harboured toxA or pfhA genes. The frequency of the other twenty genes tested was variable, and the data generated was used to build a dendrogram, showing the relatedness of strains, which were clustered according to origin. Resistance revealed to be more common against sulfonamides and cotrimoxazole, followed by erythromycin, penicillin, and amoxicillin.

  4. Multiple insecticide resistances in the disease vector Culex p. quinquefasciatus from Western Indian Ocean.

    Science.gov (United States)

    Pocquet, Nicolas; Milesi, Pascal; Makoundou, Patrick; Unal, Sandra; Zumbo, Betty; Atyame, Célestine; Darriet, Frédéric; Dehecq, Jean-Sébastien; Thiria, Julien; Bheecarry, Ambicadutt; Iyaloo, Diana P; Weill, Mylène; Chandre, Fabrice; Labbé, Pierrick

    2013-01-01

    Several mosquito-borne diseases affect the Western Indian Ocean islands. Culex pipiens quinquefasciatus is one of these vectors and transmits filariasis, Rift Valley and West Nile viruses and the Japanese encephalitis. To limit the impact of these diseases on public health, considerable vector control efforts have been implemented since the 50s, mainly through the use of neurotoxic insecticides belonging to Organochlorines (OC), Organophosphates (OP) and pyrethroids (PYR) families. However, mosquito control failures have been reported on site, and they were probably due to the selection of resistant individuals in response to insecticide exposure. In this study, we used different approaches to establish a first regional assessment of the levels and mechanisms of resistance to various insecticides. Bioassays were used to evaluate resistance to various insecticides, enzyme activity was measured to assess the presence of metabolic resistances through elevated detoxification, and molecular identification of known resistance alleles was investigated to determine the frequency of target-site mutations. These complementary approaches showed that resistance to the most used insecticides families (OC, OP and PYR) is widespread at a regional scale. However, the distribution of the different resistance genes is quite heterogeneous among the islands, some being found at high frequencies everywhere, others being frequent in some islands and absent in others. Moreover, two resistance alleles displayed clinal distributions in Mayotte and La Réunion, probably as a result of a heterogeneous selection due to local treatment practices. These widespread and diverse resistance mechanisms reduce the capacity of resistance management through classical strategies (e.g. insecticide rotation). In case of a disease outbreak, it could undermine the efforts of the vector control services, as only few compounds could be used. It thus becomes urgent to find alternatives to control populations

  5. Multiple insecticide resistances in the disease vector Culex p. quinquefasciatus from Western Indian Ocean.

    Directory of Open Access Journals (Sweden)

    Nicolas Pocquet

    Full Text Available Several mosquito-borne diseases affect the Western Indian Ocean islands. Culex pipiens quinquefasciatus is one of these vectors and transmits filariasis, Rift Valley and West Nile viruses and the Japanese encephalitis. To limit the impact of these diseases on public health, considerable vector control efforts have been implemented since the 50s, mainly through the use of neurotoxic insecticides belonging to Organochlorines (OC, Organophosphates (OP and pyrethroids (PYR families. However, mosquito control failures have been reported on site, and they were probably due to the selection of resistant individuals in response to insecticide exposure. In this study, we used different approaches to establish a first regional assessment of the levels and mechanisms of resistance to various insecticides. Bioassays were used to evaluate resistance to various insecticides, enzyme activity was measured to assess the presence of metabolic resistances through elevated detoxification, and molecular identification of known resistance alleles was investigated to determine the frequency of target-site mutations. These complementary approaches showed that resistance to the most used insecticides families (OC, OP and PYR is widespread at a regional scale. However, the distribution of the different resistance genes is quite heterogeneous among the islands, some being found at high frequencies everywhere, others being frequent in some islands and absent in others. Moreover, two resistance alleles displayed clinal distributions in Mayotte and La Réunion, probably as a result of a heterogeneous selection due to local treatment practices. These widespread and diverse resistance mechanisms reduce the capacity of resistance management through classical strategies (e.g. insecticide rotation. In case of a disease outbreak, it could undermine the efforts of the vector control services, as only few compounds could be used. It thus becomes urgent to find alternatives to

  6. Transcriptome analysis highlights defense and signaling pathways mediated by rice pi21 gene with partial resistance to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2016-12-01

    Full Text Available Rice blast disease is one of the most destructive rice diseases worldwide. The pi21 gene confers partial and durable resistance to Magnaporthe oryzae. However, little is known regarding the molecular mechanisms of resistance mediated by the loss-of-function of Pi21. In this study, comparative transcriptome profiling of the Pi21-RNAi transgenic rice line and Nipponbare with M. oryzae infection at different time points (0, 12, 24, 48, and 72 hpi were investigated using RNA sequencing. The results generated 43,222 unique genes mapped to the rice genome. In total, 1,109 differentially expressed genes (DEGs were identified between the Pi21-RNAi line and Nipponbare with M. oryzae infection, with 103, 281, 209, 69, and 678 DEGs at 0, 12, 24, 48, and 72 hpi, respectively. Functional analysis showed that most of the DEGs were involved in metabolism, transport, signaling, and defense. Among the genes assigned to plant–pathogen interaction, we identified 43 receptor kinase genes associated with pathogen-associated molecular pattern recognition and calcium ion influx. The expression levels of brassinolide-insensitive 1, flagellin sensitive 2 and elongation factor Tu receptor, ethylene (ET biosynthesis and signaling genes, were higher in the Pi21-RNAi line than Nipponbare. This suggested that there was a more robust PTI response in Pi21-RNAi plants and that ET signaling was important to rice blast resistance. We also identified 53 transcription factor genes, including WRKY, NAC, DOF, and ERF families that show differential expression between the two genotypes. This study highlights possible candidate genes that may serve a function in the partial rice blast resistance mediated by the loss-of-function of Pi21 and increase our understanding of the molecular mechanisms involved in partial resistance against M. oryzae.

  7. Resistance to Downy Mildew in Lettuce 'La Brillante' is Conferred by Dm50 Gene and Multiple QTL.

    Science.gov (United States)

    Simko, Ivan; Ochoa, Oswaldo E; Pel, Mathieu A; Tsuchida, Cayla; Font I Forcada, Carolina; Hayes, Ryan J; Truco, Maria-Jose; Antonise, Rudie; Galeano, Carlos H; Michelmore, Richard W

    2015-09-01

    Many cultivars of lettuce (Lactuca sativa L.) are susceptible to downy mildew, a nearly globally ubiquitous disease caused by Bremia lactucae. We previously determined that Batavia type cultivar 'La Brillante' has a high level of field resistance to the disease in California. Testing of a mapping population developed from a cross between 'Salinas 88' and La Brillante in multiple field and laboratory experiments revealed that at least five loci conferred resistance in La Brillante. The presence of a new dominant resistance gene (designated Dm50) that confers complete resistance to specific isolates was detected in laboratory tests of seedlings inoculated with multiple diverse isolates. Dm50 is located in the major resistance cluster on linkage group 2 that contains at least eight major, dominant Dm genes conferring resistance to downy mildew. However, this Dm gene is ineffective against the isolates of B. lactucae prevalent in the field in California and the Netherlands. A quantitative trait locus (QTL) located at the Dm50 chromosomal region (qDM2.2) was detected, though, when the amount of disease was evaluated a month before plants reached harvest maturity. Four additional QTL for resistance to B. lactucae were identified on linkage groups 4 (qDM4.1 and qDM4.2), 7 (qDM7.1), and 9 (qDM9.2). The largest effect was associated with qDM7.1 (up to 32.9% of the total phenotypic variance) that determined resistance in multiple field experiments. Markers identified in the present study will facilitate introduction of these resistance loci into commercial cultivars of lettuce.

  8. Evolutionary dynamics of human autoimmune disease genes and malfunctioned immunological genes

    Directory of Open Access Journals (Sweden)

    Podder Soumita

    2012-01-01

    Full Text Available Abstract Background One of the main issues of molecular evolution is to divulge the principles in dictating the evolutionary rate differences among various gene classes. Immunological genes have received considerable attention in evolutionary biology as candidates for local adaptation and for studying functionally important polymorphisms. The normal structure and function of immunological genes will be distorted when they experience mutations leading to immunological dysfunctions. Results Here, we examined the fundamental differences between the genes which on mutation give rise to autoimmune or other immune system related diseases and the immunological genes that do not cause any disease phenotypes. Although the disease genes examined are analogous to non-disease genes in product, expression, function, and pathway affiliation, a statistically significant decrease in evolutionary rate has been found in autoimmune disease genes relative to all other immune related diseases and non-disease genes. Possible ways of accumulation of mutation in the three steps of the central dogma (DNA-mRNA-Protein have been studied to trace the mutational effects predisposed to disease consequence and acquiring higher selection pressure. Principal Component Analysis and Multivariate Regression Analysis have established the predominant role of single nucleotide polymorphisms in guiding the evolutionary rate of immunological disease and non-disease genes followed by m-RNA abundance, paralogs number, fraction of phosphorylation residue, alternatively spliced exon, protein residue burial and protein disorder. Conclusions Our study provides an empirical insight into the etiology of autoimmune disease genes and other immunological diseases. The immediate utility of our study is to help in disease gene identification and may also help in medicinal improvement of immune related disease.

  9. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  10. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  11. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  12. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  13. Reusing Treated Wastewater: Consideration of the Safety Aspects Associated with Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Pei-Ying Hong

    2018-02-01

    Full Text Available As more countries engage in water reuse, either intended or de facto, there is an urgent need to more comprehensively evaluate resulting environmental and public health concerns. While antibiotic-resistant bacteria (ARB and antibiotic resistance genes (ARGs are increasingly coming under the spotlight, as emerging contaminants, existing water reuse regulations and guidelines do not adequately address these concerns. This perspectives paper seeks to frame the various challenges that need to be resolved to identify meaningful and realistic target types and levels of antibiotic resistance benchmarks for water reuse. First, there is the need for standardized and agreed-upon methodologies to identify and quantify ARB and ARGs. Second, even if methodologies are available, identifying which ARB and ARGs to monitor that would best relate to the occurrence of disease burden remains unknown. Third, a framework tailored to assessing the risks associated with ARB and ARGs during reuse is urgently needed. Fourth, similar to protecting drinking water sources, strategies to prevent dissemination of ARB and ARGs via wastewater treatment and reuse are required to ensure that appropriate barriers are emplaced. Finally, current wastewater treatment technologies could benefit from modification or retrofit to more effectively remove ARB and ARGs while also producing a high quality product for water and resource recovery. This perspectives paper highlights the need to consider ARB and ARGs when evaluating the overall safety aspects of water reuse and ways by which this may be accomplished.

  14. Reusing Treated Wastewater: Consideration of the Safety Aspects Associated with Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2018-02-27

    As more countries engage in water reuse, either intended or de facto, there is an urgent need to more comprehensively evaluate resulting environmental and public health concerns. While antibiotic-resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are increasingly coming under the spotlight, as emerging contaminants, existing water reuse regulations and guidelines do not adequately address these concerns. This perspectives paper seeks to frame the various challenges that need to be resolved to identify meaningful and realistic target types and levels of antibiotic resistance benchmarks for water reuse. First, there is the need for standardized and agreed-upon methodologies to identify and quantify ARB and ARGs. Second, even if methodologies are available, identifying which ARB and ARGs to monitor that would best relate to the occurrence of disease burden remains unknown. Third, a framework tailored to assessing the risks associated with ARB and ARGs during reuse is urgently needed. Fourth, similar to protecting drinking water sources, strategies to prevent dissemination of ARB and ARGs via wastewater treatment and reuse are required to ensure that appropriate barriers are emplaced. Finally, current wastewater treatment technologies could benefit from modification or retrofit to more effectively remove ARB and ARGs while also producing a high quality product for water and resource recovery. This perspectives paper highlights the need to consider ARB and ARGs when evaluating the overall safety aspects of water reuse and ways by which this may be accomplished.

  15. Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat.

    Science.gov (United States)

    Blanco, Antonio; Gadaleta, A; Cenci, A; Carluccio, A V; Abdelbacki, A M M; Simeone, R

    2008-06-01

    Powdery mildew, caused by Blumeria graminis f.sp. tritici, is one of the most important wheat diseases in many regions of the world. Triticum turgidum var. dicoccoides (2n=4x=AABB), the progenitor of cultivated wheats, shows particular promises as a donor of useful genetic variation for several traits, including disease resistances. The wild emmer accession MG29896, resistant to powdery mildew, was backcrossed to the susceptible durum wheat cultivar Latino, and a set of backcross inbred lines (BC(5)F(5)) was produced. Genetic analysis of F(3) populations from two resistant introgression lines (5BIL-29 x Latino and 5BIL-42 x Latino) indicated that the powdery mildew resistance is controlled by a single dominant gene. Molecular markers and the bulked segregant analysis were used to characterize and map the powdery mildew resistance. Five AFLP markers (XP43M32((250)), XP46M31((410)), XP41M37((100)), XP41M39((250)), XP39M32((120))), three genomic SSR markers (Xcfd07, Xwmc75, Xgwm408) and one EST-derived SSR marker (BJ261635) were found to be linked to the resistance gene in 5BIL-29 and only the BJ261635 marker in 5BIL-42. By means of Chinese Spring nullisomic-tetrasomic, ditelosomic and deletion lines, the polymorphic markers and the resistance gene were assigned to chromosome bin 5BL6-0.29-0.76. These results indicated that the two lines had the same resistance gene and that the introgressed dicoccoides chromosome segment was longer (35.5 cM) in 5BIL-29 than that introgressed in 5BIL-42 (less than 1.5 cM). As no powdery mildew resistance gene has been reported on chromosome arm 5BL, the novel resistance gene derived from var. dicoccoides was designated Pm36. The 244 bp allele of BJ261635 in 5BIL-42 can be used for marker-assisted selection during the wheat resistance breeding process for facilitating gene pyramiding.

  16. Putative resistance gene markers associated with quantitative trait loci for fire blight resistance in Malus ‘Robusta 5’ accessions

    Science.gov (United States)

    2012-01-01

    Background Breeding of fire blight resistant scions and rootstocks is a goal of several international apple breeding programs, as options are limited for management of this destructive disease caused by the bacterial pathogen Erwinia amylovora. A broad, large-effect quantitative trait locus (QTL) for fire blight resistance has been reported on linkage group 3 of Malus ‘Robusta 5’. In this study we identified markers derived from putative fire blight resistance genes associated with the QTL by integrating further genetic mapping studies with bioinformatics analysis of transcript profiling data and genome sequence databases. Results When several defined E.amylovora strains were used to inoculate three progenies from international breeding programs, all with ‘Robusta 5’ as a common parent, two distinct QTLs were detected on linkage group 3, where only one had previously been mapped. In the New Zealand ‘Malling 9’ X ‘Robusta 5’ population inoculated with E. amylovora ICMP11176, the proximal QTL co-located with SNP markers derived from a leucine-rich repeat, receptor-like protein ( MxdRLP1) and a closely linked class 3 peroxidase gene. While the QTL detected in the German ‘Idared’ X ‘Robusta 5’ population inoculated with E. amylovora strains Ea222_JKI or ICMP11176 was approximately 6 cM distal to this, directly below a SNP marker derived from a heat shock 90 family protein gene ( HSP90). In the US ‘Otawa3’ X ‘Robusta5’ population inoculated with E. amylovora strains Ea273 or E2002a, the position of the LOD score peak on linkage group 3 was dependent upon the pathogen strains used for inoculation. One of the five MxdRLP1 alleles identified in fire blight resistant and susceptible cultivars was genetically associated with resistance and used to develop a high resolution melting PCR marker. A resistance QTL detected on linkage group 7 of the US population co-located with another HSP90 gene-family member and a WRKY transcription factor

  17. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  18. Functional screen for genes responsible for tamoxifen resistance in human breast cancer cells

    NARCIS (Netherlands)

    Meijer, Danielle; van Agthoven, Ton; Bosma, Peter T.; Nooter, Kees; Dorssers, Lambert C. J.

    2006-01-01

    Antiestrogens, such as tamoxifen, are widely used for endocrine treatment of estrogen receptor-positive breast cancer. However, as breast cancer progresses, development of tamoxifen resistance is inevitable. The mechanisms underlying this resistance are not well understood. To identify genes

  19. Mining disease genes using integrated protein-protein interaction and gene-gene co-regulation information.

    Science.gov (United States)

    Li, Jin; Wang, Limei; Guo, Maozu; Zhang, Ruijie; Dai, Qiguo; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Xuan, Ping; Zhang, Mingming

    2015-01-01

    In humans, despite the rapid increase in disease-associated gene discovery, a large proportion of disease-associated genes are still unknown. Many network-based approaches have been used to prioritize disease genes. Many networks, such as the protein-protein interaction (PPI), KEGG, and gene co-expression networks, have been used. Expression quantitative trait loci (eQTLs) have been successfully applied for the determination of genes associated with several diseases. In this study, we constructed an eQTL-based gene-gene co-regulation network (GGCRN) and used it to mine for disease genes. We adopted the random walk with restart (RWR) algorithm to mine for genes associated with Alzheimer disease. Compared to the Human Protein Reference Database (HPRD) PPI network alone, the integrated HPRD PPI and GGCRN networks provided faster convergence and revealed new disease-related genes. Therefore, using the RWR algorithm for integrated PPI and GGCRN is an effective method for disease-associated gene mining.

  20. Marker-assisted introgression of broad-spectrum blast resistance genes into the cultivated MR219 rice variety.

    Science.gov (United States)

    Miah, Gous; Rafii, Mohd Y; Ismail, Mohd R; Puteh, Adam B; Rahim, Harun A; Latif, Mohammad A

    2017-07-01

    The rice cultivar MR219 is famous for its better yield and long and fine grain quality; however, it is susceptible to blast disease. The main objective of this study was to introgress blast resistance genes into MR219 through marker-assisted selection (MAS). The rice cultivar MR219 was used as the recurrent parent, and Pongsu Seribu 1 was used as the donor. Marker-assisted foreground selection was performed using RM6836 and RM8225 to identify plants possessing blast resistance genes. Seventy microsatellite markers were used to estimate recurrent parent genome (RPG) recovery. Our analysis led to the development of 13 improved blast resistant lines with Piz, Pi2 and Pi9 broad-spectrum blast resistance genes and an MR219 genetic background. The RPG recovery of the selected improved lines was up to 97.70% with an average value of 95.98%. Selected improved lines showed a resistance response against the most virulent blast pathogen pathotype, P7.2. The selected improved lines did not express any negative effect on agronomic traits in comparison with MR219. The research findings of this study will be a conducive approach for the application of different molecular techniques that may result in accelerating the development of new disease-resistant rice varieties, which in turn will match rising demand and food security worldwide. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. Neural Inductive Matrix Completion for Predicting Disease-Gene Associations

    KAUST Repository

    Hou, Siqing

    2018-05-21

    In silico prioritization of undiscovered associations can help find causal genes of newly discovered diseases. Some existing methods are based on known associations, and side information of diseases and genes. We exploit the possibility of using a neural network model, Neural inductive matrix completion (NIMC), in disease-gene prediction. Comparing to the state-of-the-art inductive matrix completion method, using neural networks allows us to learn latent features from non-linear functions of input features. Previous methods use disease features only from mining text. Comparing to text mining, disease ontology is a more informative way of discovering correlation of dis- eases, from which we can calculate the similarities between diseases and help increase the performance of predicting disease-gene associations. We compare the proposed method with other state-of-the-art methods for pre- dicting associated genes for diseases from the Online Mendelian Inheritance in Man (OMIM) database. Results show that both new features and the proposed NIMC model can improve the chance of recovering an unknown associated gene in the top 100 predicted genes. Best results are obtained by using both the new features and the new model. Results also show the proposed method does better in predicting associated genes for newly discovered diseases.

  2. Identification of Ganoderma Disease Resistance Loci Using Natural Field Infection of an Oil Palm Multiparental Population

    Directory of Open Access Journals (Sweden)

    Sébastien Tisné

    2017-06-01

    Full Text Available Multi-parental populations are promising tools for identifying quantitative disease resistance loci. Stem rot caused by Ganoderma boninense is a major threat to palm oil production, with yield losses of up to 80% prompting premature replantation of palms. There is evidence of genetic resistance sources, but the genetic architecture of Ganoderma resistance has not yet been investigated. This study aimed to identify Ganoderma resistance loci using an oil palm multi-parental population derived from nine major founders of ongoing breeding programs. A total of 1200 palm trees of the multi-parental population was planted in plots naturally infected by Ganoderma, and their health status was assessed biannually over 25 yr. The data were treated as survival data, and modeled using the Cox regression model, including a spatial effect to take the spatial component in the spread of Ganoderma into account. Based on the genotypes of 757 palm trees out of the 1200 planted, and on pedigree information, resistance loci were identified using a random effect with identity-by-descent kinship matrices as covariance matrices in the Cox model. Four Ganoderma resistance loci were identified, two controlling the occurrence of the first Ganoderma symptoms, and two the death of palm trees, while favorable haplotypes were identified among a major gene pool for ongoing breeding programs. This study implemented an efficient and flexible QTL mapping approach, and generated unique valuable information for the selection of oil palm varieties resistant to Ganoderma disease.

  3. Identification of Ganoderma Disease Resistance Loci Using Natural Field Infection of an Oil Palm Multiparental Population

    Science.gov (United States)

    Tisné, Sébastien; Pomiès, Virginie; Riou, Virginie; Syahputra, Indra; Cochard, Benoît; Denis, Marie

    2017-01-01

    Multi-parental populations are promising tools for identifying quantitative disease resistance loci. Stem rot caused by Ganoderma boninense is a major threat to palm oil production, with yield losses of up to 80% prompting premature replantation of palms. There is evidence of genetic resistance sources, but the genetic architecture of Ganoderma resistance has not yet been investigated. This study aimed to identify Ganoderma resistance loci using an oil palm multi-parental population derived from nine major founders of ongoing breeding programs. A total of 1200 palm trees of the multi-parental population was planted in plots naturally infected by Ganoderma, and their health status was assessed biannually over 25 yr. The data were treated as survival data, and modeled using the Cox regression model, including a spatial effect to take the spatial component in the spread of Ganoderma into account. Based on the genotypes of 757 palm trees out of the 1200 planted, and on pedigree information, resistance loci were identified using a random effect with identity-by-descent kinship matrices as covariance matrices in the Cox model. Four Ganoderma resistance loci were identified, two controlling the occurrence of the first Ganoderma symptoms, and two the death of palm trees, while favorable haplotypes were identified among a major gene pool for ongoing breeding programs. This study implemented an efficient and flexible QTL mapping approach, and generated unique valuable information for the selection of oil palm varieties resistant to Ganoderma disease. PMID:28592650

  4. Identification of Ganoderma Disease Resistance Loci Using Natural Field Infection of an Oil Palm Multiparental Population.

    Science.gov (United States)

    Tisné, Sébastien; Pomiès, Virginie; Riou, Virginie; Syahputra, Indra; Cochard, Benoît; Denis, Marie

    2017-06-07

    Multi-parental populations are promising tools for identifying quantitative disease resistance loci. Stem rot caused by Ganoderma boninense is a major threat to palm oil production, with yield losses of up to 80% prompting premature replantation of palms. There is evidence of genetic resistance sources, but the genetic architecture of Ganoderma resistance has not yet been investigated. This study aimed to identify Ganoderma resistance loci using an oil palm multi-parental population derived from nine major founders of ongoing breeding programs. A total of 1200 palm trees of the multi-parental population was planted in plots naturally infected by Ganoderma , and their health status was assessed biannually over 25 yr. The data were treated as survival data, and modeled using the Cox regression model, including a spatial effect to take the spatial component in the spread of Ganoderma into account. Based on the genotypes of 757 palm trees out of the 1200 planted, and on pedigree information, resistance loci were identified using a random effect with identity-by-descent kinship matrices as covariance matrices in the Cox model. Four Ganoderma resistance loci were identified, two controlling the occurrence of the first Ganoderma symptoms, and two the death of palm trees, while favorable haplotypes were identified among a major gene pool for ongoing breeding programs. This study implemented an efficient and flexible QTL mapping approach, and generated unique valuable information for the selection of oil palm varieties resistant to Ganoderma disease. Copyright © 2017 Tisné et al.

  5. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line.

    Science.gov (United States)

    Hou, Liyuan; Zhang, Xiaojun; Li, Xin; Jia, Juqing; Yang, Huizhen; Zhan, Haixian; Qiao, Linyi; Guo, Huijuan; Chang, Zhijian

    2015-07-28

    Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68-0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  6. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line

    Directory of Open Access Journals (Sweden)

    Liyuan Hou

    2015-07-01

    Full Text Available Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt, is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68–0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  7. Life-threatening infectious diseases of childhood: single-gene inborn errors of immunity?

    Science.gov (United States)

    Alcaïs, Alexandre; Quintana-Murci, Lluis; Thaler, David S; Schurr, Erwin; Abel, Laurent; Casanova, Jean-Laurent

    2010-12-01

    The hypothesis that inborn errors of immunity underlie infectious diseases is gaining experimental support. However, the apparent modes of inheritance of predisposition or resistance differ considerably among diseases and among studies. A coherent genetic architecture of infectious diseases is lacking. We suggest here that life-threatening infectious diseases in childhood, occurring in the course of primary infection, result mostly from individually rare but collectively diverse single-gene variations of variable clinical penetrance, whereas the genetic component of predisposition to secondary or reactivation infections in adults is more complex. This model is consistent with (i) the high incidence of most infectious diseases in early childhood, followed by a steady decline; (ii) theoretical modeling of the impact of monogenic or polygenic predisposition on the incidence distribution of infectious diseases before reproductive age; (iii) available molecular evidence from both monogenic and complex genetics of infectious diseases in children and adults; (iv) current knowledge of immunity to primary and secondary or latent infections; (v) the state of the art in the clinical genetics of noninfectious pediatric and adult diseases; and (vi) evolutionary data for the genes underlying single-gene and complex disease risk. With the recent advent of new-generation deep resequencing, this model of single-gene variations underlying severe pediatric infectious diseases is experimentally testable. © 2010 New York Academy of Sciences.

  8. The diversity of antimicrobial resistance genes among staphylococci of animal origin.

    Science.gov (United States)

    Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

    2013-08-01

    Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  9. Disease candidate gene identification and prioritization using protein interaction networks

    Directory of Open Access Journals (Sweden)

    Aronow Bruce J

    2009-02-01

    Full Text Available Abstract Background Although most of the current disease candidate gene identification and prioritization methods depend on functional annotations, the coverage of the gene functional annotations is a limiting factor. In the current study, we describe a candidate gene prioritization method that is entirely based on protein-protein interaction network (PPIN analyses. Results For the first time, extended versions of the PageRank and HITS algorithms, and the K-Step Markov method are applied to prioritize disease candidate genes in a training-test schema. Using a list of known disease-related genes from our earlier study as a training set ("seeds", and the rest of the known genes as a test list, we perform large-scale cross validation to rank the candidate genes and also evaluate and compare the performance of our approach. Under appropriate settings – for example, a back probability of 0.3 for PageRank with Priors and HITS with Priors, and step size 6 for K-Step Markov method – the three methods achieved a comparable AUC value, suggesting a similar performance. Conclusion Even though network-based methods are generally not as effective as integrated functional annotation-based methods for disease candidate gene prioritization, in a one-to-one comparison, PPIN-based candidate gene prioritization performs better than all other gene features or annotations. Additionally, we demonstrate that methods used for studying both social and Web networks can be successfully used for disease candidate gene prioritization.

  10. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Directory of Open Access Journals (Sweden)

    Getahun E Agga

    Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  11. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  12. Induced mutations for disease resistance in wheat and barley

    International Nuclear Information System (INIS)

    Hanis, M.; Hanisova, A.; Knytl, V.; Cerny, J.; Benc, S.

    1977-01-01

    The induction of mutations in cultivars of wheat (Triticum aestivum), barley (Hordeum vulgare), and field beans (Phaseolus vulgaris) has been part of the breeding programme at the Plant Breeding Station at Stupice since 1960. A total of 26 cultivars or selections of winter wheat, 4 cultivars or selections of spring wheat, 2 cultivars of field beans, and 43 selections of spring barley have been treated since 1960. A total of 140 mutant lines of wheat and 37 mutant lines of barley with improved disease resistance of a race-specific type have been obtained. Several mutation programme derived cultivars have been registered in Czechoslovakia (''Diamant'', ''Ametyst'', ''Favorit'', ''Hana'', ''Rapid'', and ''Atlas'' in barley, and ''Alfa'' in field beans), but none of them is a mutation for disease resistance. A series of mutants have been used in crossing programmes. Approaches to improve the efficiency of mutation breeding for disease resistance are suggested. (author)

  13. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  14. Molecular Mechanisms of Insulin Resistance in Chronic Kidney Disease

    Science.gov (United States)

    Thomas, Sandhya S.; Zhang, Liping; Mitch, William E.

    2015-01-01

    Insulin resistance refers to reduced sensitivity of organs to insulin-initiated biologic processes that result in metabolic defects. Insulin resistance is common in patients with end-stage renal disease but also occurs in patients with chronic kidney disease (CKD), even when the serum creatinine is minimally increased. Following insulin binding to its receptor, auto-phosphorylation of the insulin receptor is followed by kinase reactions that phosphorylate insulin receptor substrate-1 (IRS-1), phosphatidylinositol 3-kinase (PI3K) and Akt. In fact, low levels of Akt phosphorylation (p-Akt) identifies the presence of the insulin resistance that leads to metabolic defects in insulin-initiated metabolism of glucose, lipids and muscle proteins. Besides CKD, other complex conditions (e.g., inflammation, oxidative stress, metabolic acidosis, aging and excess angiotensin II) reduce p-Akt resulting in insulin resistance. Insulin resistance in each of these conditions is due to activation of different, E3 ubiquitin ligases which specifically conjugate ubiquitin to IRS-1 marking it for degradation in the ubiquitin-proteasome system (UPS). Consequently, IRS-1 degradation suppresses insulin-induced intracellular signaling, causing insulin resistance. Understanding mechanisms of insulin resistance could lead to therapeutic strategies that improve the metabolism of patients with CKD. PMID:26444029

  15. Understanding gene expression in coronary artery disease through ...

    Indian Academy of Sciences (India)

    Understanding gene expression in coronary artery disease through global profiling, network analysis and independent validation of key candidate genes. Prathima ... Table 2. Differentially expressed genes in CAD compared to age and gender matched controls. .... Regulation of nuclear pre-mRNA domain containing 1A.

  16. Inheritance and Gene Mapping of Resistance to Soybean Mosaic Virus Strain SC14 in Soybean

    Institute of Scientific and Technical Information of China (English)

    Hai-Chao Li; Hai-Jian Zhi; Jun-Yi Gai; Dong-Quan Guo; Yan-Wei Wang; Kai Li; Li Bai; Hua Yang

    2006-01-01

    Soybean mosaic virus (SMV) is one of the most broadly distributed diseases worldwide. It causes severe yield loss and seed quality deficiency in soybean (Glycine max (L.) Merr.). SMV Strain SC14 isolated from Shanxi Province, China, was a newly identified virulent strain and can infect Kefeng No. 1, a source with wide spectrum resistance. In the present study, soybean accessions, PI96983, Qihuang No. 1 and Qihuang No. 22 were identified to be resistant (R) and Nannong 1138-2, Pixianchadou susceptible (S) to SC14. Segregation analysis of PI96983 × Nannong 1138-2 indicated that a single dominant gene (designated as Rsc14) controlled the resistance to SC14 at both V2 and R1 developmental stages. The same results were obtained for the crosses of Qihuang No. 1 × Nannong 1138-2 and Qihuang No. 22 × Nannong 1138-2 as in PI96983 × Nannong 1138-2 at V2 stage, but at R1 stage,the F1 performed as necrosis (a susceptible symptom other than mosaic), F2 segregated in a ratio of 1R:2N:1S,and the progenies of necrotic (N) F2 individuals segregated also in R, N and S. It indicated that a single gene (designated as Rsc14o, to be different from that of PI96983) controlled the resistance to SC14, its dominance was the same as in PI96983 × Nannong 1138-2 (without symptoms) at V2 stage and not the same at R1 stage. The tightly linked co-dominant simple sequence repeat (SSR) marker Satt334 indicated that all the heterozygous bands were completely corresponding to the necrotic F2 individuals, or all the necrotic F2 individuals were heterozygotes.It was inferred that necrosis might be due to the interaction among SMV strains, resistance genes, genetic background of the resistance genes, and plant development stage. Furthermore, the bulked segregant analysis (BSA) of SSR markers was conducted to map the resistance genes. In F2 of PI96983 × Nannong 1138-2, five SSR markers, Sat_297, Sat_234, Sat_154, Sct_033 and Sat_120, were found closely linked to Rsc14, with genetic distances of 14

  17. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Presence of superantigen genes and antimicrobial resistance in Staphylococcus isolates obtained from the uteri of dairy cows with clinical endometritis.

    Science.gov (United States)

    Zhao, J-L; Ding, Y-X; Zhao, H-X; He, X-L; Li, P-F; Li, Z-F; Guan, H; Guo, X

    2014-10-11

    Clinical endometritis is an important disease of dairy cattle and results in decreased reproductive performance. This disease is caused by contamination of the uterus with a broad spectrum of microorganisms after calving. In this study, staphylococcal isolates from the uterus of dairy cows with clinical endometritis were tested for their distribution of superantigen (SAg) genes and antimicrobial resistance. Between the 127 staphylococcal isolates collected in this study, 10 species were identified. The predominant strain identified was Staphylococcus aureus (n=53), followed by Staphylococcus saprophyticus (n=38) and Staphylococcus chromogenes (n=22). PCR analysis demonstrated that most isolates (63.0 per cent) harboured at least one SAg gene. The most commonly observed SAg gene and genotype was selj (38.6 per cent) and sec-selj-seln (24.0 per cent), respectively. Most isolates were resistant to penicillin (79.5 per cent), ampicillin (71.7 per cent), erythromycin (56.7 per cent), and tetracycline (52.0 per cent). PCR analysis demonstrated that the antimicrobial resistance determinants ermA, ermB, ermC, tetK, tetM and blaZ were detected in 0 per cent, 44.4 per cent, 51.4 per cent, 68.2 per cent, 13.6 per cent and 86.1 per cent of the erythromycin, tetracycline and β-lactam resistant isolates, respectively. There were 22 (17.3 per cent of all isolates) coagulase-negative staphylococci shown to be methicillin resistant. In the methicillin-resistant isolates, significant resistances to ampicillin, erythromycin and penicillin were observed (P<0.01). The results of this study demonstrate that staphylococci recovered from dairy cows with clinical endometritis contain an extensive and complex prevalence of SAg genes. Significant resistances to antibiotics were also seen, highlighting the need for the rational appliance of antibiotics in veterinary medicine. British Veterinary Association.

  19. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

    Science.gov (United States)

    Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

    2018-03-01

    A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

  20. Constructing an integrated gene similarity network for the identification of disease genes.

    Science.gov (United States)

    Tian, Zhen; Guo, Maozu; Wang, Chunyu; Xing, LinLin; Wang, Lei; Zhang, Yin

    2017-09-20

    Discovering novel genes that are involved human diseases is a challenging task in biomedical research. In recent years, several computational approaches have been proposed to prioritize candidate disease genes. Most of these methods are mainly based on protein-protein interaction (PPI) networks. However, since these PPI networks contain false positives and only cover less half of known human genes, their reliability and coverage are very low. Therefore, it is highly necessary to fuse multiple genomic data to construct a credible gene similarity network and then infer disease genes on the whole genomic scale. We proposed a novel method, named RWRB, to infer causal genes of interested diseases. First, we construct five individual gene (protein) similarity networks based on multiple genomic data of human genes. Then, an integrated gene similarity network (IGSN) is reconstructed based on similarity network fusion (SNF) method. Finally, we employee the random walk with restart algorithm on the phenotype-gene bilayer network, which combines phenotype similarity network, IGSN as well as phenotype-gene association network, to prioritize candidate disease genes. We investigate the effectiveness of RWRB through leave-one-out cross-validation methods in inferring phenotype-gene relationships. Results show that RWRB is more accurate than state-of-the-art methods on most evaluation metrics. Further analysis shows that the success of RWRB is benefited from IGSN which has a wider coverage and higher reliability comparing with current PPI networks. Moreover, we conduct a comprehensive case study for Alzheimer's disease and predict some novel disease genes that supported by literature. RWRB is an effective and reliable algorithm in prioritizing candidate disease genes on the genomic scale. Software and supplementary information are available at http://nclab.hit.edu.cn/~tianzhen/RWRB/ .

  1. Mapping X-Disease Phytoplasma Resistance in Prunus virginiana

    OpenAIRE

    Ryan R. Lenz; Wenhao Dai

    2017-01-01

    Phytoplasmas such as “Candidatus Phytoplasma pruni,” the causal agent of X-disease of stone fruits, lack detailed biological analysis. This has limited the understanding of plant resistance mechanisms. Chokecherry (Prunus virginiana L.) is a promising model to be used for the plant-phytoplasma interaction due to its documented ability to resist X-disease infection. A consensus chokecherry genetic map “Cho” was developed with JoinMap 4.0 by joining two parental maps. The new map contains a com...

  2. Introduction of a rice blight resistance gene, Xa21, into five Chinese rice varieties through an Agrobacterium-mediated system

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A cloned gene, Xa21 was transferred into five widely-used Chinese rice varieties through an Agrobacterium-mediated system, and over 110 independent transgenic lines were obtained. PCR and Southern analysis of transgenic plants revealed the integration of the whole Xa21 gene into the host genomes. The integrated Xa21 gene was stably inherited, and segregated in a 3∶1 ratio in the selfed T1 generation when one copy of the gene was integrated in the transformants. Inoculation tests displayed that transgenic T0 plants and Xa21 PCR-positive T1 plants were highly resistant to bacterial blight disease. The selected Xa21 homozygous resistant transgenic lines with desirable qualities may be propagated as new varieties or utilized in hybrid rice breeding.

  3. Introduction of a rice blight resistance gene, Xa21, into five Chinese rice varieties through an Agrobacterium -mediated system

    Institute of Scientific and Technical Information of China (English)

    翟文学; 李晓兵; 田文忠; 周永力; 潘学彪; 曹守云; 赵显峰; 赵彬; 章琦; 朱立煌

    2000-01-01

    A cloned gene, Xa21 was transferred into five widely-used Chinese rice varieties through an Agrobacterium-mediated system, and over 110 independent transgenic lines were obtained. PCR and Southern analysis of transgenic plants revealed the integration of the whole Xa21 gene into the host genomes. The integrated Xa21 gene was stably inherited, and segregated in a 3 : 1 ratio in the selfed T1 generation when one copy of the gene was integrated in the transfor-mants. Inoculation tests displayed that transgenic T0 plants and Xa21 PCR-positive T1 plants were highly resistant to bacterial blight disease. The selected Xa21 homozygous resistant transgenic lines with desirable qualities may be propagated as new varieties or utilized in hybrid rice breeding.

  4. Ectopic expression of Arabidopsis broad-spectrum resistance gene RPW8.2 improves the resistance to powdery mildew in grapevine (Vitis vinifera).

    Science.gov (United States)

    Hu, Yang; Li, Yajuan; Hou, Fengjuan; Wan, Dongyan; Cheng, Yuan; Han, Yongtao; Gao, Yurong; Liu, Jie; Guo, Ye; Xiao, Shunyuan; Wang, Yuejin; Wen, Ying-Qiang

    2018-02-01

    Powdery mildew is the most economically important disease of cultivated grapevines worldwide. Here, we report that the Arabidopsis broad-spectrum disease resistance gene RPW8.2 could improve resistance to powdery mildew in Vitis vinifera cv. Thompson Seedless. The RPW8.2-YFP fusion gene was stably expressed in grapevines from either the constitutive 35S promoter or the native promoter (NP) of RPW8.2. The grapevine shoots and plantlets transgenic for 35S::RPW8.2-YFP showed reduced rooting and reduced growth at later development stages in the absence of any pathogens. Infection tests with an adapted grapevine powdery mildew isolate En NAFU1 showed that hyphal growth and sporulation were significantly restricted in transgenic grapevines expressing either of the two constructs. The resistance appeared to be attributable to the ectopic expression of RPW8.2, and associated with the enhanced encasement of the haustorial complex (EHC) and onsite accumulation of H 2 O 2 . In addition, the RPW8.2-YFP fusion protein showed focal accumulation around the fungal penetration sites. Transcriptome analysis revealed that ectopic expression of RPW8.2 in grapevines not only significantly enhanced salicylic acid-dependent defense signaling, but also altered expression of other phytohormone-associated genes. Taken together, our results indicate that RPW8.2 could be utilized as a transgene for improving resistance against powdery mildew in grapevines. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  6. Differential gene expression in granulosa cells from polycystic ovary syndrome patients with and without insulin resistance: identification of susceptibility gene sets through network analysis.

    Science.gov (United States)

    Kaur, Surleen; Archer, Kellie J; Devi, M Gouri; Kriplani, Alka; Strauss, Jerome F; Singh, Rita

    2012-10-01

    Polycystic ovary syndrome (PCOS) is a heterogeneous, genetically complex, endocrine disorder of uncertain etiology in women. Our aim was to compare the gene expression profiles in stimulated granulosa cells of PCOS women with and without insulin resistance vs. matched controls. This study included 12 normal ovulatory women (controls), 12 women with PCOS without evidence for insulin resistance (PCOS non-IR), and 16 women with insulin resistance (PCOS-IR) undergoing in vitro fertilization. Granulosa cell gene expression profiling was accomplished using Affymetrix Human Genome-U133 arrays. Differentially expressed genes were classified according to gene ontology using ingenuity pathway analysis tools. Microarray results for selected genes were confirmed by real-time quantitative PCR. A total of 211 genes were differentially expressed in PCOS non-IR and PCOS-IR granulosa cells (fold change≥1.5; P≤0.001) vs. matched controls. Diabetes mellitus and inflammation genes were significantly increased in PCOS-IR patients. Real-time quantitative PCR confirmed higher expression of NCF2 (2.13-fold), TCF7L2 (1.92-fold), and SERPINA1 (5.35-fold). Increased expression of inflammation genes ITGAX (3.68-fold) and TAB2 (1.86-fold) was confirmed in PCOS non-IR. Different cardiometabolic disease genes were differentially expressed in the two groups. Decreased expression of CAV1 (-3.58-fold) in PCOS non-IR and SPARC (-1.88-fold) in PCOS-IR was confirmed. Differential expression of genes involved in TGF-β signaling (IGF2R, increased; and HAS2, decreased), and oxidative stress (TXNIP, increased) was confirmed in both groups. Microarray analysis demonstrated differential expression of genes linked to diabetes mellitus, inflammation, cardiovascular diseases, and infertility in the granulosa cells of PCOS women with and without insulin resistance. Because these dysregulated genes are also involved in oxidative stress, lipid metabolism, and insulin signaling, we hypothesize that these

  7. Induced mutation for disease resistance in legumes

    International Nuclear Information System (INIS)

    Bravo, A.

    1984-01-01

    Mutation breeding has been used for developing genotypes that may contain resistance to: a) A necrotic strain of common mosaic virus, in common bean (Phaseolus vulgaris L.); b) Soil fungi causing root rots in chickpea (Cicer arietinum L.); c) The fungus Uromyces fabae that causes rust in lentil plants (Lens culinaria). Seeds of these three species were treated with gamma rays in doses of 1,000, 3,000, 6,000, and 9,000 rads. Treated materials and controls were grown during 1979. Chickpea M2 plants were grown in a naturally infested soil with soil-borne fungi. Lentil plants were sprayed with a suspension of spores of the rust fungus. Common bean M2 plants were sprayed with a solution containing virus particles. Ninety-three symptomless chickpea plants were identified in the M2 population. For lentil there were 47 symptomless plants and for common bean, 244 M2 plants with minor virus damage. Eight M3 progenies of chickpea, originated from symptomless M2 plants, had a high rate of survival and showed none or very little damage by root rots. In addition, some morphological changes were detected in other M3 chickpea progenies. Two progenies had larger leaflets, as compared to the control plants and those of other progenies. One progeny showed a more erect growth habit. These new traits have been attributed to genetic changes induced by the radiation treatments. By contrast to these promising results with chickpea no progress has been detected in the plant populations of common bean and lentil. (author)

  8. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Science.gov (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

    2018-01-01

    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  9. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed